diff --git a/pkg/obioptions/version.go b/pkg/obioptions/version.go
index 0917d0f..0323984 100644
--- a/pkg/obioptions/version.go
+++ b/pkg/obioptions/version.go
@@ -7,7 +7,7 @@ import (
 // TODO: The version number is extracted from git. This induces that the version
 // corresponds to the last commit, and not the one when the file will be
 // commited
-var _Commit = "5affee2"
+var _Commit = "0e9a136"
 var _Version = "Release 4.2.0"
 
 // Version returns the version of the obitools package.
diff --git a/pkg/obitools/obisplit/obisplit.go b/pkg/obitools/obisplit/obisplit.go
index 3713847..e9397ec 100644
--- a/pkg/obitools/obisplit/obisplit.go
+++ b/pkg/obitools/obisplit/obisplit.go
@@ -168,6 +168,11 @@ func SplitPattern(sequence *obiseq.BioSequence,
 
 			if from.name == to.name {
 				sub.SetAttribute("obisplit_group", from.name)
+				if from.name == "extremity" {
+					sub.SetAttribute("obisplit_set", "NA")
+				} else {
+					sub.SetAttribute("obisplit_set", from.name)
+				}
 			} else {
 				fname := from.name
 				tname := to.name
@@ -179,6 +184,11 @@ func SplitPattern(sequence *obiseq.BioSequence,
 					}
 				}
 				sub.SetAttribute("obisplit_group", fmt.Sprintf("%s-%s", fname, tname))
+				if fname == "extremity" {
+					sub.SetAttribute("obisplit_set", tname)
+				} else {
+					sub.SetAttribute("obisplit_set", "NA")
+				}
 			}
 
 			sub.SetAttribute("obisplit_location", fmt.Sprintf("%d..%d", start+1, end))
@@ -226,6 +236,12 @@ func SplitPattern(sequence *obiseq.BioSequence,
 		sub.SetAttribute("obisplit_frg", nfrag)
 		if from.name == to.name {
 			sub.SetAttribute("obisplit_group", from.name)
+			if from.name == "extremity" {
+				sub.SetAttribute("obisplit_set", "NA")
+			} else {
+				sub.SetAttribute("obisplit_set", from.name)
+			}
+
 		} else {
 			fname := from.name
 			tname := to.name
@@ -236,7 +252,13 @@ func SplitPattern(sequence *obiseq.BioSequence,
 					fname, tname = tname, fname
 				}
 			}
+
 			sub.SetAttribute("obisplit_group", fmt.Sprintf("%s-%s", fname, tname))
+			if fname == "extremity" {
+				sub.SetAttribute("obisplit_set", tname)
+			} else {
+				sub.SetAttribute("obisplit_set", "NA")
+			}
 		}
 		sub.SetAttribute("obisplit_location", fmt.Sprintf("%d..%d", start+1, end))
 
diff --git a/pkg/obitools/obisplit/options.go b/pkg/obitools/obisplit/options.go
index 5b56774..778cb23 100644
--- a/pkg/obitools/obisplit/options.go
+++ b/pkg/obitools/obisplit/options.go
@@ -76,11 +76,11 @@ func CLIConfig() []SplitSequence {
 
 	header := records[0]
 
-	pattern_idx := slices.Index(header, "T-tag")
+	pattern_idx := slices.Index(header, "tag")
 	pool_idx := slices.Index(header, "pcr_pool")
 
 	if pattern_idx == -1 {
-		log.Fatalf("Config file %s doesn't contain `T-tag`column", CLIConfigFile())
+		log.Fatalf("Config file %s doesn't contain `tag`column", CLIConfigFile())
 	}
 
 	if pool_idx == -1 {
@@ -128,7 +128,7 @@ func CLIAskConfigTemplate() bool {
 }
 
 func CLIConfigTemplate() string {
-	return `T-tag,pcr_pool
+	return `tag,pcr_pool
 CGGCACCTGTTACGCAGCCACTATCGGCT,pool_1
 CGGCAAGACCCTATTGCATTGGCGCGGCT,pool_2
 `