Make cleaning

This commit is contained in:
Eric Coissac
2025-11-16 14:56:03 +01:00
parent 35d275c104
commit 30b7175702
367 changed files with 170866 additions and 11173 deletions
@@ -265,7 +265,7 @@ grep -B 2 root < /etc/passwd
grep -B 2 root < /etc/passwd > result
```
![Redirect stdout](images/command-grep3.svg){width = 40%}
![Redirect stdout](images/command-grep3.svg){ width=20% }
## A basic `Unix` command: Piping a stream into another command
@@ -277,7 +277,7 @@ grep -B 2 root < /etc/passwd > result
grep -B 2 root < /etc/passwd | less
```
![Pipe between commands](/images/command-grepless.svg){width = 20%}
![Pipe between commands](images/command-grepless.svg){ width=20% }
## RTFM: Bash redirections
@@ -293,171 +293,3 @@ grep -B 2 root < /etc/passwd | less
# The `OBITools`
![OBITools](images/obitools.png){width = 80%}
## RTFM !
The [documentation](http://obitools4.metabarcoding.org) is available online.
![An OBITools command](images/OBITools-web.png){width = 80%}
## An `OBITools` command
![An OBITools command](images/obitools-command.svg){width = 80%}
## Decorated fasta sequences
Basic fasta sequence:
```
>my_sequence this is my pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
```
*Decorated* fasta sequence:
```
>my_sequence taxid=3456; direct=True; sample=A354; this is my pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
```
*decoration* can be any set of `key=value;` couples
## Main OBITools commands (1/2)
- Metabarcode design and quality assessment
- `ecoPCR`: in silico PCR
- `ecoPrimers`: new barcode markers and primers
- `ecotaxstat`: getting the coverage of an ecoPCR output compared to the original ecoPCR database
- `ecotaxspecificity`: Evaluates barcode resolution
- File format conversions
- `obiconvert`: converts sequence files to different output formats
- `obitab`: converts a sequence file to a tabular file
- Sequence annotations
- `ecotag`: assigns sequences to taxa
- `obiannotate`: adds/edits sequence record annotations
## Main OBITools commands (2/2)
- Computations on sequences
- `illuminapairedend`: aligns paired-end Illumina reads
- `ngsfilter`: Assigns sequence records to the corresponding experiment/sample based on DNA tags and primers
- `obiclean`: tags a set of sequences for PCR/sequencing errors identification
- `obiuniq`: groups and dereplicates sequences
- Sequence sampling and filtering
- `obigrep`: filters sequence file
- `obihead`: extracts the first sequence records
- Statistics over sequence file
- `obicount`: counts the number of sequence records
- `obistat`: computes basic statistics for attribute values
## Regular expressions: Regex
> In computing, a regular expression is a specific pattern that provides concise and flexible means to "match" (specify and recognize) strings of text, such as particular characters, words, or patterns of characters.
>
> Common abbreviations for "regular expression" include regex and regexp.
> - http://en.wikipedia.org/wiki/Regular_expression
## Graphical representation
A regular expression can be represented by an *automata*
![Automata](images/automata.svg){ width=50% }
## Occurrence of a regular pattern
If one can get to the final state, the text `match` the regular expression.
![tot*o](images/exp1.svg){ width=50% }
> Tutu et **_toto_** sont sur un bateau. Toto tombe à leau.
> Obama: «If daughters get tat**_too_**s, we will **_too_**»
## Exemples of regular expressions
Regular expressions defined on DNA &rarr; &Sigma;={A,C,G,T}
| Regular expression | Automata |
|-------------------------------|---------------------------------------------------------------------|
| `ATG` (start codon) | ![ATG](images/exp2.svg){ width=100% } |
| `[ATG]TG` <br> `[^C]TG`(all start codons) | ![[ATG]TG](images/exp3.svg){ width=100% } |
## Exemples of regular expressions
Regular expressions defined on DNA &rarr; &Sigma;={A,C,G,T}
| Regular expression | Automata |
|-------------------------------|---------------------------------------------------------------------|
| `.TG` <br> `[ACGT]TG` (all codons ending with TG) | ![.TG](images/exp4.svg){ width=100% } |
| `TTA+TT` <br> `TTAA*TT` (TT, at least one A, TT) | ![TTAT+TT](images/exp5.svg){ width=100% } |
## Exemples of regular expressions
Regular expressions defined on DNA &rarr; &Sigma;={A,C,G,T}
| Regular expression | Automata |
|-------------------------------|---------------------------------------------------------------------|
| `TAA`&#124;`TAG`&#124;`TGA` <br> `T(AA`&#124;`AG`&#124;`GA)` (All stop codons) | ![All stops](images/exp6.svg){ width=100% } |
## Syntax of regular expressions
| Syntax | What it matches |
|-------------------|--------------------------------------------------|
| `^` | begining of the line |
| `$` | end of the line |
| `[]` | set of characters |
| `[^]` | all characters but these ones (ex: `TTA{3,5}TT`) |
| &#124; | multiple choices |
| `{}` | repetitions |
| `*` | any number of times |
| `+` | at least once |
| `?` | none or once |
| `\*` | the `*` character (same for `+`, `(`, `[`, ...) |
## Special characters: Regular expression extensions
| Special characters| What it matches |
|-------------------|--------------------------------------------------|
| `()` | used to define sub-expressions |
| `\n` | used to reuse the text matched by the `n`th sub-expression |
## Syntax of extended regular expressions
Extended regular expressions defined on DNA &rarr; &Sigma;={A,C,G,T}
| Regular expression | Automata |
|-------------------------------|---------------------------------------------------------------------|
| `([ACGT]{3})\1{9,}` (matching a stretch of at least the same codon 10 times) | As the langage described is not regular, no automaton can be used to represent the expression |
[What is my regular expression engine capable of ?](https://en.wikipedia.org/wiki/Comparison_of_regular_expression_engines)
## Regular expressions and `obigrep`
Regular expressions can be used with `obigrep` to filter sequences with the appropriate options:
-s <REGULAR_PATTERN>, --sequence=<REGULAR_PATTERN>
regular expression pattern used to select the
sequence. The pattern is case insensitive
-D <REGULAR_PATTERN>, --definition=<REGULAR_PATTERN>
regular expression pattern matched against the
definition of the sequence. The pattern is case
sensitive
-I <REGULAR_PATTERN>, --identifier=<REGULAR_PATTERN>
regular expression pattern matched against the
identifier of the sequence. The pattern is case
sensitive