From bc12b1aaa268543067e9aa3e62c889bd633908ff Mon Sep 17 00:00:00 2001 From: Eric Coissac Date: Thu, 6 Jun 2024 23:44:23 +0200 Subject: [PATCH] Add a complete documented example of the new obitag format Former-commit-id: 748a2357cc29aefd3bdee55c85c06eab31fb9fe1 --- pkg/obioptions/version.go | 2 +- pkg/obitools/obimultiplex2/options.go | 110 +++++++++++++++++++++++++- 2 files changed, 107 insertions(+), 5 deletions(-) diff --git a/pkg/obioptions/version.go b/pkg/obioptions/version.go index f4af4eb..e6aa7b3 100644 --- a/pkg/obioptions/version.go +++ b/pkg/obioptions/version.go @@ -7,7 +7,7 @@ import ( // TODO: The version number is extracted from git. This induces that the version // corresponds to the last commit, and not the one when the file will be // commited -var _Commit = "170593b" +var _Commit = "a396240" var _Version = "Release 4.2.0" // Version returns the version of the obitools package. diff --git a/pkg/obitools/obimultiplex2/options.go b/pkg/obitools/obimultiplex2/options.go index 6fa2054..d4f1c3b 100644 --- a/pkg/obitools/obimultiplex2/options.go +++ b/pkg/obitools/obimultiplex2/options.go @@ -99,10 +99,112 @@ func CLIAskConfigTemplate() bool { } func CLIConfigTemplate() string { - return `experiment,sample,sample_tag,forward_primer,reverse_primer + return `### +### Example of NGSFilter CSV configuration file +### +# +# The CSV file can contain comments starting with the # character +# and empty lines. +# At the top of the file a set of lines of three or four columns and having +# the first column containing @param can be used to define parameters +# for the obimultiplex tool. The structure of these lines is : +# +# @param,parameter_name,parameter_value +# @param,parameter_name,parameter_value1,parameter_value2 +# +# The following lines describes the PCR multiplexed in the sequencing library. +# The first line describes the columns of the CSV file and the following lines +# describe the PCR multiplexed. +# +# Five columns are expected : +# +# - experiment: the experiment name +# - sample: the sample (pcr) name +# - sample_tag: the tag identifying the sample +# - forward_primer: the forward primer sequence +# - reverse_primer: the reverse primer sequence +# +# Supplementary columns are allowed. Their names and content will be used to +# annotate the sequence corresponding to the sample, as the key=value; located +# after the @ sign did in the original ngsfilter file format. +# +### +### Description of the parameters +### +# +# The forward_spacer and the reverse_spacer allow to specify the number of +# nucleotide separating the 5' end of the forward or reverse primer respectively +# to the 3' end of the tag. The default value is 0. +# +# The param spacer allows for specify this value for both forward and reverse +# simultaneously. The spacer parameter can also, when used wirh two arguments, +# allow to specify the # the spacer value for a specific primer: +# +# @param,spacer,CAGCTGCTATGTCGATGCTGACT,2 +# +@param,forward_spacer,0 +@param,reverse_spacer,0 +# +# A new method for designing indel proof tag is to not use one of the four +# nucleotides in their sequence and to flank the tag with this fourth nucleotide. +# That nucleotide is the tag delimiter. Similarly, to the spacer value, +# three ways to specify the tag delimiter exist: +# - the forward_tag_delimiter and reverse_tag_delimiter +# - the tag_delimiter in its two forms with one and two arguments +# +@param,forward_tag_delimiter,0 +@param,reverse_tag_delimiter,0 +# +# Three algorithms are available to math a pair of tags with a sample. +# It is specified using the @matching parameter. The three possible +# values are strict, hamming, and indel. The default value is strict. +# As for previous parameters, forward_matching and reverse_matching can +# be used to specify the matching value for each primer. And spacer +# can be used with two arguments to specify the matching value for +# a specific primer. +# +@param,matching,strict +# +# The primer_mismatches parameter allows to specify the number of errors allowed +# when matching the primer. The default value is 2. The same declination of +# the parameters forward_primer_mismatches and reverse_primer_mismatches exist. +# +@param,primer_mismatches,2 +# +# The @indel parameter allows to specify if indel are allowed during the matching +# of the primers to the sequence. The default value is false. forward_indel and +# reverse_indel can be used to specify the value for each primer. +# +@param,indels,false +# +### +### Description of the PCR multiplexed +### +# +# Below is an example for the minimal description of the PCRs multiplexed in the +# sequencing library. +# +# The first line is the column names and must exist. +# Five columns are expected : +# - experiment: the experiment name, that allows for grouping samples +# - sample: the sample (pcr) name +# - sample_tag: the tag identifying the sample +# The sample tag must be unique in the library for a given pair of primers +# + They can be a simple DNA word as here. This means that the same tag is used +# for both primers. +# + It can be two DNA words separated by a colon. For example, aagtag:gaagtag. +# This means that the first tag is used for the forward primer and the second for the +# reverse primers. "aagtag" is the same as "aagtag:aagtag". +# + In the two word syntax, if a primer forward or reverse is not tagged, its tag +# is replaced by a hyphen '-', for example 'aagtag:-' or '-:aagtag'. +# For a given primer all the tags must have the same length. +# - forward_primer: the forward primer sequence +# - reverse_primer: the reverse primer sequence +# +experiment,sample,sample_tag,forward_primer,reverse_primer wolf_diet,13a_F730603,aattaac,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG -wolf_diet,15a_F730814,gaagtag:gaatatc,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG -wolf_diet,26a_F040644,gaatatc:-,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG -wolf_diet,29a_F260619,-:-,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG +wolf_diet,15a_F730814,gaagtag,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG +wolf_diet,26a_F040644,gaatatc,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG +wolf_diet,29a_F260619,gcctcct,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG ` }