diff --git a/README.md b/README.md index fbcf12d..1dc4d21 100644 --- a/README.md +++ b/README.md @@ -1 +1,107 @@ -toto +# obikmer + +`obikmer` is a Rust toolkit for indexing, querying, and comparing DNA sequences +represented as sets of k-mers. It targets individual genome datasets (tens of +Gbases) with maximum efficiency in computation, memory, and disk usage. + +## Key principles + +**Compact k-mer encoding.** Each k-mer is stored in a `u64` at 2 bits/base. +k is odd, k ∈ [11, 31], fixed at runtime. The canonical form `min(kmer, revcomp(kmer))` +halves the effective space by collapsing both strands. + +**Superkmer-based partitioning.** Sequences are decomposed into superkmers — +maximal runs of k-mers sharing the same minimizer. Superkmers route naturally to +partitions via the minimizer hash, enabling partition-parallel indexing and querying +with no cross-partition communication. + +**Layered MPHF index.** Each partition holds a stack of layers. Each layer is a +minimal perfect hash function (MPHF) over the k-mers of one input genome, paired +with a per-genome presence/count matrix. Queries scatter k-mers to their partition, +probe each layer in order, and aggregate results. + +**Approximate indexing (Findere).** With `-z Z`, the index stores k-mers of size +`s = k − z + 1` instead of k. At query time, results are produced at size s, then +a per-genome sliding window of size z aggregates z consecutive s-mer hits into one +confirmed k-mer answer. This reduces the false-positive rate from `1/2^b` per s-mer +to `1/2^(b·z)` per k-mer, at the cost of z−1 unconfirmed positions at each sequence +break. The aggregation window spans the full query sequence, not individual superkmers, +to avoid false negatives at superkmer boundaries. + +**Multi-genome.** A single index can hold any number of genomes. Each k-mer slot +carries a per-genome count or presence vector. Distance matrices, NJ/UPGMA trees, +and classification are derived from these vectors without rebuilding the index. + +## Input formats + + Command Formats accepted + ─────────────────── ────────────────────────────────────────────────────────────── + index, superkmer FASTA (.fa .fasta), FASTQ (.fq .fastq), GenBank flat file + (.gb .gbk .gbff), all optionally gzip-compressed. + Directories expanded recursively. Streaming stdin via -. + query FASTA, FASTQ, optionally gzip-compressed. Stdin via -. + +Non-ACGT characters act as hard breaks between k-mer segments in all formats. + +## Commands + + Command Role + ───────── ──────────────────────────────────────────────────────────────────── + index Build a genome index from sequence files. + Runs scatter → dereplicate → count → layered MPHF. + Resumes automatically if interrupted. + merge Merge multiple independently built indexes into one. + rebuild Filter and compact an existing index: apply count thresholds, + drop layers, rewrite as a single-layer index. + reindex Convert evidence in-place across all layers: + exact (evidence.bin) ↔ approximate (fingerprint.bin). + Does not touch the MPHF or unitigs. + query Query an index with FASTA/FASTQ sequences. + Annotates each sequence with per-genome k-mer match counts + and optional per-position coverage vectors (--detail). + Parallel over sequence chunks. + distance Compute a pairwise Bray-Curtis or Jaccard distance matrix + between all indexed genomes. + Optionally outputs a Newick NJ or UPGMA tree. + annotate Add or update genome metadata (taxonomy, etc.) from a CSV + file; or dump the current metadata as CSV. + estimate Dry-run: resolve and print approximate-index parameters + (z, evidence bits b, FP rates) given any two of (b, z, fp). + Does not touch any index. + dump Dump all indexed k-mers as CSV with per-genome counts or + presence flags. + superkmer Extract superkmers from a sequence file and write to stdout. + Diagnostic / pipeline use. + unitig Dump the unitig sequences stored in a built index. Debug use. + utils Miscellaneous utilities. + --new-label NEW=OLD renames a genome label in-place. + +## Quick start + +```sh +# Build an exact index for two genomes +obikmer index --kmer-size 31 --label genome_a genome_a.fa --output index/ +obikmer index --kmer-size 31 --label genome_b genome_b.fa --output index/ + +# Convert to approximate index (z=5, 8-bit fingerprints) +obikmer reindex --approx -z 5 --evidence-bits 8 index/ + +# Query reads +obikmer query index/ reads.fq.gz > annotated.fa + +# Pairwise distances +obikmer distance index/ > distances.tsv +``` + +## Parameter constraints + + Parameter Constraint + ───────────────────── ────────────── + k (--kmer-size) odd, 11 ≤ k ≤ 31 + m (--minimizer-size) odd, 3 ≤ m ≤ k−1 + z (-z, --approx only) 1 ≤ z ≤ k−1 + +## Documentation + +Extended architecture and implementation notes are in `docmd/`. Build with +`make doc` (requires Python + MkDocs Material). diff --git a/TODO.md b/TODO.md index ceca1fe..9be40e6 100644 --- a/TODO.md +++ b/TODO.md @@ -24,3 +24,37 @@ Sauf qu'avec un index approximatif, les résultats seront approximatifs. --detail et --mismatch à implementer - status : affiche le statut de l'index + +## Problème biologique sur l'identification des contaminants + +Exemple de reads problématiques: +``` +>LH00534:161:22WMGWLT4:4:1101:45301:1420 {"coverage":{"gbbct":[1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1]},"kmer_count":117,"kmer_strict_matches":{"gbbct":117}} +GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGATTTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACGCTTGCATCCTCTGTATTACCGCGGCTGCTGG +``` + +Par blast match une quantité invréssemblable de genomes chloroplastique avec un match de 100% (6554 hits pour Streptophyta) + +mais aussi une quantité de sequences importantes à des OTU bactériennes (uncutured bacteria 115 hits) aussi avec 100% de similarité. + +``` + Uncultured bacterium clone Otu01032 16S ribosomal RNA gene, partial sequence +Sequence ID: KX996137.1Length: 440Number of Matches: 1 +Range 1: 153 to 303GenBankGraphics +Next Match +Previous Match +Alignment statistics for match #1 Score Expect Identities Gaps Strand +273 bits(302) 2e-69 151/151(100%) 0/151(0%) Plus/Minus + +Query 1 GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGAT 60 + |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| +Sbjct 303 GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGAT 244 + +Query 61 TTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACG 120 + |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| +Sbjct 243 TTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACG 184 + +Query 121 CTTGCATCCTCTGTATTACCGCGGCTGCTGG 151 + ||||||||||||||||||||||||||||||| +Sbjct 183 CTTGCATCCTCTGTATTACCGCGGCTGCTGG 153 +``` diff --git a/docmd/architecture/query.md b/docmd/architecture/query.md index f53896d..db37c6c 100644 --- a/docmd/architecture/query.md +++ b/docmd/architecture/query.md @@ -8,7 +8,7 @@ Given a set of query sequences, determine for each sequence how many of its k-me ## Input -- Query sequences in FASTA or FASTQ format (gzip supported, streaming stdin supported). +- Query sequences in FASTA or FASTQ format (gzip supported, streaming stdin supported). GenBank flat files are not supported at query time (only at index time). - Sequences shorter than k bases are silently skipped. - Non-ACGT characters are handled by the superkmer decomposition layer: they act as hard breaks, producing shorter superkmers (identical to the behaviour at indexing time). @@ -19,45 +19,50 @@ Given a set of query sequences, determine for each sequence how many of its k-me The query follows the same superkmer-based partitioning strategy used at indexing time. ``` -for each batch of sequences: - build QueryBatch: decompose all sequences into superkmers, deduplicate +for each chunk of sequences (parallel workers via obipipeline): + build QueryBatch: decompose all sequences into s-mers via superkmers, deduplicate + allocate seq_results[seq_idx][smer_pos] = None ← per-sequence s-mer result vectors split superkmers by partition via minimiser hash for each partition p: query_partition(p, superkmers_routed_to_p) → load QueryLayer(s) for p - → for each kmer in each superkmer: MphfLayer::find(kmer) - apply_findere(sk_kmer_results, effective_z) ← per superkmer - broadcast confirmed results back to each (seq_idx, kmer_offset) + → for each s-mer in each superkmer: MphfLayer::find(smer) + fill seq_results[seq_idx][kmer_offset + j] from partition results + for each sequence: + apply_findere(seq_results[seq_idx], effective_z) ← per full sequence + accumulate confirmed k-mer results into acc and cov emit annotated sequences ``` Superkmers that appear more than once in the batch (same sequence or across sequences) are deduplicated: each unique `RoutableSuperKmer` is queried once per partition, and the result is broadcast to every `SKDesc` entry that references it. -Parallelism is **not yet active** in the current implementation: batches are processed sequentially on a single thread despite the `--threads` flag being parsed. The `QueryBatch` / `split_by_partition` design is structured to support per-partition parallelism in a future iteration. +**Findere requires full-sequence aggregation.** `apply_findere` is applied once per sequence on the complete s-mer result vector, after all partitions have contributed. Applying it per superkmer would produce false negatives at superkmer boundaries, where the z-window spans two superkmers. + +Batches are processed in parallel via `obipipeline` workers; the `--threads` flag controls the number of worker threads. --- ## Findere z-window filter -For approximate and hybrid index modes, a raw k-mer hit is a positive from the fingerprint test with false-positive rate 1/2^b. The Findere scheme reduces the effective FP rate to 1/2^(b·z) by requiring **z consecutive k-mers** to all test positive before any of them is counted as a confirmed match. - -`apply_findere` implements this as a sliding-window confirmation, independently for each genome: +For approximate index modes, the index physically stores s-mers of size `s = k_user − z + 1`. At query time, `set_k(s)` is in effect, so queries naturally produce s-mer results. `apply_findere` then aggregates z consecutive s-mer results into one k_user-mer answer: ```rust fn apply_findere( - results: &[Option>], + results: &[Option>], // N s-mer results z: usize, n_genomes: usize, -) -> Vec>> +) -> Vec>> // N − z + 1 k_user-mer results ``` -For each genome g, a position i is confirmed if there exists at least one window of z consecutive positions `[j, j+z)` that contains i and where all z positions are present for g (i.e. `results[pos]` is `Some(row)` and `row[g] > 0`). The implementation uses a single O(n) sliding-window scan per genome. +Input length N (s-mers), output length N − z + 1 (k_user-mers). -Unconfirmed positions are zeroed in the returned row. If all genomes are zeroed for a position, it is returned as `None`. +For each genome g independently, a sliding window of size z scans the input. Output position i is confirmed for genome g iff all z values `results[i..i+z][g]` are nonzero (`None` counts as zero for all genomes). The scan is O(n) per genome. -**Short superkmers**: when a superkmer contains fewer than z k-mers, no complete z-window can be formed. Rather than discarding all results, `apply_findere` returns them unchanged (no filter applied). This avoids penalising legitimate short sequences near read ends. +Output values come from `results[i]` (leftmost s-mer of each window); genomes not confirmed are zeroed. If all genomes are zero, the position is returned as `None`. -**Exact indexes**: `z` is effectively 1 (every k-mer is its own window). `apply_findere` is a no-op. +**Short sequences**: when the s-mer count is less than z, no complete window can form — `apply_findere` returns an empty vector. K-mers from sequences shorter than k_user are not emitted. + +**Exact indexes**: `z = 1`, `apply_findere` is a passthrough (output length = input length). ### Effective z at query time @@ -105,20 +110,20 @@ genome_totals[g] += if presence { u32::from(v >= threshold) } else { v } ## Coverage vectors (`--detail`) -When `--detail` is requested, a 3-D accumulator `cov[seq_idx][genome][kmer_pos]` is allocated before the partition loop, with dimensions derived from `batch.n_kmers`: +When `--detail` is requested, a 3-D accumulator `cov[seq_idx][genome][kmer_pos]` is allocated after all partitions are queried, with dimensions derived from `n_kmers_out = n_smers − z + 1` (k_user-mer positions, not s-mer positions): ``` -cov[seq_idx][g][abs_pos] += contribution -where abs_pos = desc.kmer_offset + local_pos (absolute kmer position in the sequence) +cov[seq_idx][g][pos] += contribution +where pos is the k_user-mer index in the filtered (post-Findere) vector ``` -Coverage reflects confirmed k-mers only (post-Findere). The vectors are emitted in the JSON annotation under the key `"coverage"`. +Coverage reflects confirmed k_user-mers only. The vectors are emitted in the JSON annotation under the key `"coverage"`. --- ## `kmer_missing` semantics -`kmer_missing` counts k-mers that returned `None` from the index before Findere filtering — i.e. k-mers truly absent from every layer. K-mers that were found in the index but rejected by the z-window filter are not counted as missing. +`kmer_missing` counts k_user-mer positions where the first s-mer (`seq_results[seq_idx][pos]`) is `None` — i.e. absent from the index entirely. K-mers where the z-window fails because a later s-mer is absent or zero are not counted as missing (the first s-mer being present is used as proxy for index membership). --- @@ -151,7 +156,7 @@ Genome keys follow the iteration order of `meta.genomes`. | `kmer_strict_matches` | object | always | per-genome accumulated value (label → count or 0/1) | | `coverage` | object | `--detail` | per-genome array of per-position contributions (label → [u32]) | -`kmer_count + kmer_missing` ≤ total k-mers in the sequence. The gap (if any) corresponds to k-mers found in the index but rejected by the Findere z-window filter. +`kmer_count + kmer_missing` ≤ total k_user-mers in the sequence. The gap corresponds to k_user-mers whose z-window was not fully confirmed (at least one s-mer absent or zero for all genomes) but whose first s-mer was present in the index. --- @@ -171,7 +176,7 @@ obikmer query [--detail] [--mismatch] [--count-missing] | `--count-missing` | off | Add `kmer_missing` field to JSON | | `--force-presence` | off | Report 0/1 per genome regardless of index counts | | `--presence-threshold` | 1 | Minimum count to declare genome present | -| `-T` / `--threads` | all CPUs | Worker threads (parallelism not yet active) | +| `-T` / `--threads` | all CPUs | Worker threads | `--mismatch` is accepted but currently ignored with a warning on stderr. @@ -181,5 +186,4 @@ obikmer query [--detail] [--mismatch] [--count-missing] - **`--mismatch`**: 1-mismatch approximate matching — generate `3·k` single-substitution variants per k-mer, look each up independently. - **Read classification** (`--classify`): assign each read to the genome with the highest match score. -- **Parallelism**: activate per-partition or per-sequence worker threads using the already-parsed `--threads` value. - **Whitelist / blacklist filtering**: threshold-based accept/reject on per-genome match scores. diff --git a/docmd/implementation/evidence_elimination.md b/docmd/implementation/evidence_elimination.md index a7f3a18..eebf5be 100644 --- a/docmd/implementation/evidence_elimination.md +++ b/docmd/implementation/evidence_elimination.md @@ -35,15 +35,18 @@ stored at `s` belongs to the legitimate k-mer at that slot. The FP event is: P(FP per k-mer) = 1 / 2^b ``` -The Findere trick raises the effective window to z consecutive k-mers. A query -succeeds only when all z fingerprint checks pass, reducing the per-window FP rate: +The Findere trick reduces the indexed k-mer size. When the user specifies k_user +and z, the index physically stores k-mers of size `s = k_user − z + 1`. At query +time, the same s-mer size is used. After collecting per-position s-mer results +over the full query sequence, a sliding window of size z aggregates z consecutive +s-mer hits into one confirmed k_user-mer hit, reducing the per-window FP rate: ``` -P(FP per z-window) = 1 / 2^(b·z) +P(FP per k_user-mer) = 1 / 2^(b·z) ``` -The effective indexed k-mer length is `k − z + 1`: a query for a (k+z−1)-mer -decomposes into z overlapping k-mers, all of which must match. +`IndexConfig::kmer_size` stores `s = k_user − z + 1`, not k_user. Both indexing +and querying use this stored size via `set_k(idx.kmer_size())`. Parameters b and z are stored in `layer_meta.json` (`EvidenceKind::Approx { b, z }`). @@ -167,12 +170,12 @@ any index. It accepts the same `--evidence-bits`, `-z`, and `--fp` flags and additionally accepts `-k` to display the effective indexed k-mer length: ``` -k (query): 31 -k (indexed): 31 -z: 1 +k (user): 31 +k (indexed, s=k-z+1): 27 +z: 5 evidence bits (b): 8 -FP per k-mer: 3.906e-3 (1/2^8) -FP per z-window: 3.906e-3 (1/2^8) +FP per s-mer: 3.906e-3 (1/2^8) +FP per k-mer window: 9.537e-7 (1/2^(8·5)) ``` Useful for choosing parameters before committing to an index build. diff --git a/docmd/index.md b/docmd/index.md index 1b73fa7..262a6c3 100644 --- a/docmd/index.md +++ b/docmd/index.md @@ -25,7 +25,8 @@ - Maximum efficiency in computation, memory, and disk usage - k odd, k ∈ [11, 31], fixed at runtime; kmer fits in a u64 (2 bits/base) - Canonical form: `min(kmer, revcomp(kmer))` reduces strand-symmetric space by half -- Input formats: FASTA, FASTQ, gzip, streaming stdin; `index` reads from stdin automatically when no input files are provided (`-` can also be passed explicitly among other paths) +- Input formats for `index`/`superkmer`: FASTA (`.fa`, `.fasta`), FASTQ (`.fq`, `.fastq`), GenBank flat file (`.gb`, `.gbk`, `.gbff`), all optionally gzip-compressed; directories expanded recursively; streaming stdin via `-` +- Input formats for `query`: FASTA, FASTQ, optionally gzip-compressed; streaming stdin via `-` ## Parameter constraints (enforced at CLI) diff --git a/src/obikmer/src/cmd/query.rs b/src/obikmer/src/cmd/query.rs index 2af272e..3c0321b 100644 --- a/src/obikmer/src/cmd/query.rs +++ b/src/obikmer/src/cmd/query.rs @@ -230,16 +230,11 @@ fn process_chunk( let batch = QueryBatch::from_records(records, k, 6, 0.7); let n_seqs = batch.ids.len(); - let mut accs: Vec = - (0..n_seqs).map(|_| SeqAcc::new(n_genomes)).collect(); - - let mut cov: Vec>> = if detail { - batch.n_kmers.iter() - .map(|&n| vec![vec![0u32; n as usize]; n_genomes]) - .collect() - } else { - Vec::new() - }; + // Per-sequence s-mer result vectors in global sequence position order. + // All partitions fill into this structure before Findere is applied. + let mut seq_results: Vec>>> = batch.n_kmers.iter() + .map(|&n| vec![None; n as usize]) + .collect(); let by_part = batch.split_by_partition(n_partitions); @@ -256,38 +251,60 @@ fn process_chunk( std::process::exit(1); }); - let presence = force_presence || !with_counts; - let threshold = presence_threshold; - for (rsk, sk_kmer_results) in part_sks.iter().zip(kmer_results.iter()) { - let filtered = apply_findere(sk_kmer_results, effective_z, n_genomes); let descs = batch.map.get(*rsk).expect("rsk must be in map"); - for desc in descs { - let acc = &mut accs[desc.seq_idx as usize]; + let offset = desc.kmer_offset as usize; + let dst = &mut seq_results[desc.seq_idx as usize]; + for (j, hit) in sk_kmer_results.iter().enumerate() { + dst[offset + j] = hit.as_ref().map(|r| r.clone()); + } + } + } + } - for (local_pos, hit) in filtered.iter().enumerate() { - match hit { - None => { - if sk_kmer_results[local_pos].is_none() { - acc.kmer_missing += 1; - } - } - Some(row) => { - acc.kmer_count += 1; - for (g, &v) in row.iter().enumerate() { - if v == 0 { continue; } - let contribution = if presence { - u32::from(v >= threshold) - } else { - v - }; - acc.genome_totals[g] += contribution; - if detail { - let abs_pos = desc.kmer_offset as usize + local_pos; - cov[desc.seq_idx as usize][g][abs_pos] += contribution; - } - } + // Apply Findere on each complete sequence vector, then accumulate. + let n_kmers_out: Vec = batch.n_kmers.iter() + .map(|&n| { let n = n as usize; if n >= effective_z { n - effective_z + 1 } else { 0 } }) + .collect(); + + let mut accs: Vec = + (0..n_seqs).map(|_| SeqAcc::new(n_genomes)).collect(); + + let mut cov: Vec>> = if detail { + n_kmers_out.iter() + .map(|&n| vec![vec![0u32; n]; n_genomes]) + .collect() + } else { + Vec::new() + }; + + let presence = force_presence || !with_counts; + let threshold = presence_threshold; + + for seq_idx in 0..n_seqs { + let filtered = apply_findere(&seq_results[seq_idx], effective_z, n_genomes); + let acc = &mut accs[seq_idx]; + + for (pos, hit) in filtered.iter().enumerate() { + match hit { + None => { + if seq_results[seq_idx][pos].is_none() { + acc.kmer_missing += 1; + } + } + Some(row) => { + acc.kmer_count += 1; + for (g, &v) in row.iter().enumerate() { + if v == 0 { continue; } + let contribution = if presence { + u32::from(v >= threshold) + } else { + v + }; + acc.genome_totals[g] += contribution; + if detail { + cov[seq_idx][g][pos] += contribution; } } }