obitools/obitools4
2
0 Fork 0
mirror of https://github.com/metabarcoding/obitools4.git synced 2026-11-10 01:24:41 +00:00
Code Issues Packages Projects Releases Wiki Activity

Introduce new sequence matching logic and corpus handling

Browse Source 
This commit introduces the core matching functionality, including parallel corpus loading, the `Corpus` data structure, and implementations for `matchNaive` and `matchApat`. It also defines new matching rules, variant handling, and comprehensive unit and integration tests to validate the new logic and parameter handling.
This commit is contained in:
Eric Coissac committed 2026-11-03 22:35:51 +11:00
1 parent f75e774bd5
commit ad065f6853
10 files changed
+2265 -59
Download Patch File Download Diff File Expand all files Collapse all files

No files matched your search

pkg/obiprimer/words_test.go
+17 -7
View File
@@ -107,8 +107,11 @@ func TestFindStrictWords(t *testing.T) {
add("zz1", randDNA(rng, 50)+motif)
sel := Selection{Restrict: idPrefix("ex").Or(idPrefix("cx")), Ignore: idPrefix("cx"), Except: idPrefix("cx")}
res, err := FindStrictWords(obiiter.IBatchOver("t", data, 3), sel,
WordSearch{PrimerLength: k, Quorum: 0.7, Partitions: 8, TmpDir: t.TempDir()})
corpus, err := LoadCorpus(obiiter.IBatchOver("t", data, 3), sel)
if err != nil {
t.Fatal(err)
}
res, err := FindStrictWords(corpus, WordSearch{PrimerLength: k, Quorum: 0.7, Partitions: 8, TmpDir: t.TempDir()})
if err != nil {
t.Fatal(err)
}
@@ -151,14 +154,17 @@ func TestFindStrictWordsParameters(t *testing.T) {
it := func() obiiter.IBioSequence {
return obiiter.IBatchOver("t", obiseq.BioSequenceSlice{obiseq.NewBioSequence("a", []byte("acgtacgtacgtacgtacgtacgt"), "")}, 1)
}
if _, err := FindStrictWords(it(), Selection{}, WordSearch{PrimerLength: 1, Quorum: 0.7}); err == nil {
corpus, err := LoadCorpus(it(), Selection{})
if err != nil {
t.Fatal(err)
}
if _, err := FindStrictWords(corpus, WordSearch{PrimerLength: 1, Quorum: 0.7}); err == nil {
t.Error("primer length 1 must fail")
}
if _, err := FindStrictWords(it(), Selection{}, WordSearch{PrimerLength: 18, Quorum: 0}); err == nil {
if _, err := FindStrictWords(corpus, WordSearch{PrimerLength: 18, Quorum: 0}); err == nil {
t.Error("quorum 0 must fail")
}
if _, err := FindStrictWords(it(), Selection{Restrict: idPrefix("zz")},
WordSearch{PrimerLength: 18, Quorum: 0.7}); err == nil {
if _, err := LoadCorpus(it(), Selection{Restrict: idPrefix("zz")}); err == nil {
t.Error("no example must fail")
}
}
@@ -206,7 +212,11 @@ func TestStrictWordsAgainstEcoPrimers(t *testing.T) {
if err != nil {
t.Fatal(err)
}
res, err := FindStrictWords(seqs, Selection{Restrict: restrict},
corpus, err := LoadCorpus(seqs, Selection{Restrict: restrict})
if err != nil {
t.Fatal(err)
}
res, err := FindStrictWords(corpus,
WordSearch{PrimerLength: 18, Quorum: 0.7, Circular: true, TmpDir: t.TempDir()})
if err != nil {
t.Fatal(err)