Big change iin the data model, and a first version of obiuniq

cmd/obitools/obicount/main.go

@@ -40,13 +40,13 @@ func main() {
 	nsymbol := 0
 	for fs.Next() {
 		s := fs.Get()
-		if s.IsNil() {
+		if s==nil {
 			log.Panicln("Read sequence is nil")
 		}
 		nread += s.Count()
 		nvariant++
 		nsymbol += s.Length()
-		(&s).Recycle()
+		s.Recycle()
 	}
 
 	if obicount.CLIIsPrintingVariantCount() {

cmd/obitools/obimultiplex/main.go

@@ -1,7 +1,9 @@
 package main
 
 import (
+	"log"
 	"os"
+	"runtime/pprof"
 
 	"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
 	"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
@@ -10,12 +12,12 @@ import (
 
 func main() {
 
-	// f, err := os.Create("cpu.pprof")
-	// if err != nil {
-	// 	log.Fatal(err)
-	// }
-	// pprof.StartCPUProfile(f)
-	// defer pprof.StopCPUProfile()
+	f, err := os.Create("cpu.pprof")
+	if err != nil {
+		log.Fatal(err)
+	}
+	pprof.StartCPUProfile(f)
+	defer pprof.StopCPUProfile()
 
 	// ftrace, err := os.Create("cpu.trace")
 	// if err != nil {

cmd/obitools/obiuniq/main.go

@@ -6,12 +6,15 @@ import (
 	"runtime/pprof"
 
 	"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
+	"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
 	"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
 	"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiuniq"
 )
 
 func main() {
 
+	defer obiseq.LogBioSeqStatus()
+
 	// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
 	f, err := os.Create("cpu.pprof")
 	if err != nil {

cmd/test/main.go

@@ -43,7 +43,7 @@ func main() {
 
 	A := []byte("ccgcctccttagaacaggctcctctagaaaaccatagtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
 	// B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg")
-	sA := obiseq.MakeBioSequence("A", A, "")
+	sA := obiseq.NewBioSequence("A", A, "")
 	// sB := obiseq.MakeBioSequence("B", B, "")
 
 	pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)