Make cleaning
This commit is contained in:
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,12 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Advanced tools on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/advanced/</link>
|
||||
<description>Recent content in Advanced tools on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate></lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/advanced/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,12 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Sequence alignments on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/alignments/</link>
|
||||
<description>Recent content in Sequence alignments on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate></lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/alignments/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
+1982
File diff suppressed because it is too large
Load Diff
+11
@@ -0,0 +1,11 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Exact alignment on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/alignments/obipairing/exact-alignment/</link>
|
||||
<description>Recent content in Exact alignment on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/alignments/obipairing/exact-alignment/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
+106
File diff suppressed because one or more lines are too long
+106
File diff suppressed because one or more lines are too long
+149
@@ -0,0 +1,149 @@
|
||||
---
|
||||
title: "Untitled"
|
||||
format: html
|
||||
editor: visual
|
||||
---
|
||||
|
||||
```{r}
|
||||
library(tidyverse)
|
||||
library(plotly)
|
||||
library(matrixStats)
|
||||
```
|
||||
|
||||
```{r}
|
||||
log_sum_exp <- function(a,b) {
|
||||
m <- map2_dbl(a,b,max)
|
||||
m + log(exp(a-m)+exp(b-m))
|
||||
}
|
||||
```
|
||||
|
||||
$$
|
||||
\log(1 - e^b) = \log\left(-e^{(1-b)}\right)
|
||||
$$
|
||||
|
||||
```{r}
|
||||
log1m_exp <- function(b) {
|
||||
if (any(b >= 0)) {
|
||||
stop(glue::glue("b must be negative (b={b})"))
|
||||
}
|
||||
return(log(-expm1(b))) # expm1(b) = exp(b) - 1, pour éviter les erreurs d'arrondi
|
||||
}
|
||||
```
|
||||
|
||||
$$
|
||||
\log(e^a - e^b) = a + \log(1 - e^{b-a})
|
||||
$$
|
||||
|
||||
```{r}
|
||||
log_diff_exp <- function(a, b) {
|
||||
# Vérifier si a > b pour éviter des résultats indéfinis
|
||||
if (any(a < b)) {
|
||||
stop(glue::glue("Erreur : a ({a}) doit etre strictement sup�rieur � b ({b}) pour que e^a - e^b soit positif."))
|
||||
}
|
||||
|
||||
# Calculer log(e^a - e^b) de manière stable
|
||||
ifelse(a == b, -Inf,a + log1m_exp(b-a))
|
||||
}
|
||||
```
|
||||
|
||||
$$
|
||||
P_{error} = 10^{-\frac{Q}{10}}
|
||||
$$
|
||||
|
||||
$$
|
||||
\begin{aligned}
|
||||
q_F &= -\frac{Q_F}{10} \cdot \log(10) \\
|
||||
q_R &= -\frac{Q_R}{10} \cdot \log(10) \\
|
||||
P(macth | Obs(match)) &= (1-e^{q_F}) (1-e^{q_R}) + (1-e^{q_F})\frac{e^{q_R}}{4}+ (1-e^{q_R})\frac{e^{q_F}}{4} + \frac{e^{q_F+q_R}}{4} \\
|
||||
&=1 - e^{q_R} - e^{q_F} + e^{q_F+q_R} + \frac{e^{q_R}}{4} - \frac{e^{q_F+q_R}}{4} + \frac{e^{q_F}}{4} - \frac{e^{q_F+q_R}}{4} + \frac{e^{q_F+q_R}}{4} \\
|
||||
&= \frac{4 - 4e^{q_F} - 4e^{q_R} + 4e^{q_F+q_R} + e^{q_F} + e^{q_R} - e^{q_F+q_R}}{4} \\
|
||||
&= \frac{4 - 3e^{q_F}- 3e^{q_R} + 3e^{q_F+q_R}}{4}\\
|
||||
&= \frac{4 - 3(e^{q_F}+e^{q_R}-e^{q_F+q_R})}{4} \\
|
||||
&= 1 - \frac{3}{4}\left(e^{q_F}+e^{q_R}-e^{q_F+q_R}\right)
|
||||
\end{aligned}
|
||||
$$
|
||||
|
||||
```{r}
|
||||
Pm_match_observed <- function(Q_F, Q_R) {
|
||||
l10 <- log(10)
|
||||
l3 <- log(3)
|
||||
l4 <- log(4)
|
||||
|
||||
q_F <- -Q_F/10*l10
|
||||
q_R <- -Q_R/10*l10
|
||||
|
||||
term1 <- log_sum_exp(q_F,q_R)
|
||||
term2 <- log_diff_exp(term1,q_F+q_R) + l3 - l4
|
||||
|
||||
log1m_exp(term2)
|
||||
}
|
||||
```
|
||||
|
||||
$$
|
||||
\begin{aligned}
|
||||
P(macth | Obs(mismatch)) &= \frac{(1-e^{q_F})e^{q_R}}{4} + \frac{(1-e^{q_R})e^{q_F}}{4} + \frac{e^{q_F+q_R}}{4} \\
|
||||
&= \frac{(1-e^{q_F})e^{q_R} + (1-e^{q_R})e^{q_F} + e^{q_F+q_R}}{4} \\
|
||||
&= \frac{e^{q_R} - e^{q_F+q_R} + e^{q_F} - e^{q_F+q_R} + e^{q_F+q_R}}{4} \\
|
||||
&= \frac{e^{q_F} + e^{q_R} - e^{q_F+q_R}}{4}
|
||||
\end{aligned}
|
||||
$$
|
||||
|
||||
```{r}
|
||||
Pm_mismatch_observed <- function(Q_F, Q_R) {
|
||||
l10 <- log(10)
|
||||
l3 <- log(3)
|
||||
l4 <- log(4)
|
||||
|
||||
q_F <- -Q_F/10*l10
|
||||
q_R <- -Q_R/10*l10
|
||||
|
||||
term1 <- log_sum_exp(q_F,q_R)
|
||||
log_diff_exp(term1,q_F+q_R) - l4
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
score_match_observed <- function(Q_F, Q_R) {
|
||||
Pm_match_observed(Q_F,Q_R) - log1m_exp(Pm_match_observed(Q_F,Q_R))
|
||||
}
|
||||
|
||||
score_mismatch_observed <- function(Q_F, Q_R) {
|
||||
Pm_mismatch_observed(Q_F,Q_R) - log1m_exp(Pm_mismatch_observed(Q_F,Q_R))
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
scores <- expand_grid(QF=0:40,QR=0:40) %>%
|
||||
mutate(score_match_observed = round(score_match_observed(QF,QR),2),
|
||||
score_mismatch_observed = round(score_mismatch_observed(QF,QR),2))
|
||||
```
|
||||
|
||||
```{r}
|
||||
plot_match <- plot_ly(scores,
|
||||
x=~QF, y=~QR, z=~score_match_observed,
|
||||
type="mesh3d") %>%
|
||||
layout(
|
||||
plot_bgcolor = "#bababa",
|
||||
scene = list(
|
||||
xaxis = list(title = "Q forward read"), # Change x/y/z axis title
|
||||
yaxis = list(title = "Q reverse read"),
|
||||
zaxis = list(title = "Score match")))
|
||||
```
|
||||
|
||||
```{r}
|
||||
plot_mismatch <- plot_ly(scores,
|
||||
x=~QF, y=~QR, z=~score_mismatch_observed,
|
||||
type="mesh3d") %>%
|
||||
layout(
|
||||
plot_bgcolor = "#bababa",
|
||||
scene = list(
|
||||
xaxis = list(title = "Q forward read"), # Change x/y/z axis title
|
||||
yaxis = list(title = "Q reverse read"),
|
||||
zaxis = list(title = "Score mismatch")))
|
||||
```
|
||||
|
||||
```{r}
|
||||
write(plotly_json(plot_match,FALSE),"content/docs/commands/alignments/obipairing/exact-alignment/match.json")
|
||||
write(plotly_json(plot_mismatch,FALSE),"content/docs/commands/alignments/obipairing/exact-alignment/mismatch.json")
|
||||
|
||||
```
|
||||
BIN
Binary file not shown.
|
After Width: | Height: | Size: 27 KiB |
+2095
File diff suppressed because it is too large
Load Diff
+11
@@ -0,0 +1,11 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>The FASTA-like alignment on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/alignments/obipairing/fasta-like/</link>
|
||||
<description>Recent content in The FASTA-like alignment on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/alignments/obipairing/fasta-like/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,12 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Basics on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/basics/</link>
|
||||
<description>Recent content in Basics on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate></lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/basics/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,12 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Demultiplexing samples on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/demultiplexing/</link>
|
||||
<description>Recent content in Demultiplexing samples on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate></lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/demultiplexing/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,12 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Experimentals on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/experimental/</link>
|
||||
<description>Recent content in Experimentals on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate></lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/experimental/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,19 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>The OBITools4 commands on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/</link>
|
||||
<description>Recent content in The OBITools4 commands on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate>Fri, 04 Oct 2024 17:16:03 +0200</lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/index.xml" rel="self" type="application/rss+xml" />
|
||||
<item>
|
||||
<title>Glossary of tags</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/tags/</link>
|
||||
<pubDate>Fri, 04 Oct 2024 17:16:03 +0200</pubDate>
|
||||
<guid>http://metabar:8888/obidoc/docs/commands/tags/</guid>
|
||||
<description><h1 id="glossary-of-tags">
 Glossary of tags
 <a class="anchor" href="#glossary-of-tags">#</a>
</h1>
<h3 id="--d--">
 - D -
 <a class="anchor" href="#--d--">#</a>
</h3>
<ul>
<li>
<p><strong>definition</strong> :</p>
<blockquote>
<p>text information about the sequence present in the original sequence file.</p>
</blockquote>
</li>
<li>
<p><strong>direction</strong> :</p>
<blockquote>
<p>set to “forward” if the original sequence did not need to be reverse-complemented to be processed, set to “reverse” otherwise.
(
 <a href="http://metabar:8888/obidoc/obitools/obipcr/">obipcr</a>)</p>
</blockquote>
</li>
</ul>
<h3 id="--f--">
 - F -
 <a class="anchor" href="#--f--">#</a>
</h3>
<ul>
<li>
<p><strong>forward_error</strong> :</p>
<blockquote>
<p>Number of mismatch between forward primer and priming site
(
 <a href="http://metabar:8888/obidoc/obitools/obipcr/">obipcr</a>)</p>
</blockquote>
</li>
<li>
<p><strong>forward_match</strong> :</p>
<blockquote>
<p>Forward primer priming site sequence
(
 <a href="http://metabar:8888/obidoc/obitools/obipcr/">obipcr</a>)</p>
</blockquote>
</li>
<li>
<p><strong>forward_primer</strong> :</p>
<blockquote>
<p>Forward primer sequence
(
 <a href="http://metabar:8888/obidoc/obitools/obipcr/">obipcr</a>)</p></description>
|
||||
</item>
|
||||
</channel>
|
||||
</rss>
|
||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,12 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Shared command options on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/options/</link>
|
||||
<description>Recent content in Shared command options on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate></lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/options/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
@@ -0,0 +1,6 @@
|
||||
>AB061527 {"count":1,"definition":"Sorex unguiculatus mitochondrial NA, complete genome.","family_name":"Soricidae","family_taxid":9376,"genus_name":"Sorex","genus_taxid":9379,"obicleandb_level":"family","obicleandb_trusted":2.2137847111025621e-13,"species_name":"Sorex unguiculatus","species_taxid":62275,"taxid":62275}
|
||||
ttagccctaaacttaggtatttaatctaacaaaaatacccgtcagagaactactagcaat
|
||||
agcttaaaactcaaaggacttggcggtgctttatatccct
|
||||
>AL355887 {"count":2,"definition":"Human chromosome 14 NA sequence BAC R-179O11 of library RPCI-11 from chromosome 14 of Homo sapiens (Human)XXKW HTG.; HTGS_ACTIVFIN.","family_name":"Hominidae","family_taxid":9604,"genus_name":"Homo","genus_taxid":9605,"obicleandb_level":"genus","obicleandb_trusted":0,"species_name":"Homo sapiens","species_taxid":9606,"taxid":9606}
|
||||
ttagccctaaactctagtagttacattaacaaaaccattcgtcagaatactacgagcaac
|
||||
agcttaaaactcaaaggacctggcagttctttatatccct
|
||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,12 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Others on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/others/</link>
|
||||
<description>Recent content in Others on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate></lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/others/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
File diff suppressed because it is too large
Load Diff
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,12 @@
|
||||
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
|
||||
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
|
||||
<channel>
|
||||
<title>Taxonomy on OBITools4 documentation</title>
|
||||
<link>http://metabar:8888/obidoc/docs/commands/taxonomy/</link>
|
||||
<description>Recent content in Taxonomy on OBITools4 documentation</description>
|
||||
<generator>Hugo</generator>
|
||||
<language>en-us</language>
|
||||
<lastBuildDate></lastBuildDate>
|
||||
<atom:link href="http://metabar:8888/obidoc/docs/commands/taxonomy/index.xml" rel="self" type="application/rss+xml" />
|
||||
</channel>
|
||||
</rss>
|
||||
Reference in New Issue
Block a user