Files
obitools4/doc/tutorial.qmd

564 lines
22 KiB
Plaintext
Raw Normal View History

2023-01-31 23:04:28 +01:00
# OBITools V4 Tutorial
Here is a short tutorial on how to analyze DNA metabarcoding data produced on Illumina sequencers using:
- the OBITools
- some basic Unix commands
## Wolves diet based on DNA metabarcoding
The data used in this tutorial correspond to the analysis of four wolf scats, using the protocol published in @Shehzad2012-pn for assessing carnivore diet. After extracting DNA from the faeces, the DNA amplifications were carried out using the primers `TTAGATACCCCACTATGC` and `TAGAACAGGCTCCTCTAG` amplifiying the *12S-V5* region [@Riaz2011-gn], together with a wolf blocking oligonucleotide.
The complete data set can be downloaded here: [the tutorial dataset](wolf_diet.tgz)
Once the data file is downloaded, using a UNIX terminal unarchive the data from the `tgz` file.
```{bash untar_data}
#| output: false
tar zxvf wolf_diet.tgz
```
That command create a new directory named `wolf_data` containing every required data files:
- `fastq <fastq>` files resulting of aGA IIx (Illumina) paired-end (2 x 108 bp)
sequencing assay of DNA extracted and amplified from four wolf faeces:
- `wolf_F.fastq`
- `wolf_R.fastq`
- the file describing the primers and tags used for all samples
sequenced:
- `wolf_diet_ngsfilter.txt` The tags correspond to short and
specific sequences added on the 5\' end of each primer to
distinguish the different samples
- the file containing the reference database in a fasta format:
- `db_v05_r117.fasta` This reference database has been extracted
from the release 117 of EMBL using `obipcr`
```{bash true_mk_directory}
#| output: false
#| echo: false
#| error: true
#|
if [[ ! -d results ]] ; then
mkdir results
fi
```
To not mix raw data and processed data a new directory called `results` is created.
```{bash mk_directory}
#| output: false
#| eval: false
mkdir results
```
## Step by step analysis
### Recover full sequence reads from forward and reverse partial reads
When using the result of a paired-end sequencing assay with supposedly
overlapping forward and reverse reads, the first step is to recover the
assembled sequence.
The forward and reverse reads of the same fragment are *at the same line
position* in the two fastq files obtained after sequencing. Based on
these two files, the assembly of the forward and reverse reads is done
with the `obipairing` utility that aligns the two reads and returns the
reconstructed sequence.
In our case, the command is:
```{bash pairing}
#| output: false
obipairing --min-identity=0.8 \
--min-overlap=10 \
-F wolf_data/wolf_F.fastq \
-R wolf_data/wolf_R.fastq \
> results/wolf.fastq
```
The `--min-identity` and `--min-overlap` options allow
discarding sequences with low alignment quality. If after the aligment,
the overlaping parts of the reads is shorter than 10 base pairs or the
similarity over this aligned region is below 80% of identity, in the output file,
the forward and reverse reads are not aligned but concatenated, and the value of
the `mode` attribute in the sequence header is set to `joined` instead of `alignment`.
### Remove unaligned sequence records
Unaligned sequences (:py`mode=joined`{.interpreted-text role="mod"})
cannot be used. The following command allows removing them from the
dataset:
```{bash}
#| output: false
obigrep -p 'annotations.mode != "join"' \
results/wolf.fastq > results/wolf.ali.fastq
```
The `-p` requires a go like expression. `annotations.mode != "join"` means that
if the value of the `mode` annotation of a sequence is
different from `join`, the corresponding sequence record will be kept.
The first sequence record of `wolf.ali.fastq` can be obtained using the
following command line:
```{bash}
#| eval: false
#| output: false
head -n 4 results/wolf.ali.fastq
```
The folling piece of code appears on thew window of tour terminal.
```
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1 {"ali_dir":"left","ali_length":62,"mode":"alignment","pairing_mismatches":{"(T:26)->(G:13)":62,"(T:34)->(G:18)":48},"score":484,"score_norm":0.968,"seq_a_single":46,"seq_ab_match":60,"seq_b_single":46}
ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
+
CCCCCCCBCCCCCCCCCCCCCCCCCCCCCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCCCCCCCCCCCC
```
### Assign each sequence record to the corresponding sample/marker combination
Each sequence record is assigned to its corresponding sample and marker
using the data provided in a text file (here `wolf_diet_ngsfilter.txt`).
This text file contains one line per sample, with the name of the
experiment (several experiments can be included in the same file), the
name of the tags (for example: `aattaac` if the same tag has been used
on each extremity of the PCR products, or `aattaac:gaagtag` if the tags
were different), the sequence of the forward primer, the sequence of the
reverse primer, the letter `T` or `F` for sample identification using
the forward primer and tag only or using both primers and both tags,
respectively (see `obimultiplex` for details).
```{bash}
#| output: false
obimultiplex -t wolf_data/wolf_diet_ngsfilter.txt \
-u results/unidentified.fastq \
results/wolf.ali.fastq \
> results/wolf.ali.assigned.fastq
```
This command creates two files:
- `unidentified.fastq` containing all the sequence records that were
not assigned to a sample/marker combination
- `wolf.ali.assigned.fastq` containing all the sequence records that
were properly assigned to a sample/marker combination
Note that each sequence record of the `wolf.ali.assigned.fastq` file
contains only the barcode sequence as the sequences of primers and tags
are removed by the `obimultiplex ` program. Information concerning the
experiment, sample, primers and tags is added as attributes in the
sequence header.
For instance, the first sequence record of `wolf.ali.assigned.fastq` is:
```
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_sub[28..127] {"ali_dir":"left","ali_length":62,"direction":"direct","experiment":"wolf_diet","forward_match":"ttagataccccactatgc","forward_mismatches":0,"forward_primer":"ttagataccccactatgc","forward_tag":"gcctcct","mode":"alignment","pairing_mismatches":{"(T:26)->(G:13)":35,"(T:34)->(G:18)":21},"reverse_match":"tagaacaggctcctctag","reverse_mismatches":0,"reverse_primer":"tagaacaggctcctctag","reverse_tag":"gcctcct","sample":"29a_F260619","score":484,"score_norm":0.968,"seq_a_single":46,"seq_ab_match":60,"seq_b_single":46}
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC
```
### Dereplicate reads into uniq sequences
The same DNA molecule can be sequenced several times. In order to reduce
both file size and computations time, and to get easier interpretable
results, it is convenient to work with unique *sequences* instead of
*reads*. To *dereplicate* such *reads* into unique *sequences*, we use
the `obiuniq` command.
+-------------------------------------------------------------+
| Definition: Dereplicate reads into unique sequences |
+-------------------------------------------------------------+
| 1. compare all the reads in a data set to each other |
| 2. group strictly identical reads together |
| 3. output the sequence for each group and its count in the |
| original dataset (in this way, all duplicated reads are |
| removed) |
| |
| Definition adapted from @Seguritan2001-tg |
+-------------------------------------------------------------+
For dereplication, we use the `obiuniq ` command with the `-m sample`. The `-m sample` option is used
to keep the information of the samples of origin for each uniquesequence.
```{bash}
#| output: false
obiuniq -m sample \
results/wolf.ali.assigned.fastq \
> results/wolf.ali.assigned.uniq.fasta
```
Note that `obiuniq` returns a fasta file.
The first sequence record of `wolf.ali.assigned.uniq.fasta` is:
```
>HELIUM_000100422_612GNAAXX:7:93:6991:1942#0/1_sub[28..126] {"ali_dir":"left","ali_length":63,"count":1,"direction":"reverse","experiment":"wolf_diet","forward_match":"ttagataccccactatgc","forward_mismatches":0,"forward_primer":"ttagataccccactatgc","forward_tag":"gaatatc","merged_sample":{"26a_F040644":1},"mode":"alignment","pairing_mismatches":{"(A:10)->(G:34)":76,"(C:06)->(A:34)":58},"reverse_match":"tagaacaggctcctctag","reverse_mismatches":0,"reverse_primer":"tagaacaggctcctctag","reverse_tag":"gaatatc","score":730,"score_norm":0.968,"seq_a_single":45,"seq_ab_match":61,"seq_b_single":45}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagaactactagcaaca
gcctgaaactcaaaggacttggcggtgctttatatccct
```
The run of `obiuniq` has
added two key=values entries in the header of the fasta sequence:
- `"merged_sample":{"29a_F260619":1}`{.interpreted-text
role="mod"}: this sequence have been found once in a single sample
called **29a_F260619**
- `"count":1` : the total count for this sequence is $1$
To keep only these two attributes, we can use the `obiannotate` command:
```{bash}
#| output: false
obiannotate -k count -k merged_sample \
results/wolf.ali.assigned.uniq.fasta \
> results/wolf.ali.assigned.simple.fasta
```
The first five sequence records of `wolf.ali.assigned.simple.fasta`
become:
```
>HELIUM_000100422_612GNAAXX:7:26:18930:11105#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
ttagccctaaacacaagtaattaatataacaaaatwattcgcyagagtactacmggcaat
agctyaaarctcamagrwcttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:58:5711:11399#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtwctaccgssaat
agcttaaaactcaaaggactgggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:100:15836:9304#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
ttagccctaaacatagataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:55:13242:9085#0/1_sub[28..126] {"count":4,"merged_sample":{"26a_F040644":4}}
ttagccctaaacataaacattcaataaacaagagtgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:86:8429:13723#0/1_sub[28..127] {"count":7,"merged_sample":{"15a_F730814":5,"29a_F260619":2}}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggactcggcggtgctttataccctt
```
### Denoise the sequence dataset
To have a set of sequences assigned to their corresponding samples does
not mean that all sequences are *biologically* meaningful i.e. some of
these sequences can contains PCR and/or sequencing errors, or chimeras.
#### Tag the sequences for PCR errors (sequence variants) {.unnumbered}
The `obiclean` program tags sequence variants as potential error generated during
PCR amplification. We ask it to keep the [head]{.title-ref} sequences (`-H` option)
that are sequences which are not variants of another sequence with a count greater than 5% of their own count
(`-r 0.05` option).
```{bash}
#| output: false
obiclean -s sample -r 0.05 -H \
results/wolf.ali.assigned.simple.fasta \
> results/wolf.ali.assigned.simple.clean.fasta
```
One of the sequence records of
`wolf.ali.assigned.simple.clean.fasta` is:
```
>HELIUM_000100422_612GNAAXX:7:66:4039:8016#0/1_sub[28..127] {"count":17,"merged_sample":{"13a_F730603":17},"obiclean_head":true,"obiclean_headcount":1,"obiclean_internalcount":0,"obi
clean_samplecount":1,"obiclean_singletoncount":0,"obiclean_status":{"13a_F730603":"h"},"obiclean_weight":{"13a_F730603":25}}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaac
agcccaaaactcaaaggacttggcggtgcttcacaccctt
```
To remove such sequences as much as possible, we first discard rare
sequences and then rsequence variants that likely correspond to
artifacts.
#### Get some statistics about sequence counts {.unnumbered}
```{bash}
obicount results/wolf.ali.assigned.simple.clean.fasta
```
The dataset contains $4313$ sequences variant corresponding to 42452 sequence reads.
Most of the variants occur only a single time in the complete dataset and are usualy
named *singletons*
```{bash}
obigrep -p 'sequence.Count() == 1' results/wolf.ali.assigned.simple.clean.fasta \
| obicount
```
In that dataset sigletons corresponds to $3511$ variants.
Using *R* and the `ROBIFastread` package able to read headers of the fasta files produced by *OBITools*,
we can get more complete statistics on the distribution of occurrencies.
```{r}
#| warning: false
library(ROBIFastread)
library(ggplot2)
seqs <- read_obifasta("results/wolf.ali.assigned.simple.clean.fasta",keys="count")
ggplot(data = seqs, mapping=aes(x = count)) +
geom_histogram(bins=100) +
scale_y_sqrt() +
scale_x_sqrt() +
geom_vline(xintercept = 10, col="red", lty=2) +
xlab("number of occurrencies of a variant")
```
In a similar way it is also possible to plot the distribution of the sequence length.
```{r}
#| warning: false
ggplot(data = seqs, mapping=aes(x = nchar(sequence))) +
geom_histogram() +
scale_y_log10() +
geom_vline(xintercept = 80, col="red", lty=2) +
xlab("sequence lengths in base pair")
```
#### Keep only the sequences having a count greater or equal to 10 and a length shorter than 80 bp {.unnumbered}
Based on the previous observation, we set the cut-off for keeping
sequences for further analysis to a count of 10. To do this, we use the
`obigrep <scripts/obigrep>`{.interpreted-text role="doc"} command. The
`-p 'count>=10'` option means that the `python` expression
:py`count>=10`{.interpreted-text role="mod"} must be evaluated to
:py`True`{.interpreted-text role="mod"} for each sequence to be kept.
Based on previous knowledge we also remove sequences with a length
shorter than 80 bp (option -l) as we know that the amplified 12S-V5
barcode for vertebrates must have a length around 100bp.
```{bash}
#| output: false
obigrep -l 80 -p 'sequence.Count() >= 10' results/wolf.ali.assigned.simple.clean.fasta \
> results/wolf.ali.assigned.simple.clean.c10.l80.fasta
```
The first sequence record of `results/wolf.ali.assigned.simple.clean.c10.l80.fasta` is:
```
>HELIUM_000100422_612GNAAXX:7:22:2603:18023#0/1_sub[28..127] {"count":12182,"merged_sample":{"15a_F730814":7559,"29a_F260619":4623},"obiclean_head":true,"obiclean_headcount":2,"obiclean_internalcount":0,"obiclean_samplecount":2,"obiclean_singletoncount":0,"obiclean_status":{"15a_F730814":"h","29a_F260619":"h"},"obiclean_weight":{"15a_F730814":9165,"29a_F260619":6275}}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
```
At that time in the data cleanning we have conserved :
```{bash}
obicount results/wolf.ali.assigned.simple.clean.c10.l80.fasta
```
### Taxonomic assignment of sequences
Once denoising has been done, the next step in diet analysis is to
assign the barcodes to the corresponding species in order to get the
complete list of species associated to each sample.
Taxonomic assignment of sequences requires a reference database
compiling all possible species to be identified in the sample.
Assignment is then done based on sequence comparison between sample
sequences and reference sequences.
#### Download the taxonomy {.unnumbered}
```{bash}
#| output: false
mkdir TAXO
cd TAXO
curl http://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz \
| tar -zxvf -
cd ..
```
#### Build a reference database {.unnumbered}
One way to build the reference database is to use the
`ecoPCR <scripts/ecoPCR>`{.interpreted-text role="doc"} program to
simulate a PCR and to extract all sequences from the EMBL that may be
amplified [in silico]{.title-ref} by the two primers
([TTAGATACCCCACTATGC]{.title-ref} and [TAGAACAGGCTCCTCTAG]{.title-ref})
used for PCR amplification.
The full list of steps for building this reference database would then
be:
1. Download the whole set of EMBL sequences (available from:
<ftp://ftp.ebi.ac.uk/pub/databases/embl/release/>)
2. Download the NCBI taxonomy (available from:
<ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz>)
3. Format them into the ecoPCR format (see
`obiconvert <scripts/obiconvert>`{.interpreted-text role="doc"} for
how you can produce ecoPCR compatible files)
4. Use ecoPCR to simulate amplification and build a reference database
based on putatively amplified barcodes together with their recorded
taxonomic information
As step 1 and step 3 can be really time-consuming (about one day), we
alredy provide the reference database produced by the following commands
so that you can skip its construction. Note that as the EMBL database
and taxonomic data can evolve daily, if you run the following commands
you may end up with quite different results.
Any utility allowing file downloading from a ftp site can be used. In
the following commands, we use the commonly used `wget` *Unix* command.
##### Download the sequences {.unnumbered}
``` bash
> mkdir EMBL
> cd EMBL
> wget -nH --cut-dirs=4 -Arel_std_\*.dat.gz -m ftp://ftp.ebi.ac.uk/pub/databases/embl/release/
> cd ..
```
##### Download the taxonomy {.unnumbered}
``` bash
> mkdir TAXO
> cd TAXO
> wget ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz
> tar -zxvf taxdump.tar.gz
> cd ..
```
##### Use obipcr to simulate an in silico\` PCR {.unnumbered}
``` bash
> obipcr -d ./ECODB/embl_last -e 3 -l 50 -L 150 \
TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG > v05.ecopcr
```
Note that the primers must be in the same order both in
`wolf_diet_ngsfilter.txt` and in the `obipcr` command.
##### Clean the database {.unnumbered}
1. filter sequences so that they have a good taxonomic description at
the species, genus, and family levels
(`obigrep` command command below).
2. remove redundant sequences (`obiuniq` command below).
3. ensure that the dereplicated sequences have a taxid at the family
level (`obigrep` command below).
4. ensure that sequences each have a unique identification
(`obiannotate` command below)
``` bash
> obigrep -d embl_last --require-rank=species \
--require-rank=genus --require-rank=family v05.ecopcr > v05_clean.fasta
> obiuniq -d embl_last \
v05_clean.fasta > v05_clean_uniq.fasta
> obigrep -d embl_last --require-rank=family \
v05_clean_uniq.fasta > v05_clean_uniq_clean.fasta
> obiannotate --uniq-id v05_clean_uniq_clean.fasta > db_v05.fasta
```
obirefidx -t TAXO wolf_data/db_v05_r117.fasta > results/db_v05_r117.indexed.fasta
::: warning
::: title
Warning
:::
From now on, for the sake of clarity, the following commands will use
the filenames of the files provided with the tutorial. If you decided to
run the last steps and use the files you have produced, you\'ll have to
use `db_v05.fasta` instead of `db_v05_r117.fasta` and `embl_last`
instead of `embl_r117`
:::
### Assign each sequence to a taxon
Once the reference database is built, taxonomic assignment can be
carried out using the `obitag` command.
```{bash}
#| output: false
obitag -t TAXO -R wolf_data/db_v05_r117.indexed.fasta \
results/wolf.ali.assigned.simple.clean.c10.l80.fasta \
> results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta
```
The `obitag` adds several attributes in the sequence record header, among
them:
- obitag_bestmatch=ACCESSION where ACCESSION is the id of hte sequence in
the reference database that best aligns to the query sequence;
- obitag_bestid=FLOAT where FLOAT\*100 is the percentage of identity
between the best match sequence and the query sequence;
- taxid=TAXID where TAXID is the final assignation of the sequence by
`obitag`
- scientific_name=NAME where NAME is the scientific name of the
assigned taxid.
The first sequence record of `wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta` is:
``` bash
>HELIUM_000100422_612GNAAXX:7:81:18704:12346#0/1_sub[28..126] {"count":88,"merged_sample":{"26a_F040644":88},"obiclean_head":true,"obiclean_headcount":1,"obiclean_internalcount":0,"obiclean_samplecount":1,"obiclean_singletoncount":0,"obiclean_status":{"26a_F040644":"h"},"obiclean_weight":{"26a_F040644":208},"obitag_bestid":0.9207920792079208,"obitag_bestmatch":"AY769263","obitag_difference":8,"obitag_match_count":1,"obitag_rank":"clade","scientific_name":"Boreoeutheria","taxid":1437010}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
```
### Generate the final result table
Some unuseful attributes can be removed at this stage.
- obiclean_head
- obiclean_headcount
- obiclean_internalcount
- obiclean_samplecount
- obiclean_singletoncount
```{bash}
#| output: false
obiannotate --delete-tag=obiclean_head \
--delete-tag=obiclean_headcount \
--delete-tag=obiclean_internalcount \
--delete-tag=obiclean_samplecount \
--delete-tag=obiclean_singletoncount \
results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta \
> results/wolf.ali.assigned.simple.clean.c10.l80.taxo.ann.fasta
```
The first sequence record of
`wolf.ali.assigned.simple.c10.l80.clean.taxo.ann.fasta` is then:
```
>HELIUM_000100422_612GNAAXX:7:84:16335:5083#0/1_sub[28..126] {"count":96,"merged_sample":{"26a_F040644":11,"29a_F260619":85},"obiclean_status":{"26a_F040644":"s","29a_F260619":"h"},"obiclean_weight":{"26a_F040644":14,"29a_F260619":110},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_difference":4,"obitag_match_count":1,"obitag_rank":"subspecies","scientific_name":"Canis lupus familiaris","taxid":9615}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
```
This file contains 26 sequences. You can deduce the diet of each sample:
: - 13a_F730603: Cervus elaphus
- 15a_F730814: Capreolus capreolus
- 26a_F040644: Marmota sp. (according to the location, it is
Marmota marmota)
- 29a_F260619: Capreolus capreolus
Note that we also obtained a few wolf sequences although a wolf-blocking
oligonucleotide was used.