obitools4/doc/01_OBITools_doc.Rmd

# The OBITools

## Aims of *OBITools*

## File formats usable with *OBITools*

### The sequence files

Sequences can be stored following various format. OBITools knows some of
them. The central formats for sequence files manipulated by OBITools
scripts are the `fasta` and fastq format. OBITools extends the both
these formats by specifying a syntax to include in the definition line
data qualifying the sequence. All file formats use the `IUPAC` code for
encoding nucleotides.

### The IUPAC Code

The International Union of Pure and Applied Chemistry (IUPAC\_) defined
the standard code for representing protein or DNA sequences.

#### Nucleic IUPAC Code  {#DNA-IUPAC}

| **Code** | **Nucleotide**              |
|----------|-----------------------------|
| A        | Adenine                     |
| C        | Cytosine                    |
| G        | Guanine                     |
| T        | Thymine                     |
| U        | Uracil                      |
| R        | Purine (A or G)             |
| Y        | Pyrimidine (C, T, or U)     |
| M        | C or A                      |
| K        | T, U, or G                  |
| W        | T, U, or A                  |
| S        | C or G                      |
| B        | C, T, U, or G (not A)       |
| D        | A, T, U, or G (not C)       |
| H        | A, T, U, or C (not G)       |
| V        | A, C, or G (not T, not U)   |
| N        | Any base (A, C, G, T, or U) |

### The *fasta* format {#classical-fasta}

The **fasta format** is certainly the most widely used sequence file
format. This is certainly due to its great simplicity. It was originally
created for the Lipman and Pearson [FASTA
program](http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation).
OBITools use in more of the classical :ref:`fasta` format an
:ref:`extended version` of this format where structured data are
included in the title line.

In *fasta* format a sequence is represented by a title line beginning
with a **`>`** character and the sequences by itself following the
:doc:`iupac` code. The sequence is usually split other severals lines of
the same length (expect for the last one)

    >my_sequence this is my pretty sequence
    ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
    GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
    AACGACGTTGCAGTACGTTGCAGT

This is no special format for the title line excepting that this line
should be unique. Usually the first word following the **\>** character
is considered as the sequence identifier. The end of the title line
corresponding to a description of the sequence. Several sequences can be
concatenated in a same file. The description of the next sequence is
just pasted at the end of the record of the previous one

    >sequence_A this is my first pretty sequence
    ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
    GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
    AACGACGTTGCAGTACGTTGCAGT
    >sequence_B this is my second pretty sequence
    ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
    GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
    AACGACGTTGCAGTACGTTGCAGT
    >sequence_C this is my third pretty sequence
    ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
    GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
    AACGACGTTGCAGTACGTTGCAGT

### The *fastq* sequence format {#classical-fastq}

.. note::

    This article uses material from the Wikipedia article 
    `FASTQ format `
    which is released under the 
    `Creative Commons Attribution-Share-Alike License 3.0 `

**fastq format** is a text-based format for storing both a biological
sequence (usually nucleotide sequence) and its corresponding quality
scores. Both the sequence letter and quality score are encoded with a
single ASCII character for brevity. It was originally developed at the
`Wellcome Trust Sanger Institute` to bundle a [fasta](#classical-fasta)
sequence and its quality data, but has recently become the *de facto*
standard for storing the output of high throughput sequencing
instruments such as the Illumina Genome Analyzer Illumina. [1]\_

#### Format

A fastq file normally uses four lines per sequence.

-   Line 1 begins with a '\@' character and is followed by a sequence
    identifier and an *optional* description (like a :ref:`fasta` title
    line).
-   Line 2 is the raw sequence letters.
-   Line 3 begins with a '+' character and is *optionally* followed by
    the same sequence identifier (and any description) again.
-   Line 4 encodes the quality values for the sequence in Line 2, and
    must contain the same number of symbols as letters in the sequence.

A fastq file containing a single sequence might look like this:

    @SEQ_ID
    GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
    +
    !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

The character '!' represents the lowest quality while '\~' is the
highest. Here are the quality value characters in left-to-right
increasing order of quality (`ASCII`):

    !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~

The original Sanger FASTQ files also allowed the sequence and quality
strings to be wrapped (split over multiple lines), but this is generally
discouraged as it can make parsing complicated due to the unfortunate
choice of "\@" and "+" as markers (these characters can also occur in
the quality string).

#### Variations

##### Quality

A quality value *Q* is an integer mapping of *p* (i.e., the probability
that the corresponding base call is incorrect). Two different equations
have been in use. The first is the standard Sanger variant to assess
reliability of a base call, otherwise known as Phred quality score:

$$
Q_\text{sanger} = -10 \, \log_{10} p
$$

The Solexa pipeline (i.e., the software delivered with the Illumina
Genome Analyzer) earlier used a different mapping, encoding the odds
$\mathbf{p}/(1-\mathbf{p})$ instead of the probability $\mathbf{p}$:

$$
Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p}
$$

Although both mappings are asymptotically identical at higher quality
values, they differ at lower quality levels (i.e., approximately
$\mathbf{p} > 0.05$, or equivalently, $\mathbf{Q} < 13$).

\|Relationship between *Q* and *p* using the Sanger (red) and Solexa
(black) equations (described above). The vertical dotted line indicates
$\mathbf{p}= 0.05$, or equivalently, $Q = 13$.\|

#### Encoding

-   Sanger format can encode a Phred quality score from 0 to 93 using
    ASCII 33 to 126 (although in raw read data the Phred quality score
    rarely exceeds 60, higher scores are possible in assemblies or read
    maps).
-   Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality
    score from -5 to 62 using ASCII 59 to 126 (although in raw read data
    Solexa scores from -5 to 40 only are expected)
-   Starting with Illumina 1.3 and before Illumina 1.8, the format
    encoded a Phred quality score from 0 to 62 using ASCII 64 to 126
    (although in raw read data Phred scores from 0 to 40 only are
    expected).
-   Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0
    to 2 have a slightly different meaning. The values 0 and 1 are no
    longer used and the value 2, encoded by ASCII 66 "B".

Sequencing Control Software, Version 2.6, Catalog \# SY-960-2601, Part
\# 15009921 Rev. A, November
2009] [[http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\\\\](http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\){.uri}]([http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\\](http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf)%7B.uri%7D){.uri}
(page 30) states the following: *If a read ends with a segment of mostly
low quality (Q15 or below), then all of the quality values in the
segment are replaced with a value of 2 (encoded as the letter B in
Illumina's text-based encoding of quality scores)... This Q2 indicator
does not predict a specific error rate, but rather indicates that a
specific final portion of the read should not be used in further
analyses.* Also, the quality score encoded as "B" letter may occur
internally within reads at least as late as pipeline version 1.6, as
shown in the following example:

    @HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
    TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
    +HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
    efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB

An alternative interpretation of this ASCII encoding has been proposed.
Also, in Illumina runs using PhiX controls, the character 'B' was
observed to represent an "unknown quality score". The error rate of 'B'
reads was roughly 3 phred scores lower the mean observed score of a
given run.

-   Starting in Illumina 1.8, the quality scores have basically returned
    to the use of the Sanger format (Phred+33).

## File extension

There is no standard file extension for a FASTQ file, but .fq and
.fastq, are commonly used.

## See also

-   :ref:`fasta`

## References

.. [1] Cock et al (2009) The Sanger FASTQ file format for sequences with
quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids
Research,

.. [2] Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego,
Illumina `1`\_\_

.. \|Relationship between *Q* and *p* using the Sanger (red) and Solexa
(black) equations (described above). The vertical dotted line indicates
*p* = 0.05, or equivalently, *Q* Å 13.\| image:: Probability metrics.png

See <http://en.wikipedia.org/wiki/FASTQ_format>