obitools/ecopcr
2
0
Fork 0
Code Issues 4 Pull Requests Actions Packages Projects Releases 3 Wiki Activity

malloc: *** error #1

New Issue
Open
opened 2015-05-16 22:07:48 +00:00 by coissac · 1 comment
coissac commented 2015-05-16 22:07:48 +00:00 (Migrated from git.metabarcoding.org)
Copy Link
Copy Source

ecoPCR is an electronic PCR software developed at LECA (http://www-leca.ujf-grenoble.fr/).

Here is the command I was running:

ecoPCR -d /Volumes/R5/Users/abonin/R119/embl_r119 -D 20 -e 6 -l 50 -L 600 CTTGGTCATTTAGAGGAAGTAA AGAYMMATGRTYAMAAGTTGT  > ITS1.ecopcr

Here is what I got after a little while:

Readind 1162548 taxa...
No local taxon
Reading file /Volumes/R5/Users/abonin/R119/embl_r119_001.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_002.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_003.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_004.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_005.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_006.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_007.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_008.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_009.sdx containing 117641 sequences...

ecoPCR(49371) malloc: *** error for object 0x7f851b269998: incorrect checksum for freed object - object was probably modified after being freed.
*** set a breakpoint in malloc_error_break to debug
Abort

I tried the same command twice, same outcome except that the error message is now:

ecoPCR(53144) malloc: *** error for object 0x7f8f3c269998: incorrect checksum for freed object - object was probably modified after being freed.
*** set a breakpoint in malloc_error_break to debug
Abort

No hurry to solve it, it seems that with embl release 117 it works (but ecoPCR is still running...)

ecoPCR is an electronic PCR software developed at LECA (http://www-leca.ujf-grenoble.fr/). Here is the command I was running: ``` ecoPCR -d /Volumes/R5/Users/abonin/R119/embl_r119 -D 20 -e 6 -l 50 -L 600 CTTGGTCATTTAGAGGAAGTAA AGAYMMATGRTYAMAAGTTGT > ITS1.ecopcr Here is what I got after a little while: Readind 1162548 taxa... No local taxon Reading file /Volumes/R5/Users/abonin/R119/embl_r119_001.sdx containing 700000 sequences... Reading file /Volumes/R5/Users/abonin/R119/embl_r119_002.sdx containing 700000 sequences... Reading file /Volumes/R5/Users/abonin/R119/embl_r119_003.sdx containing 700000 sequences... Reading file /Volumes/R5/Users/abonin/R119/embl_r119_004.sdx containing 700000 sequences... Reading file /Volumes/R5/Users/abonin/R119/embl_r119_005.sdx containing 700000 sequences... Reading file /Volumes/R5/Users/abonin/R119/embl_r119_006.sdx containing 700000 sequences... Reading file /Volumes/R5/Users/abonin/R119/embl_r119_007.sdx containing 700000 sequences... Reading file /Volumes/R5/Users/abonin/R119/embl_r119_008.sdx containing 700000 sequences... Reading file /Volumes/R5/Users/abonin/R119/embl_r119_009.sdx containing 117641 sequences... ecoPCR(49371) malloc: *** error for object 0x7f851b269998: incorrect checksum for freed object - object was probably modified after being freed. *** set a breakpoint in malloc_error_break to debug Abort I tried the same command twice, same outcome except that the error message is now: ecoPCR(53144) malloc: *** error for object 0x7f8f3c269998: incorrect checksum for freed object - object was probably modified after being freed. *** set a breakpoint in malloc_error_break to debug Abort ``` No hurry to solve it, it seems that with embl release 117 it works (but ecoPCR is still running...)
coissac commented 2015-05-16 22:09:04 +00:00 (Migrated from git.metabarcoding.org)
Copy Link
Copy Source

Added ~10 label

Added ~10 label
Sign in to join this conversation.
No Branch/Tag Specified
Branches Tags
Labels
Clear labels
bug
confirmed
critical
discussion
documentation
enhancement
suggestion
support
No labels bug
Milestone
No items
No Milestone
Projects
Clear projects
No projects
Assignees
Clear assignees
boyerfr coissac
No Assignees
1 Participants
Notifications
Due Date
No due date set.
Dependencies

No dependencies set.

Reference: obitools/ecopcr#1