Make cleaning

This commit is contained in:
Eric Coissac
2025-11-16 14:56:03 +01:00
parent 35d275c104
commit 30b7175702
367 changed files with 170866 additions and 11173 deletions

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,11 @@
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
<channel>
<title>GenBank Flat File format on OBITools4 documentation</title>
<link>http://metabar:8888/obidoc/formats/genbank/</link>
<description>Recent content in GenBank Flat File format on OBITools4 documentation</description>
<generator>Hugo</generator>
<language>en-us</language>
<atom:link href="http://metabar:8888/obidoc/formats/genbank/index.xml" rel="self" type="application/rss+xml" />
</channel>
</rss>

View File

@@ -0,0 +1,3 @@
>HQ324066 {"definition":"Trinia glauca tRNA-Leu (trnL) gene, intron; chloroplast.","scientific_name":"chloroplast Trinia glauca","taxid":1000432}
gggcaatcctgagccaaatcctattttacaaaaacaaacaaaggcccagaaggtgaaaaa
aggataggtgcagagactcaatgg

View File

@@ -0,0 +1,40 @@
LOCUS HQ324066 84 bp DNA linear PLN 18-NOV-2011
DEFINITION Trinia glauca tRNA-Leu (trnL) gene, intron; chloroplast.
ACCESSION HQ324066
VERSION HQ324066.1
KEYWORDS .
SOURCE chloroplast Trinia glauca
ORGANISM Trinia glauca
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; asterids; campanulids; Apiales; Apiaceae; Apioideae;
apioid superclade; Selineae; Trinia.
REFERENCE 1 (bases 1 to 84)
AUTHORS Raye,G., Miquel,C., Coissac,E., Redjadj,C., Loison,A. and
Taberlet,P.
TITLE New insights on diet variability revealed by DNA barcoding and
high-throughput pyrosequencing: chamois diet in autumn as a case
study
JOURNAL Ecol. Res. 26 (2), 265-276 (2011)
REFERENCE 2 (bases 1 to 84)
AUTHORS Raye,G.
TITLE Direct Submission
JOURNAL Submitted (25-SEP-2010) LECA, Universite Joseph Fourier, Bp 53,
2233 rue de la Piscine, Grenoble 38041, France
FEATURES Location/Qualifiers
source 1..84
/organism="Trinia glauca"
/organelle="plastid:chloroplast"
/mol_type="genomic DNA"
/db_xref="taxon:1000432"
/geo_loc_name="France"
gene <1..>84
/gene="trnL"
/note="tRNA-Leu; tRNA-Leu(UAA)"
intron <1..>84
/gene="trnL"
/note="P6 loop"
ORIGIN
1 gggcaatcct gagccaaatc ctattttaca aaaacaaaca aaggcccaga aggtgaaaaa
61 aggataggtg cagagactca atgg
//