From a6af0abdd8162497615a53a8d5917ee561827005 Mon Sep 17 00:00:00 2001 From: Eric Coissac Date: Fri, 3 Feb 2023 23:00:23 +0100 Subject: [PATCH] Documentation writting --- doc/Probabilitymetrics.png | Bin 0 -> 7795 bytes doc/_book/Probabilitymetrics.png | Bin 0 -> 7795 bytes doc/_book/annexes.html | 115 +++---- doc/_book/commands.html | 211 ++++++------ doc/_book/formats.html | 533 +++++++++++++++++++++++++++++++ doc/_book/index.html | 13 +- doc/_book/intro.html | 272 +++++----------- doc/_book/library.html | 85 ++--- doc/_book/references.html | 106 +++++- doc/_book/search.json | 112 +++---- doc/_book/tutorial.html | 127 ++++---- doc/_quarto.yml | 3 + doc/book.bib | 529 ++++++++++++++++++++++++++++++ doc/commands.qmd | 11 +- doc/formats.qmd | 145 +++++++++ doc/intro.qmd | 175 +++------- 16 files changed, 1771 insertions(+), 666 deletions(-) create mode 100644 doc/Probabilitymetrics.png create mode 100644 doc/_book/Probabilitymetrics.png create mode 100644 doc/_book/formats.html create mode 100644 doc/formats.qmd diff --git a/doc/Probabilitymetrics.png b/doc/Probabilitymetrics.png new file mode 100644 index 0000000000000000000000000000000000000000..2a8897bf90d506020ba07e9e2a9d69323350350f GIT binary patch literal 7795 zcmd6MXH-*Lw{}8+NRg6A6Oa}_>7YocQF^F~C`cDXln&BsA}yha25BlFMG#Sn^d2?J zi}a4tB8UW$CP?V{HhSLk>yGi=pLZk~8GFyU)_P`HbI<)O{3SDk zi|Arm>pp?OgN-m@5zb?DV0>2WMSWgxI?*Lpx3xN4rBY#8?@L@^AM=|Z zF>1S*`wG=RdKC%_dlj1f4Fu8!KibpXyEl1nQiOV;0fC71?W}F?J6u;!Pc(IuvJdPn zeYtUnMJp( z^-7QIkzk=qJwFdDz#t=Hvy=+n7@W)b5v~UnM*oP=R2{275z@yyts=C&$&-Y6Sh|*fuD0ap_m+ zZXq2{|6OYD)NTSkbfE*r)bg05uAB`C;1R?iN;l?n`sE>7j89qjk0Fr@yGg!&17Jgf zn&Y(n3g`)z1$$jLI3OCV_-(PE0P+A4*w$i8QMZLeWH`%7{o1tqtNW0tRYuD;07NM2 zb<^&f7W`|(b2G}Ev*6CFscaoVLJ>haPDc#rF->VG*=cqlM&VZp4<<%+vounPHp&q|*ONqsDV}l&$^+ zbNAQnzosq1cdc$je7w4U=i|IF;imQ~_Bx-{dc@I%yUZ2g1%D<5Je(}vm*|7y0 z5{$}+nKUI0PW*9kx>kN_OzYY5+2~t#Z3y(d86~n3{}UAxsU+t}DDs!we9E1%^Y1Xh zXLRAW>^_9@Wy+&18sT9m&mW)MI+W1_rSxF!Jcu3i6=WAvOPnXRsdj+Boo7F&`0LP6 z$;~pX9x?xdd?m=5*)IF8fchqJGr4R#=m@N?dGGH7u&+!lgZ(Iohi+j(01BG8p{XD@ z=brniAp%YC_sO4Oe`;Kl*o@&L^5Cw8i!{BNc{+dP4~!M216J~BCniPLpNdWnVH&}a zYuYM5bN!UrZys6H7~Ck&FnuH0HsutX(i$T8$8YqR8# z=o#KF+W|v`nYi|CgY60ZPcPo9p9S17yerq!bPq_b8IYNIJ5AO1q~e!@W}>&B^Fhkt-XqR0|X7>bc748(>A`nx~3MZ^Ps0&OeI@ov7zVW*Jhrguz?T+#Xdn z&@MTBT|s%y{rey9H%e}HVe8q|f?&R0y?&re*c8=(#=LC59Rgy0dR}X|*9FzB8ZUVM zef8X%RezfM-$?gd#{{-2h|j4>{5OP-ahc84j=Lj0*AeJ!Al=Nx`7&wGle;nzow2zw znTc!{2*W!jl+Sz4|K_I3zv;k!)A7T>XDc8xn+GK~1+*~Qb@AzlbYmdf&W{Huc6V1M zzUIr2MZ=u5-OhTxATFJKHM`5&m4RSV$lqYrm`Ypr_Azj^u0xhGoG{&S?E_Ac?( z34bw->16--ht%8+Lec2mJEL5W+Tz%jO_vM(6o#i-}jXx4&26aT~1nq*V<+m{^o^Zl9LE520vkZ49dnnH|{ zIC@u8OnlRv&Wcky$DSpkh3R(>xEwMHjwITU{hekc9!)){^*zX4t7A><_4l}jCNTT4 zuZcU!KjY70h&bNhl{~NPbxENA_iAMWe*UU`*2Qc>(H3FnS;Ipa(WWm?RINSL6{7m9 z9GsSTyF6}bFX&rGR6i*-Bs{L@zq|s4p(8QYOD%j$IY(RTC+9RnH>mBw=#_?%wKXMV zYv+gi{0HI$gz~MTSO?Rl^qf;EY7iu|wRX*@5aj#w4i+kM-&bw_dRkIzL+3o2uqk!D zr*-;jHFiWyBbs-uROEgh+s^?KQi|m(KJ7-kL`EaDG9M2pe(8Ho{H%BN@S+o!;>kz` zUmN%*4VLj^lRc|_JEuH?qpqyxL+l_)axprO?aL9R!_0yws2aYkiYE`~$&C_^c5d2y zA0TSGQ!{NP@*P2Wt&E3_c)i>S(i;SNxwJpF?G!S@M%!^LR%x$vsy^DlMy}?Pb{=%j zCw|^k=9j6dj4@$2m)VpeB)s)&#k~Ez%O=%`d|dq?LaR#6whIw}ktUaWd`*3G+LmBx z6eqDM^R#a@_@WiY7?%`Z^&doj-tm%Yj(YmXUs1}X0%(i99}Th7p4q^-=$Lf#_eByX zMt+7a197-Qd8ZVOqAW!JN9n<}4UdK&ZQr{^+MAeM4GHIN*)krqG(I@3pK+ZMX2<=t$^!<=~@>*|BT)IvMFAlP^1{fQ<=S|9;w!k?0#Pscef#-Kq?%#|F|@mt#OCFjx&7Gk zytnYAulM0auhA{dC3X+BdV zf0g8}g_A_p)Sa?U@qEZr_Vxy7Teejsq3FKFZEYHhvnDmQ80C1?N#=d0Y(6Bd0`t7g z#UQ&JtBaF6aRsaNJv24Cd5%ZTDB(dwE zW3p&>TLA30+U}w zqYmJW1^^P}IM&4QhgOoCniwlw+$|flG!XsI33?Xo(%8r(Ho&p|%!~f*Y)JNTAqwMn z5D&;|NR6px~WL1XiBjg59i*jU2X;vV0*^T-y86VPRy%}*`33RfdytG_O! zzAK>bHFg5p9$>)SJ0&mA5AGqW`3k=01!kb_hU6YSs5sg}+I^loY($2PEA>6dS(9gq zKw)E&*o+8|q-`mJPRA=L;>d$k^4p!t3C8USdO5UH*uYz$3daELOCGx28!8vY+g2lq zSdGt(+HMXww@(hG0RD|}Tm_FXzDl`h=kyvYoSwC=zAQZ7Z2-a>tX-zL+^mDrI zpLQWsEiiV05f{C;S01O#l@%(r&$zuoAN82{8Q*%EP{ds$$cv&_%U1>_&)2>`O=Vws z=Mj!!hm8GX5SpT2K=^vmMK7LQCk&6OdEdwm$H>D9o11arA01t{y%z^+bhL$%4x5;|yh|SRBZM55D10t&X zULhQ*i9hZnXHGWPA5X9+467-bQ$i(Uo)g34k-4CB&VM@PU?2TUeBttIzK~U#*Y3E- z@rYtN13IgH_~iDDZI=S$DD^cRanqezA@$f^@~f(1G%-{WG`YiQG(pT zq(Q&Ww02E2pQgT6#;jpw{fJPMW6%85K7ga=QSusZQV_+z?^hHxz`0`A7Q=##fn^bh z9fONLR^n?P5VyDt35i2~)P8xWg9>Tg%#1SAQ<}R&tjC8Q=0Vs@o)L(OOc7#ONAaqR z{Y9pq53iUIiu(PS4ur{)Is&WTVztgJ>`LiU_hukta2NJ1Mnk7CIyZ#x^)F$xi*z)_ zPLw`c>Pa^|tZY(8s7z^EXNHT5Y)uXzb2x{Q(}~WQ8tFqMncf-m&4}zx&g2StjtLPj zy#l-yOvUE5%0nEb)o{aKiBMeMPd>6EUi|hR7?x$qTBrUX>*AV#;=4l?u8;y8M!Zxf ztKVRNjVba}im7eaCl72Yoe!vv6SCwD$}Mjbo?=)*I{%pRUR*jQ#@*65ajgY0(i5wd z7-UFUc7pjbD^?r?5(`Om7wX>(y=hr&`n7>a(70!5=0a6kG(lo3*Z5P9Z-n7fCX~Y4 z39(V!YwbyF&OCw_5Y#ygo}@|jz=ZRi!zkiww`mWo*S?1o?6uKp7*3|Pm%!9J(H7a+ zf507Bk{9%#0~lt-+bg%prX=U{Ntig@!Kie^d9o@iQZ&-XXLp#H97X0NV~xUA9SBCm zzZi3hpBVmhgFRVd<&dS?;%{myO!B8S_@IQ4d|BBUwJFxH5al%wCq36#B}A#|Ka25x zYoL}2^N#FsfUPlKA}&4kp8AZu*Ety0pPx-^U* zDWItX&ytXUmGl}hmQuH+e0rZt!ZfXuUUGktdcP^t*A&T8>y^7<73K`0=VMbGUFyFlT3!$=Nd}x^^Yxte zJMH3((_S7$_YgsC>akfFR?EG4W?nT1Hlm+>gc-MAzap}v44*-t`8z@I+~%vQ$0o@a zkp#nET(b^475I#;1Cnq{v0;H8EzCKveF|R%x-t|d31f<8sA647BmHMzJZRDQWen3F z3#5}HRa9HQ=oWBA(13KC)1(1nJmF4dSKBFca`rg;c;0rq zYNp|??O^66Cq9}_k#@*8OZTnRXcJ`k!vuI@0u?OJG@wT+`Yirpun$82gSm)JzcF5J z4~i?wE30|l&b}V);zL%}RiWv+8!uc756UQ3EYHu_9-9}eE{gw~L-wzqKjGyFw%*M$ z_B>skVz`#dF}2ml&E<3zR!DP$zdnq_lW2_2AQ4@UcI{35SE8ody1yJD8up(*oWT;5 zT(pIb3S%`MUOIXnYq++7O~cKkL=}|nbGjQ3)!EgDGzA^X6pXa9SMn&zauldIVYaCz z5{#VXlH3c|4G{a{BQEIz-o}RFu778O;{tm}awRzNho@(!w^^OF_9P0pBBZMfA|@uU zp`Bk&cW?TgUSG{d+a25F;8A(vA-|yNY>yFNq$ZP47_nP<2Sc88T*ol-UOLQ5)P9$m)aJ)Ubga0k=!cd4Y&JXt)L0qov1$W z(xj`o_`J=EAX$)@q6f_{o-lgl9z6DJZi;kI*#~4M*|gRHx1Z?aC|tJUcs-Tjcu~Q$ zt*s1CGqd2#P6<@Yy8d`c_XEmIR@!m}wkFN|S% zA5M{)XhVamR7ttykKijqRdkx9F|FC^6-lkK*Cf5c>fs;J+}4hG7W&e;&+~Fz6-n0l z-rl?8skeK!U}9rs&7U;QYMktgZb_nF{ix@uodCn}NhLA(r00CPvqI*Z$1LFyDvA_8 zK}B^kL&2Dn;K12REQQZ^!a+I49&iZy2k;n2Ru0Lu&F`WFgK1N2-T>4h4Cq&?WSm@4~z#A4nw!8T?6uAuQ8(m zG_LzJ;WbJ2UJ5DsUTyjpkj|MafNOFXA{r^e!*vd#L3zz?xP@CB_`@DumBRqh&znW7 z&1tu%P#@(cA@WH9s?)WLE{o-DDEz5MQ~0FvJEX_pvqKe{B)xa95VwpxMSD$atpcPT zZZ-pH@|*NJPI72Y9>xRZAM7wrM@k&;k_#?9yR5VC-7Oi0-$F1Jc!>}?Vu*#q+(mxv zSh}J)x|j8=#U%+PaGqmBxNQ14oHBioWbe!g=VT(tuj-P$**3$hvy-5oV!y$rji-p* z>Cuu^+l6@TxXP|ph{?0M`}L19ONKgp;zPWJL_6g{TG|MlwlT<3q78)$M9$c!{P`Mj;clQ8Mph7+~t4(Hb=ixBF z+?-RHO;PndGs}I01)!V2T2}%%EOKsfY%IBP4)uKJpgs=AfnAJowey*mCe$4SB}%9C zUua3dtJ&%}&vFDw%E7jZgQWBG8h8x{SNGgMC}JCODs#VBblKuqVl(kcA9)5B99|JO zuG9Eg$nTVno{m~64F&06rs$o&ZQISJ?(ySw^Ejf1tzgkOA4!|7Y)_Z6t+e4VreZh` zbO`4VyFM((QCytbIebfkwaBrI*7tJ83dho&IatB89_=IMYbDMd?5-Tt7z|2lRQtf~ z%+Qh$A5yN3*xAvwIt<6Zy2We&y5R>$k+;jT&HRf8A9 zA0u%4@Ld72vvXq4iY`wl4bm&N@;pE^GcsND;><%WMt<{vd3oXUXLpY&N})t-?4|L0 zzsqoELZtnwcowhzGNV|*yKY3?GyHxQV-B{0-MyneunO=j?tT-zQ8xr}SgVoI14WX5 zl{b`E0Qpt*%9soCFf_;N_LmcWo1@l z+fIa-_Xct=o3ggD)fYK?fmck0bUvq2dh>LWyJupupi_F2T6V_CpB%MWN5jSELY{M~ zddY@M-q6ncGLW|DBC-~9vCkCoaZBLXKGfOQr#6rVt989w_ImH?PV6fsfIwX(0Oam) zz!PlqV26`ENmP9#oa)BOl4pqnhw|f8sZ^Nk-aK+t-_!}9cXI>2H<1YO=P%UsTY*%- zG$dtb3L^&eAbAAuEbW>V6`0rt&lTINeO$jSd4QLeHr9wbiZG%!nFnhNOrM5-xD5rb ziZU(-UT#LUKe|0dyFY$7db0xHhd!%U06cnaiWP6vGY9!9$TZz-+kqsm{VRNEL8u^T z=1|0B>$!_|U#_vGk$e1W-L8liBa-1jsC6*)99;`$g+V@tezQ>raNW$PJ1Po`H-VyN zPajbQEFV~-67A`v@4qHi-2(E6R`$lzKYbx5>Q1T7l<@Mx#_|qJ5zVl^o z^^A6RwWHx=wPTKP5uFJo)Y<`{(uZ$)40g!I+&7od|0-m{+8ZwGmlwrcTN*SHx+PaU zbY$6-C7|~x%?dM9oSGBJS-7?UE`hz?J3~@x?7K9v+^f9Ke-y7yU1}O4eFRji`YQ(d zy@&BTWL0={nOB(cm!?5?Np$S(DW5Ls@gP?~^=($a_#NbkthbLqz`in(iD--O@d?AN z>;)1dNoK)GcoxtN?Y{TaB*5w~{nf+~9f3RpPml1E3YlNrL#Y=0q#Gf~!Z~giz(MB(TgjY~+Hburn{+Z{ z72Lz@j9kv`ZwII`;$9!Uw~vL)`^C4)NlRZ7!(P9?JD{e)^Lmc{u%!7YY@d{?cM z3xOMUHEex)OKWyD_cKsD(>j@mQV8G*^be3k0Ptph;WNBxV!ihMvL5uAAh3|&p+gN@ zw7kvab^)ZHZ4Sr*_3iKhwZ9U>|KXr(IP^Oxn3DxE`JsPed}QOKa(Qmwj)s$JmGP7m z`Blq3>1_KQ6ir09Q>6IK%LTiijCRJJB~ACYH7{?B+?AU?u3;v#U(FlhRm!pPS%&@Z43}Kv-K?gvu9{LlmoC_Cg7YLYgb$9b-PX!aHv>Q*XWvPI9YhID{%_c_9!8TqIR>eO32rC_i+M7>=$dLE}*koavtuc>T8n=Hu@g||NlMqED9QB@B|-1E5XRNabE;_ z&{|wq6m>G>CD|Id;1$21GGMbRkK{%-KPx#ZjZX_PV9$JjV6B6ZeJ~4H7v}qV1VqYZ p3!oHyEG|1bh5X;axMN5Yx;7YocQF^F~C`cDXln&BsA}yha25BlFMG#Sn^d2?J zi}a4tB8UW$CP?V{HhSLk>yGi=pLZk~8GFyU)_P`HbI<)O{3SDk zi|Arm>pp?OgN-m@5zb?DV0>2WMSWgxI?*Lpx3xN4rBY#8?@L@^AM=|Z zF>1S*`wG=RdKC%_dlj1f4Fu8!KibpXyEl1nQiOV;0fC71?W}F?J6u;!Pc(IuvJdPn zeYtUnMJp( z^-7QIkzk=qJwFdDz#t=Hvy=+n7@W)b5v~UnM*oP=R2{275z@yyts=C&$&-Y6Sh|*fuD0ap_m+ zZXq2{|6OYD)NTSkbfE*r)bg05uAB`C;1R?iN;l?n`sE>7j89qjk0Fr@yGg!&17Jgf zn&Y(n3g`)z1$$jLI3OCV_-(PE0P+A4*w$i8QMZLeWH`%7{o1tqtNW0tRYuD;07NM2 zb<^&f7W`|(b2G}Ev*6CFscaoVLJ>haPDc#rF->VG*=cqlM&VZp4<<%+vounPHp&q|*ONqsDV}l&$^+ zbNAQnzosq1cdc$je7w4U=i|IF;imQ~_Bx-{dc@I%yUZ2g1%D<5Je(}vm*|7y0 z5{$}+nKUI0PW*9kx>kN_OzYY5+2~t#Z3y(d86~n3{}UAxsU+t}DDs!we9E1%^Y1Xh zXLRAW>^_9@Wy+&18sT9m&mW)MI+W1_rSxF!Jcu3i6=WAvOPnXRsdj+Boo7F&`0LP6 z$;~pX9x?xdd?m=5*)IF8fchqJGr4R#=m@N?dGGH7u&+!lgZ(Iohi+j(01BG8p{XD@ z=brniAp%YC_sO4Oe`;Kl*o@&L^5Cw8i!{BNc{+dP4~!M216J~BCniPLpNdWnVH&}a zYuYM5bN!UrZys6H7~Ck&FnuH0HsutX(i$T8$8YqR8# z=o#KF+W|v`nYi|CgY60ZPcPo9p9S17yerq!bPq_b8IYNIJ5AO1q~e!@W}>&B^Fhkt-XqR0|X7>bc748(>A`nx~3MZ^Ps0&OeI@ov7zVW*Jhrguz?T+#Xdn z&@MTBT|s%y{rey9H%e}HVe8q|f?&R0y?&re*c8=(#=LC59Rgy0dR}X|*9FzB8ZUVM zef8X%RezfM-$?gd#{{-2h|j4>{5OP-ahc84j=Lj0*AeJ!Al=Nx`7&wGle;nzow2zw znTc!{2*W!jl+Sz4|K_I3zv;k!)A7T>XDc8xn+GK~1+*~Qb@AzlbYmdf&W{Huc6V1M zzUIr2MZ=u5-OhTxATFJKHM`5&m4RSV$lqYrm`Ypr_Azj^u0xhGoG{&S?E_Ac?( z34bw->16--ht%8+Lec2mJEL5W+Tz%jO_vM(6o#i-}jXx4&26aT~1nq*V<+m{^o^Zl9LE520vkZ49dnnH|{ zIC@u8OnlRv&Wcky$DSpkh3R(>xEwMHjwITU{hekc9!)){^*zX4t7A><_4l}jCNTT4 zuZcU!KjY70h&bNhl{~NPbxENA_iAMWe*UU`*2Qc>(H3FnS;Ipa(WWm?RINSL6{7m9 z9GsSTyF6}bFX&rGR6i*-Bs{L@zq|s4p(8QYOD%j$IY(RTC+9RnH>mBw=#_?%wKXMV zYv+gi{0HI$gz~MTSO?Rl^qf;EY7iu|wRX*@5aj#w4i+kM-&bw_dRkIzL+3o2uqk!D zr*-;jHFiWyBbs-uROEgh+s^?KQi|m(KJ7-kL`EaDG9M2pe(8Ho{H%BN@S+o!;>kz` zUmN%*4VLj^lRc|_JEuH?qpqyxL+l_)axprO?aL9R!_0yws2aYkiYE`~$&C_^c5d2y zA0TSGQ!{NP@*P2Wt&E3_c)i>S(i;SNxwJpF?G!S@M%!^LR%x$vsy^DlMy}?Pb{=%j zCw|^k=9j6dj4@$2m)VpeB)s)&#k~Ez%O=%`d|dq?LaR#6whIw}ktUaWd`*3G+LmBx z6eqDM^R#a@_@WiY7?%`Z^&doj-tm%Yj(YmXUs1}X0%(i99}Th7p4q^-=$Lf#_eByX zMt+7a197-Qd8ZVOqAW!JN9n<}4UdK&ZQr{^+MAeM4GHIN*)krqG(I@3pK+ZMX2<=t$^!<=~@>*|BT)IvMFAlP^1{fQ<=S|9;w!k?0#Pscef#-Kq?%#|F|@mt#OCFjx&7Gk zytnYAulM0auhA{dC3X+BdV zf0g8}g_A_p)Sa?U@qEZr_Vxy7Teejsq3FKFZEYHhvnDmQ80C1?N#=d0Y(6Bd0`t7g z#UQ&JtBaF6aRsaNJv24Cd5%ZTDB(dwE zW3p&>TLA30+U}w zqYmJW1^^P}IM&4QhgOoCniwlw+$|flG!XsI33?Xo(%8r(Ho&p|%!~f*Y)JNTAqwMn z5D&;|NR6px~WL1XiBjg59i*jU2X;vV0*^T-y86VPRy%}*`33RfdytG_O! zzAK>bHFg5p9$>)SJ0&mA5AGqW`3k=01!kb_hU6YSs5sg}+I^loY($2PEA>6dS(9gq zKw)E&*o+8|q-`mJPRA=L;>d$k^4p!t3C8USdO5UH*uYz$3daELOCGx28!8vY+g2lq zSdGt(+HMXww@(hG0RD|}Tm_FXzDl`h=kyvYoSwC=zAQZ7Z2-a>tX-zL+^mDrI zpLQWsEiiV05f{C;S01O#l@%(r&$zuoAN82{8Q*%EP{ds$$cv&_%U1>_&)2>`O=Vws z=Mj!!hm8GX5SpT2K=^vmMK7LQCk&6OdEdwm$H>D9o11arA01t{y%z^+bhL$%4x5;|yh|SRBZM55D10t&X zULhQ*i9hZnXHGWPA5X9+467-bQ$i(Uo)g34k-4CB&VM@PU?2TUeBttIzK~U#*Y3E- z@rYtN13IgH_~iDDZI=S$DD^cRanqezA@$f^@~f(1G%-{WG`YiQG(pT zq(Q&Ww02E2pQgT6#;jpw{fJPMW6%85K7ga=QSusZQV_+z?^hHxz`0`A7Q=##fn^bh z9fONLR^n?P5VyDt35i2~)P8xWg9>Tg%#1SAQ<}R&tjC8Q=0Vs@o)L(OOc7#ONAaqR z{Y9pq53iUIiu(PS4ur{)Is&WTVztgJ>`LiU_hukta2NJ1Mnk7CIyZ#x^)F$xi*z)_ zPLw`c>Pa^|tZY(8s7z^EXNHT5Y)uXzb2x{Q(}~WQ8tFqMncf-m&4}zx&g2StjtLPj zy#l-yOvUE5%0nEb)o{aKiBMeMPd>6EUi|hR7?x$qTBrUX>*AV#;=4l?u8;y8M!Zxf ztKVRNjVba}im7eaCl72Yoe!vv6SCwD$}Mjbo?=)*I{%pRUR*jQ#@*65ajgY0(i5wd z7-UFUc7pjbD^?r?5(`Om7wX>(y=hr&`n7>a(70!5=0a6kG(lo3*Z5P9Z-n7fCX~Y4 z39(V!YwbyF&OCw_5Y#ygo}@|jz=ZRi!zkiww`mWo*S?1o?6uKp7*3|Pm%!9J(H7a+ zf507Bk{9%#0~lt-+bg%prX=U{Ntig@!Kie^d9o@iQZ&-XXLp#H97X0NV~xUA9SBCm zzZi3hpBVmhgFRVd<&dS?;%{myO!B8S_@IQ4d|BBUwJFxH5al%wCq36#B}A#|Ka25x zYoL}2^N#FsfUPlKA}&4kp8AZu*Ety0pPx-^U* zDWItX&ytXUmGl}hmQuH+e0rZt!ZfXuUUGktdcP^t*A&T8>y^7<73K`0=VMbGUFyFlT3!$=Nd}x^^Yxte zJMH3((_S7$_YgsC>akfFR?EG4W?nT1Hlm+>gc-MAzap}v44*-t`8z@I+~%vQ$0o@a zkp#nET(b^475I#;1Cnq{v0;H8EzCKveF|R%x-t|d31f<8sA647BmHMzJZRDQWen3F z3#5}HRa9HQ=oWBA(13KC)1(1nJmF4dSKBFca`rg;c;0rq zYNp|??O^66Cq9}_k#@*8OZTnRXcJ`k!vuI@0u?OJG@wT+`Yirpun$82gSm)JzcF5J z4~i?wE30|l&b}V);zL%}RiWv+8!uc756UQ3EYHu_9-9}eE{gw~L-wzqKjGyFw%*M$ z_B>skVz`#dF}2ml&E<3zR!DP$zdnq_lW2_2AQ4@UcI{35SE8ody1yJD8up(*oWT;5 zT(pIb3S%`MUOIXnYq++7O~cKkL=}|nbGjQ3)!EgDGzA^X6pXa9SMn&zauldIVYaCz z5{#VXlH3c|4G{a{BQEIz-o}RFu778O;{tm}awRzNho@(!w^^OF_9P0pBBZMfA|@uU zp`Bk&cW?TgUSG{d+a25F;8A(vA-|yNY>yFNq$ZP47_nP<2Sc88T*ol-UOLQ5)P9$m)aJ)Ubga0k=!cd4Y&JXt)L0qov1$W z(xj`o_`J=EAX$)@q6f_{o-lgl9z6DJZi;kI*#~4M*|gRHx1Z?aC|tJUcs-Tjcu~Q$ zt*s1CGqd2#P6<@Yy8d`c_XEmIR@!m}wkFN|S% zA5M{)XhVamR7ttykKijqRdkx9F|FC^6-lkK*Cf5c>fs;J+}4hG7W&e;&+~Fz6-n0l z-rl?8skeK!U}9rs&7U;QYMktgZb_nF{ix@uodCn}NhLA(r00CPvqI*Z$1LFyDvA_8 zK}B^kL&2Dn;K12REQQZ^!a+I49&iZy2k;n2Ru0Lu&F`WFgK1N2-T>4h4Cq&?WSm@4~z#A4nw!8T?6uAuQ8(m zG_LzJ;WbJ2UJ5DsUTyjpkj|MafNOFXA{r^e!*vd#L3zz?xP@CB_`@DumBRqh&znW7 z&1tu%P#@(cA@WH9s?)WLE{o-DDEz5MQ~0FvJEX_pvqKe{B)xa95VwpxMSD$atpcPT zZZ-pH@|*NJPI72Y9>xRZAM7wrM@k&;k_#?9yR5VC-7Oi0-$F1Jc!>}?Vu*#q+(mxv zSh}J)x|j8=#U%+PaGqmBxNQ14oHBioWbe!g=VT(tuj-P$**3$hvy-5oV!y$rji-p* z>Cuu^+l6@TxXP|ph{?0M`}L19ONKgp;zPWJL_6g{TG|MlwlT<3q78)$M9$c!{P`Mj;clQ8Mph7+~t4(Hb=ixBF z+?-RHO;PndGs}I01)!V2T2}%%EOKsfY%IBP4)uKJpgs=AfnAJowey*mCe$4SB}%9C zUua3dtJ&%}&vFDw%E7jZgQWBG8h8x{SNGgMC}JCODs#VBblKuqVl(kcA9)5B99|JO zuG9Eg$nTVno{m~64F&06rs$o&ZQISJ?(ySw^Ejf1tzgkOA4!|7Y)_Z6t+e4VreZh` zbO`4VyFM((QCytbIebfkwaBrI*7tJ83dho&IatB89_=IMYbDMd?5-Tt7z|2lRQtf~ z%+Qh$A5yN3*xAvwIt<6Zy2We&y5R>$k+;jT&HRf8A9 zA0u%4@Ld72vvXq4iY`wl4bm&N@;pE^GcsND;><%WMt<{vd3oXUXLpY&N})t-?4|L0 zzsqoELZtnwcowhzGNV|*yKY3?GyHxQV-B{0-MyneunO=j?tT-zQ8xr}SgVoI14WX5 zl{b`E0Qpt*%9soCFf_;N_LmcWo1@l z+fIa-_Xct=o3ggD)fYK?fmck0bUvq2dh>LWyJupupi_F2T6V_CpB%MWN5jSELY{M~ zddY@M-q6ncGLW|DBC-~9vCkCoaZBLXKGfOQr#6rVt989w_ImH?PV6fsfIwX(0Oam) zz!PlqV26`ENmP9#oa)BOl4pqnhw|f8sZ^Nk-aK+t-_!}9cXI>2H<1YO=P%UsTY*%- zG$dtb3L^&eAbAAuEbW>V6`0rt&lTINeO$jSd4QLeHr9wbiZG%!nFnhNOrM5-xD5rb ziZU(-UT#LUKe|0dyFY$7db0xHhd!%U06cnaiWP6vGY9!9$TZz-+kqsm{VRNEL8u^T z=1|0B>$!_|U#_vGk$e1W-L8liBa-1jsC6*)99;`$g+V@tezQ>raNW$PJ1Po`H-VyN zPajbQEFV~-67A`v@4qHi-2(E6R`$lzKYbx5>Q1T7l<@Mx#_|qJ5zVl^o z^^A6RwWHx=wPTKP5uFJo)Y<`{(uZ$)40g!I+&7od|0-m{+8ZwGmlwrcTN*SHx+PaU zbY$6-C7|~x%?dM9oSGBJS-7?UE`hz?J3~@x?7K9v+^f9Ke-y7yU1}O4eFRji`YQ(d zy@&BTWL0={nOB(cm!?5?Np$S(DW5Ls@gP?~^=($a_#NbkthbLqz`in(iD--O@d?AN z>;)1dNoK)GcoxtN?Y{TaB*5w~{nf+~9f3RpPml1E3YlNrL#Y=0q#Gf~!Z~giz(MB(TgjY~+Hburn{+Z{ z72Lz@j9kv`ZwII`;$9!Uw~vL)`^C4)NlRZ7!(P9?JD{e)^Lmc{u%!7YY@d{?cM z3xOMUHEex)OKWyD_cKsD(>j@mQV8G*^be3k0Ptph;WNBxV!ihMvL5uAAh3|&p+gN@ zw7kvab^)ZHZ4Sr*_3iKhwZ9U>|KXr(IP^Oxn3DxE`JsPed}QOKa(Qmwj)s$JmGP7m z`Blq3>1_KQ6ir09Q>6IK%LTiijCRJJB~ACYH7{?B+?AU?u3;v#U(FlhRm!pPS%&@Z43}Kv-K?gvu9{LlmoC_Cg7YLYgb$9b-PX!aHv>Q*XWvPI9YhID{%_c_9!8TqIR>eO32rC_i+M7>=$dLE}*koavtuc>T8n=Hu@g||NlMqED9QB@B|-1E5XRNabE;_ z&{|wq6m>G>CD|Id;1$21GGMbRkK{%-KPx#ZjZX_PV9$JjV6B6ZeJ~4H7v}qV1VqYZ p3!oHyEG|1bh5X;axMN5Yx; -OBITools V4 - 5  Annexes +OBITools V4 - 6  Annexes + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+
+ +
+ +
+ + + + + +
+ +
+
+

2  File formats usable with OBITools

+
+ + + +
+ + + + +
+ + +
+ +

OBITools manipulate have to manipulate DNA sequence data and taxonomical data. They can use some supplentary metadata describing the experiment and produce some stats about the processed DNA data. All the manipulated data are stored in text files, following standard data format.

+
+

2.1 The DNA sequence data

+

Sequences can be stored following various format. OBITools knows some of them. The central formats for sequence files manipulated by OBITools scripts are the fasta and fastq format. OBITools extends the both these formats by specifying a syntax to include in the definition line data qualifying the sequence. All file formats use the IUPAC code for encoding nucleotides.

+

Moreover these two formats that can be used as input and output formats, OBITools4 can read the following format :

+ +
+

2.1.1 The IUPAC Code

+

The International Union of Pure and Applied Chemistry (IUPAC_) defined the standard code for representing protein or DNA sequences.

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
CodeNucleotide
AAdenine
CCytosine
GGuanine
TThymine
UUracil
RPurine (A or G)
YPyrimidine (C, T, or U)
MC or A
KT, U, or G
WT, U, or A
SC or G
BC, T, U, or G (not A)
DA, T, U, or G (not C)
HA, T, U, or C (not G)
VA, C, or G (not T, not U)
NAny base (A, C, G, T, or U)
+
+
+

2.1.2 The fasta sequence format

+

The fasta format is certainly the most widely used sequence file format. This is certainly due to its great simplicity. It was originally created for the Lipman and Pearson FASTA program. OBITools use in more of the classical fasta format an extended version of this format where structured data are included in the title line.

+

In fasta format a sequence is represented by a title line beginning with a > character and the sequences by itself following the :doc:iupac code. The sequence is usually split other severals lines of the same length (expect for the last one)

+
>my_sequence this is my pretty sequence
+ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
+GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
+AACGACGTTGCAGTACGTTGCAGT
+

This is no special format for the title line excepting that this line should be unique. Usually the first word following the > character is considered as the sequence identifier. The end of the title line corresponding to a description of the sequence. Several sequences can be concatenated in a same file. The description of the next sequence is just pasted at the end of the record of the previous one

+
>sequence_A this is my first pretty sequence
+ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
+GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
+AACGACGTTGCAGTACGTTGCAGT
+>sequence_B this is my second pretty sequence
+ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
+GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
+AACGACGTTGCAGTACGTTGCAGT
+>sequence_C this is my third pretty sequence
+ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
+GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
+AACGACGTTGCAGTACGTTGCAGT
+
+
+

2.1.3 The fastq sequence format1

+

The FASTQ format is a text file format for storing both biological sequences (only nucleic acid sequences) and the associated quality scores. The sequence and score are each encoded by a single ASCII character. This format was originally developed by the Wellcome Trust Sanger Institute to link a FASTA sequence file to the corresponding quality data, but has recently become the de facto standard for storing results from high-throughput sequencers (Cock et al. 2010).

+

A fastq file normally uses four lines per sequence.

+
    +
  • Line 1 begins with a ‘@’ character and is followed by a sequence identifier and an optional description (like a :ref:fasta title line).
    • +
  • Line 2 is the raw sequence letters.
    • +
  • Line 3 begins with a ‘+’ character and is optionally followed by the same sequence identifier (and any description) again.
    • +
  • Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
    • +
+

A fastq file containing a single sequence might look like this:

+
@SEQ_ID
+GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
++
+!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
+

The character ‘!’ represents the lowest quality while ‘~’ is the highest. Here are the quality value characters in left-to-right increasing order of quality (ASCII):

+
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+

The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of “@” and “+” as markers (these characters can also occur in the quality string).

+
+

Sequence quality scores

+

The Phred quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:

+

\[ +Q_\text{sanger} = -10 \, \log_{10} p +\]

+

The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds \(\mathbf{p}/(1-\mathbf{p})\) instead of the probability \(\mathbf{p}\):

+

\[ +Q_\text{solexa-prior to v.1.3} = -10 \; \log_{10} \frac{p}{1-p} +\]

+

Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately \(\mathbf{p} > 0.05\), or equivalently, \(\mathbf{Q} < 13\)).

+
+
+

+

Figure 2.1: Relationship between Q and p using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates \(\mathbf{p}= 0.05\), or equivalently, \(Q = 13\).

+
+
+
+
Encoding
+

The fastq format had differente way of encoding the Phred quality score along the time. Here a breif history of these changes is presented.

+
    +
  • Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps).
    • +
  • Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
    • +
  • Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
    • +
  • Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 “B”.
    • +
+
+

Sequencing Control Software, Version 2.6, (Catalog # SY-960-2601, Part # 15009921 Rev. A, November 2009, page 30) states the following: If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina’s text-based encoding of quality scores)… This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses. Also, the quality score encoded as “B” letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:

+
+
@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
+TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
++HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
+efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB
+

An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character ‘B’ was observed to represent an “unknown quality score”. The error rate of ‘B’ reads was roughly 3 phred scores lower the mean observed score of a given run.

+
    +
  • Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).
    • +
+

OBItools support the Sanger format. It is nevertheless to read files encoded following the Solexa/Illumina format, that are still possible to find in old files, by applying a shift of 62.

+
+
+
+
+

2.1.4 File extension

+

There is no standard file extension for a FASTQ file, but .fq and .fastq, are commonly used.

+ + + +
+
+
+
+
    +

  1. This article uses material from the Wikipedia article FASTQ format which is released under the Creative Commons Attribution-Share-Alike License 3.0↩︎

    2. +
+
+ +
+ + +
+ + + + \ No newline at end of file diff --git a/doc/_book/index.html b/doc/_book/index.html index 665ada0..9b9b303 100644 --- a/doc/_book/index.html +++ b/doc/_book/index.html @@ -125,22 +125,27 @@ div.csl-indent {
  • - 2  OBITools V4 Tutorial + 2  File formats usable with OBITools
  • - 3  The OBITools V4 commands + 3  OBITools V4 Tutorial
  • - 4  The GO OBITools library + 4  The OBITools V4 commands
  • - 5  Annexes + 5  The GO OBITools library +
    +
    • +
  • +
    + 6  Annexes
  • diff --git a/doc/_book/intro.html b/doc/_book/intro.html index cd2e22f..bf3b4d4 100644 --- a/doc/_book/intro.html +++ b/doc/_book/intro.html @@ -49,7 +49,7 @@ div.csl-indent { - + @@ -125,22 +125,27 @@ div.csl-indent {
  • - 2  OBITools V4 Tutorial + 2  File formats usable with OBITools
  • - 3  The OBITools V4 commands + 3  OBITools V4 Tutorial
  • - 4  The GO OBITools library + 4  The OBITools V4 commands
  • - 5  Annexes + 5  The GO OBITools library +
    +
    • +
  • +
    + 6  Annexes
  • @@ -158,16 +163,11 @@ div.csl-indent { @@ -191,201 +191,73 @@ div.csl-indent { +

    The OBITools4 are programs specifically designed for analyzing NGS data in a DNA metabarcoding context, taking into account taxonomic information. It is distributed as an open source software available on the following website: http://metabarcoding.org/obitools4.

    1.1 Aims of OBITools

    +

    DNA metabarcoding is an efficient approach for biodiversity studies (Taberlet et al. 2012). Originally mainly developed by microbiologists (e.g. Sogin et al. 2006), it is now widely used for plants (e.g. Sønstebø et al. 2010; Yoccoz et al. 2012; Parducci et al. 2012) and animals from meiofauna (e.g. Chariton et al. 2010; Baldwin et al. 2013) to larger organisms (e.g. Andersen et al. 2012; Thomsen et al. 2012). Interestingly, this method is not limited to sensu stricto biodiversity surveys, but it can also be implemented in other ecological contexts such as for herbivore (e.g. Valentini et al. 2009; Kowalczyk et al. 2011) or carnivore (e.g. Deagle, Kirkwood, and Jarman 2009; Shehzad et al. 2012) diet analyses.

    +

    Whatever the biological question under consideration, the DNA metabarcoding methodology relies heavily on next-generation sequencing (NGS), and generates considerable numbers of DNA sequence reads (typically million of reads). Manipulation of such large datasets requires dedicated programs usually running on a Unix system. Unix is an operating system, whose first version was created during the sixties. Since its early stages, it is dedicated to scientific computing and includes a large set of simple tools to efficiently process text files. Most of those programs can be viewed as filters extracting information from a text file to create a new text file. These programs process text files as streams, line per line, therefore allowing computation on a huge dataset without requiring a large memory. Unix programs usually print their results to their standard output (stdout), which by default is the terminal, so the results can be examined on screen. The main philosophy of the Unix environment is to allow easy redirection of the stdout either to a file, for saving the results, or to the standard input (stdin) of a second program thus allowing to easily create complex processing from simple base commands. Access to Unix computers is increasingly easier for scientists nowadays. Indeed, the Linux operating system, an open source version of Unix, can be freely installed on every PC machine and the MacOS operating system, running on Apple computers, is also a Unix system. The OBITools programs imitate Unix standard programs because they usually act as filters, reading their data from text files or the stdin and writing their results to the stdout. The main difference with classical Unix programs is that text files are not analyzed line per line but sequence record per sequence record (see below for a detailed description of a sequence record). Compared to packages for similar purposes like mothur (Schloss et al. 2009) or QIIME (Caporaso et al. 2010), the OBITools mainly rely on filtering and sorting algorithms. This allows users to set up versatile data analysis pipelines (Figure 1), adjustable to the broad range of DNA metabarcoding applications. The innovation of the OBITools is their ability to take into account the taxonomic annotations, ultimately allowing sorting and filtering of sequence records based on the taxonomy.

    -
    -

    1.2 File formats usable with OBITools

    -
    -

    1.2.1 The sequence files

    -

    Sequences can be stored following various format. OBITools knows some of them. The central formats for sequence files manipulated by OBITools scripts are the fasta and fastq format. OBITools extends the both these formats by specifying a syntax to include in the definition line data qualifying the sequence. All file formats use the IUPAC code for encoding nucleotides.

    +
    +

    1.2 Installation of the obitools

    +
    +

    1.2.1 Availability of the OBITools

    +

    The OBITools are open source and protected by the CeCILL 2.1 license.

    +

    All the sources of the OBITools4 can be downloaded from the metabarcoding git server (https://git.metabarcoding.org).

    -
    -

    1.2.2 The IUPAC Code

    -

    The International Union of Pure and Applied Chemistry (IUPAC_) defined the standard code for representing protein or DNA sequences.

    -
    -

    1.2.2.1 Nucleic IUPAC Code

    - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    CodeNucleotide
    AAdenine
    CCytosine
    GGuanine
    TThymine
    UUracil
    RPurine (A or G)
    YPyrimidine (C, T, or U)
    MC or A
    KT, U, or G
    WT, U, or A
    SC or G
    BC, T, U, or G (not A)
    DA, T, U, or G (not C)
    HA, T, U, or C (not G)
    VA, C, or G (not T, not U)
    NAny base (A, C, G, T, or U)
    -
    -
    -
    -

    1.2.3 The fasta format

    -

    The fasta format is certainly the most widely used sequence file format. This is certainly due to its great simplicity. It was originally created for the Lipman and Pearson FASTA program. OBITools use in more of the classical :ref:fasta format an :ref:extended version of this format where structured data are included in the title line.

    -

    In fasta format a sequence is represented by a title line beginning with a > character and the sequences by itself following the :doc:iupac code. The sequence is usually split other severals lines of the same length (expect for the last one)

    -
    >my_sequence this is my pretty sequence
-ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
-GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
-AACGACGTTGCAGTACGTTGCAGT
    -

    This is no special format for the title line excepting that this line should be unique. Usually the first word following the > character is considered as the sequence identifier. The end of the title line corresponding to a description of the sequence. Several sequences can be concatenated in a same file. The description of the next sequence is just pasted at the end of the record of the previous one

    -
    >sequence_A this is my first pretty sequence
-ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
-GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
-AACGACGTTGCAGTACGTTGCAGT
->sequence_B this is my second pretty sequence
-ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
-GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
-AACGACGTTGCAGTACGTTGCAGT
->sequence_C this is my third pretty sequence
-ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
-GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
-AACGACGTTGCAGTACGTTGCAGT
    -
    -
    -

    1.2.4 The fastq sequence format1

    -

    fastq format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a fasta sequence and its quality data, but has recently become the de facto standard for storing the output of high throughput sequencing instruments such as the Illumina Genome Analyzer Illumina (Cock et al. 2010) .

    -

    A fastq file normally uses four lines per sequence.

    -
      -
    • Line 1 begins with a ‘@’ character and is followed by a sequence identifier and an optional description (like a :ref:fasta title line).
      • -
    • Line 2 is the raw sequence letters.
      • -
    • Line 3 begins with a ‘+’ character and is optionally followed by the same sequence identifier (and any description) again.
      • -
    • Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
      • -
    -

    A fastq file containing a single sequence might look like this:

    -
    @SEQ_ID
-GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
-+
-!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
    -

    The character ‘!’ represents the lowest quality while ‘~’ is the highest. Here are the quality value characters in left-to-right increasing order of quality (ASCII):

    -
    !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
    -

    The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of “@” and “+” as markers (these characters can also occur in the quality string).

    -
    -

    1.2.4.1 Variations

    -
    -
    1.2.4.1.1 Quality
    -

    A quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:

    -

    \[ -Q_\text{sanger} = -10 \, \log_{10} p -\]

    -

    The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds \(\mathbf{p}/(1-\mathbf{p})\) instead of the probability \(\mathbf{p}\):

    -

    \[ -Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p} -\]

    -

    Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately \(\mathbf{p} > 0.05\), or equivalently, \(\mathbf{Q} < 13\)).

    -

    |Relationship between Q and p using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates \(\mathbf{p}= 0.05\), or equivalently, \(Q = 13\).|

    -
    -
    -
    -

    1.2.4.2 Encoding

    -
      -
    • Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps).
      • -
    • Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
      • -
    • Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
      • -
    • Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 “B”.
      • -
    -

    Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part # 15009921 Rev. A, November 2009] [http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\\](http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf){.uri} (page 30) states the following: If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina’s text-based encoding of quality scores)… This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses. Also, the quality score encoded as “B” letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:

    -
    @HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
-TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
-+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
-efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB
    -

    An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character ‘B’ was observed to represent an “unknown quality score”. The error rate of ‘B’ reads was roughly 3 phred scores lower the mean observed score of a given run.

    -
      -
    • Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).
      • -
    -
    -
    -
    -
    -

    1.3 File extension

    -

    There is no standard file extension for a FASTQ file, but .fq and .fastq, are commonly used.

    -
    -
    -

    1.4 See also

    -
      -
    • :ref:fasta
      • -
    -
    -
    -

    1.5 References

    -

    .. [1] Cock et al (2009) The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Research,

    -

    .. [2] Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego, Illumina 1__

    -

    .. |Relationship between Q and p using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates p = 0.05, or equivalently, Q Å 13.| image:: Probability metrics.png

    -

    See http://en.wikipedia.org/wiki/FASTQ_format

    +
    +

    1.2.2 Prerequisites

    +

    The OBITools4 are developped using the GO programming language, we stick to the latest version of the language, today the \(1.19.5\). If you want to download and compile the sources yourself, you first need to install the corresponding compiler on your system. Some parts of the soft are also written in C, therefore a recent C compiler is also requested, GCC on Linux or Windows, the Developer Tools on Mac.

    +

    Whatever the installation you decide for, you will have to ensure that a C compiler is available on your system.

    -
    -
    -
      -

    1. This article uses material from the Wikipedia article FASTQ format which is released under the Creative Commons Attribution-Share-Alike License 3.0↩︎

      2. -
    @@ -529,8 +401,8 @@ window.document.addEventListener("DOMContentLoaded", function (event) {
    - - 2  OBITools V4 Tutorial + + 2  File formats usable with OBITools
    diff --git a/doc/_book/library.html b/doc/_book/library.html index 35c7898..15f5a8e 100644 --- a/doc/_book/library.html +++ b/doc/_book/library.html @@ -7,7 +7,7 @@ -OBITools V4 - 4  The GO OBITools library +OBITools V4 - 5  The GO OBITools library