From 656eda1f73f50890d6b52405cb61563d8a603e85 Mon Sep 17 00:00:00 2001 From: Eric Coissac Date: Mon, 7 Mar 2022 16:37:21 +0100 Subject: [PATCH] A fiirst version of LCS score function --- LICENCE-CECILL-2.1.txt | 1071 ++++++++++++++++++++++++++++++++++++++++ cmd/test/main.go | 49 +- pkg/obialign/lcs.go | 142 ++++++ 3 files changed, 1242 insertions(+), 20 deletions(-) create mode 100644 LICENCE-CECILL-2.1.txt create mode 100644 pkg/obialign/lcs.go diff --git a/LICENCE-CECILL-2.1.txt b/LICENCE-CECILL-2.1.txt new file mode 100644 index 0000000..10640e7 --- /dev/null +++ b/LICENCE-CECILL-2.1.txt @@ -0,0 +1,1071 @@ + + CeCILL FREE SOFTWARE LICENSE AGREEMENT + +Version 2.1 dated 2013-06-21 + + + Notice + +This Agreement is a Free Software license agreement that is the result +of discussions between its authors in order to ensure compliance with +the two main principles guiding its drafting: + + * firstly, compliance with the principles governing the distribution + of Free Software: access to source code, broad rights granted to users, + * secondly, the election of a governing law, French law, with which it + is conformant, both as regards the law of torts and intellectual + property law, and the protection that it offers to both authors and + holders of the economic rights over software. + +The authors of the CeCILL (for Ce[a] C[nrs] I[nria] L[ogiciel] L[ibre]) +license are: + +Commissariat à l'énergie atomique et aux énergies alternatives - CEA, a +public scientific, technical and industrial research establishment, +having its principal place of business at 25 rue Leblanc, immeuble Le +Ponant D, 75015 Paris, France. + +Centre National de la Recherche Scientifique - CNRS, a public scientific +and technological establishment, having its principal place of business +at 3 rue Michel-Ange, 75794 Paris cedex 16, France. + +Institut National de Recherche en Informatique et en Automatique - +Inria, a public scientific and technological establishment, having its +principal place of business at Domaine de Voluceau, Rocquencourt, BP +105, 78153 Le Chesnay cedex, France. + + + Preamble + +The purpose of this Free Software license agreement is to grant users +the right to modify and redistribute the software governed by this +license within the framework of an open source distribution model. + +The exercising of this right is conditional upon certain obligations for +users so as to preserve this status for all subsequent redistributions. + +In consideration of access to the source code and the rights to copy, +modify and redistribute granted by the license, users are provided only +with a limited warranty and the software's author, the holder of the +economic rights, and the successive licensors only have limited liability. + +In this respect, the risks associated with loading, using, modifying +and/or developing or reproducing the software by the user are brought to +the user's attention, given its Free Software status, which may make it +complicated to use, with the result that its use is reserved for +developers and experienced professionals having in-depth computer +knowledge. Users are therefore encouraged to load and test the +suitability of the software as regards their requirements in conditions +enabling the security of their systems and/or data to be ensured and, +more generally, to use and operate it in the same conditions of +security. This Agreement may be freely reproduced and published, +provided it is not altered, and that no provisions are either added or +removed herefrom. + +This Agreement may apply to any or all software for which the holder of +the economic rights decides to submit the use thereof to its provisions. + +Frequently asked questions can be found on the official website of the +CeCILL licenses family (http://www.cecill.info/index.en.html) for any +necessary clarification. + + + Article 1 - DEFINITIONS + +For the purpose of this Agreement, when the following expressions +commence with a capital letter, they shall have the following meaning: + +Agreement: means this license agreement, and its possible subsequent +versions and annexes. + +Software: means the software in its Object Code and/or Source Code form +and, where applicable, its documentation, "as is" when the Licensee +accepts the Agreement. + +Initial Software: means the Software in its Source Code and possibly its +Object Code form and, where applicable, its documentation, "as is" when +it is first distributed under the terms and conditions of the Agreement. + +Modified Software: means the Software modified by at least one +Contribution. + +Source Code: means all the Software's instructions and program lines to +which access is required so as to modify the Software. + +Object Code: means the binary files originating from the compilation of +the Source Code. + +Holder: means the holder(s) of the economic rights over the Initial +Software. + +Licensee: means the Software user(s) having accepted the Agreement. + +Contributor: means a Licensee having made at least one Contribution. + +Licensor: means the Holder, or any other individual or legal entity, who +distributes the Software under the Agreement. + +Contribution: means any or all modifications, corrections, translations, +adaptations and/or new functions integrated into the Software by any or +all Contributors, as well as any or all Internal Modules. + +Module: means a set of sources files including their documentation that +enables supplementary functions or services in addition to those offered +by the Software. + +External Module: means any or all Modules, not derived from the +Software, so that this Module and the Software run in separate address +spaces, with one calling the other when they are run. + +Internal Module: means any or all Module, connected to the Software so +that they both execute in the same address space. + +GNU GPL: means the GNU General Public License version 2 or any +subsequent version, as published by the Free Software Foundation Inc. + +GNU Affero GPL: means the GNU Affero General Public License version 3 or +any subsequent version, as published by the Free Software Foundation Inc. + +EUPL: means the European Union Public License version 1.1 or any +subsequent version, as published by the European Commission. + +Parties: mean both the Licensee and the Licensor. + +These expressions may be used both in singular and plural form. + + + Article 2 - PURPOSE + +The purpose of the Agreement is the grant by the Licensor to the +Licensee of a non-exclusive, transferable and worldwide license for the +Software as set forth in Article 5 <#scope> hereinafter for the whole +term of the protection granted by the rights over said Software. + + + Article 3 - ACCEPTANCE + +3.1 The Licensee shall be deemed as having accepted the terms and +conditions of this Agreement upon the occurrence of the first of the +following events: + + * (i) loading the Software by any or all means, notably, by + downloading from a remote server, or by loading from a physical medium; + * (ii) the first time the Licensee exercises any of the rights granted + hereunder. + +3.2 One copy of the Agreement, containing a notice relating to the +characteristics of the Software, to the limited warranty, and to the +fact that its use is restricted to experienced users has been provided +to the Licensee prior to its acceptance as set forth in Article 3.1 +<#accepting> hereinabove, and the Licensee hereby acknowledges that it +has read and understood it. + + + Article 4 - EFFECTIVE DATE AND TERM + + + 4.1 EFFECTIVE DATE + +The Agreement shall become effective on the date when it is accepted by +the Licensee as set forth in Article 3.1 <#accepting>. + + + 4.2 TERM + +The Agreement shall remain in force for the entire legal term of +protection of the economic rights over the Software. + + + Article 5 - SCOPE OF RIGHTS GRANTED + +The Licensor hereby grants to the Licensee, who accepts, the following +rights over the Software for any or all use, and for the term of the +Agreement, on the basis of the terms and conditions set forth hereinafter. + +Besides, if the Licensor owns or comes to own one or more patents +protecting all or part of the functions of the Software or of its +components, the Licensor undertakes not to enforce the rights granted by +these patents against successive Licensees using, exploiting or +modifying the Software. If these patents are transferred, the Licensor +undertakes to have the transferees subscribe to the obligations set +forth in this paragraph. + + + 5.1 RIGHT OF USE + +The Licensee is authorized to use the Software, without any limitation +as to its fields of application, with it being hereinafter specified +that this comprises: + + 1. permanent or temporary reproduction of all or part of the Software + by any or all means and in any or all form. + + 2. loading, displaying, running, or storing the Software on any or all + medium. + + 3. entitlement to observe, study or test its operation so as to + determine the ideas and principles behind any or all constituent + elements of said Software. This shall apply when the Licensee + carries out any or all loading, displaying, running, transmission or + storage operation as regards the Software, that it is entitled to + carry out hereunder. + + + 5.2 ENTITLEMENT TO MAKE CONTRIBUTIONS + +The right to make Contributions includes the right to translate, adapt, +arrange, or make any or all modifications to the Software, and the right +to reproduce the resulting software. + +The Licensee is authorized to make any or all Contributions to the +Software provided that it includes an explicit notice that it is the +author of said Contribution and indicates the date of the creation thereof. + + + 5.3 RIGHT OF DISTRIBUTION + +In particular, the right of distribution includes the right to publish, +transmit and communicate the Software to the general public on any or +all medium, and by any or all means, and the right to market, either in +consideration of a fee, or free of charge, one or more copies of the +Software by any means. + +The Licensee is further authorized to distribute copies of the modified +or unmodified Software to third parties according to the terms and +conditions set forth hereinafter. + + + 5.3.1 DISTRIBUTION OF SOFTWARE WITHOUT MODIFICATION + +The Licensee is authorized to distribute true copies of the Software in +Source Code or Object Code form, provided that said distribution +complies with all the provisions of the Agreement and is accompanied by: + + 1. a copy of the Agreement, + + 2. a notice relating to the limitation of both the Licensor's warranty + and liability as set forth in Articles 8 and 9, + +and that, in the event that only the Object Code of the Software is +redistributed, the Licensee allows effective access to the full Source +Code of the Software for a period of at least three years from the +distribution of the Software, it being understood that the additional +acquisition cost of the Source Code shall not exceed the cost of the +data transfer. + + + 5.3.2 DISTRIBUTION OF MODIFIED SOFTWARE + +When the Licensee makes a Contribution to the Software, the terms and +conditions for the distribution of the resulting Modified Software +become subject to all the provisions of this Agreement. + +The Licensee is authorized to distribute the Modified Software, in +source code or object code form, provided that said distribution +complies with all the provisions of the Agreement and is accompanied by: + + 1. a copy of the Agreement, + + 2. a notice relating to the limitation of both the Licensor's warranty + and liability as set forth in Articles 8 and 9, + +and, in the event that only the object code of the Modified Software is +redistributed, + + 3. a note stating the conditions of effective access to the full source + code of the Modified Software for a period of at least three years + from the distribution of the Modified Software, it being understood + that the additional acquisition cost of the source code shall not + exceed the cost of the data transfer. + + + 5.3.3 DISTRIBUTION OF EXTERNAL MODULES + +When the Licensee has developed an External Module, the terms and +conditions of this Agreement do not apply to said External Module, that +may be distributed under a separate license agreement. + + + 5.3.4 COMPATIBILITY WITH OTHER LICENSES + +The Licensee can include a code that is subject to the provisions of one +of the versions of the GNU GPL, GNU Affero GPL and/or EUPL in the +Modified or unmodified Software, and distribute that entire code under +the terms of the same version of the GNU GPL, GNU Affero GPL and/or EUPL. + +The Licensee can include the Modified or unmodified Software in a code +that is subject to the provisions of one of the versions of the GNU GPL, +GNU Affero GPL and/or EUPL and distribute that entire code under the +terms of the same version of the GNU GPL, GNU Affero GPL and/or EUPL. + + + Article 6 - INTELLECTUAL PROPERTY + + + 6.1 OVER THE INITIAL SOFTWARE + +The Holder owns the economic rights over the Initial Software. Any or +all use of the Initial Software is subject to compliance with the terms +and conditions under which the Holder has elected to distribute its work +and no one shall be entitled to modify the terms and conditions for the +distribution of said Initial Software. + +The Holder undertakes that the Initial Software will remain ruled at +least by this Agreement, for the duration set forth in Article 4.2 <#term>. + + + 6.2 OVER THE CONTRIBUTIONS + +The Licensee who develops a Contribution is the owner of the +intellectual property rights over this Contribution as defined by +applicable law. + + + 6.3 OVER THE EXTERNAL MODULES + +The Licensee who develops an External Module is the owner of the +intellectual property rights over this External Module as defined by +applicable law and is free to choose the type of agreement that shall +govern its distribution. + + + 6.4 JOINT PROVISIONS + +The Licensee expressly undertakes: + + 1. not to remove, or modify, in any manner, the intellectual property + notices attached to the Software; + + 2. to reproduce said notices, in an identical manner, in the copies of + the Software modified or not. + +The Licensee undertakes not to directly or indirectly infringe the +intellectual property rights on the Software of the Holder and/or +Contributors, and to take, where applicable, vis-à-vis its staff, any +and all measures required to ensure respect of said intellectual +property rights of the Holder and/or Contributors. + + + Article 7 - RELATED SERVICES + +7.1 Under no circumstances shall the Agreement oblige the Licensor to +provide technical assistance or maintenance services for the Software. + +However, the Licensor is entitled to offer this type of services. The +terms and conditions of such technical assistance, and/or such +maintenance, shall be set forth in a separate instrument. Only the +Licensor offering said maintenance and/or technical assistance services +shall incur liability therefor. + +7.2 Similarly, any Licensor is entitled to offer to its licensees, under +its sole responsibility, a warranty, that shall only be binding upon +itself, for the redistribution of the Software and/or the Modified +Software, under terms and conditions that it is free to decide. Said +warranty, and the financial terms and conditions of its application, +shall be subject of a separate instrument executed between the Licensor +and the Licensee. + + + Article 8 - LIABILITY + +8.1 Subject to the provisions of Article 8.2, the Licensee shall be +entitled to claim compensation for any direct loss it may have suffered +from the Software as a result of a fault on the part of the relevant +Licensor, subject to providing evidence thereof. + +8.2 The Licensor's liability is limited to the commitments made under +this Agreement and shall not be incurred as a result of in particular: +(i) loss due the Licensee's total or partial failure to fulfill its +obligations, (ii) direct or consequential loss that is suffered by the +Licensee due to the use or performance of the Software, and (iii) more +generally, any consequential loss. In particular the Parties expressly +agree that any or all pecuniary or business loss (i.e. loss of data, +loss of profits, operating loss, loss of customers or orders, +opportunity cost, any disturbance to business activities) or any or all +legal proceedings instituted against the Licensee by a third party, +shall constitute consequential loss and shall not provide entitlement to +any or all compensation from the Licensor. + + + Article 9 - WARRANTY + +9.1 The Licensee acknowledges that the scientific and technical +state-of-the-art when the Software was distributed did not enable all +possible uses to be tested and verified, nor for the presence of +possible defects to be detected. In this respect, the Licensee's +attention has been drawn to the risks associated with loading, using, +modifying and/or developing and reproducing the Software which are +reserved for experienced users. + +The Licensee shall be responsible for verifying, by any or all means, +the suitability of the product for its requirements, its good working +order, and for ensuring that it shall not cause damage to either persons +or properties. + +9.2 The Licensor hereby represents, in good faith, that it is entitled +to grant all the rights over the Software (including in particular the +rights set forth in Article 5 <#scope>). + +9.3 The Licensee acknowledges that the Software is supplied "as is" by +the Licensor without any other express or tacit warranty, other than +that provided for in Article 9.2 <#good-faith> and, in particular, +without any warranty as to its commercial value, its secured, safe, +innovative or relevant nature. + +Specifically, the Licensor does not warrant that the Software is free +from any error, that it will operate without interruption, that it will +be compatible with the Licensee's own equipment and software +configuration, nor that it will meet the Licensee's requirements. + +9.4 The Licensor does not either expressly or tacitly warrant that the +Software does not infringe any third party intellectual property right +relating to a patent, software or any other property right. Therefore, +the Licensor disclaims any and all liability towards the Licensee +arising out of any or all proceedings for infringement that may be +instituted in respect of the use, modification and redistribution of the +Software. Nevertheless, should such proceedings be instituted against +the Licensee, the Licensor shall provide it with technical and legal +expertise for its defense. Such technical and legal expertise shall be +decided on a case-by-case basis between the relevant Licensor and the +Licensee pursuant to a memorandum of understanding. The Licensor +disclaims any and all liability as regards the Licensee's use of the +name of the Software. No warranty is given as regards the existence of +prior rights over the name of the Software or as regards the existence +of a trademark. + + + Article 10 - TERMINATION + +10.1 In the event of a breach by the Licensee of its obligations +hereunder, the Licensor may automatically terminate this Agreement +thirty (30) days after notice has been sent to the Licensee and has +remained ineffective. + +10.2 A Licensee whose Agreement is terminated shall no longer be +authorized to use, modify or distribute the Software. However, any +licenses that it may have granted prior to termination of the Agreement +shall remain valid subject to their having been granted in compliance +with the terms and conditions hereof. + + + Article 11 - MISCELLANEOUS + + + 11.1 EXCUSABLE EVENTS + +Neither Party shall be liable for any or all delay, or failure to +perform the Agreement, that may be attributable to an event of force +majeure, an act of God or an outside cause, such as defective +functioning or interruptions of the electricity or telecommunications +networks, network paralysis following a virus attack, intervention by +government authorities, natural disasters, water damage, earthquakes, +fire, explosions, strikes and labor unrest, war, etc. + +11.2 Any failure by either Party, on one or more occasions, to invoke +one or more of the provisions hereof, shall under no circumstances be +interpreted as being a waiver by the interested Party of its right to +invoke said provision(s) subsequently. + +11.3 The Agreement cancels and replaces any or all previous agreements, +whether written or oral, between the Parties and having the same +purpose, and constitutes the entirety of the agreement between said +Parties concerning said purpose. No supplement or modification to the +terms and conditions hereof shall be effective as between the Parties +unless it is made in writing and signed by their duly authorized +representatives. + +11.4 In the event that one or more of the provisions hereof were to +conflict with a current or future applicable act or legislative text, +said act or legislative text shall prevail, and the Parties shall make +the necessary amendments so as to comply with said act or legislative +text. All other provisions shall remain effective. Similarly, invalidity +of a provision of the Agreement, for any reason whatsoever, shall not +cause the Agreement as a whole to be invalid. + + + 11.5 LANGUAGE + +The Agreement is drafted in both French and English and both versions +are deemed authentic. + + + Article 12 - NEW VERSIONS OF THE AGREEMENT + +12.1 Any person is authorized to duplicate and distribute copies of this +Agreement. + +12.2 So as to ensure coherence, the wording of this Agreement is +protected and may only be modified by the authors of the License, who +reserve the right to periodically publish updates or new versions of the +Agreement, each with a separate number. These subsequent versions may +address new issues encountered by Free Software. + +12.3 Any Software distributed under a given version of the Agreement may +only be subsequently distributed under the same version of the Agreement +or a subsequent version, subject to the provisions of Article 5.3.4 +<#compatibility>. + + + Article 13 - GOVERNING LAW AND JURISDICTION + +13.1 The Agreement is governed by French law. The Parties agree to +endeavor to seek an amicable solution to any disagreements or disputes +that may arise during the performance of the Agreement. + +13.2 Failing an amicable solution within two (2) months as from their +occurrence, and unless emergency proceedings are necessary, the +disagreements or disputes shall be referred to the Paris Courts having +jurisdiction, by the more diligent Party. + + + +=============================================================================== + + CONTRAT DE LICENCE DE LOGICIEL LIBRE CeCILL + +Version 2.1 du 2013-06-21 + + + Avertissement + +Ce contrat est une licence de logiciel libre issue d'une concertation +entre ses auteurs afin que le respect de deux grands principes préside à +sa rédaction: + + * d'une part, le respect des principes de diffusion des logiciels + libres: accès au code source, droits étendus conférés aux utilisateurs, + * d'autre part, la désignation d'un droit applicable, le droit + français, auquel elle est conforme, tant au regard du droit de la + responsabilité civile que du droit de la propriété intellectuelle et + de la protection qu'il offre aux auteurs et titulaires des droits + patrimoniaux sur un logiciel. + +Les auteurs de la licence CeCILL (Ce[a] C[nrs] I[nria] L[ogiciel] L[ibre]) +sont: + +Commissariat à l'énergie atomique et aux énergies alternatives - CEA, +établissement public de recherche à caractère scientifique, technique et +industriel, dont le siège est situé 25 rue Leblanc, immeuble Le Ponant +D, 75015 Paris. + +Centre National de la Recherche Scientifique - CNRS, établissement +public à caractère scientifique et technologique, dont le siège est +situé 3 rue Michel-Ange, 75794 Paris cedex 16. + +Institut National de Recherche en Informatique et en Automatique - +Inria, établissement public à caractère scientifique et technologique, +dont le siège est situé Domaine de Voluceau, Rocquencourt, BP 105, 78153 +Le Chesnay cedex. + + + Préambule + +Ce contrat est une licence de logiciel libre dont l'objectif est de +conférer aux utilisateurs la liberté de modification et de +redistribution du logiciel régi par cette licence dans le cadre d'un +modèle de diffusion en logiciel libre. + +L'exercice de ces libertés est assorti de certains devoirs à la charge +des utilisateurs afin de préserver ce statut au cours des +redistributions ultérieures. + +L'accessibilité au code source et les droits de copie, de modification +et de redistribution qui en découlent ont pour contrepartie de n'offrir +aux utilisateurs qu'une garantie limitée et de ne faire peser sur +l'auteur du logiciel, le titulaire des droits patrimoniaux et les +concédants successifs qu'une responsabilité restreinte. + +A cet égard l'attention de l'utilisateur est attirée sur les risques +associés au chargement, à l'utilisation, à la modification et/ou au +développement et à la reproduction du logiciel par l'utilisateur étant +donné sa spécificité de logiciel libre, qui peut le rendre complexe à +manipuler et qui le réserve donc à des développeurs ou des +professionnels avertis possédant des connaissances informatiques +approfondies. Les utilisateurs sont donc invités à charger et tester +l'adéquation du logiciel à leurs besoins dans des conditions permettant +d'assurer la sécurité de leurs systèmes et/ou de leurs données et, plus +généralement, à l'utiliser et l'exploiter dans les mêmes conditions de +sécurité. Ce contrat peut être reproduit et diffusé librement, sous +réserve de le conserver en l'état, sans ajout ni suppression de clauses. + +Ce contrat est susceptible de s'appliquer à tout logiciel dont le +titulaire des droits patrimoniaux décide de soumettre l'exploitation aux +dispositions qu'il contient. + +Une liste de questions fréquemment posées se trouve sur le site web +officiel de la famille des licences CeCILL +(http://www.cecill.info/index.fr.html) pour toute clarification qui +serait nécessaire. + + + Article 1 - DEFINITIONS + +Dans ce contrat, les termes suivants, lorsqu'ils seront écrits avec une +lettre capitale, auront la signification suivante: + +Contrat: désigne le présent contrat de licence, ses éventuelles versions +postérieures et annexes. + +Logiciel: désigne le logiciel sous sa forme de Code Objet et/ou de Code +Source et le cas échéant sa documentation, dans leur état au moment de +l'acceptation du Contrat par le Licencié. + +Logiciel Initial: désigne le Logiciel sous sa forme de Code Source et +éventuellement de Code Objet et le cas échéant sa documentation, dans +leur état au moment de leur première diffusion sous les termes du Contrat. + +Logiciel Modifié: désigne le Logiciel modifié par au moins une +Contribution. + +Code Source: désigne l'ensemble des instructions et des lignes de +programme du Logiciel et auquel l'accès est nécessaire en vue de +modifier le Logiciel. + +Code Objet: désigne les fichiers binaires issus de la compilation du +Code Source. + +Titulaire: désigne le ou les détenteurs des droits patrimoniaux d'auteur +sur le Logiciel Initial. + +Licencié: désigne le ou les utilisateurs du Logiciel ayant accepté le +Contrat. + +Contributeur: désigne le Licencié auteur d'au moins une Contribution. + +Concédant: désigne le Titulaire ou toute personne physique ou morale +distribuant le Logiciel sous le Contrat. + +Contribution: désigne l'ensemble des modifications, corrections, +traductions, adaptations et/ou nouvelles fonctionnalités intégrées dans +le Logiciel par tout Contributeur, ainsi que tout Module Interne. + +Module: désigne un ensemble de fichiers sources y compris leur +documentation qui permet de réaliser des fonctionnalités ou services +supplémentaires à ceux fournis par le Logiciel. + +Module Externe: désigne tout Module, non dérivé du Logiciel, tel que ce +Module et le Logiciel s'exécutent dans des espaces d'adressage +différents, l'un appelant l'autre au moment de leur exécution. + +Module Interne: désigne tout Module lié au Logiciel de telle sorte +qu'ils s'exécutent dans le même espace d'adressage. + +GNU GPL: désigne la GNU General Public License dans sa version 2 ou +toute version ultérieure, telle que publiée par Free Software Foundation +Inc. + +GNU Affero GPL: désigne la GNU Affero General Public License dans sa +version 3 ou toute version ultérieure, telle que publiée par Free +Software Foundation Inc. + +EUPL: désigne la Licence Publique de l'Union européenne dans sa version +1.1 ou toute version ultérieure, telle que publiée par la Commission +Européenne. + +Parties: désigne collectivement le Licencié et le Concédant. + +Ces termes s'entendent au singulier comme au pluriel. + + + Article 2 - OBJET + +Le Contrat a pour objet la concession par le Concédant au Licencié d'une +licence non exclusive, cessible et mondiale du Logiciel telle que +définie ci-après à l'article 5 <#etendue> pour toute la durée de +protection des droits portant sur ce Logiciel. + + + Article 3 - ACCEPTATION + +3.1 L'acceptation par le Licencié des termes du Contrat est réputée +acquise du fait du premier des faits suivants: + + * (i) le chargement du Logiciel par tout moyen notamment par + téléchargement à partir d'un serveur distant ou par chargement à + partir d'un support physique; + * (ii) le premier exercice par le Licencié de l'un quelconque des + droits concédés par le Contrat. + +3.2 Un exemplaire du Contrat, contenant notamment un avertissement +relatif aux spécificités du Logiciel, à la restriction de garantie et à +la limitation à un usage par des utilisateurs expérimentés a été mis à +disposition du Licencié préalablement à son acceptation telle que +définie à l'article 3.1 <#acceptation-acquise> ci dessus et le Licencié +reconnaît en avoir pris connaissance. + + + Article 4 - ENTREE EN VIGUEUR ET DUREE + + + 4.1 ENTREE EN VIGUEUR + +Le Contrat entre en vigueur à la date de son acceptation par le Licencié +telle que définie en 3.1 <#acceptation-acquise>. + + + 4.2 DUREE + +Le Contrat produira ses effets pendant toute la durée légale de +protection des droits patrimoniaux portant sur le Logiciel. + + + Article 5 - ETENDUE DES DROITS CONCEDES + +Le Concédant concède au Licencié, qui accepte, les droits suivants sur +le Logiciel pour toutes destinations et pour la durée du Contrat dans +les conditions ci-après détaillées. + +Par ailleurs, si le Concédant détient ou venait à détenir un ou +plusieurs brevets d'invention protégeant tout ou partie des +fonctionnalités du Logiciel ou de ses composants, il s'engage à ne pas +opposer les éventuels droits conférés par ces brevets aux Licenciés +successifs qui utiliseraient, exploiteraient ou modifieraient le +Logiciel. En cas de cession de ces brevets, le Concédant s'engage à +faire reprendre les obligations du présent alinéa aux cessionnaires. + + + 5.1 DROIT D'UTILISATION + +Le Licencié est autorisé à utiliser le Logiciel, sans restriction quant +aux domaines d'application, étant ci-après précisé que cela comporte: + + 1. + + la reproduction permanente ou provisoire du Logiciel en tout ou + partie par tout moyen et sous toute forme. + + 2. + + le chargement, l'affichage, l'exécution, ou le stockage du Logiciel + sur tout support. + + 3. + + la possibilité d'en observer, d'en étudier, ou d'en tester le + fonctionnement afin de déterminer les idées et principes qui sont à + la base de n'importe quel élément de ce Logiciel; et ceci, lorsque + le Licencié effectue toute opération de chargement, d'affichage, + d'exécution, de transmission ou de stockage du Logiciel qu'il est en + droit d'effectuer en vertu du Contrat. + + + 5.2 DROIT D'APPORTER DES CONTRIBUTIONS + +Le droit d'apporter des Contributions comporte le droit de traduire, +d'adapter, d'arranger ou d'apporter toute autre modification au Logiciel +et le droit de reproduire le logiciel en résultant. + +Le Licencié est autorisé à apporter toute Contribution au Logiciel sous +réserve de mentionner, de façon explicite, son nom en tant qu'auteur de +cette Contribution et la date de création de celle-ci. + + + 5.3 DROIT DE DISTRIBUTION + +Le droit de distribution comporte notamment le droit de diffuser, de +transmettre et de communiquer le Logiciel au public sur tout support et +par tout moyen ainsi que le droit de mettre sur le marché à titre +onéreux ou gratuit, un ou des exemplaires du Logiciel par tout procédé. + +Le Licencié est autorisé à distribuer des copies du Logiciel, modifié ou +non, à des tiers dans les conditions ci-après détaillées. + + + 5.3.1 DISTRIBUTION DU LOGICIEL SANS MODIFICATION + +Le Licencié est autorisé à distribuer des copies conformes du Logiciel, +sous forme de Code Source ou de Code Objet, à condition que cette +distribution respecte les dispositions du Contrat dans leur totalité et +soit accompagnée: + + 1. + + d'un exemplaire du Contrat, + + 2. + + d'un avertissement relatif à la restriction de garantie et de + responsabilité du Concédant telle que prévue aux articles 8 + <#responsabilite> et 9 <#garantie>, + +et que, dans le cas où seul le Code Objet du Logiciel est redistribué, +le Licencié permette un accès effectif au Code Source complet du +Logiciel pour une durée d'au moins 3 ans à compter de la distribution du +logiciel, étant entendu que le coût additionnel d'acquisition du Code +Source ne devra pas excéder le simple coût de transfert des données. + + + 5.3.2 DISTRIBUTION DU LOGICIEL MODIFIE + +Lorsque le Licencié apporte une Contribution au Logiciel, les conditions +de distribution du Logiciel Modifié en résultant sont alors soumises à +l'intégralité des dispositions du Contrat. + +Le Licencié est autorisé à distribuer le Logiciel Modifié, sous forme de +code source ou de code objet, à condition que cette distribution +respecte les dispositions du Contrat dans leur totalité et soit +accompagnée: + + 1. + + d'un exemplaire du Contrat, + + 2. + + d'un avertissement relatif à la restriction de garantie et de + responsabilité du Concédant telle que prévue aux articles 8 + <#responsabilite> et 9 <#garantie>, + +et, dans le cas où seul le code objet du Logiciel Modifié est redistribué, + + 3. + + d'une note précisant les conditions d'accès effectif au code source + complet du Logiciel Modifié, pendant une période d'au moins 3 ans à + compter de la distribution du Logiciel Modifié, étant entendu que le + coût additionnel d'acquisition du code source ne devra pas excéder + le simple coût de transfert des données. + + + 5.3.3 DISTRIBUTION DES MODULES EXTERNES + +Lorsque le Licencié a développé un Module Externe les conditions du +Contrat ne s'appliquent pas à ce Module Externe, qui peut être distribué +sous un contrat de licence différent. + + + 5.3.4 COMPATIBILITE AVEC D'AUTRES LICENCES + +Le Licencié peut inclure un code soumis aux dispositions d'une des +versions de la licence GNU GPL, GNU Affero GPL et/ou EUPL dans le +Logiciel modifié ou non et distribuer l'ensemble sous les conditions de +la même version de la licence GNU GPL, GNU Affero GPL et/ou EUPL. + +Le Licencié peut inclure le Logiciel modifié ou non dans un code soumis +aux dispositions d'une des versions de la licence GNU GPL, GNU Affero +GPL et/ou EUPL et distribuer l'ensemble sous les conditions de la même +version de la licence GNU GPL, GNU Affero GPL et/ou EUPL. + + + Article 6 - PROPRIETE INTELLECTUELLE + + + 6.1 SUR LE LOGICIEL INITIAL + +Le Titulaire est détenteur des droits patrimoniaux sur le Logiciel +Initial. Toute utilisation du Logiciel Initial est soumise au respect +des conditions dans lesquelles le Titulaire a choisi de diffuser son +oeuvre et nul autre n'a la faculté de modifier les conditions de +diffusion de ce Logiciel Initial. + +Le Titulaire s'engage à ce que le Logiciel Initial reste au moins régi +par le Contrat et ce, pour la durée visée à l'article 4.2 <#duree>. + + + 6.2 SUR LES CONTRIBUTIONS + +Le Licencié qui a développé une Contribution est titulaire sur celle-ci +des droits de propriété intellectuelle dans les conditions définies par +la législation applicable. + + + 6.3 SUR LES MODULES EXTERNES + +Le Licencié qui a développé un Module Externe est titulaire sur celui-ci +des droits de propriété intellectuelle dans les conditions définies par +la législation applicable et reste libre du choix du contrat régissant +sa diffusion. + + + 6.4 DISPOSITIONS COMMUNES + +Le Licencié s'engage expressément: + + 1. + + à ne pas supprimer ou modifier de quelque manière que ce soit les + mentions de propriété intellectuelle apposées sur le Logiciel; + + 2. + + à reproduire à l'identique lesdites mentions de propriété + intellectuelle sur les copies du Logiciel modifié ou non. + +Le Licencié s'engage à ne pas porter atteinte, directement ou +indirectement, aux droits de propriété intellectuelle du Titulaire et/ou +des Contributeurs sur le Logiciel et à prendre, le cas échéant, à +l'égard de son personnel toutes les mesures nécessaires pour assurer le +respect des dits droits de propriété intellectuelle du Titulaire et/ou +des Contributeurs. + + + Article 7 - SERVICES ASSOCIES + +7.1 Le Contrat n'oblige en aucun cas le Concédant à la réalisation de +prestations d'assistance technique ou de maintenance du Logiciel. + +Cependant le Concédant reste libre de proposer ce type de services. Les +termes et conditions d'une telle assistance technique et/ou d'une telle +maintenance seront alors déterminés dans un acte séparé. Ces actes de +maintenance et/ou assistance technique n'engageront que la seule +responsabilité du Concédant qui les propose. + +7.2 De même, tout Concédant est libre de proposer, sous sa seule +responsabilité, à ses licenciés une garantie, qui n'engagera que lui, +lors de la redistribution du Logiciel et/ou du Logiciel Modifié et ce, +dans les conditions qu'il souhaite. Cette garantie et les modalités +financières de son application feront l'objet d'un acte séparé entre le +Concédant et le Licencié. + + + Article 8 - RESPONSABILITE + +8.1 Sous réserve des dispositions de l'article 8.2 +<#limite-responsabilite>, le Licencié a la faculté, sous réserve de +prouver la faute du Concédant concerné, de solliciter la réparation du +préjudice direct qu'il subirait du fait du Logiciel et dont il apportera +la preuve. + +8.2 La responsabilité du Concédant est limitée aux engagements pris en +application du Contrat et ne saurait être engagée en raison notamment: +(i) des dommages dus à l'inexécution, totale ou partielle, de ses +obligations par le Licencié, (ii) des dommages directs ou indirects +découlant de l'utilisation ou des performances du Logiciel subis par le +Licencié et (iii) plus généralement d'un quelconque dommage indirect. En +particulier, les Parties conviennent expressément que tout préjudice +financier ou commercial (par exemple perte de données, perte de +bénéfices, perte d'exploitation, perte de clientèle ou de commandes, +manque à gagner, trouble commercial quelconque) ou toute action dirigée +contre le Licencié par un tiers, constitue un dommage indirect et +n'ouvre pas droit à réparation par le Concédant. + + + Article 9 - GARANTIE + +9.1 Le Licencié reconnaît que l'état actuel des connaissances +scientifiques et techniques au moment de la mise en circulation du +Logiciel ne permet pas d'en tester et d'en vérifier toutes les +utilisations ni de détecter l'existence d'éventuels défauts. L'attention +du Licencié a été attirée sur ce point sur les risques associés au +chargement, à l'utilisation, la modification et/ou au développement et à +la reproduction du Logiciel qui sont réservés à des utilisateurs avertis. + +Il relève de la responsabilité du Licencié de contrôler, par tous +moyens, l'adéquation du produit à ses besoins, son bon fonctionnement et +de s'assurer qu'il ne causera pas de dommages aux personnes et aux biens. + +9.2 Le Concédant déclare de bonne foi être en droit de concéder +l'ensemble des droits attachés au Logiciel (comprenant notamment les +droits visés à l'article 5 <#etendue>). + +9.3 Le Licencié reconnaît que le Logiciel est fourni "en l'état" par le +Concédant sans autre garantie, expresse ou tacite, que celle prévue à +l'article 9.2 <#bonne-foi> et notamment sans aucune garantie sur sa +valeur commerciale, son caractère sécurisé, innovant ou pertinent. + +En particulier, le Concédant ne garantit pas que le Logiciel est exempt +d'erreur, qu'il fonctionnera sans interruption, qu'il sera compatible +avec l'équipement du Licencié et sa configuration logicielle ni qu'il +remplira les besoins du Licencié. + +9.4 Le Concédant ne garantit pas, de manière expresse ou tacite, que le +Logiciel ne porte pas atteinte à un quelconque droit de propriété +intellectuelle d'un tiers portant sur un brevet, un logiciel ou sur tout +autre droit de propriété. Ainsi, le Concédant exclut toute garantie au +profit du Licencié contre les actions en contrefaçon qui pourraient être +diligentées au titre de l'utilisation, de la modification, et de la +redistribution du Logiciel. Néanmoins, si de telles actions sont +exercées contre le Licencié, le Concédant lui apportera son expertise +technique et juridique pour sa défense. Cette expertise technique et +juridique est déterminée au cas par cas entre le Concédant concerné et +le Licencié dans le cadre d'un protocole d'accord. Le Concédant dégage +toute responsabilité quant à l'utilisation de la dénomination du +Logiciel par le Licencié. Aucune garantie n'est apportée quant à +l'existence de droits antérieurs sur le nom du Logiciel et sur +l'existence d'une marque. + + + Article 10 - RESILIATION + +10.1 En cas de manquement par le Licencié aux obligations mises à sa +charge par le Contrat, le Concédant pourra résilier de plein droit le +Contrat trente (30) jours après notification adressée au Licencié et +restée sans effet. + +10.2 Le Licencié dont le Contrat est résilié n'est plus autorisé à +utiliser, modifier ou distribuer le Logiciel. Cependant, toutes les +licences qu'il aura concédées antérieurement à la résiliation du Contrat +resteront valides sous réserve qu'elles aient été effectuées en +conformité avec le Contrat. + + + Article 11 - DISPOSITIONS DIVERSES + + + 11.1 CAUSE EXTERIEURE + +Aucune des Parties ne sera responsable d'un retard ou d'une défaillance +d'exécution du Contrat qui serait dû à un cas de force majeure, un cas +fortuit ou une cause extérieure, telle que, notamment, le mauvais +fonctionnement ou les interruptions du réseau électrique ou de +télécommunication, la paralysie du réseau liée à une attaque +informatique, l'intervention des autorités gouvernementales, les +catastrophes naturelles, les dégâts des eaux, les tremblements de terre, +le feu, les explosions, les grèves et les conflits sociaux, l'état de +guerre... + +11.2 Le fait, par l'une ou l'autre des Parties, d'omettre en une ou +plusieurs occasions de se prévaloir d'une ou plusieurs dispositions du +Contrat, ne pourra en aucun cas impliquer renonciation par la Partie +intéressée à s'en prévaloir ultérieurement. + +11.3 Le Contrat annule et remplace toute convention antérieure, écrite +ou orale, entre les Parties sur le même objet et constitue l'accord +entier entre les Parties sur cet objet. Aucune addition ou modification +aux termes du Contrat n'aura d'effet à l'égard des Parties à moins +d'être faite par écrit et signée par leurs représentants dûment habilités. + +11.4 Dans l'hypothèse où une ou plusieurs des dispositions du Contrat +s'avèrerait contraire à une loi ou à un texte applicable, existants ou +futurs, cette loi ou ce texte prévaudrait, et les Parties feraient les +amendements nécessaires pour se conformer à cette loi ou à ce texte. +Toutes les autres dispositions resteront en vigueur. De même, la +nullité, pour quelque raison que ce soit, d'une des dispositions du +Contrat ne saurait entraîner la nullité de l'ensemble du Contrat. + + + 11.5 LANGUE + +Le Contrat est rédigé en langue française et en langue anglaise, ces +deux versions faisant également foi. + + + Article 12 - NOUVELLES VERSIONS DU CONTRAT + +12.1 Toute personne est autorisée à copier et distribuer des copies de +ce Contrat. + +12.2 Afin d'en préserver la cohérence, le texte du Contrat est protégé +et ne peut être modifié que par les auteurs de la licence, lesquels se +réservent le droit de publier périodiquement des mises à jour ou de +nouvelles versions du Contrat, qui posséderont chacune un numéro +distinct. Ces versions ultérieures seront susceptibles de prendre en +compte de nouvelles problématiques rencontrées par les logiciels libres. + +12.3 Tout Logiciel diffusé sous une version donnée du Contrat ne pourra +faire l'objet d'une diffusion ultérieure que sous la même version du +Contrat ou une version postérieure, sous réserve des dispositions de +l'article 5.3.4 <#compatibilite>. + + + Article 13 - LOI APPLICABLE ET COMPETENCE TERRITORIALE + +13.1 Le Contrat est régi par la loi française. Les Parties conviennent +de tenter de régler à l'amiable les différends ou litiges qui +viendraient à se produire par suite ou à l'occasion du Contrat. + +13.2 A défaut d'accord amiable dans un délai de deux (2) mois à compter +de leur survenance et sauf situation relevant d'une procédure d'urgence, +les différends ou litiges seront portés par la Partie la plus diligente +devant les Tribunaux compétents de Paris. + diff --git a/cmd/test/main.go b/cmd/test/main.go index f54046c..5e30b1a 100644 --- a/cmd/test/main.go +++ b/cmd/test/main.go @@ -6,9 +6,9 @@ import ( "os" "runtime/trace" - "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiapat" - "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" + + "git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign" ) func main() { @@ -41,29 +41,38 @@ func main() { // fmt.Printf("Shift : %d Score : %d\n", maxshift, maxcount) // } - A := []byte("ccgcctccttagaacaggctcctctagaaaaccatagtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg") + A := []byte("ccgcctccttagaacaggctcctctagaaaaccatgtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg") + B := []byte("ccgcctccttagaacaggctcctctagaaaaaccatgtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg") // B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg") sA := obiseq.NewBioSequence("A", A, "") - // sB := obiseq.MakeBioSequence("B", B, "") + sB := obiseq.MakeBioSequence("B", B, "") - pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3) - as, _ := obiapat.MakeApatSequence(sA, false) - fmt.Println(pat.FindAllIndex(as)) + s, l := obialign.LCSScore(sA, &sB, 2, nil) - file, _ := os.Open("sample/wolf_diet_ngsfilter.txt") - xxx, _ := obiformats.ReadNGSFilter(file) - xxx.Compile(2) - fmt.Printf("%v\n==================\n", xxx) + fmt.Printf("score : %d length : %d error : %d\n", s, l, l-s) - for pp, m := range xxx { - fmt.Printf("%v %v\n", pp, *m) - } + s, l = obialign.LCSScore(&sB, &sB, 2, nil) - seqfile, _ := obiformats.ReadFastSeqFromFile("xxxx.fastq") + fmt.Printf("score : %d length : %d error : %d\n", s, l, l-s) - for seqfile.Next() { - seq := seqfile.Get() - barcode, _ := xxx.ExtractBarcode(seq, true) - fmt.Println(obiformats.FormatFasta(barcode, obiformats.FormatFastSeqOBIHeader)) - } + // pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3) + // as, _ := obiapat.MakeApatSequence(sA, false) + // fmt.Println(pat.FindAllIndex(as)) + + // file, _ := os.Open("sample/wolf_diet_ngsfilter.txt") + // xxx, _ := obiformats.ReadNGSFilter(file) + // xxx.Compile(2) + // fmt.Printf("%v\n==================\n", xxx) + + // for pp, m := range xxx { + // fmt.Printf("%v %v\n", pp, *m) + // } + + // seqfile, _ := obiformats.ReadFastSeqFromFile("xxxx.fastq") + + // for seqfile.Next() { + // seq := seqfile.Get() + // barcode, _ := xxx.ExtractBarcode(seq, true) + // fmt.Println(obiformats.FormatFasta(barcode, obiformats.FormatFastSeqOBIHeader)) + // } } diff --git a/pkg/obialign/lcs.go b/pkg/obialign/lcs.go new file mode 100644 index 0000000..41835b6 --- /dev/null +++ b/pkg/obialign/lcs.go @@ -0,0 +1,142 @@ +package obialign + +import ( + "log" + + "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" +) + +func max(a, b int) int { + if a > b { + return a + } + return b +} + +func min(a, b int) int { + if a < b { + return a + } + return b +} + +type LCSMatrix struct { + matrix []int16 // Score matrix + lenght []int16 // Alignment length matrix + ll int // Length of the longest sequence + l int // Length of the shortest sequence + delta int // ll - l + extra int + w int +} + +func NewLCSMatrix(matrix *LCSMatrix, L, l int, maxError int) *LCSMatrix { + if matrix == nil { + matrix = &LCSMatrix{} + } + + if l > L { + log.Panicf("L (%d) must be greater or equal to l (%d)", L, l) + } + + delta := L - l + extra := ((maxError - delta) / 2) + 1 + + needed := L * (1 + delta + 2*extra) + + if needed > matrix.Cap() { + matrix.matrix = make([]int16, needed) + matrix.lenght = make([]int16, needed) + } + + matrix.matrix = matrix.matrix[:needed] + matrix.lenght = matrix.lenght[:needed] + + matrix.ll = L + matrix.l = l + matrix.delta = delta + matrix.extra = extra + matrix.w = delta + 1 + 2*extra + + return matrix +} + +func (matrix *LCSMatrix) Cap() int { + return cap(matrix.matrix) +} + +func (matrix *LCSMatrix) Length() int { + return len(matrix.matrix) +} + +func (matrix *LCSMatrix) Get(i, j int) (int16, int16) { + ij := max(0, i-matrix.extra) + sj := min(i+matrix.delta+matrix.extra, matrix.ll) + + switch { + case i == 0: + return int16(0), int16(j) + case j == 0: + return int16(0), int16(i) + case j < ij || j > sj: + return -1, 30000 + default: + return matrix.matrix[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)], + matrix.lenght[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)] + } +} + +func (matrix *LCSMatrix) Set(i, j int, score, length int16) { + ij := max(0, i-matrix.extra) + sj := min(i+matrix.delta+matrix.extra, matrix.ll) + + if i > 0 && j > 0 && j >= ij && j <= sj { + matrix.matrix[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)] = score + matrix.lenght[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)] = length + } +} + +func LCSScore(seqA, seqB *obiseq.BioSequence, maxError int, + matrix *LCSMatrix) (int, int) { + // swapped := false + + if seqA.Length() < seqB.Length() { + seqA, seqB = seqB, seqA + // swapped = true + } + + if (seqA.Length() - seqB.Length()) > maxError { + return -1, -1 + } + + matrix = NewLCSMatrix(matrix, seqA.Length(), seqB.Length(), maxError) + + for i := 1; i <= matrix.l; i++ { + ij := max(1, i-matrix.extra) + sj := min(i+matrix.delta+matrix.extra, matrix.ll) + for j := ij; j <= sj; j++ { + sd, ld := matrix.Get(i-1, j-1) + if seqB.Sequence()[i-1] == seqA.Sequence()[j-1] { + sd++ + } + sup, lup := matrix.Get(i-1, j) + sleft, lleft := matrix.Get(i, j-1) + switch { + case sd >= sup && sd >= sleft: + matrix.Set(i, j, sd, ld+1) + case sup >= sleft && sup >= sd: + matrix.Set(i, j, sup, lup+1) + default: + matrix.Set(i, j, sleft, lleft+1) + } + } + } + + s, l := matrix.Get(seqB.Length(), seqA.Length()) + + if (l - s) > int16(maxError) { + return -1, -1 + } + + return int(s), int(l) +}