Add pedagogic content

This commit is contained in:
Eric Coissac
2025-11-16 14:55:30 +01:00
parent 78156a8c95
commit 35d275c104
63 changed files with 21409 additions and 1998 deletions
+1
View File
@@ -9,3 +9,4 @@
/web_src/**/*_files
/web_src/**/*_cache
/.luarc.json
*.log
+862
View File
@@ -0,0 +1,862 @@
---
title: "Designing Fish primers"
format: revealjs
editor: visual
---
```{r setup, include=FALSE}
library(knitr)
```
# Preparing the data
------------------------------------------------------------------------
## What do we need ?
To design a new animal DNA metabarcode we download from the NCBI the following data
- The complete set of whole mitochondrial genomes
- The NCBI taxonomy
------------------------------------------------------------------------
## We need also:
- a Unix computer: a Mac or a Linux box
- A unix terminal window for typing commands
- Installed on the computer
- The OBITools --- <http://github.com/metabarcoding/obitools4>
- ecoPrimers --- <http://metabarcoding.org/ecoprimers>
- R --- <http://wwww.r-project.org>
------------------------------------------------------------------------
## Downloading the mitochondrial genomes
We can use an internet browser and download the files from NCBI FTP website
![](ncbi-ftp.png){fig-align="center"}
------------------------------------------------------------------------
## Downloading the mitochondrial genomes
We can use an internet browser and download the files from NCBI FTP website
or run the following command lines
```{bash}
#| eval: false
#| echo: true
curl 'https://ftp.ncbi.nlm.nih.gov/genomes/refseq/mitochondrion/mitochondrion.1.genomic.gbff.gz' \
> mito.all.gb.gz
```
------------------------------------------------------------------------
```{bash}
#| eval: false
#| echo: true
zless mito.all.gb.gz
```
```
LOCUS NW_009243181 45189 bp DNA linear CON 06-OCT-2014
DEFINITION Fonticula alba strain ATCC 38817 mitochondrial scaffold
supercont2.211, whole genome shotgun sequence.
ACCESSION NW_009243181 NZ_AROH01000000
VERSION NW_009243181.1
DBLINK BioProject: PRJNA262900
Assembly: GCF_000388065.1
KEYWORDS WGS; RefSeq.
SOURCE mitochondrion Fonticula alba
ORGANISM Fonticula alba
Eukaryota; Rotosphaerida; Fonticulaceae; Fonticula.
REFERENCE 1 (bases 1 to 45189)
```
------------------------------------------------------------------------
## Downloading the complete taxonomy
```{bash}
#| eval: false
#| echo: true
obitaxonomy --download-ncbi
```
```
INFO[0000] Number of workers set 16
INFO[0000] Downloading NCBI Taxdump to ncbitaxo_20250211.tgz
downloading 100% ████████████████████████████████████████| (66/66 MB, 5.1 MB/s)
```
The NCBI taxonomy contains all the relationship between taxa. Each taxon is identified by a unique numerical id: `taxid`
------------------------------------------------------------------------
## The archive contains several files
file: `nodes.dmp`
```
1 | 1 | no rank | | 8 | 0 | ...
2 | 131567 | superkingdom | | 0 | 0 |
6 | 335928 | genus | | 0 | 1 |
7 | 6 | species | AC | 0 | 1 |
9 | 32199 | species | BA | 0 |
10 | 135621 | genus | | 0 |
11 | 1707 | species | CG | 0 | 1 |
13 | 203488 | genus | | 0 | 1 |
14 | 13 | species | DT | 0 | 1 |
```
------------------------------------------------------------------------
## file: `names.dmp`
```
1 | root | | scientific name |
2 | Bacteria | Bacteria <prokaryote> | scientific name |
2 | Monera | Monera <Bacteria> | in-part |
2 | Procaryotae | Procaryotae <Bacteria> | in-part |
2 | Prokaryota | Prokaryota <Bacteria> | in-part |
2 | Prokaryotae | Prokaryotae <Bacteria> | in-part |
2 | bacteria | bacteria <blast2> | blast name |
2 | eubacteria | | genbank common name |
2 | prokaryote | prokaryote <Bacteria> | in-part |
...
10 | Cellvibrio | | scientific name |
11 | [Cellvibrio] gilvus | | scientific name |
13 | Dictyoglomus | | scientific name |
14 | Dictyoglomus thermophilum | | scientific name |
```
------------------------------------------------------------------------
## Preparing the set of complete genomes
```{bash}
#| eval: false
#| echo: true
obiconvert --skip-empty \
--update-taxid \
-t ncbitaxo_20250211.tgz \
mito.all.gb.gz \
> mito.all.fasta
head -5 mito.all.fasta
```
five first lines of the new `mito.all.fasta` file
```
>NC_072933 {"definition":"Echinosophora koreensis mitochondrion, complete genome.","scientific_name":"mitochondrion Echinosophora koreensis","taxid":228658}
ctttcgggtcggaaatagaagatctggattagatcccttctcgatagctttagtcagagc
tcatccctcgaaaaagggagtagtgagatgagaaaagggtgactagaatacggaaattca
actagtgaagtcagatccgggaattccactattgaagttatccgtcttaggcttcaagca
agctatctttcaaggaagtcagtctaagccctaagccaagatctgctttttgccagtcaa
```
------------------------------------------------------------------------
## We want:
- annotate sequences by their species `taxid`
- keep a single genome per species
- extract only vertebrate genome
------------------------------------------------------------------------
## Looking for the **Vertebrata**'s taxid
```{bash}
#| eval: false
#| echo: true
obitaxonomy -t ncbitaxo_20250211.tgz \
--fixed \
'vertebrata'
```
``` csv
taxid,parent,taxonomic_rank,scientific_name
taxon:1261581 [Vertebrata]@genus,taxon:2008651 [Polysiphonioideae]@subfamily,genus,Vertebrata
taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
```
------------------------------------------------------------------------
## Looking for the **Vertebrata**'s taxid
```{bash}
#| eval: false
#| echo: true
obitaxonomy -t ncbitaxo_20250211.tgz \
--fixed \
'vertebrata' \
| csvlook
```
``` csv
| taxid | parent | taxonomic_rank | scientific_name |
| -------------------------------- | ------------------------------------------- | -------------- | --------------- |
| taxon:1261581 [Vertebrata]@genus | taxon:2008651 [Polysiphonioideae]@subfamily | genus | Vertebrata |
| taxon:7742 [Vertebrata]@clade | taxon:89593 [Craniata]@subphylum | clade | Vertebrata |
```
## A genus called **Vertebrata**
```{bash}
#| eval: false
#| echo: true
obitaxonomy -t ncbitaxo_20250211.tgz \
-p 2008651 \
| csvlook
```
``` csv
| taxid | parent | taxonomic_rank | scientific_name |
| ------------------------------------------- | ------------------------------------------- | -------------- | ------------------ |
| taxon:2008651 [Polysiphonioideae]@subfamily | taxon:2803 [Rhodomelaceae]@family | subfamily | Polysiphonioideae |
| taxon:2803 [Rhodomelaceae]@family | taxon:2802 [Ceramiales]@order | family | Rhodomelaceae |
| taxon:2802 [Ceramiales]@order | taxon:2045261 [Rhodymeniophycidae]@subclass | order | Ceramiales |
| taxon:2045261 [Rhodymeniophycidae]@subclass | taxon:2806 [Florideophyceae]@class | subclass | Rhodymeniophycidae |
| taxon:2806 [Florideophyceae]@class | taxon:2763 [Rhodophyta]@phylum | class | Florideophyceae |
| taxon:2763 [Rhodophyta]@phylum | taxon:2759 [Eukaryota]@superkingdom | phylum | Rhodophyta |
| taxon:2759 [Eukaryota]@superkingdom | taxon:131567 [cellular organisms]@no rank | superkingdom | Eukaryota |
| taxon:131567 [cellular organisms]@no rank | taxon:1 [root]@no rank | no rank | cellular organisms |
| taxon:1 [root]@no rank | taxon:1 [root]@no rank | no rank | root |
```
------------------------------------------------------------------------
## Reannotation and selection of the genomes
```{bash}
#| eval: false
#| echo: true
obiannotate -t ncbitaxo_20250211.tgz \
--with-taxon-at-rank=species \
mito.all.fasta | \
obiannotate -S 'ori_taxid=annotations.taxid' | \
obiannotate -S 'taxid=annotations.species_taxid' | \
obiuniq -c taxid > mito.one.fasta
```
------------------------------------------------------------------------
## Species representation
```{bash}
#| eval: false
#| echo: true
obicsv -k taxid mito.one.fasta \
| tail -n +2 \
| sort \
| uniq -c \
| sort -nk1 \
| cut -w -f 2 \
| uplot count
```
```
┌ ┐
1 ┤■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■ 17769.0
2 ┤ 90.0
3 ┤ 17.0
4 ┤ 5.0
5 ┤ 4.0
6 ┤ 2.0
7 ┤ 1.0
└ ┘
```
------------------------------------------------------------------------
## Selection of the vertebrata genomes
```{bash}
#| eval: false
#| echo: true
obigrep -t ncbitaxo_20250211.tgz \
-r 7742 \
mito.one.fasta > mito.vert.fasta
```
```{bash}
#| eval: false
#| echo: true
obicount mito.vert.fasta \
| csvlook
```
```
| entities | n |
| -------- | ----------- |
| variants | 7,822 |
| reads | 7,823 |
| symbols | 131,378,756 |
```
------------------------------------------------------------------------
## Prepare data for ecoPrimers 1/3
```{bash}
#| eval: false
#| echo: true
mkdir ncbitaxo_20250211
cd ncbitaxo_20250211
tar zxvf ../ncbitaxo_20250211.tgz
cd ..
```
------------------------------------------------------------------------
## Prepare data for ecoPrimers 2/3
```{bash}
#| eval: false
#| echo: true
obiconvert -O mito.vert.fasta > mito.vert.old.fasta
```
```{bash}
#| eval: false
#| echo: true
head -5 mito.vert.old.fasta
```
``` csv
>NC_071784 taxid=taxon:2065826 [Sineleotris saccharae]@species; count=1; ori_taxid=taxon:2065826 [Sineleotris saccharae]@species; scientific_name=mitochondrion Sineleotris saccharae; species_name=Sineleotris saccharae; species_taxid=taxon:2065826 [Sineleotris saccharae]@species; Sineleotris saccharae mitochondrion, complete genome.
gctagcgtagcttaaccaaagcataacactgaagatgttaagatgggccctagaaagccc
cgcaagcacaaaagcttggtcctggctttactatcagcttaggctaaacttacacatgca
agtatccgcatccccgtgagaatgcccttaagctcccaccgctaacaggagtcaaggagc
cggtatcaggcacaaccctgagttagcccacgacaccttgctcagccacacccccaaggg
```
------------------------------------------------------------------------
## Prepare data for ecoPrimers 3/3
```{bash}
#| eval: false
#| echo: true
ecoPCRFormat -t ncbitaxo_20250211 \
-f \
-n vertebrata \
mito.vert.old.fasta
```
```{bash}
#| eval: false
#| echo: true
ls -l vertebrata*
```
```
-rw-r--r--@ 1 coissac staff 260899785 Feb 11 11:53 vertabrata.ndx
-rw-r--r--@ 1 coissac staff 546 Feb 11 11:53 vertabrata.rdx
-rw-r--r--@ 1 coissac staff 121379751 Feb 11 11:53 vertabrata.tdx
-rw-r--r--@ 1 coissac staff 40446318 Feb 11 11:54 vertabrata_001.sdx
```
------------------------------------------------------------------------
## Looking for the *Teleostei* `taxid`
```{bash}
#| eval: false
#| echo: true
obitaxonomy -t ncbitaxo_20250211.tgz \
--fixed \
'Teleostei' \
| csvlook
```
``` csv
| taxid | parent | taxonomic_rank | scientific_name |
| ---------------------------------- | ---------------------------------- | -------------- | --------------- |
| taxon:32443 [Teleostei]@infraclass | taxon:41665 [Neopterygii]@subclass | infraclass | Teleostei |
```
------------------------------------------------------------------------
## Selecting the best primer pairs
```{bash}
#| eval: false
#| echo: true
ecoPrimers -d vertebrata \
-e 3 -3 2 \
-l 30 -L 150 \
-r 32443 \
-c > Teleostei.ecoprimers
```
- Total pair count : 9407
- Total good pair count : 407
------------------------------------------------------------------------
```{bash}
#| eval: false
#| echo: true
head -35 Teleostei.ecoprimers
```
``` csv
#
# ecoPrimer version 0.5
# Rank level optimisation : species
# max error count by oligonucleotide : 3
#
# Restricted to taxon:
# 32443 : Teleostei (infraclass)
#
# strict primer quorum : 0.70
# example quorum : 0.90
# counterexample quorum : 0.10
#
# database : vertebrata
# Database is constituted of 3909 examples corresponding to 3876 species
# and 0 counterexamples corresponding to 0 species
#
# amplifiat length between [30,150] bp
# DB sequences are considered as circular
# Pairs having specificity less than 0.60 will be ignored
#
0 AGAGTGACGGGCGGTGTG CGTCAGGTCGAGGTGTAG 62.8 42.4 57.5 34.1 12 11 GG 3864 0 0.988 3832 0 0.989 2731 0.713 134 146 138.22
1 CGTCAGGTCGAGGTGTAG GAGTGACGGGCGGTGTGT 57.5 34.1 63.1 42.9 11 12 GG 3863 0 0.988 3831 0 0.988 2730 0.713 133 145 137.22
2 CGTCAGGTCGAGGTGTAG GGGAGAGTGACGGGCGGT 57.5 34.1 64.5 37.0 11 13 GG 3811 0 0.975 3779 0 0.975 2689 0.712 137 149 141.22
3 CGTCAGGTCGAGGTGTAG GGGGAGAGTGACGGGCGG 57.5 34.1 65.5 38.4 11 14 GG 3804 0 0.973 3772 0 0.973 2682 0.711 138 149 142.22
4 ACACCGCCCGTCACTCTC ACCTTCCGGTACACTTAC 62.5 36.8 54.0 16.6 12 9 GG 3850 0 0.985 3818 0 0.985 2658 0.696 46 132 66.51
5 AACGTCAGGTCGAGGTGT AGAGTGACGGGCGGTGTG 58.8 28.4 62.8 41.7 10 12 GG 3779 0 0.967 3746 0 0.966 2653 0.708 137 148 140.23
6 ACACCGCCCGTCACTCTC CACCTTCCGGTACACTTA 62.5 36.8 54.0 16.6 12 9 GG 3846 0 0.984 3814 0 0.984 2654 0.696 47 133 67.51
7 AACGTCAGGTCGAGGTGT GAGTGACGGGCGGTGTGT 58.8 28.4 63.1 42.1 10 12 GG 3778 0 0.966 3745 0 0.966 2652 0.708 136 147 139.23
8 ACCTTCCGGTACACTTAC CACACCGCCCGTCACTCT 54.0 16.6 62.8 37.3 9 12 GG 3845 0 0.984 3813 0 0.984 2653 0.696 47 133 67.51
9 ACACCGCCCGTCACTCTC TCCGGTACACTTACCATG 62.5 36.8 54.1 18.1 12 9 GG 3851 0 0.985 3819 0 0.985 2651 0.694 42 128 62.51
10 ACACCGCCCGTCACTCTC CCGGTACACTTACCATGT 62.5 36.8 54.4 18.6 12 9 GG 3851 0 0.985 3819 0 0.985 2651 0.694 41 127 61.51
11 ACACCGCCCGTCACTCTC CCAAGTGCACCTTCCGGT 62.5 36.8 60.7 28.9 12 11 GG 3837 0 0.982 3805 0 0.982 2650 0.696 54 140 74.51
12 ACACCGCCCGTCACTCTC GCACCTTCCGGTACACTT 62.5 36.8 57.7 22.5 12 10 GG 3842 0 0.983 3810 0 0.983 2650 0.696 48 134 68.51
13 ACACCGCCCGTCACTCTC CGGTACACTTACCATGTT 62.5 36.8 52.4 15.7 12 8 GG 3850 0 0.985 3818 0 0.985 2650 0.694 40 126 60.51
14 ACACCGCCCGTCACTCTC CACTTACCATGTTACGAC 62.5 36.8 51.1 27.7 12 8 GG 3850 0 0.985 3817 0 0.985 2649 0.694 35 121 55.51
```
------------------------------------------------------------------------
- Primer ID : 11
 
| Primer | sequence | tm max | tm min | GC count |
|---------|--------------------|--------|--------|----------|
| Forward | ACACCGCCCGTCACTCTC | 62.5 | 36.8 | 12 |
| Reverse | CCAAGTGCACCTTCCGGT | 60.7 | 28.9 | 11 |
 
- amplifying 3837/3909 sequences\
- identify 2650/3876 Species
- Size ranging from 54bp to 140bp (mean: 74.75 bp)
## Testing the new primer pair
```{bash}
#| eval: false
#| echo: true
obipcr --forward ACACCGCCCGTCACTCTC \
--reverse CCAAGTGCACCTTCCGGT \
-e 5 \
-l 30 -L 150 \
-c \
mito.vert.fasta \
> Teleostei_11.fasta
```
```{bash}
#| eval: false
#| echo: true
head Teleostei_11.fasta
```
``` csv
>NC_022183_sub[925..998] {"count":1,"definition":"Acrossocheilus hemispinus mitochondrion, complete genome.","direction":"forward","forward_error":1,"forward_match":"acaccgcccgtcaccctc","forward_primer":"ACACCGCCCGTCACTCTC","ori_taxid":"taxon:356810 [Acrossocheilus hemispinus]@species","reverse_error":0,"reverse_match":"ccaagtgcaccttccggt","reverse_primer":"CCAAGTGCACCTTCCGGT","scientific_name":"mitochondrion Acrossocheilus hemispinus","species_name":"Acrossocheilus hemispinus","species_taxid":"taxon:356810 [Acrossocheilus hemispinus]@species","taxid":"taxon:356810 [Acrossocheilus hemispinus]@species"}
cccgtcaaaatacaccaaaaatacttaatacaataacactaacaaggggaggcaagtcgt
aacatggtaagtgt
>NC_018560_sub[916..988] {"count":1,"definition":"Astatotilapia calliptera mitochondrion, complete genome.","direction":"forward","forward_error":0,"forward_match":"acaccgcccgtcactctc","forward_primer":"ACACCGCCCGTCACTCTC","ori_taxid":"taxon:8154 [Astatotilapia calliptera]@species","reverse_error":1,"reverse_match":"ccaagtacaccttccggt","reverse_primer":"CCAAGTGCACCTTCCGGT","scientific_name":"mitochondrion Astatotilapia calliptera (eastern happy)","species_name":"Astatotilapia calliptera","species_taxid":"taxon:8154 [Astatotilapia calliptera]@species","taxid":"taxon:8154 [Astatotilapia calliptera]@species"}
cccaagccaacaacatcctataaataatacattttaccggtaaaggggaggcaagtcgta
acatggtaagtgt
>NC_056117_sub[923..997] {"count":1,"definition":"Pseudocrossocheilus tridentis mitochondrion, complete genome.","direction":"forward","forward_error":0,"forward_match":"acaccgcccgtcactctc","forward_primer":"ACACCGCCCGTCACTCTC","ori_taxid":"taxon:887881 [Pseudocrossocheilus tridentis]@species","reverse_error":0,"reverse_match":"ccaagtgcaccttccggt","reverse_primer":"CCAAGTGCACCTTCCGGT","scientific_name":"mitochondrion Pseudocrossocheilus tridentis","species_name":"Pseudocrossocheilus tridentis","species_taxid":"taxon:887881 [Pseudocrossocheilus tridentis]@species","taxid":"taxon:887881 [Pseudocrossocheilus tridentis]@species"}
ccctgtcaaaaagcatcaaatatatataataaattagcaatgacaaggggaggcaagtcg
taacacggtaagtgt
>NC_045904_sub[919..997] {"count":1,"definition":"Eospalax fontanierii mitochondrion, complete genome.","direction":"forward","forward_error":1,"forward_match":"acaccgcccgtcgctctc","forward_primer":"ACACCGCCCGTCACTCTC","ori_taxid":"taxon:146134 [Eospalax fontanierii]@species","reverse_error":4,"reverse_match":"ccaagcacactttccagt","reverse_primer":"CCAAGTGCACCTTCCGGT","scientific_name":"mitochondrion Eospalax fontanierii","species_name":"Eospalax fontanierii","species_taxid":"taxon:146134 [Eospalax fontanierii]@species","taxid":"taxon:146134 [Eospalax fontanierii]@species"}
```
------------------------------------------------------------------------
convert the fasta file to csv
```{bash}
#| eval: false
#| echo: true
obicsv --auto -s -i Teleostei_11.fasta > Teleostei_11.csv
```
and display the begining of the table
```{bash}
#| eval: false
#| echo: true
head Teleostei_11.csv | csvlook
```
``` csv
| id | count | direction | forward_error | forward_match | forward_primer | ori_taxid | reverse_error | reverse_match | reverse_primer | scientific_name | species_name | species_taxid | taxid | sequence |
| ------------------------- | ----- | --------- | ------------- | ------------------ | ------------------ | ---------------------------------------------------- | ------------- | ------------------ | ------------------ | ------------------------------------------------------ | ----------------------------- | ---------------------------------------------------- | ---------------------------------------------------- | ------------------------------------------------------------------------------- |
| NC_022183_sub[925..998] | True | forward | True | acaccgcccgtcaccctc | ACACCGCCCGTCACTCTC | taxon:356810 [Acrossocheilus hemispinus]@species | 0 | ccaagtgcaccttccggt | CCAAGTGCACCTTCCGGT | mitochondrion Acrossocheilus hemispinus | Acrossocheilus hemispinus | taxon:356810 [Acrossocheilus hemispinus]@species | taxon:356810 [Acrossocheilus hemispinus]@species | cccgtcaaaatacaccaaaaatacttaatacaataacactaacaaggggaggcaagtcgtaacatggtaagtgt |
| NC_018560_sub[916..988] | True | forward | False | acaccgcccgtcactctc | ACACCGCCCGTCACTCTC | taxon:8154 [Astatotilapia calliptera]@species | 1 | ccaagtacaccttccggt | CCAAGTGCACCTTCCGGT | mitochondrion Astatotilapia calliptera (eastern happy) | Astatotilapia calliptera | taxon:8154 [Astatotilapia calliptera]@species | taxon:8154 [Astatotilapia calliptera]@species | cccaagccaacaacatcctataaataatacattttaccggtaaaggggaggcaagtcgtaacatggtaagtgt |
| NC_056117_sub[923..997] | True | forward | False | acaccgcccgtcactctc | ACACCGCCCGTCACTCTC | taxon:887881 [Pseudocrossocheilus tridentis]@species | 0 | ccaagtgcaccttccggt | CCAAGTGCACCTTCCGGT | mitochondrion Pseudocrossocheilus tridentis | Pseudocrossocheilus tridentis | taxon:887881 [Pseudocrossocheilus tridentis]@species | taxon:887881 [Pseudocrossocheilus tridentis]@species | ccctgtcaaaaagcatcaaatatatataataaattagcaatgacaaggggaggcaagtcgtaacacggtaagtgt |
| NC_045904_sub[919..997] | True | forward | True | acaccgcccgtcgctctc | ACACCGCCCGTCACTCTC | taxon:146134 [Eospalax fontanierii]@species | 4 | ccaagcacactttccagt | CCAAGTGCACCTTCCGGT | mitochondrion Eospalax fontanierii | Eospalax fontanierii | taxon:146134 [Eospalax fontanierii]@species | taxon:146134 [Eospalax fontanierii]@species | ctcaagtacataaacttggatatattcttaataacccaacaaaaatattagaggagataagtcgtaacaaggtaagcat |
| NC_018546_sub[916..987] | True | forward | False | acaccgcccgtcactctc | ACACCGCCCGTCACTCTC | taxon:30732 [Oryzias melastigma]@species | 0 | ccaagtgcaccttccggt | CCAAGTGCACCTTCCGGT | mitochondrion Oryzias melastigma (Indian medaka) | Oryzias melastigma | taxon:30732 [Oryzias melastigma]@species | taxon:30732 [Oryzias melastigma]@species | cccgacccattttaaaaattaaataaaagatttcaggaactaaggggaggcaagtcgtaacatggtaagtgt |
| NC_044151_sub[922..993] | True | forward | False | acaccgcccgtcactctc | ACACCGCCCGTCACTCTC | taxon:2597641 [Sicyopterus squamosissimus]@species | 0 | ccaagtgcaccttccggt | CCAAGTGCACCTTCCGGT | mitochondrion Sicyopterus squamosissimus (cling goby) | Sicyopterus squamosissimus | taxon:2597641 [Sicyopterus squamosissimus]@species | taxon:2597641 [Sicyopterus squamosissimus]@species | cccaaaacaaacacacacataaataagaaaaaatgaaaataaaggggaggcaagtcgtaacatggtaagtgt |
| NC_044152_sub[922..994] | True | forward | False | acaccgcccgtcactctc | ACACCGCCCGTCACTCTC | taxon:2597642 [Sicyopterus stiphodonoides]@species | 0 | ccaagtgcaccttccggt | CCAAGTGCACCTTCCGGT | mitochondrion Sicyopterus stiphodonoides (cling goby) | Sicyopterus stiphodonoides | taxon:2597642 [Sicyopterus stiphodonoides]@species | taxon:2597642 [Sicyopterus stiphodonoides]@species | cccaaaacaaacacacacataaataagaaaaaantgaaaataaaggggaggcaagtcgtaacatggtaagtgt |
| NC_026976_sub[1453..1531] | True | forward | True | acaccgcccgtcactccc | ACACCGCCCGTCACTCTC | taxon:9545 [Macaca nemestrina]@species | 1 | ccaagtgcaccttccagt | CCAAGTGCACCTTCCGGT | mitochondrion Macaca nemestrina (pig-tailed macaque) | Macaca nemestrina | taxon:9545 [Macaca nemestrina]@species | taxon:9545 [Macaca nemestrina]@species | ctcaaatatatttaaggaacatcttaactaaacgccctaatatttatatagaggggataagtcgtaacatggtaagtgt |
| NC_031553_sub[921..995] | True | forward | False | acaccgcccgtcactctc | ACACCGCCCGTCACTCTC | taxon:643337 [Puntioplites proctozystron]@species | 0 | ccaagtgcaccttccggt | CCAAGTGCACCTTCCGGT | mitochondrion Puntioplites proctozystron | Puntioplites proctozystron | taxon:643337 [Puntioplites proctozystron]@species | taxon:643337 [Puntioplites proctozystron]@species | ccctgtcaaaacgcactaaaaatatctaatacaaaagcaccgacaaggggaggcaagtcgtaacacggtaagtgt |
```
# We are now switching to R
------------------------------------------------------------------------
## Preparing our R session
First we have to download the two follong libraries
```{r}
#| echo: true
library(tidyverse)
library(ggpubr)
library(ROBITools4)
```
------------------------------------------------------------------------
## Loading the data
```{r}
#| echo: true
fish <- read_csv('Teleostei_11.csv', show_col_types = FALSE)
taxo <- read_ncbi_taxdump('ncbitaxo_20250211')
assign_default_taxonomy(taxo)
```
------------------------------------------------------------------------
Looking for Teleostei taxid
```{r}
#| echo: true
teleo_taxid <- ecofind('Teleostei')
teleo_taxid
```
------------------------------------------------------------------------
## Format taxids
```{r}
#| echo: true
fish %>% mutate(
taxid = as_taxid(
as.integer(
str_split_fixed(
str_split_fixed(
taxid,pattern = " ",
n = 2)[,1],
":",
2)[,2]))
) %>%
as_tbl_obipcr() %>%
mutate(across(taxon(),
.names="category",
.fn=taxonomy_classifier(Teleostei = 32443))) %>%
group_by(category) %>%
mutate(weight = taxonomic_weights(taxid,taxo)) %>%
ungroup() -> fish
```
------------------------------------------------------------------------
## The fish tibble
```{r}
#| echo: true
head(fish,n = 4)
```
------------------------------------------------------------------------
## Identifying which sequences belongs fish
```{r}
#| echo: true
table(fish$category)
```
------------------------------------------------------------------------
## Testing the conservation of the priming sites
```{r}
#| echo: true
pssm_forward <- pssm(fish$forward_match,
weights = fish$weight,
categories = fish$category)
pssm_reverse <- pssm(fish$reverse_match,
weights = fish$weight,
categories = fish$category)
```
```{r}
#| echo: true
pssm_forward
```
------------------------------------------------------------------------
## Rescaling the matrix as Shanon entropy
$$
H = - \sum_{i \in \{A,C,G,T\}} p_i \times \frac{\log(p_i)}{\log(2)}
$$
```{r}
#| echo: true
pssm_forward <- pssm_scale_shanon(pssm_forward)
pssm_reverse <- pssm_scale_shanon(pssm_reverse)
```
------------------------------------------------------------------------
## Display the rescaled matrix
```{r}
#| echo: true
pssm_forward
```
------------------------------------------------------------------------
## The DNA logo of our primer pair
```{r}
#| echo: true
flogo <- ggbarcodelogo(pssm_forward) +
xlab("Forward primer") + ylab("Bits")
rlogo <- ggbarcodelogo(pssm_reverse) +
xlab("Reverse primer") + ylab("Bits")
ggarrange(flogo,rlogo,ncol=2) -> dnaplot
dnaplot
```
------------------------------------------------------------------------
## How many mismatches ?
```{r}
#| echo: true
ggbarcodemistmatch(fish$forward_error,
fish$reverse_error,
otu=fish$species_name,
categories=fish$category) + theme_minimal()
```
------------------------------------------------------------------------
## Are we discriminate taxa ?
```{r}
#| echo: true
with(fish %>% filter(category == "Teleostei"),
discriminated_at_rank(taxid,
c("species","genus","family","order"),
sequence))
```
------------------------------------------------------------------------
## How many sequences will provide information at rank ?
```{r}
#| echo: true
with(fish %>% filter(category == "Teleostei"),
discriminant_at_rank(taxid,
c("species","genus","family","order"),
sequence))
```
------------------------------------------------------------------------
## Is it the same for *Cyprinidae* ?
```{r}
#| echo: true
cyprinidae_taxid <- ecofind('Cyprinidae')
cyprinidae_taxid
```
------------------------------------------------------------------------
## Classify according to both categories
```{r}
#| echo: true
fish %>%
mutate(across(taxon(),
.names="category2",
.fn=taxonomy_classifier(Teleostei = 32443,
Cyprinidae = 7953))) -> fish
table(fish$category2)
```
------------------------------------------------------------------------
## Are we discriminate taxa ?
```{r}
#| echo: true
with(fish %>% filter(category2 == "Cyprinidae"),
discriminated_at_rank(taxid,
c("species","genus"),
sequence))
```
# Go back to unix
## We run ecoPrimers and ecoPCR on the select primer pair
```{bash}
#| eval: false
#| echo: true
ecoPrimers -d vertebrata \
-e 3 -3 2 \
-l 30 -L 150 \
-r 7953 -c > Cyprinidae.ecoprimers
```
```{bash}
#| eval: false
#| echo: true
obipcr --forward ACGGCGTAAAGGGTGGTT \
--reverse TATCTAATCCCAGTTTGT \
-e 5 \
-l 30 -L 500 \
-c \
mito.vert.fasta \
> Cyprinidae_14.fasta
```
```{bash}
#| eval: false
#| echo: true
obicsv --auto -s -i Cyprinidae_14.fasta > Cyprinidae_14.csv
```
# Go back to R
```{r}
cyprinidae <- read_csv('Cyprinidae_14.csv',
show_col_types = FALSE) %>%
mutate(
taxid = as_taxid(
as.integer(
str_split_fixed(
str_split_fixed(
taxid,pattern = " ",
n = 2)[,1],
":",
2)[,2]))
) %>%
as_tbl_obipcr() %>%
mutate(across(taxon(),
.names="category",
.fn=taxonomy_classifier(Teleostei = 32443,
Cyprinidae = 7953))) %>%
group_by(category) %>%
mutate(weight = taxonomic_weights(taxid,taxo)) %>%
ungroup()
```
------------------------------------------------------------------------
## Identifying which sequences belongs fish and *Cyprinidae*
```{r}
#| echo: true
table(cyprinidae$category)
```
------------------------------------------------------------------------
## Looking for conservation
```{r}
#| echo: true
pssm_forward <- pssm(cyprinidae$forward_match,
weights = cyprinidae$weight,
categories = cyprinidae$category) %>%
pssm_scale_shanon()
pssm_reverse <- pssm(cyprinidae$reverse_match,
weights = cyprinidae$weight,
categories = cyprinidae$category) %>%
pssm_scale_shanon()
```
------------------------------------------------------------------------
## Plot the new DNA logo
```{r}
flogo <- ggbarcodelogo(pssm_forward) +
xlab("Forward primer") + ylab("Bits")
rlogo <- ggbarcodelogo(pssm_reverse) +
xlab("Reverse primer") + ylab("Bits")
ggarrange(flogo,rlogo,ncol=2) -> dnaplot
dnaplot
```
------------------------------------------------------------------------
## How many mismatches ?
```{r}
#| echo: true
ggbarcodemistmatch(cyprinidae$forward_error,
cyprinidae$reverse_error,
otu=cyprinidae$species_name,
categories=cyprinidae$category) + theme_minimal()
```
------------------------------------------------------------------------
## Are we discriminate *Cyprinidae* taxa ?
```{r}
#| echo: true
with(cyprinidae %>% filter(category == "Cyprinidae"),
discriminated_at_rank(taxid,
c("species","genus"),
sequence))
```
File diff suppressed because it is too large Load Diff
+787 -32
View File
@@ -2,128 +2,883 @@
"cells": [
{
"cell_type": "markdown",
"id": "30438c30",
"metadata": {},
"source": [
"# Unix Essentials — Bash Exercises\n",
"# Unix Essentials — Bash Practice Notebook\n",
"\n",
"This notebook contains short hands-on Bash exercises.\n",
"Each exercise has a hidden solution that can be unfolded when needed."
"This notebook contains 50 small Bash exercises grouped by topic.\n",
"Each exercise includes a hidden solution that can be revealed in Jupyter."
]
},
{
"cell_type": "markdown",
"id": "39d711f9",
"metadata": {},
"source": [
"## Exercise 1 Listing and Filtering Files\n",
"\n",
"Create three files and list only those whose name ends with `.log`."
"## Series 1 — Paths and Directories"
]
},
{
"cell_type": "markdown",
"id": "6fb7335e",
"metadata": {},
"source": [
"### Exercise 1.1 — Show your current working directory"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "2b8575f3",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"touch report.log notes.txt errors.log\n",
"# list files ending with .log"
"pwd"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "21f63bb0",
"metadata": {
"jupyter": {
"source_hidden": true,
"outputs_hidden": true
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"ls *.log"
"pwd"
]
},
{
"cell_type": "markdown",
"id": "61a624bf",
"metadata": {},
"source": [
"## Exercise 2 Redirecting Output\n",
"\n",
"List the `/etc` directory and save the results in a file named `listing.txt`, then display the first five lines of that file."
"### Exercise 1.2 — Create a new directory named `testdir`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "4a4df387",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"# 1. list /etc\n",
"# 2. redirect output to listing.txt\n",
"# 3. show first five lines"
"mkdir testdir"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "2b5cfbca",
"metadata": {
"jupyter": {
"source_hidden": true,
"outputs_hidden": true
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"ls /etc > listing.txt\n",
"head -5 listing.txt"
"mkdir testdir"
]
},
{
"cell_type": "markdown",
"id": "2dccbb61",
"metadata": {},
"source": [
"## Exercise 3 Using a For Loop\n",
"\n",
"Write a loop that prints the line count of each `.txt` file in the current directory."
"### Exercise 1.3 — Move into `testdir` using a relative path"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "fb73ca3c",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"# hint: use wc -l"
"cd testdir"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "ba670a20",
"metadata": {
"jupyter": {
"source_hidden": true,
"outputs_hidden": true
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"for f in *.txt; do\n",
" echo \"$f: $(wc -l < \"$f\") lines\"\n",
"done"
"cd testdir"
]
},
{
"cell_type": "markdown",
"id": "4f7e5817",
"metadata": {},
"source": [
"---\n",
"All solutions are hidden by default (`source_hidden: true`). Students can unfold them in Jupyters interface to compare with their own answers."
"### Exercise 1.4 — Create two subdirectories `a` and `b` in one command"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "30be8f44",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"mkdir a b"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "caf92714",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"mkdir a b"
]
},
{
"cell_type": "markdown",
"id": "edec9041",
"metadata": {},
"source": [
"### Exercise 1.5 — Return to the parent directory using `..`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "32a0f1df",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"cd .."
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "2a0aa92f",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"cd .."
]
},
{
"cell_type": "markdown",
"id": "31917159",
"metadata": {},
"source": [
"### Exercise 1.6 — Create nested directories `one/two/three` in a single command"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "c0a313c3",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"mkdir -p one/two/three"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "4af63dce",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"mkdir -p one/two/three"
]
},
{
"cell_type": "markdown",
"id": "24ee949e",
"metadata": {},
"source": [
"### Exercise 1.7 — List the absolute path of the current directory"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "8258fff7",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"pwd"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "a6a062b2",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"pwd"
]
},
{
"cell_type": "markdown",
"id": "6d724d3e",
"metadata": {},
"source": [
"### Exercise 1.8 — Create a directory using an absolute path"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "5f497f7c",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"mkdir /tmp/mydir"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "1d1d4e27",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"mkdir /tmp/mydir"
]
},
{
"cell_type": "markdown",
"id": "0a4cbe5b",
"metadata": {},
"source": [
"### Exercise 1.9 — Display both `.` and `..` directories with `ls -a`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "7d962a9f",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"ls -a"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "91994de2",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"ls -a"
]
},
{
"cell_type": "markdown",
"id": "e147ff34",
"metadata": {},
"source": [
"### Exercise 1.10 — Remove the directory `/tmp/mydir`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "dcae28e3",
"metadata": {},
"outputs": [],
"source": [
"# your work here\n",
"rmdir /tmp/mydir"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "1a000f14",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"rmdir /tmp/mydir"
]
},
{
"cell_type": "markdown",
"id": "578548f7",
"metadata": {},
"source": [
"## Series 2 — File Manipulation"
]
},
{
"cell_type": "markdown",
"id": "813140d5",
"metadata": {},
"source": [
"### Exercise 2.1 — Create an empty file named `notes.txt`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "08385872",
"metadata": {},
"outputs": [],
"source": [
"touch notes.txt"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "a474ad37",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"touch notes.txt"
]
},
{
"cell_type": "markdown",
"id": "6e918f3d",
"metadata": {},
"source": [
"### Exercise 2.2 — Copy `notes.txt` to `backup.txt`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "faf85985",
"metadata": {},
"outputs": [],
"source": [
"cp notes.txt backup.txt"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "4d3e54d5",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"cp notes.txt backup.txt"
]
},
{
"cell_type": "markdown",
"id": "2c924f2e",
"metadata": {},
"source": [
"### Exercise 2.3 — Rename `backup.txt` to `archive.txt`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "2d4adeb4",
"metadata": {},
"outputs": [],
"source": [
"mv backup.txt archive.txt"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "2c62e70f",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"mv backup.txt archive.txt"
]
},
{
"cell_type": "markdown",
"id": "c9e525a7",
"metadata": {},
"source": [
"### Exercise 2.4 — Create 3 files and remove one with `rm`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "3ef53a3a",
"metadata": {},
"outputs": [],
"source": [
"touch a.txt b.txt c.txt\n",
"rm b.txt"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "55e07074",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"touch a.txt b.txt c.txt\n",
"rm b.txt"
]
},
{
"cell_type": "markdown",
"id": "b5a406b4",
"metadata": {},
"source": [
"### Exercise 2.5 — Remove a directory recursively"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "2c819a49",
"metadata": {},
"outputs": [],
"source": [
"mkdir -p tmpdir/sub\n",
"rm -rf tmpdir"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "b958a668",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"mkdir -p tmpdir/sub\n",
"rm -rf tmpdir"
]
},
{
"cell_type": "markdown",
"id": "9aa4996e",
"metadata": {},
"source": [
"## Series 3 — Redirections and Pipes"
]
},
{
"cell_type": "markdown",
"id": "ada90797",
"metadata": {},
"source": [
"### Exercise 3.1 — Save the output of `ls` to a file `list.txt`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "25afa75b",
"metadata": {},
"outputs": [],
"source": [
"ls > list.txt"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "80ca4767",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"ls > list.txt"
]
},
{
"cell_type": "markdown",
"id": "61c3bff6",
"metadata": {},
"source": [
"### Exercise 3.2 — Append the date to `list.txt`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "b7849f15",
"metadata": {},
"outputs": [],
"source": [
"date >> list.txt"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "83b08fe6",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"date >> list.txt"
]
},
{
"cell_type": "markdown",
"id": "600edcaa",
"metadata": {},
"source": [
"### Exercise 3.3 — Count lines of `list.txt` with a pipe"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "37e859f4",
"metadata": {},
"outputs": [],
"source": [
"cat list.txt | wc -l"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "d1429a1c",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"cat list.txt | wc -l"
]
},
{
"cell_type": "markdown",
"id": "a901cf34",
"metadata": {},
"source": [
"### Exercise 3.4 — Redirect error messages to a file"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "f2c1d530",
"metadata": {},
"outputs": [],
"source": [
"ls /fakepath 2> errors.txt"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "66c68bc4",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"ls /fakepath 2> errors.txt"
]
},
{
"cell_type": "markdown",
"id": "72e5eca4",
"metadata": {},
"source": [
"## Series 4 — Viewing Results"
]
},
{
"cell_type": "markdown",
"id": "dd7cbf2e",
"metadata": {},
"source": [
"### Exercise 4.1 — Display the first 5 lines of `/etc/passwd`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "195c0f25",
"metadata": {},
"outputs": [],
"source": [
"head -5 /etc/passwd"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "72dc0297",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"head -5 /etc/passwd"
]
},
{
"cell_type": "markdown",
"id": "227ebdf8",
"metadata": {},
"source": [
"### Exercise 4.2 — Show the last 3 lines of `/etc/passwd`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "3a829074",
"metadata": {},
"outputs": [],
"source": [
"tail -3 /etc/passwd"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "e66f1752",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"tail -3 /etc/passwd"
]
},
{
"cell_type": "markdown",
"id": "826cbb41",
"metadata": {},
"source": [
"### Exercise 4.3 — Use `grep` to show lines containing 'root'"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "df9a877b",
"metadata": {},
"outputs": [],
"source": [
"grep root /etc/passwd"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "5ed43d3d",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"grep root /etc/passwd"
]
},
{
"cell_type": "markdown",
"id": "a6c2f0a8",
"metadata": {},
"source": [
"## Series 5 — Process Management"
]
},
{
"cell_type": "markdown",
"id": "333ab7c1",
"metadata": {},
"source": [
"### Exercise 5.1 — List current processes"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "41dc9dfb",
"metadata": {},
"outputs": [],
"source": [
"ps"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "c0f28455",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"ps"
]
},
{
"cell_type": "markdown",
"id": "c2d37e8f",
"metadata": {},
"source": [
"### Exercise 5.2 — Display dynamic process list with `top`"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "7931c9aa",
"metadata": {},
"outputs": [],
"source": [
"top"
]
},
{
"cell_type": "code",
"execution_count": null,
"id": "947570cf",
"metadata": {
"jupyter": {
"outputs_hidden": true,
"source_hidden": true
}
},
"outputs": [],
"source": [
"# Solution\n",
"top"
]
}
],
File diff suppressed because it is too large Load Diff
+15157 -1959
View File
File diff suppressed because one or more lines are too long
@@ -2,9 +2,11 @@
title: "Regular Expressions"
format:
revealjs:
theme: beige # thème des slides
css: ../../slides.css
transition: fade # effet de transition entre les slides
transition: slide
scrollable: true
theme: beige
html-math-method: mathjax
---

Before

Width:  |  Height:  |  Size: 9.6 KiB

After

Width:  |  Height:  |  Size: 9.6 KiB

Before

Width:  |  Height:  |  Size: 6.5 KiB

After

Width:  |  Height:  |  Size: 6.5 KiB

Before

Width:  |  Height:  |  Size: 146 KiB

After

Width:  |  Height:  |  Size: 146 KiB

Before

Width:  |  Height:  |  Size: 110 KiB

After

Width:  |  Height:  |  Size: 110 KiB

Before

Width:  |  Height:  |  Size: 2.5 KiB

After

Width:  |  Height:  |  Size: 2.5 KiB

Before

Width:  |  Height:  |  Size: 15 KiB

After

Width:  |  Height:  |  Size: 15 KiB

Before

Width:  |  Height:  |  Size: 15 KiB

After

Width:  |  Height:  |  Size: 15 KiB

Before

Width:  |  Height:  |  Size: 10 KiB

After

Width:  |  Height:  |  Size: 10 KiB

Before

Width:  |  Height:  |  Size: 13 KiB

After

Width:  |  Height:  |  Size: 13 KiB

Before

Width:  |  Height:  |  Size: 155 KiB

After

Width:  |  Height:  |  Size: 155 KiB

Before

Width:  |  Height:  |  Size: 15 KiB

After

Width:  |  Height:  |  Size: 15 KiB

Before

Width:  |  Height:  |  Size: 54 KiB

After

Width:  |  Height:  |  Size: 54 KiB

Before

Width:  |  Height:  |  Size: 29 KiB

After

Width:  |  Height:  |  Size: 29 KiB

Before

Width:  |  Height:  |  Size: 31 KiB

After

Width:  |  Height:  |  Size: 31 KiB

Before

Width:  |  Height:  |  Size: 23 KiB

After

Width:  |  Height:  |  Size: 23 KiB

Before

Width:  |  Height:  |  Size: 31 KiB

After

Width:  |  Height:  |  Size: 31 KiB

Before

Width:  |  Height:  |  Size: 4.6 KiB

After

Width:  |  Height:  |  Size: 4.6 KiB

Before

Width:  |  Height:  |  Size: 3.4 KiB

After

Width:  |  Height:  |  Size: 3.4 KiB

Before

Width:  |  Height:  |  Size: 2.9 KiB

After

Width:  |  Height:  |  Size: 2.9 KiB

Before

Width:  |  Height:  |  Size: 4.0 KiB

After

Width:  |  Height:  |  Size: 4.0 KiB

Before

Width:  |  Height:  |  Size: 4.4 KiB

After

Width:  |  Height:  |  Size: 4.4 KiB

Before

Width:  |  Height:  |  Size: 4.5 KiB

After

Width:  |  Height:  |  Size: 4.5 KiB

Before

Width:  |  Height:  |  Size: 4.5 KiB

After

Width:  |  Height:  |  Size: 4.5 KiB

Before

Width:  |  Height:  |  Size: 265 KiB

After

Width:  |  Height:  |  Size: 265 KiB

Before

Width:  |  Height:  |  Size: 198 KiB

After

Width:  |  Height:  |  Size: 198 KiB

Before

Width:  |  Height:  |  Size: 231 KiB

After

Width:  |  Height:  |  Size: 231 KiB

Before

Width:  |  Height:  |  Size: 18 KiB

After

Width:  |  Height:  |  Size: 18 KiB

Before

Width:  |  Height:  |  Size: 32 KiB

After

Width:  |  Height:  |  Size: 32 KiB

Before

Width:  |  Height:  |  Size: 5.3 KiB

After

Width:  |  Height:  |  Size: 5.3 KiB

Before

Width:  |  Height:  |  Size: 86 KiB

After

Width:  |  Height:  |  Size: 86 KiB

Before

Width:  |  Height:  |  Size: 13 KiB

After

Width:  |  Height:  |  Size: 13 KiB

Before

Width:  |  Height:  |  Size: 10 KiB

After

Width:  |  Height:  |  Size: 10 KiB

Before

Width:  |  Height:  |  Size: 13 KiB

After

Width:  |  Height:  |  Size: 13 KiB

Before

Width:  |  Height:  |  Size: 22 KiB

After

Width:  |  Height:  |  Size: 22 KiB

Before

Width:  |  Height:  |  Size: 4.4 KiB

After

Width:  |  Height:  |  Size: 4.4 KiB

Before

Width:  |  Height:  |  Size: 12 KiB

After

Width:  |  Height:  |  Size: 12 KiB

@@ -6,12 +6,11 @@ title: |
author: frederic.boyer@univ-grenoble-alpes.fr
format:
revealjs:
theme: beige
css: ../../slides.css
transition: fade
width: 1280
height: 720
center: true
transition: slide
scrollable: true
theme: beige
html-math-method: mathjax
---
# Introduction to Unix
File diff suppressed because it is too large Load Diff
@@ -0,0 +1,167 @@
<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd">
<svg width="100%" height="100%" viewBox="0 0 2031 2071" version="1.1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" xml:space="preserve" style="fill-rule:evenodd;clip-rule:evenodd;stroke-linecap:square;stroke-linejoin:round;stroke-miterlimit:1.41421;">
<g transform="matrix(1,0,0,1,-192,-982)">
<g id="Main-Plot">
<g>
<g id="Grille">
<g transform="matrix(1.1808,0,0,1,-75.4118,0)">
<g transform="matrix(1,0,0,1.31073,-19.234,-172.262)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,975.279)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,811.344)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,647.41)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,1303.15)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,319.541)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,155.607)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,-8.32717)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,1139.21)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,483.476)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
</g>
<g transform="matrix(3.34494e-16,1.1808,-1,2.83277e-16,3205.71,544.557)">
<g transform="matrix(1,0,0,1.31073,-19.234,-172.262)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,975.279)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,811.344)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,647.41)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,1303.15)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,319.541)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,155.607)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,-8.32717)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,1139.21)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
<g transform="matrix(1,0,0,1.31073,-19.234,483.476)">
<path d="M436.328,1027.97L1919.68,1027.97" style="fill:none;stroke-width:50.1px;stroke:rgb(181,181,181);"/>
</g>
</g>
</g>
</g>
<g id="Manhattan-distance">
<g transform="matrix(1.01074,0,0,1.02216,-24.6851,-56.3204)">
<clipPath id="_clip1">
<path d="M1863.49,1501.96L718.479,1502.83L720.193,2321.91"/>
</clipPath>
<g clip-path="url(#_clip1)">
<g transform="matrix(0.989373,0,0,0.978321,24.4228,55.0994)">
<path d="M731.553,2320.07L1041.96,2321.26L1869.39,1502.84" style="fill:none;stroke-width:20.83px;stroke:rgb(239,159,75);"/>
</g>
</g>
<path d="M1863.49,1501.96L718.479,1502.83L720.193,2321.91" style="fill:none;stroke-width:20.5px;stroke:rgb(239,159,75);"/>
</g>
<g transform="matrix(1,0,0,1,-8.23449,-149.065)">
<path d="M745.363,2464.19L745.61,1981.62L894.445,1981.51L893.831,1816.25L1221.66,1817.42L1222.61,1674.94L1870.55,1673.53" style="fill:none;stroke-width:20.83px;stroke:rgb(239,159,75);"/>
</g>
</g>
<g id="Euclidean-distance" transform="matrix(0.703395,-0.510486,0.510486,0.703395,-942.486,881.423)">
<g transform="matrix(-1.21281,-1.91042e-15,-5.1683e-15,18.1142,3042.18,-42457.3)">
<path d="M723.133,2480.78L2039.58,2480.04" style="fill:none;stroke-width:1.87px;stroke:rgb(31,146,28);"/>
</g>
<g transform="matrix(1.73227,-8.453e-16,7.24543e-16,1.73227,700.347,-1893.39)">
<text x="183.268px" y="2487.83px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Euclidean distance</text>
</g>
<g transform="matrix(1.40197,1.01747,-1.01747,1.40197,3635.4,-1896.41)">
<text x="183.268px" y="2487.83px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Manhattan distance</text>
</g>
<g transform="matrix(1.70572,-0.302138,0.302138,1.70572,92.3532,-1423.68)">
<text x="183.268px" y="2487.83px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Chebyshev distance</text>
</g>
</g>
<g transform="matrix(1,0,0,1,-7.03869,-1.75967)">
<path d="M1869.12,1514.53L1052.81,2325.83L741.235,2322.67" style="fill:none;stroke-width:20.83px;stroke-linecap:butt;stroke:rgb(201,0,157);"/>
</g>
<g id="Point-B" transform="matrix(1,0,0,1,330.868,1784.29)">
<g transform="matrix(1,0,0,1,2.98908,0)">
<ellipse cx="381.618" cy="545.025" rx="28.788" ry="32.295" style="fill:rgb(235,235,235);stroke-width:62.5px;stroke:rgb(0,19,255);"/>
</g>
<g transform="matrix(2.92627,0,0,2.04123,-334.325,-1052.74)">
<text x="229.007px" y="733.807px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">A</text>
</g>
</g>
<g id="Point-B1" transform="matrix(1,0,0,1,1080.14,962.633)">
<g transform="matrix(1,0,0,1,402.614,0)">
<ellipse cx="381.618" cy="545.025" rx="28.788" ry="32.295" style="fill:rgb(235,235,235);stroke-width:62.5px;stroke:rgb(255,0,6);"/>
</g>
<g transform="matrix(2.92627,0,0,2.04123,65.3005,-1052.74)">
<text x="229.007px" y="733.807px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">B</text>
</g>
</g>
<g id="Coordinates">
<g id="B">
<g id="Xb">
<g id="Xb1" transform="matrix(1.40046e-16,-2.28712,1,6.12323e-17,-458.914,3473.11)">
<path d="M254.53,2321.59L898.365,2321.59" style="fill:none;stroke-width:5.9px;stroke-linecap:butt;stroke-dasharray:5.9,5.9,5.9,0;stroke:black;"/>
</g>
<g transform="matrix(20.9725,0,1.97215e-31,20.9725,-12015.1,-59666.6)">
<text x="658.77px" y="2988.33px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:6.548px;fill:black;">x</text>
<text x="662.044px" y="2990.51px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:3.817px;fill:black;">B</text>
</g>
</g>
<g id="Yb">
<g id="Yb1" transform="matrix(2.53289,0,0,0.949467,-314.832,-697.08)">
<path d="M254.53,2321.59L898.365,2321.59" style="fill:none;stroke-width:5.45px;stroke-linecap:butt;stroke-dasharray:5.45,5.45,5.45,0;stroke:black;"/>
</g>
<g transform="matrix(20.9725,0,1.97215e-31,20.9725,-13626.2,-61124.7)">
<text x="658.77px" y="2988.33px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:6.548px;fill:black;">y</text>
<text x="662.044px" y="2990.51px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:3.817px;fill:black;">B</text>
</g>
</g>
</g>
<g id="A">
<g id="Ya">
<g id="Ya1" transform="matrix(0.865442,-6.16298e-33,0,1,109.585,4.54747e-13)">
<path d="M254.53,2321.59L898.365,2321.59" style="fill:none;stroke-width:11.14px;stroke-linecap:butt;stroke-dasharray:11.14,11.14,11.14,0;stroke:black;"/>
</g>
<g transform="matrix(20.9725,0,0,20.9725,-13626.2,-60326.8)">
<text x="658.77px" y="2988.33px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:6.548px;fill:black;">y</text>
<text x="662.044px" y="2990.51px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:3.817px;fill:black;">A</text>
</g>
</g>
<g id="Xa">
<g id="Xa1" transform="matrix(6.08856e-17,-0.994338,1,6.12323e-17,-1605.05,3144.05)">
<path d="M254.53,2321.59L898.365,2321.59" style="fill:black;stroke-width:10.45px;stroke-linecap:butt;stroke-dasharray:10.45,10.45,10.45,0;stroke:black;"/>
</g>
<g transform="matrix(20.9725,0,0,20.9725,-13160.4,-59666.6)">
<text x="658.77px" y="2988.33px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:6.548px;fill:black;">x</text>
<text x="662.044px" y="2990.51px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:3.817px;fill:black;">A</text>
</g>
</g>
</g>
</g>
</g>
</g>
</svg>

After

Width:  |  Height:  |  Size: 12 KiB

@@ -0,0 +1,108 @@
<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd">
<svg width="100%" height="100%" viewBox="0 0 2021 852" version="1.1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" xml:space="preserve" style="fill-rule:evenodd;clip-rule:evenodd;stroke-linecap:round;stroke-linejoin:round;stroke-miterlimit:1.41421;">
<g transform="matrix(1,0,0,1,-187,-683)">
<g>
<g>
<g transform="matrix(0.824429,0,0,0.824429,40.8885,111.226)">
<rect x="195.263" y="711.481" width="997.627" height="997.627" style="fill:rgb(235,235,235);stroke-width:20.22px;stroke:black;"/>
</g>
<g>
<g transform="matrix(1,0,0,1,324.539,-65.9235)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(248,0,230);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-62.3224,-805.515)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">B</text>
</g>
</g>
<g>
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(82,110,255);"/>
<g transform="matrix(1.76539,0,0,1.76539,-386.861,-739.592)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">A</text>
</g>
</g>
<g>
<g transform="matrix(1,0,0,1,291.652,223.089)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(109,255,87);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-97.6439,-516.503)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">D</text>
</g>
</g>
<g transform="matrix(1,0,0,1,-17.2537,10.505)">
<text x="245.684px" y="752.356px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Environment 1</text>
</g>
<g>
<g transform="matrix(1,0,0,1,-9.40327,285.266)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(255,255,49);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-398.699,-454.326)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">C</text>
</g>
</g>
</g>
<g>
<g transform="matrix(0.824429,0,0,0.824429,1209.24,111.226)">
<rect x="195.263" y="711.481" width="997.627" height="997.627" style="fill:rgb(235,235,235);stroke-width:20.22px;stroke:black;"/>
</g>
<g transform="matrix(0.333632,0,0,0.333632,1745.99,939.675)">
<g transform="matrix(1,0,0,1,324.539,-65.9235)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(80,254,255);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-62.3224,-805.515)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">G</text>
</g>
</g>
<g transform="matrix(1,0,0,1,1165.64,10.505)">
<text x="245.684px" y="752.356px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Environment 2</text>
</g>
<g transform="matrix(0.333632,0,0,0.333632,1563.39,529.401)">
<g transform="matrix(1,0,0,1,324.539,-65.9235)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(248,0,230);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-62.3224,-805.515)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">B</text>
</g>
</g>
<g transform="matrix(0.333632,0,0,0.333632,1745.51,807.014)">
<g transform="matrix(1,0,0,1,324.539,-65.9235)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(255,201,226);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-62.3224,-805.515)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">F</text>
</g>
</g>
<g transform="matrix(0.333632,0,0,0.333632,1711.84,590.465)">
<g transform="matrix(1,0,0,1,324.539,-65.9235)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(255,95,111);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-62.3224,-805.515)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">E</text>
</g>
</g>
<g transform="matrix(1.74862,0,0,1.74862,827.639,-680.448)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(82,110,255);"/>
<g transform="matrix(1.76539,0,0,1.76539,-386.861,-739.592)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">A</text>
</g>
</g>
<g transform="matrix(0.468295,0,0,0.468295,1493.29,758.779)">
<g transform="matrix(1,0,0,1,291.652,223.089)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(109,255,87);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-97.6439,-516.503)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">D</text>
</g>
</g>
<g transform="matrix(0.311548,0,0,0.311548,1336.31,890.508)">
<g transform="matrix(1,0,0,1,-9.40327,285.266)">
<ellipse cx="477.16" cy="995.163" rx="110.023" ry="109.093" style="fill:rgb(255,255,49);"/>
</g>
<g transform="matrix(1.76539,0,0,1.76539,-398.699,-454.326)">
<text x="472.748px" y="995.259px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">C</text>
</g>
</g>
</g>
</g>
</g>
</svg>

After

Width:  |  Height:  |  Size: 7.1 KiB

@@ -0,0 +1,66 @@
<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd">
<svg width="100%" height="100%" viewBox="0 0 1846 1637" version="1.1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" xml:space="preserve" style="fill-rule:evenodd;clip-rule:evenodd;stroke-linecap:round;stroke-linejoin:round;stroke-miterlimit:1.41421;">
<g transform="matrix(1,0,0,1,-105,-316)">
<g>
<g>
<g transform="matrix(3.56657,0,0,3.42572,-1715.29,-1858.59)">
<ellipse cx="815.464" cy="910.747" rx="208.192" ry="186.092" style="fill:rgb(235,235,235);stroke-width:4.77px;stroke:black;"/>
</g>
<g transform="matrix(2.37512,0,0,2.37512,-1050.26,-4483.8)">
<text x="805.445px" y="2617.15px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Environment</text>
</g>
</g>
<g>
<g transform="matrix(0.875323,0,0,0.814584,53.5525,-933.789)">
<ellipse cx="826.904" cy="2457.22" rx="238.262" ry="246.522" style="fill:rgb(142,255,140);stroke-width:19.71px;stroke:black;"/>
</g>
<g transform="matrix(2.01739,0,0,2.01739,-329.967,-4026.53)">
<text x="483.571px" y="2537.83px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Site <tspan x="580.861px " y="2537.83px ">A</tspan></text>
</g>
</g>
<g>
<g transform="matrix(0.875323,0,0,0.814584,495.154,-585.114)">
<ellipse cx="826.904" cy="2457.22" rx="238.262" ry="246.522" style="fill:rgb(255,178,148);stroke-width:19.71px;stroke:black;"/>
</g>
<g transform="matrix(2.01739,0,0,2.01739,126.222,-3672.28)">
<text x="483.571px" y="2537.83px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Site B</text>
</g>
</g>
<g>
<g transform="matrix(0.875323,0,0,0.814584,875.962,-933.789)">
<ellipse cx="826.904" cy="2457.22" rx="238.262" ry="246.522" style="fill:rgb(252,255,142);stroke-width:19.71px;stroke:black;"/>
</g>
<g transform="matrix(2.01739,0,0,2.01739,486.877,-4026.53)">
<text x="483.571px" y="2537.83px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">Site C</text>
</g>
</g>
<g transform="matrix(1.90555,0,0,1.90555,-1159.48,-204.501)">
<text x="1107.37px" y="318.159px" style="font-family:'STIXGeneral-Regular', 'STIXGeneral';font-size:65.598px;fill:black;">𝛂-div<tspan x="1253.72px " y="318.159px ">e</tspan>rsity</text>
</g>
<g transform="matrix(1.90555,0,0,1.90555,-2008.56,1318.74)">
<text x="1107.37px" y="318.159px" style="font-family:'STIXGeneral-Italic', 'STIXGeneral';font-style:italic;font-size:65.598px;fill:black;">𝛾</text>
<text x="1135.45px" y="318.159px" style="font-family:'STIXGeneral-Regular', 'STIXGeneral';font-size:65.598px;fill:black;">-div<tspan x="1239.55px " y="318.159px ">e</tspan>rsity</text>
</g>
<g transform="matrix(1.90555,0,0,1.90555,-1535.83,762.329)">
<text x="1107.37px" y="318.159px" style="font-family:'STIXGeneral-Italic', 'STIXGeneral';font-style:italic;font-size:50px;fill:black;">𝛽</text>
<text x="1132.02px" y="318.159px" style="font-family:'STIXGeneral-Regular', 'STIXGeneral';font-size:50px;fill:black;">-div<tspan x="1211.37px " y="318.159px ">e</tspan>rsity</text>
</g>
<g transform="matrix(-2.57949e-16,1.40421,-7.56783,-1.39019e-15,3559.03,56.614)">
<path d="M287.175,308.403L287.175,306.419L860.49,306.419L860.49,303.444L913.72,307.411L860.49,311.379L860.49,308.403L287.175,308.403Z" style="fill:black;stroke-width:0.69px;stroke:black;"/>
</g>
<g transform="matrix(-0.612613,0.844268,-6.71099,-4.86959,3409.58,1712.57)">
<path d="M287.175,308.403L287.175,306.419L835.211,306.419L835.211,303.444L913.72,307.411L835.211,311.379L835.211,308.403L287.175,308.403Z" style="fill:black;stroke-width:0.63px;stroke:black;"/>
</g>
<g transform="matrix(0.251261,-0.311578,5.89101,4.75059,-1333.11,417.689)">
<path d="M287.175,308.403L287.175,306.419L726.98,306.419L726.98,303.444L913.72,307.411L726.98,311.379L726.98,308.403L287.175,308.403Z" style="fill:black;stroke-width:0.7px;stroke:black;"/>
</g>
<g transform="matrix(0.437815,0.363403,-4.83348,5.8232,2225.37,-773.088)">
<path d="M418.542,308.403L418.542,311.379L287.175,307.411L418.542,303.444L418.542,306.419L782.353,306.419L782.353,303.444L913.72,307.411L782.353,311.379L782.353,308.403L418.542,308.403Z" style="fill:black;stroke-width:0.7px;stroke:black;"/>
</g>
<g transform="matrix(0.345195,0.841982,-6.44148,2.64087,3196.59,-594.14)">
<path d="M287.175,308.403L287.175,306.419L838.159,306.419L838.159,303.444L913.72,307.411L838.159,311.379L838.159,308.403L287.175,308.403Z" style="fill:black;stroke-width:0.76px;stroke:black;"/>
</g>
</g>
</g>
</svg>

After

Width:  |  Height:  |  Size: 5.4 KiB

@@ -0,0 +1,34 @@
<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd">
<svg width="100%" height="100%" viewBox="0 0 1502 1501" version="1.1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" xml:space="preserve" style="fill-rule:evenodd;clip-rule:evenodd;stroke-linecap:round;stroke-linejoin:round;stroke-miterlimit:1.41421;">
<g transform="matrix(1,0,0,1,-380,-775)">
<g transform="matrix(1,0,0,1.48478,0,-917.84)">
<path d="M775.395,1921.11L775.395,1913.9L1685.12,1913.9L1685.12,1893.32L1756.93,1917.5L1685.12,1941.69L1685.12,1921.11L775.395,1921.11Z" style="fill:rgb(0,1,2);"/>
</g>
<g transform="matrix(0.605804,-0.795614,1.18131,0.899484,-1951.37,817.912)">
<path d="M775.395,1921.11L775.395,1913.9L1685.12,1913.9L1685.12,1893.32L1756.93,1917.5L1685.12,1941.69L1685.12,1921.11L775.395,1921.11Z" style="fill:rgb(0,1,2);"/>
</g>
<g transform="matrix(3.8068,0,0,3.89337,-3178.36,-6714.08)">
<circle cx="1035.39" cy="2222.51" r="260.137" style="fill:none;stroke-width:0.87px;stroke-dasharray:0.87,3.46,0.87,0;stroke:black;"/>
</g>
<path d="M2051.47,1936.49L526.666,1926.49" style="fill:none;stroke-width:3.33px;stroke-dasharray:3.33,13.33,3.33,0;stroke:black;"/>
<g transform="matrix(6.12323e-17,-1,1,6.12323e-17,-1146.44,2711.11)">
<path d="M2051.47,1936.49L526.666,1926.49" style="fill:none;stroke-width:3.33px;stroke-dasharray:3.33,13.33,3.33,0;stroke:black;"/>
</g>
<path d="M1378.06,1143.23L1754.19,1928.24" style="fill:none;stroke-width:8.33px;stroke:rgb(253,36,0);"/>
<g transform="matrix(6.12323e-17,-1,1,6.12323e-17,-359.004,3304.88)">
<path d="M1378.06,1143.23L1754.19,1928.24" style="fill:none;stroke-width:8.33px;stroke-dasharray:8.33,33.33,8.33,0;stroke:rgb(253,36,0);"/>
</g>
<g transform="matrix(-3.81475e-16,-2.37218,2.37218,-3.81475e-16,-3006.71,2967.43)">
<path d="M437.279,1709.62C472.759,1709.62 506.172,1692.93 527.486,1664.57L437.279,1596.78L437.279,1709.62Z" style="fill:none;stroke-width:3.51px;stroke-dasharray:3.51,14.05,3.51,0;stroke:black;"/>
</g>
<g transform="matrix(1,0,0,1,-11.9118,184.176)">
<text x="1089.21px" y="1669.29px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">cos(</text>
<text x="1183.67px" y="1669.29px" style="font-family:'STIXGeneral-Regular', 'STIXGeneral';font-size:50px;fill:black;">𝛼</text>
<text x="1209.87px" y="1669.29px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">)=R</text>
</g>
<g transform="matrix(2.44125,0,0,1.95351,-2681.3,-1267.15)">
<text x="1776.48px" y="1492.45px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:rgb(255,76,31);">d</text>
</g>
</g>
</svg>

After

Width:  |  Height:  |  Size: 2.9 KiB

@@ -0,0 +1,32 @@
<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd">
<svg width="100%" height="100%" viewBox="0 0 1267 936" version="1.1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" xml:space="preserve" style="fill-rule:evenodd;clip-rule:evenodd;stroke-linecap:round;stroke-linejoin:round;stroke-miterlimit:1.41421;">
<g transform="matrix(1,0,0,1,-473,-887)">
<g id="metric" transform="matrix(1,0,0,1,85.1006,-84.2667)">
<g transform="matrix(1,0,0,1,0.196399,0)">
<path d="M520.389,1821.09L1554.35,1821.09" style="fill:none;stroke-width:1px;stroke:black;"/>
</g>
<g transform="matrix(6.12323e-17,-1,-1,-6.12323e-17,2858.39,2245.09)">
<path d="M1137.81,2034.33L423.607,2337.94L423.239,1303.71L1137.81,2034.33Z" style="fill:none;stroke-width:1px;stroke:black;"/>
</g>
<g transform="matrix(2.46916,0,0,2.46916,-1742.45,-175.128)">
<text x="1022.83px" y="500.74px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">C</text>
</g>
<g transform="matrix(2.46916,0,0,2.46916,-2137.03,670.818)">
<text x="1022.83px" y="500.74px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">A</text>
</g>
<g transform="matrix(2.46916,0,0,2.46916,-946.651,670.818)">
<text x="1022.83px" y="500.74px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">B</text>
</g>
<g transform="matrix(1,0,0,1,19.4596,34.2956)">
<circle cx="505.904" cy="1785.24" r="15.508" style="fill:rgb(255,120,60);stroke-width:3.33px;stroke:black;"/>
</g>
<g transform="matrix(1,0,0,1,1044.28,33.9027)">
<circle cx="505.904" cy="1785.24" r="15.508" style="fill:rgb(255,120,60);stroke-width:3.33px;stroke:black;"/>
</g>
<g transform="matrix(1,0,0,1,319.278,-679.347)">
<circle cx="505.904" cy="1785.24" r="15.508" style="fill:rgb(255,120,60);stroke-width:3.33px;stroke:black;"/>
</g>
</g>
</g>
</svg>

After

Width:  |  Height:  |  Size: 2.2 KiB

File diff suppressed because one or more lines are too long

After

Width:  |  Height:  |  Size: 408 KiB

@@ -0,0 +1,44 @@
<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd">
<svg width="100%" height="100%" viewBox="0 0 1267 1445" version="1.1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" xml:space="preserve" style="fill-rule:evenodd;clip-rule:evenodd;stroke-linecap:round;stroke-linejoin:round;stroke-miterlimit:1.41421;">
<g transform="matrix(1,0,0,1,-388,-463)">
<g id="Umtrametric">
<g transform="matrix(1,0,0,1,0.196399,0)">
<path d="M520.389,1821.09L1554.35,1821.09" style="fill:none;stroke-width:1px;stroke:black;"/>
</g>
<g transform="matrix(6.12323e-17,-1,-1,-6.12323e-17,2858.39,2245.09)">
<path d="M1554.35,1821.09L423.607,2337.94L423.239,1303.71L1554.31,1821" style="fill:none;stroke-width:1px;stroke:black;"/>
</g>
<g transform="matrix(2.46916,0,0,2.46916,-1532.55,-683.049)">
<text x="1022.83px" y="500.74px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">C</text>
</g>
<g transform="matrix(2.46916,0,0,2.46916,-2137.03,670.818)">
<text x="1022.83px" y="500.74px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">A</text>
</g>
<g transform="matrix(2.46916,0,0,2.46916,-946.651,670.818)">
<text x="1022.83px" y="500.74px" style="font-family:'ArialMT', 'Arial', sans-serif;font-size:50px;fill:black;">B</text>
</g>
<g transform="matrix(1,0,0,1,19.4596,34.2956)">
<circle cx="505.904" cy="1785.24" r="15.508" style="fill:rgb(255,120,60);stroke-width:3.33px;stroke:black;"/>
</g>
<g transform="matrix(1,0,0,1,1044.28,33.9027)">
<circle cx="505.904" cy="1785.24" r="15.508" style="fill:rgb(255,120,60);stroke-width:3.33px;stroke:black;"/>
</g>
<g transform="matrix(1,0,0,1,529.835,-1093.64)">
<circle cx="505.904" cy="1785.24" r="15.508" style="fill:rgb(255,120,60);stroke-width:3.33px;stroke:black;"/>
</g>
<g>
<path d="M740.104,1216.22L832.267,1257.12" style="fill:none;stroke-width:3.33px;stroke:black;"/>
<g transform="matrix(1,0,0,1,7,-17)">
<path d="M740.104,1216.22L832.267,1257.12" style="fill:none;stroke-width:3.33px;stroke:black;"/>
</g>
</g>
<g transform="matrix(-1,0,0,1,2071.79,-0.155385)">
<path d="M740.104,1216.22L832.267,1257.12" style="fill:none;stroke-width:3.33px;stroke:black;"/>
<g transform="matrix(1,0,0,1,7,-17)">
<path d="M740.104,1216.22L832.267,1257.12" style="fill:none;stroke-width:3.33px;stroke:black;"/>
</g>
</g>
</g>
</g>
</svg>

After

Width:  |  Height:  |  Size: 2.9 KiB

@@ -0,0 +1,60 @@
%% This BibTeX bibliography file was created using BibDesk.
%% http://bibdesk.sourceforge.net/
%% Created for Eric Coissac at 2018-10-18 14:52:51 +0200
%% Saved with string encoding Unicode (UTF-8)
@article{Tsallis:94:00,
Author = {Tsallis, Constantino},
Date-Added = {2018-10-18 14:52:41 +0200},
Date-Modified = {2018-10-18 14:52:49 +0200},
Journal = {Quim. Nova},
Number = 6,
Pages = {468--471},
Title = {What are the numbers that experiments provide},
Volume = 17,
Year = 1994}
@ARTICLE{Whittaker:10:00,
title = "Meta-analyses and mega-mistakes: calling time on meta-analysis
of the species richness-productivity relationship",
author = "Whittaker, Robert J",
abstract = "The form of the species richness-productivity relationship
(SRPR) is both theoretically important and contentious. In an
effort to distill general patterns, ecologists have undertaken
meta-analyses, within which each SRPR data set is first
classified into one of five alternative forms: positive, humped
(unimodal), negative, U-shaped (unimodal), and no relationship.
Herein, I first provide a critique of this approach, based on 68
plant data sets/ studies used in three meta-analyses published
in Ecology. The meta-analyses are shown to have resulted in
highly divergent outcomes, inconsistent and often highly
inappropriate classification of data sets, and the introduction
and multiplication of errors from one meta-analysis to the next.
I therefore call on the ecological community at large to adopt a
far more rigorous and critical attitude to the use of
meta-analysis. Second, I develop the argument that the
literature on the SRPR continues to be bedeviled by a common
failing to appreciate the fundamental importance of the scale of
analysis, beginning with the confusion evident between concepts
of grain, focus, and extent. I postulate that variation in the
form of the SRPR at fine scales of analysis owes much to
artifacts of the sampling regime adopted. An improved
understanding may emerge from combining sampling theory with an
understanding of the factors controlling the form of species
abundance distributions and species accumulation curves.",
journal = "Ecology",
publisher = "Eco Soc America",
volume = 91,
number = 9,
pages = "2522--2533",
month = sep,
year = 2010
}