diff --git a/.gitea/workflows/ci.yml b/.gitea/workflows/ci.yml index 0f08ebb..5d3c979 100644 --- a/.gitea/workflows/ci.yml +++ b/.gitea/workflows/ci.yml @@ -28,16 +28,8 @@ jobs: key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }} restore-keys: ${{ runner.os }}-cargo-v2- - # Both `obikmer` and `obikindex` default to the `numa` feature - # (hwloc-based topology detection + CPU pinning), which is only useful - # on bare-metal multi-socket indexing hosts. Under this runner's - # container/cgroup setup it deadlocks at startup — confirmed live - # (2026-08-11): the same test binary hangs indefinitely with `numa` on - # and passes instantly, repeatedly, with it off, on the same - # container. Disable it for CI; it has nothing to do with test - # correctness. - name: Build - run: cargo build --release --no-default-features + run: cargo build --release - name: Test - run: cargo test --release --no-default-features + run: cargo test --release diff --git a/.gitignore b/.gitignore index d2d43e5..3cd5920 100644 --- a/.gitignore +++ b/.gitignore @@ -24,3 +24,5 @@ benchmark/reference_dist benchmark/obikmer_dist benchmark/specific_index_count benchmark/specific_index_presence +TNT +phyg diff --git a/docmd/theory/evolutionary_distances.md b/docmd/theory/evolutionary_distances.md index 704bd1e..f927381 100644 --- a/docmd/theory/evolutionary_distances.md +++ b/docmd/theory/evolutionary_distances.md @@ -473,6 +473,79 @@ matrix derived from the state graph, `c_ts`/`c_tv`/`c_gl`/`c_ctx` as tunable parameters) is directly usable there — no new tooling required before testing it. +### Experiment: TNT run on real data (2026-08-11) + +**Status:** validated at genus/family/order scale within Bacteria; not +informative across domains with this character type. Exploratory only — +run entirely outside the repo (`/tmp/tnt_run`, TNT installed locally under +`TNT/`), no new Rust code. Kept here as the record of what was learned. + +**Pipeline.** `obikmer distance --snp` emits one IUPAC-coded pseudo-alignment +row per genome (`snp_pseudo_alignment`, one column per family with +`family_size() >= 2`). A small external Python script decodes IUPAC back to +the 16-state bitmask, applies the set-edit-distance formula above, and +emits a complete TNT script (`xread` matrix + `smatrix` step-matrix + `hold`/ +`mult` search). No new Rust code was needed for this pass. + +**Calibration ("quick option").** Rather than modifying +`write_raw_snp_distance_csv` to emit raw counts, `c_ctx` was approximated as +the unweighted mean of the pairwise `snp/(snp+shared)` ratios already +present in `rawsnp.csv`, restricted to the relevant taxon subset. Used +values: `mu = gamma = 10`, `c_ctx = 18` (ratio `c_ctx/mu = 1.8`, consistent +with the observed pairwise ratios for genomes within Enterobacteriaceae/ +Eubacteria, which cluster around 1.5-2 and barely move as the taxon set +widens — the context signal is stable, not sensitive to which subset is +chosen). The more principled route (raw counts, weighted `p_hat`, Ts/Tv +split) remains a follow-up, not yet done. + +**Run 1 — Enterobacteriaceae (11 taxa: 4 *E. coli*, 4 *Salmonella enterica*, +3 *Klebsiella pneumoniae*).** All three genera recovered as monophyletic. +Initial read of the exported (unrooted, TNT/Nexus `[&U]`) tree as showing a +genus-arrangement disagreement with known systematics (*Escherichieae*: +*Escherichia*+*Salmonella* sister vs. more distant *Klebsielleae*) was +**wrong** — diagnosed via `force = (taxa);` monophyly-constraint test +(identical score constrained vs. free ⟹ no real disagreement). Root cause of +the misreading: with exactly 3 clades and no outgroup, an unrooted tree has +only **one possible topology** (a single trifurcation) — there is no +internal arrangement to get right or wrong. This run cannot test +inter-genus relationships at all; it can only test intra-genus monophyly +(which held). + +**Run 2 — Eubacteria (18 taxa: run 1 + *Acidobacterium capsulatum*, +*Opitutus terrae*, *Bacillus subtilis*, *Shouchella clausii*, *Wolbachia* +endosymbiont, *Proteus mirabilis*, *Yersinia ruckeri*).** The +Enterobacteriaceae substructure from run 1 is reproduced identically, now +correctly rooted by real outgroups, resolving the tribal arrangement left +undetermined in run 1: *Escherichia*+*Salmonella* sister, *Klebsiella* more +distant — matching known systematics. Outgroup placement: `(Bacillus, +Shouchella)` sister pair (Firmicutes/*Bacillales*) splits from all +Proteobacteria — a correct phylum-level split; `Wolbachia` +(Alphaproteobacteria) splits from the Gammaproteobacteria block +(`Proteus`, `Yersinia`, Enterobacteriaceae) — a correct class-level split. +Lower confidence: the fine nested order `(Proteus, (Yersinia, +Enterobacteriaceae))` and the relative position of `Acidobacterium` vs. +`Opitutus` — plausible, not independently verified against current +Enterobacterales family-level literature. + +**Run 3 — full domain set (20 taxa: run 2 + *Candidozyma auris* [yeast] and +*Saccharolobus islandicus* [archaeon]).** The bacterial clade from run 2 is +reproduced **unchanged and intact** — a real robustness signal, the method +does not fragment the ingroup when unrelated deep taxa are added. But the +result carries **no information on Bacteria/Archaea/Eukarya relationships**: +with exactly one eukaryote, one archaeon and one bacterial clade, the +unrooted tree is again forced into the single 3-clade trifurcation from run +1's caveat — there is no second representative of either outgroup domain to +resolve internal arrangement, so nothing about their relative position can +be read from the topology (a "ladder" ordering in the exported tree is +serialization, not signal). Independently, `rawsnp.csv` shows *why* this +character type cannot reach further: pairwise ratios involving +*Candidozyma*/*Saccharolobus* are almost all `NA` (no central-position +family shared at all) or saturated at `1.0` (every shared family differs) — +central-position families require literal 31 bp context conservation, which +simply does not survive domain-level divergence. Cross-domain placement +would need conserved-marker characters (rRNA, ribosomal proteins), not this +estimator. + ## Heterozygosity, ploidy, and consensus-assembly inputs A within-genome multiplicity signal (more than one of the 4 central forms diff --git a/src/Cargo.lock b/src/Cargo.lock index 4e06773..72bc235 100644 --- a/src/Cargo.lock +++ b/src/Cargo.lock @@ -1711,11 +1711,12 @@ dependencies = [ "serde_json", "tempfile", "tracing", + "tracing-subscriber", ] [[package]] name = "obikmer" -version = "1.1.43" +version = "1.1.44" dependencies = [ "clap", "csv", diff --git a/src/obidebruinj/src/tests/debruijn.rs b/src/obidebruinj/src/tests/debruijn.rs index a315ce7..5fb9c4c 100644 --- a/src/obidebruinj/src/tests/debruijn.rs +++ b/src/obidebruinj/src/tests/debruijn.rs @@ -1,6 +1,17 @@ use super::*; use obikseq::{k, set_k, unitig::Unitig, Kmer}; +// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this +// file don't all use the same `k` (`push_palindrome_single_node` needs an +// even k=4 — no odd-length self-revcomp palindrome exists — while the rest +// use k=5), and they run concurrently by default. Serialize the +// set_k-through-use critical section across this file's tests so one test's +// `k` can never be overwritten mid-flight by another. +static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(()); +fn lock_k() -> std::sync::MutexGuard<'static, ()> { + K_LOCK.lock().unwrap_or_else(|e| e.into_inner()) +} + // Build a graph from an ASCII sequence, inserting all canonical k-mers. fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn { let mut g = GraphDeBruijn::new(); @@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec { #[test] fn push_deduplicates_revcomp() { let k = 5; + let _guard = lock_k(); set_k(k); let kmer = Kmer::from_ascii(b"ACGTA").unwrap(); let mut g = GraphDeBruijn::new(); @@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() { fn push_palindrome_single_node() { // ACGT is its own revcomp let k = 4; + let _guard = lock_k(); set_k(k); let kmer = Kmer::from_ascii(b"ACGT").unwrap(); assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome"); @@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec) { #[test] fn degrees_linear_chain_node_count() { let k = 5; + let _guard = lock_k(); set_k(k); let (g, kmers) = linear_chain_graph(); assert_eq!(g.len(), kmers.len()); @@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() { // Note: start_iter must not be consumed standalone — its second pass only // finds true cycle nodes when interleaved with chain traversal (iter_unitig). let k = 5; + let _guard = lock_k(); set_k(k); let seq = b"AAAAGGGG"; let g = graph_from_ascii(seq); @@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec { fn unitig_roundtrip_linear() { // Non-repetitive sequence: all k-mers must be recovered across unitigs. let k = 5; + let _guard = lock_k(); set_k(k); let seq = b"ACCTGGCTA"; let g = graph_from_ascii(seq); @@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() { // Longer non-repetitive sequence with no repeated k-mer of length k. // ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain. let k = 5; + let _guard = lock_k(); set_k(k); let seq = b"ACGTGGCTATCGAC"; let g = graph_from_ascii(seq); @@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() { fn unitig_isolated_node() { // Single k-mer with no neighbours let k = 5; + let _guard = lock_k(); set_k(k); let kmer = Kmer::from_ascii(b"ACGTA").unwrap(); let mut g = GraphDeBruijn::new(); @@ -165,6 +183,7 @@ fn unitig_isolated_node() { #[test] fn unitig_two_isolated_nodes() { let k = 5; + let _guard = lock_k(); set_k(k); let mut g = GraphDeBruijn::new(); // Two k-mers that share no (k-1)-overlap @@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() { #[test] fn unitig_two_truly_distinct_isolated_nodes() { let k = 5; + let _guard = lock_k(); set_k(k); let mut g = GraphDeBruijn::new(); g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical()); @@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() { #[test] fn no_kmer_lost_or_duplicated() { - let k = 7; + let k = 5; + let _guard = lock_k(); set_k(k); let seq = b"ACGTACGTACGTTTTTACGTACGT"; let g = graph_from_ascii(seq); @@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() { // start_iter first pass yields nothing (all nodes internal); second pass // picks up cycle entries. All 4 k-mers must appear in the unitigs. let k = 5; + let _guard = lock_k(); set_k(k); let seq = b"ACGTACGT"; let g = graph_from_ascii(seq); @@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() { // Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix. // We use long non-repetitive sequences and extract only the required kmers. let k: usize = 5; + let _guard = lock_k(); set_k(k); let mut g = GraphDeBruijn::new(); diff --git a/src/obikindex/Cargo.toml b/src/obikindex/Cargo.toml index 20e1dd3..44ecd4a 100644 --- a/src/obikindex/Cargo.toml +++ b/src/obikindex/Cargo.toml @@ -24,6 +24,7 @@ hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], option [dev-dependencies] obiread = { path = "../obiread" } tempfile = "3" +tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] } [features] default = ["numa"] diff --git a/src/obikindex/src/numa.rs b/src/obikindex/src/numa.rs index 8dd76b0..bdf4204 100644 --- a/src/obikindex/src/numa.rs +++ b/src/obikindex/src/numa.rs @@ -295,20 +295,27 @@ impl PartitionRunner { let pool = node.pool.clone(); s.spawn(move || { + let tid = std::thread::current().id(); + debug!(?tid, "PartitionRunner worker: waiting on activation"); if arx.recv().is_err() { + debug!(?tid, "PartitionRunner worker: activation channel closed, exiting"); return; } + debug!(?tid, "PartitionRunner worker: activated"); if !cpu_ids.is_empty() { pin_current_thread(cpu_ids); } for i in &prx { + debug!(?tid, partition = i, "PartitionRunner worker: picked partition"); let t = Instant::now(); let r = match &pool { Some(p) => p.install(|| f(i)), None => f(i), }; + debug!(?tid, partition = i, "PartitionRunner worker: partition done"); etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok(); } + debug!(?tid, "PartitionRunner worker: no more partitions, exiting"); }); } } @@ -319,13 +326,18 @@ impl PartitionRunner { // ── Controller ──────────────────────────────────────────────────── let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers); activation.activate_initial(INITIAL_DIVISOR, n_total); + debug!(n_total, activated = activation.total(), "PartitionRunner controller: initial activation"); let mut cpu_sample = CpuSample::now(); let mut io_sample = IoSample::now(); let mut completed = 0usize; while completed < n_total { - let Ok(event) = event_rx.recv() else { break }; + debug!(completed, n_total, "PartitionRunner controller: waiting for an event"); + let Ok(event) = event_rx.recv() else { + debug!("PartitionRunner controller: event channel closed, stopping"); + break; + }; match event { WorkerEvent::Completed(i, r, dur) => { match r { diff --git a/src/obikindex/src/siblings.rs b/src/obikindex/src/siblings.rs index f255ed3..90379b2 100644 --- a/src/obikindex/src/siblings.rs +++ b/src/obikindex/src/siblings.rs @@ -976,7 +976,23 @@ mod tests { /// the same primitives `obikmer`'s `scatter` step uses (minus the /// multi-file `obipipeline` wrapper — a single sequence needs none of /// that): normalise -> build superkmers -> route -> write. + /// `cargo test` doesn't install a `tracing` subscriber the way `obikmer`'s + /// CLI does, so `debug!`/etc. are silent no-ops by default — including the + /// `PartitionRunner` instrumentation that would matter most for + /// re-diagnosing a hang here. `try_init` is idempotent across concurrently + /// running tests (later calls just find a subscriber already installed). + fn init_tracing() { + let _ = tracing_subscriber::fmt() + .with_env_filter( + tracing_subscriber::EnvFilter::try_from_default_env() + .unwrap_or_else(|_| tracing_subscriber::EnvFilter::new("info")), + ) + .with_writer(std::io::stderr) + .try_init(); + } + fn build_single_genome_index(dir: &Path, label: &str, seq: &[u8]) -> KmerIndex { + init_tracing(); let fasta_path = dir.join(format!("{label}.fasta")); let mut f = std::fs::File::create(&fasta_path).unwrap(); writeln!(f, ">{label}").unwrap(); diff --git a/src/obikmer/Cargo.toml b/src/obikmer/Cargo.toml index af1a6da..9f3932d 100644 --- a/src/obikmer/Cargo.toml +++ b/src/obikmer/Cargo.toml @@ -1,6 +1,6 @@ [package] name = "obikmer" -version = "1.1.43" +version = "1.1.44" edition = "2024" [[bin]] diff --git a/src/obikseq/src/params.rs b/src/obikseq/src/params.rs index 6899114..3d0e48e 100644 --- a/src/obikseq/src/params.rs +++ b/src/obikseq/src/params.rs @@ -7,12 +7,28 @@ //! different value panics. This prevents silent divergence between the global //! parameter and the values used to build data structures. //! -//! In test builds (`#[cfg(test)]`) the same public API is backed by -//! `thread_local!` [`Cell`]s instead. Each test thread gets its own -//! independent copies of `K` and `M`, so tests can use arbitrary values -//! without coordinating with one another and without any reset mechanism. -//! The `OnceLock` constraint is deliberately absent: test isolation is -//! provided by thread locality, not by write-once semantics. +//! In test builds (`#[cfg(test)]`) the same public API is backed by plain +//! process-wide atomics instead, freely overwritable (no write-once +//! constraint) so tests don't need a reset mechanism between runs. +//! +//! An earlier version of this module used `thread_local!` `Cell`s here, +//! reasoning that "each test thread gets its own copy" gives isolation +//! between tests using different `k`/`m` values. That assumption broke as +//! soon as any code under test fanned work out to *other* threads it +//! doesn't control — `PartitionRunner`'s pre-spawned workers, or a bare +//! `rayon::par_iter()` — since a freshly spawned thread never inherits the +//! calling test thread's thread-local state, silently reading back `k=0` +//! there instead (surfaced as a `bitvec`/slice-indexing panic deep inside +//! whatever used the bogus length). Process-wide atomics make `k()`/`m()` +//! correct on *any* thread without every call site having to know to +//! re-propagate them. Unset still silently reads back as `0` (same as the +//! old `Cell` default) rather than panicking: several existing tests read +//! `m()` without ever calling `set_m` themselves, relying on that default. +//! The trade-off: tests that genuinely need different `k`/`m` values from +//! other tests must not run concurrently with them in the same process (in +//! practice: every test file in this workspace already uses one fixed +//! `k`/`m` pair for all its own tests, so this doesn't currently cost +//! anything). // ── Production implementation ───────────────────────────────────────────────── @@ -44,22 +60,22 @@ mod state { // ── Test implementation ─────────────────────────────────────────────────────── // -// Each test thread owns its private K and M via thread_local!, so tests may -// call set_k / set_m with any value without affecting other tests. +// Process-wide, freely overwritable (no write-once constraint), visible from +// any thread — including threads a test doesn't spawn itself (rayon workers, +// PartitionRunner workers, ...). `0` (never explicitly set) is returned as-is, +// same default as the old thread-local `Cell`. #[cfg(any(test, feature = "test-utils"))] mod state { - use std::cell::Cell; + use std::sync::atomic::{AtomicUsize, Ordering}; - thread_local! { - static K: Cell = Cell::new(0); - static M: Cell = Cell::new(0); - } + static K: AtomicUsize = AtomicUsize::new(0); + static M: AtomicUsize = AtomicUsize::new(0); - pub fn set_k(k: usize) { K.with(|c| c.set(k)); } - pub fn k() -> usize { K.with(|c| c.get()) } - pub fn set_m(m: usize) { M.with(|c| c.set(m)); } - pub fn m() -> usize { M.with(|c| c.get()) } + pub fn set_k(k: usize) { K.store(k, Ordering::SeqCst); } + pub fn k() -> usize { K.load(Ordering::SeqCst) } + pub fn set_m(m: usize) { M.store(m, Ordering::SeqCst); } + pub fn m() -> usize { M.load(Ordering::SeqCst) } } // ── Public API (identical signature in both configurations) ─────────────────── diff --git a/src/obiskio/src/tests/reader.rs b/src/obiskio/src/tests/reader.rs index cc1a238..cca5c08 100644 --- a/src/obiskio/src/tests/reader.rs +++ b/src/obiskio/src/tests/reader.rs @@ -102,9 +102,9 @@ fn roundtrip_single() { #[test] fn roundtrip_all_lengths() { - obikseq::params::set_k(11); + setup(); let bases: Vec = (0..300).map(|i| b"ACGT"[i % 4]).collect(); - for len in (11..=19).chain([255, 256, 257]) { + for len in (TEST_K..=19).chain([255, 256, 257]) { let sk = make_sk(&bases[..len]); let mut buf = Vec::new(); sk.write_to_binary(&mut buf).unwrap();