tar zxvf wolf_diet.tgz
2 OBITools V4 Tutorial
+Here is a short tutorial on how to analyze DNA metabarcoding data produced on Illumina sequencers using:
+-
+
- the OBITools +
- some basic Unix commands +
2.1 Wolves’ diet based on DNA metabarcoding
+The data used in this tutorial correspond to the analysis of four wolf scats, using the protocol published in Shehzad et al. (2012) for assessing carnivore diet. After extracting DNA from the faeces, the DNA amplifications were carried out using the primers TTAGATACCCCACTATGC
and TAGAACAGGCTCCTCTAG
amplifiying the 12S-V5 region (Riaz et al. 2011), together with a wolf blocking oligonucleotide.
The complete data set can be downloaded here: the tutorial dataset
+Once the data file is downloaded, using a UNIX terminal unarchive the data from the tgz
file.
That command create a new directory named wolf_data
containing every required data files:
-
+
+fastq <fastq>
files resulting of aGA IIx (Illumina) paired-end (2 x 108 bp) sequencing assay of DNA extracted and amplified from four wolf faeces:-
+
wolf_F.fastq
+wolf_R.fastq
+
+the file describing the primers and tags used for all samples sequenced:
+-
+
wolf_diet_ngsfilter.txt
The tags correspond to short and specific sequences added on the 5' end of each primer to distinguish the different samples
+
+the file containing the reference database in a fasta format:
+-
+
db_v05_r117.fasta
This reference database has been extracted from the release 117 of EMBL usingobipcr
+
+
To not mix raw data and processed data a new directory called results
is created.
mkdir results
2.2 Step by step analysis
+2.2.1 Recover full sequence reads from forward and reverse partial reads
+When using the result of a paired-end sequencing assay with supposedly overlapping forward and reverse reads, the first step is to recover the assembled sequence.
+The forward and reverse reads of the same fragment are at the same line position in the two fastq files obtained after sequencing. Based on these two files, the assembly of the forward and reverse reads is done with the obipairing
utility that aligns the two reads and returns the reconstructed sequence.
In our case, the command is:
+obipairing --min-identity=0.8 \
+--min-overlap=10 \
+ -F wolf_data/wolf_F.fastq \
+ -R wolf_data/wolf_R.fastq \
+ > results/wolf.fastq
The --min-identity
and --min-overlap
options allow discarding sequences with low alignment quality. If after the aligment, the overlaping parts of the reads is shorter than 10 base pairs or the similarity over this aligned region is below 80% of identity, in the output file, the forward and reverse reads are not aligned but concatenated, and the value of the mode
attribute in the sequence header is set to joined
instead of alignment
.
2.2.2 Remove unaligned sequence records
+Unaligned sequences (:pymode=joined
) cannot be used. The following command allows removing them from the dataset:
obigrep -p 'annotations.mode != "join"' \
+> results/wolf.ali.fastq results/wolf.fastq
The -p
requires a go like expression. annotations.mode != "join"
means that if the value of the mode
annotation of a sequence is different from join
, the corresponding sequence record will be kept.
The first sequence record of wolf.ali.fastq
can be obtained using the following command line:
head -n 4 results/wolf.ali.fastq
The folling piece of code appears on thew window of tour terminal.
+@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1 {"ali_dir":"left","ali_length":62,"mode":"alignment","pairing_mismatches":{"(T:26)->(G:13)":62,"(T:34)->(G:18)":48},"score":484,"score_norm":0.968,"seq_a_single":46,"seq_ab_match":60,"seq_b_single":46}
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+CCCCCCCBCCCCCCCCCCCCCCCCCCCCCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCCCCCCCCCCCC
+2.2.3 Assign each sequence record to the corresponding sample/marker combination
+Each sequence record is assigned to its corresponding sample and marker using the data provided in a text file (here wolf_diet_ngsfilter.txt
). This text file contains one line per sample, with the name of the experiment (several experiments can be included in the same file), the name of the tags (for example: aattaac
if the same tag has been used on each extremity of the PCR products, or aattaac:gaagtag
if the tags were different), the sequence of the forward primer, the sequence of the reverse primer, the letter T
or F
for sample identification using the forward primer and tag only or using both primers and both tags, respectively (see obimultiplex
for details).
obimultiplex -t wolf_data/wolf_diet_ngsfilter.txt \
+-u results/unidentified.fastq \
+ \
+ results/wolf.ali.fastq > results/wolf.ali.assigned.fastq
This command creates two files:
+-
+
unidentified.fastq
containing all the sequence records that were not assigned to a sample/marker combination
+wolf.ali.assigned.fastq
containing all the sequence records that were properly assigned to a sample/marker combination
+
Note that each sequence record of the wolf.ali.assigned.fastq
file contains only the barcode sequence as the sequences of primers and tags are removed by the obimultiplex
program. Information concerning the experiment, sample, primers and tags is added as attributes in the sequence header.
For instance, the first sequence record of wolf.ali.assigned.fastq
is:
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_sub[28..127] {"ali_dir":"left","ali_length":62,"direction":"direct","experiment":"wolf_diet","forward_match":"ttagataccccactatgc","forward_mismatches":0,"forward_primer":"ttagataccccactatgc","forward_tag":"gcctcct","mode":"alignment","pairing_mismatches":{"(T:26)->(G:13)":35,"(T:34)->(G:18)":21},"reverse_match":"tagaacaggctcctctag","reverse_mismatches":0,"reverse_primer":"tagaacaggctcctctag","reverse_tag":"gcctcct","sample":"29a_F260619","score":484,"score_norm":0.968,"seq_a_single":46,"seq_ab_match":60,"seq_b_single":46}
+ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+CCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC
+2.2.4 Dereplicate reads into uniq sequences
+The same DNA molecule can be sequenced several times. In order to reduce both file size and computations time, and to get easier interpretable results, it is convenient to work with unique sequences instead of reads. To dereplicate such reads into unique sequences, we use the obiuniq
command.
Definition: Dereplicate reads into unique sequences | +
Definition adapted from Seguritan and Rohwer (2001) |
+
For dereplication, we use the obiuniq
command with the -m sample
. The -m sample
option is used to keep the information of the samples of origin for each uniquesequence.
obiuniq -m sample \
+\
+ results/wolf.ali.assigned.fastq > results/wolf.ali.assigned.uniq.fasta
Note that obiuniq
returns a fasta file.
The first sequence record of wolf.ali.assigned.uniq.fasta
is:
>HELIUM_000100422_612GNAAXX:7:93:6991:1942#0/1_sub[28..126] {"ali_dir":"left","ali_length":63,"count":1,"direction":"reverse","experiment":"wolf_diet","forward_match":"ttagataccccactatgc","forward_mismatches":0,"forward_primer":"ttagataccccactatgc","forward_tag":"gaatatc","merged_sample":{"26a_F040644":1},"mode":"alignment","pairing_mismatches":{"(A:10)->(G:34)":76,"(C:06)->(A:34)":58},"reverse_match":"tagaacaggctcctctag","reverse_mismatches":0,"reverse_primer":"tagaacaggctcctctag","reverse_tag":"gaatatc","score":730,"score_norm":0.968,"seq_a_single":45,"seq_ab_match":61,"seq_b_single":45}
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagaactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttatatccct
+The run of obiuniq
has added two key=values entries in the header of the fasta sequence:
-
+
"merged_sample":{"29a_F260619":1}
: this sequence have been found once in a single sample called 29a_F260619
+"count":1
: the total count for this sequence is \(1\)
+
To keep only these two attributes, we can use the obiannotate
command:
obiannotate -k count -k merged_sample \
+\
+ results/wolf.ali.assigned.uniq.fasta > results/wolf.ali.assigned.simple.fasta
The first five sequence records of wolf.ali.assigned.simple.fasta
become:
>HELIUM_000100422_612GNAAXX:7:26:18930:11105#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
+ttagccctaaacacaagtaattaatataacaaaatwattcgcyagagtactacmggcaat
+agctyaaarctcamagrwcttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:58:5711:11399#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtwctaccgssaat
+agcttaaaactcaaaggactgggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:100:15836:9304#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
+ttagccctaaacatagataattacacaaacaaaattgttcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:55:13242:9085#0/1_sub[28..126] {"count":4,"merged_sample":{"26a_F040644":4}}
+ttagccctaaacataaacattcaataaacaagagtgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:86:8429:13723#0/1_sub[28..127] {"count":7,"merged_sample":{"15a_F730814":5,"29a_F260619":2}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggactcggcggtgctttataccctt
+2.2.5 Denoise the sequence dataset
+To have a set of sequences assigned to their corresponding samples does not mean that all sequences are biologically meaningful i.e. some of these sequences can contains PCR and/or sequencing errors, or chimeras.
+Tag the sequences for PCR errors (sequence variants)
+The obiclean
program tags sequence variants as potential error generated during PCR amplification. We ask it to keep the head sequences (-H
option) that are sequences which are not variants of another sequence with a count greater than 5% of their own count (-r 0.05
option).
obiclean -s sample -r 0.05 -H \
+\
+ results/wolf.ali.assigned.simple.fasta > results/wolf.ali.assigned.simple.clean.fasta
One of the sequence records of wolf.ali.assigned.simple.clean.fasta
is:
>HELIUM_000100422_612GNAAXX:7:66:4039:8016#0/1_sub[28..127] {"count":17,"merged_sample":{"13a_F730603":17},"obiclean_head":true,"obiclean_headcount":1,"obiclean_internalcount":0,"obi
+clean_samplecount":1,"obiclean_singletoncount":0,"obiclean_status":{"13a_F730603":"h"},"obiclean_weight":{"13a_F730603":25}}
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaac
+agcccaaaactcaaaggacttggcggtgcttcacaccctt
+To remove such sequences as much as possible, we first discard rare sequences and then rsequence variants that likely correspond to artifacts.
+Get some statistics about sequence counts
+obicount results/wolf.ali.assigned.simple.clean.fasta
time="2023-01-31T22:44:30+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
+ 2749 36409 273387
+The dataset contains \(4313\) sequences variant corresponding to 42452 sequence reads. Most of the variants occur only a single time in the complete dataset and are usualy named singletons
+obigrep -p 'sequence.Count() == 1' results/wolf.ali.assigned.simple.clean.fasta \
+| obicount
time="2023-01-31T22:44:30+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
+time="2023-01-31T22:44:30+01:00" level=info msg="Reading sequences from stdin in guessed\n"
+time="2023-01-31T22:44:30+01:00" level=info msg="On output use JSON headers"
+ 2309 2309 229920
+In that dataset sigletons corresponds to \(3511\) variants.
+Using R and the ROBIFastread
package able to read headers of the fasta files produced by OBITools, we can get more complete statistics on the distribution of occurrencies.
library(ROBIFastread)
+library(ggplot2)
+
+<- read_obifasta("results/wolf.ali.assigned.simple.clean.fasta",keys="count")
+ seqs
+ggplot(data = seqs, mapping=aes(x = count)) +
+geom_histogram(bins=100) +
+ scale_y_sqrt() +
+ scale_x_sqrt() +
+ geom_vline(xintercept = 10, col="red", lty=2) +
+ xlab("number of occurrencies of a variant")
In a similar way it is also possible to plot the distribution of the sequence length.
+ggplot(data = seqs, mapping=aes(x = nchar(sequence))) +
+geom_histogram() +
+ scale_y_log10() +
+ geom_vline(xintercept = 80, col="red", lty=2) +
+ xlab("sequence lengths in base pair")
Keep only the sequences having a count greater or equal to 10 and a length shorter than 80 bp
+Based on the previous observation, we set the cut-off for keeping sequences for further analysis to a count of 10. To do this, we use the obigrep <scripts/obigrep>
command. The -p 'count>=10'
option means that the python
expression :pycount>=10
must be evaluated to :pyTrue
for each sequence to be kept. Based on previous knowledge we also remove sequences with a length shorter than 80 bp (option -l) as we know that the amplified 12S-V5 barcode for vertebrates must have a length around 100bp.
obigrep -l 80 -p 'sequence.Count() >= 10' results/wolf.ali.assigned.simple.clean.fasta \
+> results/wolf.ali.assigned.simple.clean.c10.l80.fasta
The first sequence record of results/wolf.ali.assigned.simple.clean.c10.l80.fasta
is:
>HELIUM_000100422_612GNAAXX:7:22:2603:18023#0/1_sub[28..127] {"count":12182,"merged_sample":{"15a_F730814":7559,"29a_F260619":4623},"obiclean_head":true,"obiclean_headcount":2,"obiclean_internalcount":0,"obiclean_samplecount":2,"obiclean_singletoncount":0,"obiclean_status":{"15a_F730814":"h","29a_F260619":"h"},"obiclean_weight":{"15a_F730814":9165,"29a_F260619":6275}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+At that time in the data cleanning we have conserved :
+obicount results/wolf.ali.assigned.simple.clean.c10.l80.fasta
time="2023-01-31T22:44:32+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.c10.l80.fasta file\n"
+ 26 31337 2585
+2.2.6 Taxonomic assignment of sequences
+Once denoising has been done, the next step in diet analysis is to assign the barcodes to the corresponding species in order to get the complete list of species associated to each sample.
+Taxonomic assignment of sequences requires a reference database compiling all possible species to be identified in the sample. Assignment is then done based on sequence comparison between sample sequences and reference sequences.
+Download the taxonomy
+mkdir TAXO
+cd TAXO
+curl http://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz \
+| tar -zxvf -
+ cd ..
Build a reference database
+One way to build the reference database is to use the ecoPCR <scripts/ecoPCR>
program to simulate a PCR and to extract all sequences from the EMBL that may be amplified in silico by the two primers (TTAGATACCCCACTATGC and TAGAACAGGCTCCTCTAG) used for PCR amplification.
The full list of steps for building this reference database would then be:
+-
+
- Download the whole set of EMBL sequences (available from: ftp://ftp.ebi.ac.uk/pub/databases/embl/release/) +
- Download the NCBI taxonomy (available from: ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz) +
- Format them into the ecoPCR format (see
obiconvert <scripts/obiconvert>
for how you can produce ecoPCR compatible files)
+ - Use ecoPCR to simulate amplification and build a reference database based on putatively amplified barcodes together with their recorded taxonomic information +
As step 1 and step 3 can be really time-consuming (about one day), we alredy provide the reference database produced by the following commands so that you can skip its construction. Note that as the EMBL database and taxonomic data can evolve daily, if you run the following commands you may end up with quite different results.
+Any utility allowing file downloading from a ftp site can be used. In the following commands, we use the commonly used wget
Unix command.
Download the sequences
+> mkdir EMBL
+> cd EMBL
+> wget -nH --cut-dirs=4 -Arel_std_\*.dat.gz -m ftp://ftp.ebi.ac.uk/pub/databases/embl/release/
+> cd ..
Download the taxonomy
+> mkdir TAXO
+> cd TAXO
+> wget ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz
+> tar -zxvf taxdump.tar.gz
+> cd ..
Use obipcr to simulate an in silico` PCR
+> obipcr -d ./ECODB/embl_last -e 3 -l 50 -L 150 \
+TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG > v05.ecopcr
Note that the primers must be in the same order both in wolf_diet_ngsfilter.txt
and in the obipcr
command.
Clean the database
+-
+
- filter sequences so that they have a good taxonomic description at the species, genus, and family levels (
obigrep
command command below).
+ - remove redundant sequences (
obiuniq
command below).
+ - ensure that the dereplicated sequences have a taxid at the family level (
obigrep
command below).
+ - ensure that sequences each have a unique identification (
obiannotate
command below)
+
> obigrep -d embl_last --require-rank=species \
+--require-rank=genus --require-rank=family v05.ecopcr > v05_clean.fasta
+
+> obiuniq -d embl_last \
+v05_clean.fasta > v05_clean_uniq.fasta
+
+> obigrep -d embl_last --require-rank=family \
+v05_clean_uniq.fasta > v05_clean_uniq_clean.fasta
+
+> obiannotate --uniq-id v05_clean_uniq_clean.fasta > db_v05.fasta
obirefidx -t TAXO wolf_data/db_v05_r117.fasta > results/db_v05_r117.indexed.fasta
+Warning
+From now on, for the sake of clarity, the following commands will use the filenames of the files provided with the tutorial. If you decided to run the last steps and use the files you have produced, you'll have to use db_v05.fasta
instead of db_v05_r117.fasta
and embl_last
instead of embl_r117
2.2.7 Assign each sequence to a taxon
+Once the reference database is built, taxonomic assignment can be carried out using the obitag
command.
obitag -t TAXO -R wolf_data/db_v05_r117.indexed.fasta \
+\
+ results/wolf.ali.assigned.simple.clean.c10.l80.fasta > results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta
The obitag
adds several attributes in the sequence record header, among them:
-
+
- obitag_bestmatch=ACCESSION where ACCESSION is the id of hte sequence in the reference database that best aligns to the query sequence; +
- obitag_bestid=FLOAT where FLOAT*100 is the percentage of identity between the best match sequence and the query sequence; +
- taxid=TAXID where TAXID is the final assignation of the sequence by
obitag
+ - scientific_name=NAME where NAME is the scientific name of the assigned taxid. +
The first sequence record of wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta
is:
>HELIUM_000100422_612GNAAXX:7:81:18704:12346#0/1_sub[28..126] {"count":88,"merged_sample":{"26a_F040644":88},"obiclean_head":true,"obiclean_headcount":1,"obiclean_internalcount":0,"obiclean_samplecount":1,"obiclean_singletoncount":0,"obiclean_status":{"26a_F040644":"h"},"obiclean_weight":{"26a_F040644":208},"obitag_bestid":0.9207920792079208,"obitag_bestmatch":"AY769263","obitag_difference":8,"obitag_match_count":1,"obitag_rank":"clade","scientific_name":"Boreoeutheria","taxid":1437010}
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
+gcttaaaactcaaaggacttggcggtgctttatatccct
2.2.8 Generate the final result table
+Some unuseful attributes can be removed at this stage.
+-
+
- obiclean_head +
- obiclean_headcount +
- obiclean_internalcount +
- obiclean_samplecount +
- obiclean_singletoncount +
obiannotate --delete-tag=obiclean_head \
+--delete-tag=obiclean_headcount \
+ --delete-tag=obiclean_internalcount \
+ --delete-tag=obiclean_samplecount \
+ --delete-tag=obiclean_singletoncount \
+ \
+ results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta > results/wolf.ali.assigned.simple.clean.c10.l80.taxo.ann.fasta
The first sequence record of wolf.ali.assigned.simple.c10.l80.clean.taxo.ann.fasta
is then:
>HELIUM_000100422_612GNAAXX:7:84:16335:5083#0/1_sub[28..126] {"count":96,"merged_sample":{"26a_F040644":11,"29a_F260619":85},"obiclean_status":{"26a_F040644":"s","29a_F260619":"h"},"obiclean_weight":{"26a_F040644":14,"29a_F260619":110},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_difference":4,"obitag_match_count":1,"obitag_rank":"subspecies","scientific_name":"Canis lupus familiaris","taxid":9615}
+ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
+gattaaacctcaaaggacttggcagtgctttatacccct
+-
+
- This file contains 26 sequences. You can deduce the diet of each sample: +
-
+
-
+
- 13a_F730603: Cervus elaphus +
- 15a_F730814: Capreolus capreolus +
- 26a_F040644: Marmota sp. (according to the location, it is Marmota marmota) +
- 29a_F260619: Capreolus capreolus +
+
Note that we also obtained a few wolf sequences although a wolf-blocking oligonucleotide was used.
+ + + +