mRNA Mitochondrial mRNA LO.RRNA Internal Transcribed Spacer (ITS) 16S rRNA LO.MRRNA mitochondria 12S rRNA LO.MRRNA mitochondria P6-Loop trnL chloroplast ITS1 LO.ITS nucleus Root no rank EukaryotasuperkingdomTX.131567Embryophytano rankTX.131221Bryophytano rankTX.3193FungikingdomTX.33154Eumetazoano rankTX.33208AnnelidaphylumTX.193545OligochaetasubclassTX.42113HaplotaxidaorderTX.6381TubificinasuborderTX.6382EnchytraeidaefamilyTX.6383ArthropodaphylumTX.88770HexapodasuperclassTX.197562ColeopteraorderTX.33392Pterygotano rankTX.85512ChordataphylumTX.33511Vertebratano rankTX.89593GnathostomatasuperclassTX.7742Sarcopterygiino rankTX.117571Sauropsidano rankTX.32524Archosauriano rankTX.32561AvesclassTX.436492Tetrapodano rankTX.8287Amniotano rankTX.32523Sauriano rankTX.8457ViridiplantaekingdomTX.2759Opisthokontano rankTX.2759MetazoakingdomTX.33154Bilateriano rankTX.6072Coelomatano rankTX.33213Protostomiano rankTX.33316NeopterasubclassTX.7496EndopterygotainfraclassTX.33340Deuterostomiano rankTX.33316StreptophytaphylumTX.33090Clitellatano rankTX.6340InsectaclassTX.6960Dicondyliano rankTX.50557Panarthropodano rankTX.33317CraniatasubphylumTX.7711Teleostomino rankTX.7776Euteleostomino rankTX.117570Streptophytinano rankTX.35493cellular organismsno rankTX.1Annelida/Echiura/Pogonophora groupno rankTX.33317Pancrustaceano rankTX.197563Mandibulatano rankTX.6656Dinosauriano rankTX.8492Saurischiano rankTX.436486Theropodano rankTX.436489Coelurosauriano rankTX.436491 G GGGCAATCCTGAGCCAA false H CCATTGAGTCTCTGCACCTATC false ITS5 GGAAGTAAAAGTCGTAACAAGG false 5.8S_fungi CAAGAGATCCGTTGTTGAAAGTT false bryo_P6F GATTCAGGGAAACTTAGGTTG false bryo_P6R CCATTGAGTCTCTGCACC false Ench_12Sa GCTGCACTTTGACTTGAC false Ench_12Sc AGCCTGTGTACTGCTGTC false Coleop_16Sc TGCAAAGGTAGCATAATMATTAG false Coleop_16Sd TCCATAGGGTCTTCTCGTC false Aves_12Sa GATTAGATACCCCACTATGC false Aves_12Sc GTTTTAAGCGTTTGTGCTCG false GH LO.P6_LOOP PR.G PR.H TX.35493 8 150 Fungi_ITS1 LO.ITS1 PR.ITS5 PR.58S_FUNGI TX.4751 BI.BELLEMAIN_10_00 BI.EPP_12_00 Bryophytes_GH LO.P6_LOOP PR.BRYO_P6F PR.BRYO_P6R TX.3208 BI.EPP_12_00 Enchytraeids_12S LO.M12SRRNA PR.ENCH_12SA PR.ENCH_12SC TX.6388 BI.EPP_12_00 Coleopters_16S LO.M16SRRNA PR.COLEOP_16SC PR.COLEOP_16SD TX.7041 BI.EPP_12_00 Birds_12S LO.M12SRRNA PR.AVES_12SA PR.AVES_12SC TX.8782 BI.EPP_12_00 Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Pierre Taberlet author Eric Coissac author Francois Pompanon author Ludovic Gielly author Christian Miquel author Alice Valentini author Thierry Vermat author Gerard Corthier author Christian Brochmann author Eske Willerslev author 2007 text journal article Nucleic Acids Research continuing periodical academic journal Taberlet:07:00 2007 35 3 e14 DNA from soil mirrors plant taxonomic and growth form diversity N G Yoccoz author K A Bråthen author L Gielly author J Haile author M E Edwards author T Goslar author H Von Stedingk author A K Brysting author E Coissac author F Pompanon author J H Sønstebø author C Miquel author A Valentini author F De Bello author J Chave author W Thuiller author P Wincker author C Cruaud author F Gavory author M Rasmussen author M T P Gilbert author L Orlando author C Brochmann author E Willerslev author P Taberlet author 2012-Aug text journal article Mol Ecol continuing periodical academic journal Yoccoz:12:00 2012-Aug 21 15 3647 55 New environmental metabarcodes for analysing soil DNA potential for studying past and present ecosystems Laura S Epp author Sanne Boessenkool author Eva P Bellemain author James Haile author Alfonso Esposito author Tiayyba Riaz author Christer Erséus author Vladimir I Gusarov author Mary E Edwards author Arild Johnsen author Hans K Stenøien author Kristian Hassel author Håvard Kauserud author Nigel G Yoccoz author Kari Anne Bråthen author Eske Willerslev author Pierre Taberlet author Eric Coissac author Christian Brochmann author 2012-Apr text journal article Molecular Ecology continuing periodical academic journal Epp:12:00 2012-Apr 21 8 1821 1833 ITS as an environmental DNA barcode for fungi an in silico approach reveals potential PCR biases Eva Bellemain author Tor Carlsen author Christian Brochmann author Eric Coissac author Pierre Taberlet author Håvard Kauserud author 2010 text journal article BMC Microbiology continuing periodical academic journal Bellemain:10:00 2010 10 189