Make cleaning

This commit is contained in:
Eric Coissac
2025-11-16 14:56:03 +01:00
parent 35d275c104
commit 30b7175702
367 changed files with 170866 additions and 11173 deletions

View File

@@ -0,0 +1,36 @@
[
{
"annotations": {
"count": 1,
"definition": "Sorex unguiculatus mitochondrial NA, complete genome.",
"family_name": "Soricidae",
"family_taxid": "9376",
"genus_name": "Sorex",
"genus_taxid": "9379",
"obicleandb_level": "family",
"obicleandb_trusted": 2.2137847111025621e-13,
"species_name": "Sorex unguiculatus",
"species_taxid": "62275",
"taxid": "62275"
},
"id": "AB061527",
"sequence": "ttagccctaaacttaggtatttaatctaacaaaaatacccgtcagagaactactagcaatagcttaaaactcaaaggacttggcggtgctttatatccct"
},
{
"annotations": {
"count": 2,
"definition": "Human chromosome 14 NA sequence BAC R-179O11 of library RPCI-11 from chromosome 14 of Homo sapiens (Human)XXKW HTG.; HTGS_ACTIVFIN.",
"family_name": "Hominidae",
"family_taxid": "9604",
"genus_name": "Homo",
"genus_taxid": "9605",
"obicleandb_level": "genus",
"obicleandb_trusted": 0,
"species_name": "Homo sapiens",
"species_taxid": "9606",
"taxid": "9606"
},
"id": "AL355887",
"sequence": "ttagccctaaactctagtagttacattaacaaaaccattcgtcagaatactacgagcaacagcttaaaactcaaaggacctggcagttctttatatccct"
}
]