refactor: extract obikindex crate and remove deprecated CLI commands

Extracted core indexing logic, state tracking, and metadata management into a new `obikindex` crate. Refactored the `index` and `unitig` commands to leverage the `KmerIndex` abstraction and state-driven pipeline transitions. Removed obsolete CLI subcommands (`count`, `fasta`, `longtig`, `partition`) and their associated pipeline steps. Updated FASTA writing utilities for single-line output and deterministic identifiers, and refreshed workspace dependencies.
This commit is contained in:
Eric Coissac
2026-05-20 18:54:12 +02:00
parent f8cfb493b8
commit 17c9e076bd
24 changed files with 792 additions and 1593 deletions
+27 -3
View File
@@ -1,4 +1,28 @@
## Dans OBILayeredMap
## Chose à vérifier suite à la commande index
- Est-ce que CachelineEfVec est vraiment justifier dans notre cas. vu les contraintes sur la distribution des valeurs imposées par CachelineEfVec en terme d'ordre, de grandeur et de dispersion ?
- Il semble que le count de kmer soit stocké, ce qui doit-être une possibilité pas une obligation.
- partition.meta ne devrait plus exister
- les spectrums globaux devrait etre identifier par génome
- regrouper dans un sous-dossier spectrums à la racine de l'index avec un nom basé sur le génome
- les spectrum patiels ont-ils vocation à être conserver ?
- l'étape de déreplication dure quasiment autant de temps que le comptage mais ne laisse aucune trace de progression à l'utilisateur
## commandes à ajouter
- merge : pour construire un index à partir d'index existants
- deux modes : count et presence/absence. count exige que tous les index mergés soient déjà en mode count. mode presence/absence par defaut. Si passage de mode count à mode presence/absence, par defaut presence = count >= 1. Possibilité de spécifier un seuil personnalisé.
- filter : produit un nouvel index filtré à partir d'un index existant en verifiant que les kmer présents dans le nouvel index respectent les critères de filtrage spécifiés
- quorum de presence en fraction-(min/max) du nombre de génomes, en nombre-(min/max) de génomes, si mode count la présence peut être défini par un seuil personnalisé minimum et maximum
- aggregate : aggrege toutes les colonnes d'une matrice d'index en une seule colonne.
- query : scan un fichier de sequences et retourne pour chaque sequence quels kmer sont présents dans l'index et dans quel genomes
- distance : calcule la matrice de distance entre les genomes
- proposer une option pour chaque distance à calculer
- un possibité de récuperer la matrice des kmer communs
- un possibité de calculer l'arbre nj
- les matrices sont sauvegardées en CSV
- les arbres NJ sont sauvegardés en Newick avec les longeurs de branche
- dump : une table csv de l'index avec les kmer et les genomes associés en mode count ou presence/absence avec une option pour forcer le mode presence/absence meme si l'index est en mode count. Par defaut, le mode count est utilisé pour les index en mode count et le mode presence/absence pour les index en mode presence/absence.
+62 -658
View File
File diff suppressed because it is too large Load Diff
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace]
resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys"]
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex"]
[profile.release]
debug = 1
-109
View File
@@ -1,12 +1,10 @@
//use ahash::RandomState;
use hashbrown::HashMap;
use obifastwrite::write_unitig;
use obikseq::k;
use obikseq::unitig::Unitig;
use obikseq::{CanonicalKmer, Kmer, Sequence};
use std::cell::Cell;
use std::fmt;
use std::io;
use xxhash_rust::xxh3::Xxh3Builder;
// ── Types ─────────────────────────────────────────────────────────────────────
@@ -293,59 +291,6 @@ impl GraphDeBruijn {
Some(oriented)
}
fn next_longtig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
let canonical = kmer.canonical();
let node = self.nodes.get(&canonical)?.get();
let direct = kmer.raw() == canonical.raw();
if (direct && node.n_right_neighbours() == 0) || (!direct && node.n_left_neighbours() == 0)
{
return None;
}
let next_c: CanonicalKmer = if direct {
if node.can_extend_right() {
canonical
.into_kmer()
.push_right(node.right_nuc())
.canonical()
} else {
self.iter_right_neighbors(canonical)
.filter(|n| !self.is_visited(n).unwrap_or(true))
.next()?
}
} else {
if node.can_extend_left() {
canonical.into_kmer().push_left(node.left_nuc()).canonical()
} else {
self.iter_left_neighbors(canonical)
.filter(|n| !self.is_visited(n).unwrap_or(true))
.next()?
}
};
let cell = self.nodes.get(&next_c)?;
let next_node = cell.get();
if next_node.is_visited() {
return None;
}
let oriented = oriented_next(kmer, next_c);
let ndirect = oriented.raw() == next_c.raw();
if (ndirect && next_node.n_right_neighbours() > 1)
|| (!ndirect && next_node.n_left_neighbours() > 1)
{
return None;
}
let mut updated = next_node;
updated.set_visited();
cell.set(updated);
Some(oriented)
}
fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
UnitigIter {
graph: self,
@@ -353,13 +298,6 @@ impl GraphDeBruijn {
}
}
fn iter_longtig_kmers(&self, start: Kmer) -> LongtigIter<'_> {
LongtigIter {
graph: self,
current: Some(start),
}
}
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
let k = k();
self.start_iter().map(move |(start, first_next)| {
@@ -373,36 +311,6 @@ impl GraphDeBruijn {
})
}
pub fn iter_longtig(&self) -> impl Iterator<Item = Unitig> + '_ {
let k = k();
self.start_iter().map(move |(start, first_next)| {
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
if let Some(next_c) = first_next {
for kmer in self.iter_longtig_kmers(next_c) {
nucs.push(kmer.nucleotide(k - 1));
}
}
Unitig::from_nucleotides(&nucs)
})
}
/// Write all unitigs to `out` in FASTA format.
///
/// Calls [`obifastwrite::write_unitig`] for each unitig produced by
/// [`iter_unitig`]. Stops and returns the first I/O error encountered.
pub fn write_fasta<W: io::Write>(&self, out: &mut W, unitig: bool) -> io::Result<()> {
if unitig {
for unitig in self.iter_unitig() {
write_unitig(&unitig, k(), out)?;
}
} else {
for unitig in self.iter_longtig() {
write_unitig(&unitig, k(), out)?;
}
}
Ok(())
}
pub fn len(&self) -> usize {
self.nodes.len()
}
@@ -516,23 +424,6 @@ impl Iterator for UnitigIter<'_> {
}
}
// ── UnitigIter ────────────────────────────────────────────────────────────────
struct LongtigIter<'a> {
graph: &'a GraphDeBruijn,
current: Option<Kmer>,
}
impl Iterator for LongtigIter<'_> {
type Item = Kmer;
fn next(&mut self) -> Option<Kmer> {
let current = self.current?;
self.current = self.graph.next_longtig_kmer(current);
Some(current)
}
}
// ── helpers ───────────────────────────────────────────────────────────────────
fn oriented_next(from: Kmer, to: CanonicalKmer) -> Kmer {
+31 -13
View File
@@ -1,9 +1,11 @@
use std::fmt;
use std::io::{self, Write};
use xxhash_rust::xxh64::xxh64;
pub(crate) enum JsonVal<'a> {
/// A JSON value that is either a number or a quoted string.
pub enum JsonVal<'a> {
/// Integer value, serialised without quotes.
Num(u64),
/// String value, serialised with double quotes.
Str(&'a str),
}
@@ -16,11 +18,8 @@ impl fmt::Display for JsonVal<'_> {
}
}
pub(crate) fn seq_id(ascii: &[u8]) -> String {
format!("{:016X}", xxh64(ascii, 0))
}
pub(crate) fn annotation<W: Write>(
/// Write a JSON object `{"k1":v1,"k2":v2,...}` to `writer`.
pub fn annotation<W: Write>(
writer: &mut W,
fields: &[(&str, JsonVal<'_>)],
) -> io::Result<()> {
@@ -34,10 +33,29 @@ pub(crate) fn annotation<W: Write>(
write!(writer, "}}")
}
pub(crate) fn write_sequence<W: Write>(writer: &mut W, seq: &[u8], width: usize) -> io::Result<()> {
for chunk in seq.chunks(width) {
// SAFETY: seq is valid UTF-8; any contiguous slice of ASCII bytes is too
writeln!(writer, "{}", unsafe { std::str::from_utf8_unchecked(chunk) })?;
}
Ok(())
/// xxHash-64 of `ascii`, formatted as 16 uppercase hex digits.
pub fn seq_id(ascii: &[u8]) -> String {
use xxhash_rust::xxh64::xxh64;
format!("{:016X}", xxh64(ascii, 0))
}
/// Write `seq` as one line of ASCII DNA, followed by a newline.
pub fn write_sequence<W: Write>(writer: &mut W, seq: &[u8]) -> io::Result<()> {
// SAFETY: seq is valid ASCII DNA (A/C/G/T).
writeln!(writer, "{}", unsafe { std::str::from_utf8_unchecked(seq) })
}
/// Core FASTA record writer.
///
/// Writes `>{id} {annotation}\n{sequence}\n`.
pub fn write_record<W: Write>(
seq: &[u8],
id: &str,
fields: &[(&str, JsonVal<'_>)],
out: &mut W,
) -> io::Result<()> {
write!(out, ">{id} ")?;
annotation(out, fields)?;
writeln!(out)?;
write_sequence(out, seq)
}
+89 -116
View File
@@ -1,32 +1,20 @@
//! FASTA serialisation of [`SuperKmer`] values.
//! FASTA serialisation for obikmer sequence types.
//!
//! Two functions cover the two phases of the scatter pipeline:
//! Three public functions cover the main output cases:
//!
//! - [`write_scatter`]: scatter phase (before routing). The header annotation
//! contains the minimizer sequence decoded from [`SuperKmer::minimizer_pos`].
//! - [`write_scatter`]: super-kmers in scatter phase (minimizer annotation)
//! - [`write_count`]: super-kmers in count phase (occurrence count annotation)
//! - [`write_unitig`]: unitigs from the layered index (partition + index annotation)
//!
//! - [`write_count`]: count phase (after deduplication). The header annotation
//! contains the occurrence count from [`SuperKmer::count`].
//!
//! Both functions write standard OBITools-compatible FASTA:
//! All produce OBITools-compatible FASTA:
//!
//! ```text
//! >ID {"seq_length":32,"kmer_size":31,"minimizer_size":11,"partition":42,"minimizer":"CGTGCTAGATC"}
//! GCTAGCATGCTAGCTGTAGCTGTGAGTGCTG
//! >ID {"key":value,...}
//! SEQUENCE
//! ```
//!
//! The record identifier is the xxHash-64 of the ASCII sequence, formatted as
//! a 16-digit uppercase hexadecimal string. xxHash-64 is collision-resistant
//! enough for debugging identifiers (collision probability < 1e-9 for billions
//! of distinct super-kmers).
//!
//! # Phase contract
//!
//! `write_scatter` reads [`SuperKmer::minimizer_pos`], which is only valid
//! **before** [`SuperKmer::init_count`] is called. `write_count` reads
//! [`SuperKmer::count`], which is only meaningful **after** `init_count`.
//! Mixing the two functions in the wrong phase produces silently wrong output;
//! this is enforced by pipeline structure, not by the type system.
//! The lower-level primitive [`write_record`] and the [`JsonVal`] type are also
//! public for callers that need custom annotations.
#![deny(missing_docs)]
@@ -35,22 +23,15 @@ mod fasta;
use std::io::{self, Write};
use obikseq::{Minimizer, SuperKmer, Unitig};
use xxhash_rust::xxh64::xxh64;
pub use fasta::{JsonVal, annotation, seq_id, write_record};
// ── public API ────────────────────────────────────────────────────────────────
/// Write one super-kmer in FASTA format — **scatter phase**.
///
/// The `minimizer` field in the JSON annotation contains the ASCII sequence of
/// the minimizer, decoded from [`SuperKmer::minimizer_pos`] (scatter-phase
/// value of the payload field).
///
/// # Parameters
/// - `sk`: the super-kmer to serialise (must be in scatter phase)
/// - `out`: destination writer
/// - `k`: k-mer size used to build `sk`
/// - `m`: minimizer size
/// - `partition`: partition index computed from the minimizer hash
/// ID is the xxHash-64 of the sequence. JSON annotation includes
/// `seq_length`, `kmer_size`, `minimizer_size`, `partition`, `minimizer`.
pub fn write_scatter<W: Write>(
sk: &SuperKmer,
out: &mut W,
@@ -61,37 +42,26 @@ pub fn write_scatter<W: Write>(
) -> io::Result<()> {
let ascii = sk.to_ascii();
let id = seq_id(&ascii);
let seq_len = ascii.len();
let min_seq = minimizer.to_ascii();
writeln!(
let min_str = unsafe { std::str::from_utf8_unchecked(&min_seq) };
write_record(
&ascii,
&id,
&[
("seq_length", JsonVal::Num(ascii.len() as u64)),
("kmer_size", JsonVal::Num(k as u64)),
("minimizer_size",JsonVal::Num(m as u64)),
("partition", JsonVal::Num(partition as u64)),
("minimizer", JsonVal::Str(min_str)),
],
out,
">{id} {{\"seq_length\":{seq_len},\"kmer_size\":{k},\
\"minimizer_size\":{m},\"partition\":{partition},\
\"minimizer\":\"{min}\"}}",
id = id,
seq_len = seq_len,
k = k,
m = m,
partition = partition,
min = unsafe { std::str::from_utf8_unchecked(&min_seq) },
)?;
out.write_all(&ascii)?;
out.write_all(b"\n")
)
}
/// Write one super-kmer in FASTA format — **count phase**.
///
/// The `count` field in the JSON annotation contains the occurrence count from
/// [`SuperKmer::count`] (count-phase value of the payload field).
///
/// # Parameters
/// - `sk`: the super-kmer to serialise (must be in count phase, i.e. after
/// [`SuperKmer::init_count`] has been called)
/// - `out`: destination writer
/// - `k`: k-mer size
/// - `m`: minimizer size
/// - `partition`: partition index
/// ID is the xxHash-64 of the sequence. JSON annotation includes
/// `seq_length`, `kmer_size`, `minimizer_size`, `partition`, `count`.
pub fn write_count<W: Write>(
sk: &SuperKmer,
out: &mut W,
@@ -101,52 +71,47 @@ pub fn write_count<W: Write>(
) -> io::Result<()> {
let ascii = sk.to_ascii();
let id = seq_id(&ascii);
let seq_len = ascii.len();
let count = sk.count();
writeln!(
write_record(
&ascii,
&id,
&[
("seq_length", JsonVal::Num(ascii.len() as u64)),
("kmer_size", JsonVal::Num(k as u64)),
("minimizer_size",JsonVal::Num(m as u64)),
("partition", JsonVal::Num(partition as u64)),
("count", JsonVal::Num(sk.count() as u64)),
],
out,
">{id} {{\"seq_length\":{seq_len},\"kmer_size\":{k},\
\"minimizer_size\":{m},\"partition\":{partition},\
\"count\":{count}}}",
id = id,
seq_len = seq_len,
k = k,
m = m,
partition = partition,
count = count,
)?;
out.write_all(&ascii)?;
out.write_all(b"\n")
)
}
/// Write one unitig in FASTA format.
///
/// Header annotation (JSON):
/// ```text
/// >HASH {"seq_length":<seql>,"kmer_size":<k>,"n_kmers":<seql-k+1>}
/// ```
///
/// `HASH` is the xxHash-64 of the ASCII sequence (16 uppercase hex digits).
/// `n_kmers` is the number of distinct k-mers covered by this unitig.
pub fn write_unitig<W: Write>(unitig: &Unitig, k: usize, out: &mut W) -> io::Result<()> {
/// ID is `part_PPPPP_unitig_IIIIII` where `P` is the partition index and `I`
/// is the unitig index within that partition. JSON annotation includes
/// `seq_length`, `kmer_size`, `n_kmers`, `partition`, `unitig_index`.
pub fn write_unitig<W: Write>(
unitig: &Unitig,
k: usize,
partition: usize,
index: usize,
out: &mut W,
) -> io::Result<()> {
let ascii = unitig.to_ascii();
let id = seq_id(&ascii);
let seql = unitig.seql();
let n_kmers = seql - k + 1;
writeln!(
let id = format!("part_{partition:05}_unitig_{index:06}");
write_record(
&ascii,
&id,
&[
("seq_length", JsonVal::Num(seql as u64)),
("kmer_size", JsonVal::Num(k as u64)),
("n_kmers", JsonVal::Num((seql - k + 1) as u64)),
("partition", JsonVal::Num(partition as u64)),
("unitig_index", JsonVal::Num(index as u64)),
],
out,
">{id} {{\"seq_length\":{seql},\"kmer_size\":{k},\"n_kmers\":{n_kmers}}}",
)?;
out.write_all(&ascii)?;
out.write_all(b"\n")
}
// ── internal helpers ──────────────────────────────────────────────────────────
/// xxHash-64 of the ASCII sequence, formatted as 16 uppercase hex digits.
fn seq_id(ascii: &[u8]) -> String {
format!("{:016X}", xxh64(ascii, 0))
)
}
// ── tests ─────────────────────────────────────────────────────────────────────
@@ -178,9 +143,6 @@ mod tests {
#[test]
fn scatter_minimizer_decoded_from_hash() {
// "ACG" right-aligned: A=00, C=01, G=10 → 0b000110 = 6
// Left-aligned for m=3: shift by 64 2·3 = 58.
// set_m(3) so that Minimizer::to_ascii() decodes exactly 3 bases.
obikseq::params::set_m(3);
let sk = make(b"ACGTACGTACGT");
let minimizer = Minimizer::from_raw_unchecked(6u64 << (64 - 2 * 3));
@@ -230,13 +192,34 @@ mod tests {
#[test]
fn count_sequence_line_correct() {
// TTTTACGT canonicalises to ACGTAAAA (revcomp is ACGTAAAA < TTTTACGT)
let sk = make(b"TTTTACGT");
let out = capture(|w| write_count(&sk, w, 4, 2, 0));
let lines: Vec<&str> = out.lines().collect();
assert_eq!(lines[1], "ACGTAAAA");
}
// ── write_unitig ──────────────────────────────────────────────────────────
#[test]
fn unitig_id_format() {
obikseq::params::set_k(4);
let unitig = obikseq::packed_seq::PackedSeq::from_ascii(b"ACGTACGT");
let out = capture(|w| write_unitig(&unitig, 4, 3, 17, w));
let id = out.lines().next().unwrap();
assert!(id.starts_with(">part_00003_unitig_000017"), "got: {id}");
}
#[test]
fn unitig_annotation_fields() {
obikseq::params::set_k(4);
let unitig = obikseq::packed_seq::PackedSeq::from_ascii(b"ACGTACGT");
let out = capture(|w| write_unitig(&unitig, 4, 2, 5, w));
assert!(out.contains("\"partition\":2"));
assert!(out.contains("\"unitig_index\":5"));
assert!(out.contains("\"n_kmers\":5"));
assert!(out.contains("\"kmer_size\":4"));
}
// ── ID stability ──────────────────────────────────────────────────────────
#[test]
@@ -260,7 +243,7 @@ mod tests {
.next()
.unwrap()[1..]
.to_string();
assert_eq!(id1, id2, "same sequence must produce same ID");
assert_eq!(id1, id2);
}
#[test]
@@ -269,21 +252,11 @@ mod tests {
let sk2 = make(b"TTTTTTTT");
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
.lines()
.next()
.unwrap()
.split_whitespace()
.next()
.unwrap()[1..]
.to_string();
.lines().next().unwrap()
.split_whitespace().next().unwrap()[1..].to_string();
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
.lines()
.next()
.unwrap()
.split_whitespace()
.next()
.unwrap()[1..]
.to_string();
.lines().next().unwrap()
.split_whitespace().next().unwrap()[1..].to_string();
assert_ne!(id1, id2);
}
@@ -291,7 +264,7 @@ mod tests {
fn id_is_16_hex_digits() {
let sk = make(b"ACGTACGT");
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)));
let id = &out.lines().next().unwrap()[1..17]; // skip '>'
let id = &out.lines().next().unwrap()[1..17];
assert_eq!(id.len(), 16);
assert!(id.chars().all(|c| c.is_ascii_hexdigit()));
}
+21
View File
@@ -0,0 +1,21 @@
[package]
name = "obikindex"
version = "0.1.0"
edition = "2024"
[dependencies]
obikpartitionner = { path = "../obikpartitionner" }
obikseq = { path = "../obikseq" }
obisys = { path = "../obisys" }
obiskio = { path = "../obiskio" }
obidebruinj = { path = "../obidebruinj" }
obilayeredmap = { path = "../obilayeredmap" }
obicompactvec = { path = "../obicompactvec" }
cacheline-ef = "1.1"
epserde = "0.8"
ptr_hash = "1.1"
rayon = "1"
serde = { version = "1", features = ["derive"] }
serde_json = "1"
indicatif = "0.17"
tracing = "0.1.44"
+53
View File
@@ -0,0 +1,53 @@
use std::fmt;
use std::io;
use obiskio::SKError;
use obilayeredmap::OLMError;
#[derive(Debug)]
pub enum OKIError {
Io(io::Error),
Json(serde_json::Error),
Partition(SKError),
Layer(OLMError),
}
pub type OKIResult<T> = Result<T, OKIError>;
impl fmt::Display for OKIError {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
match self {
OKIError::Io(e) => write!(f, "I/O error: {e}"),
OKIError::Json(e) => write!(f, "JSON error: {e}"),
OKIError::Partition(e) => write!(f, "partition error: {e}"),
OKIError::Layer(e) => write!(f, "layer error: {e}"),
}
}
}
impl std::error::Error for OKIError {
fn source(&self) -> Option<&(dyn std::error::Error + 'static)> {
match self {
OKIError::Io(e) => Some(e),
OKIError::Json(e) => Some(e),
OKIError::Partition(e) => Some(e),
OKIError::Layer(e) => Some(e),
}
}
}
impl From<io::Error> for OKIError {
fn from(e: io::Error) -> Self { OKIError::Io(e) }
}
impl From<serde_json::Error> for OKIError {
fn from(e: serde_json::Error) -> Self { OKIError::Json(e) }
}
impl From<SKError> for OKIError {
fn from(e: SKError) -> Self { OKIError::Partition(e) }
}
impl From<OLMError> for OKIError {
fn from(e: OLMError) -> Self { OKIError::Layer(e) }
}
+301
View File
@@ -0,0 +1,301 @@
use std::fs;
use std::path::{Path, PathBuf};
use std::sync::atomic::{AtomicUsize, Ordering};
use std::sync::{Arc, Mutex};
use cacheline_ef::{CachelineEf, CachelineEfVec};
use epserde::prelude::*;
use indicatif::{ProgressBar, ProgressStyle};
use obicompactvec::{PersistentCompactIntMatrix, PersistentCompactIntVec};
use obidebruinj::GraphDeBruijn;
use obikpartitionner::KmerPartition;
use obilayeredmap::layer::Layer;
use obiskio::{SKFileMeta, SKFileReader};
use obisys::{Reporter, Stage};
use ptr_hash::{PtrHash, bucket_fn::CubicEps, hash::Xx64};
use rayon::prelude::*;
use tracing::info;
use crate::error::{OKIError, OKIResult};
use crate::meta::{IndexConfig, IndexMeta};
use crate::state::{IndexState, SENTINEL_INDEXED, SENTINEL_SCATTERED};
type Mphf = PtrHash<u64, CubicEps, CachelineEfVec<Vec<CachelineEf>>, Xx64, Vec<u8>>;
pub struct KmerIndex {
root_path: PathBuf,
meta: IndexMeta,
partition: KmerPartition,
}
impl KmerIndex {
/// Create a new index at `path`.
///
/// If `genome_label` is `Some`, it is stored immediately.
/// If `None`, the label will be derived from the first scatter input path
/// when `mark_scattered` is called.
pub fn create<P: AsRef<Path>>(
path: P,
config: IndexConfig,
genome_label: Option<String>,
force: bool,
) -> OKIResult<Self> {
let root_path = path.as_ref().to_owned();
let partition = KmerPartition::create(
&root_path,
config.n_bits,
config.kmer_size,
config.minimizer_size,
force,
)?;
let mut meta = IndexMeta::new(config);
if let Some(label) = genome_label {
meta.genomes.push(label);
}
meta.write(&root_path)?;
Ok(Self { root_path, meta, partition })
}
pub fn open<P: AsRef<Path>>(path: P) -> OKIResult<Self> {
let root_path = path.as_ref().to_owned();
let meta = IndexMeta::read(&root_path).map_err(OKIError::Io)?;
let partition = KmerPartition::open(&root_path)?;
Ok(Self { root_path, meta, partition })
}
/// Return `true` if `path` contains an `index.meta` file.
pub fn exists<P: AsRef<Path>>(path: P) -> bool {
IndexMeta::exists(path.as_ref())
}
/// Current construction state, as reported by sentinel files on disk.
pub fn state(&self) -> IndexState {
IndexState::detect(&self.root_path).unwrap_or(IndexState::Empty)
}
pub fn meta(&self) -> &IndexMeta { &self.meta }
pub fn kmer_size(&self) -> usize { self.meta.config.kmer_size }
pub fn minimizer_size(&self) -> usize { self.meta.config.minimizer_size }
pub fn n_partitions(&self) -> usize { self.partition.n_partitions() }
/// Expose the inner partition so the caller can run scatter into it.
/// Call `mark_scattered` once scatter is complete.
pub fn partition_mut(&mut self) -> &mut KmerPartition {
&mut self.partition
}
/// Mark scatter as complete and write `scatter.done`.
///
/// If no genome label was set at creation time, one is derived from
/// `first_scatter_path` (filename stripped of all extensions).
/// If `first_scatter_path` is also `None`, the label defaults to `"unknown"`.
pub fn mark_scattered(&mut self, first_scatter_path: Option<&Path>) -> OKIResult<()> {
if self.meta.genomes.is_empty() {
let label = first_scatter_path
.map(label_from_path)
.unwrap_or_else(|| "unknown".to_string());
self.meta.genomes.push(label);
self.meta.write(&self.root_path)?;
}
touch(&self.root_path.join(SENTINEL_SCATTERED))?;
Ok(())
}
/// Dereplicate all partitions then compute kmer counts.
///
/// Writes `kmer_spectrum_raw.json` at the index root upon completion
/// (this file doubles as the `Counted` sentinel).
pub fn dereplicate_and_count(&self, rep: &mut Reporter) -> OKIResult<()> {
let t = Stage::start("dereplicate");
self.partition.dereplicate()?;
rep.push(t.stop());
let t = Stage::start("count_kmer");
self.partition.count_kmer()?;
rep.push(t.stop());
Ok(())
}
/// Build the layered MPHF index for all partitions.
///
/// Default mode (`config.with_counts = false`): set membership only.
/// With counts: count matrix per kmer.
///
/// Writes `index.done` upon completion.
/// Path to the unitigs file for partition `part`, layer `layer`.
pub fn layer_unitigs_path(&self, part: usize, layer: usize) -> PathBuf {
self.partition.part_dir(part)
.join("index")
.join(format!("layer_{layer}"))
.join("unitigs.bin")
}
pub fn build_layers(
&self,
min_ab: u32,
max_ab: Option<u32>,
keep_intermediate: bool,
rep: &mut Reporter,
) -> OKIResult<()> {
let n = self.partition.n_partitions();
let t = Stage::start("index");
let with_counts = self.meta.config.with_counts;
let filter_active = min_ab > 1 || max_ab.is_some();
let need_counts = filter_active || with_counts;
let total_kmers = AtomicUsize::new(0);
let partition = &self.partition;
let pb = Arc::new(Mutex::new(
ProgressBar::new(n as u64).with_style(
ProgressStyle::with_template("index — [{bar:20}] {pos}/{len} | {msg}").unwrap(),
),
));
(0..n).into_par_iter().for_each(|i| {
let part_dir = partition.part_dir(i);
let dedup_path = part_dir.join("dereplicated.skmer.zst");
if !dedup_path.exists() {
return;
}
let layer_dir = part_dir.join("index").join("layer_0");
if layer_dir.join("mphf.bin").exists() {
return;
}
let mphf1_opt: Option<Mphf> = if need_counts {
let p = part_dir.join("mphf1.bin");
p.exists().then(|| Mphf::load_full(&p).ok()).flatten()
} else {
None
};
let counts1_opt: Option<PersistentCompactIntVec> = if need_counts {
let p = part_dir.join("counts1.bin");
p.exists()
.then(|| PersistentCompactIntVec::open(&p).ok())
.flatten()
} else {
None
};
let mut g = GraphDeBruijn::new();
let mut reader = SKFileReader::open(&dedup_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", dedup_path.display());
std::process::exit(1);
});
for sk in reader.iter() {
for kmer in sk.iter_canonical_kmers() {
let accept = if filter_active {
match (&mphf1_opt, &counts1_opt) {
(Some(mphf), Some(counts)) => {
let ab = counts.get(mphf.index(&kmer.raw()));
ab >= min_ab && max_ab.map_or(true, |max| ab <= max)
}
_ => true,
}
} else {
true
};
if accept {
g.push(kmer);
}
}
}
let n_kmers = g.len();
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
g.compute_degrees();
fs::create_dir_all(&layer_dir).unwrap_or_else(|e| {
eprintln!("error creating {}: {e}", layer_dir.display());
std::process::exit(1);
});
let mut uw = Layer::<()>::unitig_writer(&layer_dir).unwrap_or_else(|e| {
eprintln!("error creating unitig writer (partition {i}): {e}");
std::process::exit(1);
});
for unitig in g.iter_unitig() {
uw.write(&unitig).unwrap_or_else(|e| {
eprintln!("error writing unitig (partition {i}): {e}");
std::process::exit(1);
});
}
uw.close().unwrap_or_else(|e| {
eprintln!("error closing unitig writer (partition {i}): {e}");
std::process::exit(1);
});
if with_counts {
Layer::<PersistentCompactIntMatrix>::build(&layer_dir, |kmer| {
match (&mphf1_opt, &counts1_opt) {
(Some(mphf), Some(counts)) => counts.get(mphf.index(&kmer.raw())),
_ => 1,
}
})
.unwrap_or_else(|e| {
eprintln!("error building count layer (partition {i}): {e}");
std::process::exit(1);
});
} else {
Layer::<()>::build(&layer_dir).unwrap_or_else(|e| {
eprintln!("error building set layer (partition {i}): {e}");
std::process::exit(1);
});
}
let pb = pb.lock().unwrap();
pb.inc(1);
pb.set_message(format!("{i}: {n_kmers} kmers"));
});
pb.lock().unwrap().finish_and_clear();
info!(
"done — {} total kmers indexed",
total_kmers.load(Ordering::Relaxed)
);
if !keep_intermediate {
for i in 0..n {
let part_dir = partition.part_dir(i);
remove_if_exists(&part_dir.join("dereplicated.skmer.zst"));
remove_if_exists(&SKFileMeta::sidecar_path(
&part_dir.join("dereplicated.skmer.zst"),
));
remove_if_exists(&part_dir.join("mphf1.bin"));
remove_if_exists(&part_dir.join("counts1.bin"));
}
}
touch(&self.root_path.join(SENTINEL_INDEXED))?;
rep.push(t.stop());
Ok(())
}
}
/// Derive a genome label from a file path: filename stripped of all extensions.
fn label_from_path(path: &Path) -> String {
let name = path
.file_name()
.unwrap_or(path.as_os_str())
.to_string_lossy()
.into_owned();
let mut s = name;
while let Some(pos) = s.rfind('.') {
s.truncate(pos);
}
if s.is_empty() { "unknown".to_string() } else { s }
}
fn touch(path: &Path) -> Result<(), std::io::Error> {
fs::File::create(path).map(|_| ())
}
fn remove_if_exists(path: &Path) {
if let Err(e) = fs::remove_file(path) {
if e.kind() != std::io::ErrorKind::NotFound {
eprintln!("warning: could not remove {}: {e}", path.display());
}
}
}
+9
View File
@@ -0,0 +1,9 @@
pub mod error;
pub mod meta;
pub mod state;
mod index;
pub use error::{OKIError, OKIResult};
pub use index::KmerIndex;
pub use meta::{IndexConfig, IndexMeta, META_FILENAME};
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
+45
View File
@@ -0,0 +1,45 @@
use std::fs;
use std::io;
use std::path::Path;
use serde::{Deserialize, Serialize};
pub const META_FILENAME: &str = "index.meta";
const META_VERSION: u32 = 1;
#[derive(Debug, Clone, Serialize, Deserialize)]
pub struct IndexConfig {
pub kmer_size: usize,
pub minimizer_size: usize,
pub n_bits: usize,
pub with_counts: bool,
}
#[derive(Debug, Clone, Serialize, Deserialize)]
pub struct IndexMeta {
pub version: u32,
pub config: IndexConfig,
/// Ordered list of genome labels indexed here.
/// Element 0 is the initial genome; subsequent entries come from merges.
pub genomes: Vec<String>,
}
impl IndexMeta {
pub fn new(config: IndexConfig) -> Self {
Self { version: META_VERSION, config, genomes: Vec::new() }
}
pub fn write(&self, root: &Path) -> io::Result<()> {
let file = fs::File::create(root.join(META_FILENAME))?;
serde_json::to_writer_pretty(file, self).map_err(io::Error::other)
}
pub fn read(root: &Path) -> io::Result<Self> {
let file = fs::File::open(root.join(META_FILENAME))?;
serde_json::from_reader(file).map_err(io::Error::other)
}
pub fn exists(root: &Path) -> bool {
root.join(META_FILENAME).exists()
}
}
+45
View File
@@ -0,0 +1,45 @@
use std::path::Path;
use crate::meta::META_FILENAME;
pub const SENTINEL_SCATTERED: &str = "scatter.done";
pub const SENTINEL_COUNTED: &str = "kmer_spectrum_raw.json";
pub const SENTINEL_INDEXED: &str = "index.done";
/// Progression state of a `KmerIndex`.
///
/// Variants are ordered: `Empty < Scattered < Counted < Indexed`.
/// A state is reported only when its sentinel file is fully present —
/// partial states (e.g. scatter interrupted mid-way) are not accepted.
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord)]
pub enum IndexState {
/// `index.meta` present; scatter not yet completed.
Empty,
/// `scatter.done` sentinel present — all super-kmers have been routed.
Scattered,
/// `kmer_spectrum_raw.json` present — dereplicate + count complete.
Counted,
/// `index.done` sentinel present — layered MPHF index fully built.
Indexed,
}
impl IndexState {
/// Detect the state of the index at `root`.
///
/// Returns `None` if `index.meta` is absent (not an obikindex directory).
pub fn detect(root: &Path) -> Option<Self> {
if !root.join(META_FILENAME).exists() {
return None;
}
if root.join(SENTINEL_INDEXED).exists() {
return Some(Self::Indexed);
}
if root.join(SENTINEL_COUNTED).exists() {
return Some(Self::Counted);
}
if root.join(SENTINEL_SCATTERED).exists() {
return Some(Self::Scattered);
}
Some(Self::Empty)
}
}
+2 -10
View File
@@ -13,21 +13,13 @@ obiread = { path = "../obiread" }
obiskbuilder = { path = "../obiskbuilder" }
obifastwrite = { path = "../obifastwrite" }
obipipeline = { path = "../obipipeline" }
obidebruinj = { path = "../obidebruinj" }
clap = { version = "4", features = ["derive"] }
obikrope = { path = "../obikrope" }
obikpartitionner = { path = "../obikpartitionner" }
obisys = { path = "../obisys" }
obiskio = { path = "../obiskio" }
obicompactvec = { path = "../obicompactvec" }
obilayeredmap = { path = "../obilayeredmap" }
niffler = "3"
obikindex = { path = "../obikindex" }
clap = { version = "4", features = ["derive"] }
rayon = "1"
ph = "0.11"
memmap2 = "0.9"
epserde = "0.8"
ptr_hash = "1.1"
cacheline-ef = "1.1"
indicatif = "0.17"
tracing = "0.1.44"
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
-24
View File
@@ -1,24 +0,0 @@
use clap::Args;
use obikpartitionner::KmerPartition;
use std::path::PathBuf;
use tracing::info;
#[derive(Args)]
pub struct CountArgs {
/// Partition directory produced by the `partition` command
#[arg(short, long)]
pub partition: PathBuf,
}
pub fn run(args: CountArgs) {
let kp = KmerPartition::open(&args.partition).unwrap_or_else(|e| {
eprintln!("error: {e}");
std::process::exit(1)
});
info!("counting kmers in {}", args.partition.display());
kp.count_kmer().unwrap_or_else(|e| {
eprintln!("error: {e}");
std::process::exit(1)
});
}
-84
View File
@@ -1,84 +0,0 @@
use std::fs::File;
use std::path::PathBuf;
use std::sync::atomic::{AtomicUsize, Ordering};
use clap::Args;
use niffler::Level;
use niffler::send::compression::Format;
use obifastwrite::write_count;
use obikpartitionner::KmerPartition;
use obiskio::SKFileReader;
use rayon::prelude::*;
use tracing::info;
#[derive(Args)]
pub struct FastaArgs {
/// Root of the k-mer partition directory (produced by the `partition` command)
pub partition: PathBuf,
/// Dump dereplicated super-kmers as FASTA (→ <partition>/dereplicated.skmer.fasta.gz)
#[arg(long)]
pub super_kmers: bool,
}
pub fn run(args: FastaArgs) {
if !args.super_kmers {
eprintln!("error: specify at least one output mode (--super-kmers)");
std::process::exit(1);
}
let kp = KmerPartition::open(&args.partition).unwrap_or_else(|e| {
eprintln!("error opening partition: {e}");
std::process::exit(1)
});
if args.super_kmers {
dump_super_kmers(&kp, &args.partition);
}
}
fn dump_super_kmers(kp: &KmerPartition, _partition_dir: &PathBuf) {
let k = kp.kmer_size();
let m = kp.minimizer_size();
let n = kp.n_partitions();
info!("writing {n} partition FASTA files (parallel)");
let total = AtomicUsize::new(0);
(0..n).into_par_iter().for_each(|i| {
let part_dir = kp.part_dir(i);
let in_path = part_dir.join("dereplicated.skmer.zst");
if !in_path.exists() {
return;
}
let out_path = part_dir.join("dereplicated.skmer.fasta.gz");
let file = File::create(&out_path).unwrap_or_else(|e| {
eprintln!("error creating {}: {e}", out_path.display());
std::process::exit(1)
});
let mut writer = niffler::send::get_writer(Box::new(file), Format::Gzip, Level::Six)
.unwrap_or_else(|e| {
eprintln!("error creating gzip writer: {e}");
std::process::exit(1)
});
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", in_path.display());
std::process::exit(1)
});
let mut count = 0usize;
for sk in reader.iter() {
write_count(&sk, &mut writer, k, m, i as u32).unwrap_or_else(|e| {
eprintln!("write error: {e}");
std::process::exit(1)
});
count += 1;
}
info!("partition {i}: {count} super-kmers → {}", out_path.display());
total.fetch_add(count, Ordering::Relaxed);
});
info!("wrote {} super-kmers total", total.load(Ordering::Relaxed));
}
+56 -34
View File
@@ -1,17 +1,17 @@
use std::path::PathBuf;
use clap::Args;
use obikpartitionner::KmerPartition;
use obikindex::{IndexConfig, IndexState, KmerIndex};
use obikseq::{set_k, set_m};
use obisys::Reporter;
use tracing::info;
use crate::cli::CommonArgs;
use crate::steps::{build_index, dereplicate_and_count, scatter};
use crate::steps::scatter;
#[derive(Args)]
pub struct IndexArgs {
/// Output partition directory
/// Output index directory
#[arg(short, long)]
pub output: PathBuf,
@@ -19,6 +19,10 @@ pub struct IndexArgs {
#[arg(long, default_value_t = false)]
pub force: bool,
/// Genome label (default: input filename without path/extension)
#[arg(long)]
pub label: Option<String>,
/// Minimum kmer abundance (inclusive)
#[arg(long, default_value_t = 1)]
pub min_abundance: u32,
@@ -43,53 +47,71 @@ pub fn run(args: IndexArgs) {
let output = args.output.clone();
let mut rep = Reporter::new();
// ── Stage 1: scatter (skipped if partition already exists) ───────────────
let kp = if output.join("partition.meta").exists() {
info!("resuming from existing partition at {}", output.display());
let kp = KmerPartition::open(&output).unwrap_or_else(|e| {
eprintln!("error opening partition: {e}");
// ── Open or create the index ─────────────────────────────────────────────
let mut idx = if KmerIndex::exists(&output) {
info!("resuming from existing index at {}", output.display());
KmerIndex::open(&output).unwrap_or_else(|e| {
eprintln!("error opening index: {e}");
std::process::exit(1);
});
set_k(kp.kmer_size());
set_m(kp.minimizer_size());
kp
})
} else {
let k = args.common.kmer_size;
set_k(k);
let m = args.common.minimizer_size;
set_m(m);
let theta = args.common.theta;
let config = IndexConfig {
kmer_size: args.common.kmer_size,
minimizer_size: args.common.minimizer_size,
n_bits: args.common.partition_bits,
with_counts: args.with_counts,
};
KmerIndex::create(&output, config, args.label.clone(), args.force).unwrap_or_else(|e| {
eprintln!("error creating index: {e}");
std::process::exit(1);
})
};
set_k(idx.kmer_size());
set_m(idx.minimizer_size());
// ── Stage 1: scatter ─────────────────────────────────────────────────────
if idx.state() < IndexState::Scattered {
let first_path = args.common.inputs.first().map(PathBuf::from);
let k = idx.kmer_size();
let level_max = args.common.level_max;
let theta = args.common.theta;
let n_workers = args.common.threads.max(1);
let mut kp =
KmerPartition::create(&output, args.common.partition_bits, k, m, args.force)
.unwrap_or_else(|e| {
scatter(idx.partition_mut(), args.common.seqfile_paths(), k, level_max, theta, n_workers, &mut rep);
idx.mark_scattered(first_path.as_deref()).unwrap_or_else(|e| {
eprintln!("error marking scatter done: {e}");
std::process::exit(1);
});
} else {
info!("scatter already done, skipping");
}
// ── Stage 2: dereplicate + count ─────────────────────────────────────────
if idx.state() < IndexState::Counted {
idx.dereplicate_and_count(&mut rep).unwrap_or_else(|e| {
eprintln!("error: {e}");
std::process::exit(1);
});
scatter(&mut kp, args.common.seqfile_paths(), k, level_max, theta, n_workers, &mut rep);
kp
};
// ── Stage 2: dereplicate + count (skipped if already done) ───────────────
if !output.join("kmer_spectrum_raw.json").exists() {
dereplicate_and_count(&kp, &mut rep);
} else {
info!("kmer counts already present, skipping dereplicate + count");
info!("dereplicate+count already done, skipping");
}
// ── Stage 3: build layered index ─────────────────────────────────────────
build_index(
&kp,
if idx.state() < IndexState::Indexed {
idx.build_layers(
args.min_abundance,
args.max_abundance,
args.with_counts,
args.keep_intermediate,
&mut rep,
);
).unwrap_or_else(|e| {
eprintln!("error: {e}");
std::process::exit(1);
});
} else {
info!("index already built, skipping");
}
rep.print();
}
-143
View File
@@ -1,143 +0,0 @@
use std::fs::File;
use std::path::PathBuf;
use std::sync::atomic::{AtomicUsize, Ordering};
use clap::Args;
use niffler::Level;
use niffler::send::compression::Format;
use obidebruinj::GraphDeBruijn;
use obikpartitionner::KmerPartition;
use obikseq::set_k;
use obiskio::SKFileReader;
use ph::fmph::GOFunction;
use rayon::prelude::*;
use tracing::info;
#[derive(Args)]
pub struct LongtigArgs {
/// Root of the k-mer partition directory (produced by the `partition` command)
pub partition: PathBuf,
/// Minimum kmer abundance (inclusive); kmers below this threshold are excluded
#[arg(long, default_value_t = 1)]
pub min_abundance: u32,
/// Maximum kmer abundance (inclusive); kmers above this threshold are excluded
#[arg(long)]
pub max_abundance: Option<u32>,
}
pub fn run(args: LongtigArgs) {
let kp = KmerPartition::open(&args.partition).unwrap_or_else(|e| {
eprintln!("error opening partition: {e}");
std::process::exit(1)
});
let k = kp.kmer_size();
set_k(k);
let n = kp.n_partitions();
info!("building longtigs from {n} partitions (k={k}, parallel)");
let total_kmers = AtomicUsize::new(0);
(0..n).into_par_iter().for_each(|i| {
let part_dir = kp.part_dir(i);
let in_path = part_dir.join("dereplicated.skmer.zst");
if !in_path.exists() {
return;
}
let out_path = part_dir.join("longtig.fasta.gz");
let mut g = GraphDeBruijn::new();
let mphf_path = part_dir.join("mphf1.bin");
let counts_path = part_dir.join("counts1.bin");
let filter_active = (args.min_abundance > 1 || args.max_abundance.is_some())
&& mphf_path.exists()
&& counts_path.exists();
let mphf_opt: Option<GOFunction> = if filter_active {
let mut f = File::open(&mphf_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", mphf_path.display());
std::process::exit(1)
});
Some(GOFunction::read(&mut f).unwrap_or_else(|e| {
eprintln!("error reading MPHF {}: {e}", mphf_path.display());
std::process::exit(1)
}))
} else {
None
};
let counts_mmap_opt = if filter_active {
let cf = File::open(&counts_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", counts_path.display());
std::process::exit(1)
});
Some(unsafe {
memmap2::Mmap::map(&cf).unwrap_or_else(|e| {
eprintln!("error mmapping {}: {e}", counts_path.display());
std::process::exit(1)
})
})
} else {
None
};
let counts_slice: Option<&[u32]> = counts_mmap_opt
.as_ref()
.map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) });
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", in_path.display());
std::process::exit(1)
});
for sk in reader.iter() {
for kmer in sk.iter_canonical_kmers() {
let accept = match (&mphf_opt, counts_slice) {
(Some(mphf), Some(counts)) => {
if let Some(slot) = mphf.get(&kmer) {
let ab = counts[slot as usize];
ab >= args.min_abundance
&& args.max_abundance.map_or(true, |max| ab <= max)
} else {
false
}
}
_ => true,
};
if accept {
g.push(kmer);
}
}
}
let n_kmers = g.len();
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
info!(
"partition {i}/{n}: {n_kmers} canonical k-mers → {}",
out_path.display()
);
g.compute_degrees();
let file = File::create(&out_path).unwrap_or_else(|e| {
eprintln!("error creating {}: {e}", out_path.display());
std::process::exit(1)
});
let mut writer = niffler::send::get_writer(Box::new(file), Format::Gzip, Level::Six)
.unwrap_or_else(|e| {
eprintln!("error creating gzip writer: {e}");
std::process::exit(1)
});
g.write_fasta(&mut writer, false).unwrap_or_else(|e| {
eprintln!("write error on partition {i}: {e}");
std::process::exit(1)
});
});
info!(
"done — {} total canonical k-mers across all partitions",
total_kmers.load(Ordering::Relaxed)
);
}
-4
View File
@@ -1,7 +1,3 @@
pub mod count;
pub mod fasta;
pub mod index;
pub mod longtig;
pub mod partition;
pub mod superkmer;
pub mod unitig;
-49
View File
@@ -1,49 +0,0 @@
use std::path::PathBuf;
use clap::Args;
use obikpartitionner::KmerPartition;
use obisys::Reporter;
use obikseq::{set_k, set_m};
use crate::cli::CommonArgs;
use crate::steps::{dereplicate_and_count, scatter};
#[derive(Args)]
pub struct PartitionArgs {
/// Output partition directory
#[arg(short, long)]
pub output: PathBuf,
/// Overwrite output directory if it already exists
#[arg(long, default_value_t = false)]
pub force: bool,
#[command(flatten)]
pub common: CommonArgs,
}
// ── Entry point ───────────────────────────────────────────────────────────────
pub fn run(args: PartitionArgs) {
let k = args.common.kmer_size;
set_k(k);
let m = args.common.minimizer_size;
set_m(m);
let theta = args.common.theta;
let level_max = args.common.level_max;
let n_workers = args.common.threads.max(1);
let mut kp = KmerPartition::create(&args.output, args.common.partition_bits, k, m, args.force)
.unwrap_or_else(|e| {
eprintln!("error: {e}");
std::process::exit(1)
});
let path_source = args.common.seqfile_paths();
let mut rep = Reporter::new();
scatter(&mut kp, path_source, k, level_max, theta, n_workers, &mut rep);
dereplicate_and_count(&kp, &mut rep);
rep.print();
}
+23 -112
View File
@@ -1,143 +1,54 @@
use std::fs::File;
use std::io::{self, BufWriter, Write};
use std::path::PathBuf;
use std::sync::atomic::{AtomicUsize, Ordering};
use std::sync::Mutex;
use clap::Args;
use niffler::Level;
use niffler::send::compression::Format;
use obidebruinj::GraphDeBruijn;
use obikpartitionner::KmerPartition;
use obifastwrite::write_unitig;
use obikindex::KmerIndex;
use obikseq::set_k;
use obiskio::SKFileReader;
use ph::fmph::GOFunction;
use obiskio::UnitigFileReader;
use rayon::prelude::*;
use tracing::info;
#[derive(Args)]
pub struct UnitigArgs {
/// Root of the k-mer partition directory (produced by the `partition` command)
pub partition: PathBuf,
/// Minimum kmer abundance (inclusive); kmers below this threshold are excluded
#[arg(long, default_value_t = 1)]
pub min_abundance: u32,
/// Maximum kmer abundance (inclusive); kmers above this threshold are excluded
#[arg(long)]
pub max_abundance: Option<u32>,
/// Index directory produced by the `index` command
pub index: PathBuf,
}
pub fn run(args: UnitigArgs) {
let kp = KmerPartition::open(&args.partition).unwrap_or_else(|e| {
eprintln!("error opening partition: {e}");
let idx = KmerIndex::open(&args.index).unwrap_or_else(|e| {
eprintln!("error opening index: {e}");
std::process::exit(1)
});
let k = kp.kmer_size();
let k = idx.kmer_size();
set_k(k);
let n = kp.n_partitions();
info!("building unitigs from {n} partitions (k={k}, parallel)");
let n = idx.n_partitions();
info!("dumping unitigs from {n} partitions (k={k})");
let total_kmers = AtomicUsize::new(0);
let stdout = Mutex::new(BufWriter::new(io::stdout()));
(0..n).into_par_iter().for_each(|i| {
let part_dir = kp.part_dir(i);
let in_path = part_dir.join("dereplicated.skmer.zst");
if !in_path.exists() {
let path = idx.layer_unitigs_path(i, 0);
if !path.exists() {
return;
}
let out_path = part_dir.join("unitig.fasta.gz");
let mut g = GraphDeBruijn::new();
let mphf_path = part_dir.join("mphf1.bin");
let counts_path = part_dir.join("counts1.bin");
let filter_active = (args.min_abundance > 1 || args.max_abundance.is_some())
&& mphf_path.exists()
&& counts_path.exists();
let mphf_opt: Option<GOFunction> = if filter_active {
let mut f = File::open(&mphf_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", mphf_path.display());
let reader = UnitigFileReader::open(&path).unwrap_or_else(|e| {
eprintln!("error opening unitigs (partition {i}): {e}");
std::process::exit(1)
});
Some(GOFunction::read(&mut f).unwrap_or_else(|e| {
eprintln!("error reading MPHF {}: {e}", mphf_path.display());
std::process::exit(1)
}))
} else {
None
};
let counts_mmap_opt = if filter_active {
let cf = File::open(&counts_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", counts_path.display());
for j in 0..reader.len() {
let unitig = reader.unitig(j);
let mut out = stdout.lock().unwrap();
write_unitig(&unitig, k, i, j, &mut *out).unwrap_or_else(|e| {
eprintln!("write error: {e}");
std::process::exit(1)
});
Some(unsafe {
memmap2::Mmap::map(&cf).unwrap_or_else(|e| {
eprintln!("error mmapping {}: {e}", counts_path.display());
std::process::exit(1)
})
})
} else {
None
};
let counts_slice: Option<&[u32]> = counts_mmap_opt
.as_ref()
.map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) });
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", in_path.display());
std::process::exit(1)
});
for sk in reader.iter() {
for kmer in sk.iter_canonical_kmers() {
let accept = match (&mphf_opt, counts_slice) {
(Some(mphf), Some(counts)) => {
if let Some(slot) = mphf.get(&kmer) {
let ab = counts[slot as usize];
ab >= args.min_abundance
&& args.max_abundance.map_or(true, |max| ab <= max)
} else {
false
}
}
_ => true,
};
if accept {
g.push(kmer);
}
}
}
let n_kmers = g.len();
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
info!(
"partition {i}/{n}: {n_kmers} canonical k-mers → {}",
out_path.display()
);
g.compute_degrees();
let file = File::create(&out_path).unwrap_or_else(|e| {
eprintln!("error creating {}: {e}", out_path.display());
std::process::exit(1)
});
let mut writer = niffler::send::get_writer(Box::new(file), Format::Gzip, Level::Six)
.unwrap_or_else(|e| {
eprintln!("error creating gzip writer: {e}");
std::process::exit(1)
});
g.write_fasta(&mut writer, true).unwrap_or_else(|e| {
eprintln!("write error on partition {i}: {e}");
std::process::exit(1)
});
});
info!(
"done — {} total canonical k-mers across all partitions",
total_kmers.load(Ordering::Relaxed)
);
stdout.into_inner().unwrap().flush().expect("flush error");
}
+4 -16
View File
@@ -14,20 +14,12 @@ struct Cli {
#[derive(Subcommand)]
enum Commands {
/// Extract super-kmers from a sequence file (scatter phase)
/// Extract super-kmers from a sequence file and write to stdout
Superkmer(cmd::superkmer::SuperkmerArgs),
/// Partition super-kmers on disk by minimizer
Partition(cmd::partition::PartitionArgs),
/// Count kmers from an existing dereplicated partition directory
Count(cmd::count::CountArgs),
/// Export partition data to FASTA (--super-kmers: dereplicated super-kmers)
Fasta(cmd::fasta::FastaArgs),
/// Build de Bruijn unitigs for all partitions and write to unitig.fasta.gz
Unitig(cmd::unitig::UnitigArgs),
/// Build de Bruijn longtigs for all partitions and write to longtig.fasta.gz
Longtig(cmd::longtig::LongtigArgs),
/// Build the complete genome index (scatter → dereplicate → count → layered MPHF)
Index(cmd::index::IndexArgs),
/// Dump unitigs from a built index to stdout (debug)
Unitig(cmd::unitig::UnitigArgs),
}
fn main() {
@@ -50,12 +42,8 @@ fn main() {
let cli = Cli::parse();
match cli.command {
Commands::Superkmer(args) => cmd::superkmer::run(args),
Commands::Partition(args) => cmd::partition::run(args),
Commands::Count(args) => cmd::count::run(args),
Commands::Fasta(args) => cmd::fasta::run(args),
Commands::Unitig(args) => cmd::unitig::run(args),
Commands::Longtig(args) => cmd::longtig::run(args),
Commands::Index(args) => cmd::index::run(args),
Commands::Unitig(args) => cmd::unitig::run(args),
}
#[cfg(feature = "profiling")]
-177
View File
@@ -1,177 +0,0 @@
use std::fs;
use std::path::Path;
use std::sync::atomic::{AtomicUsize, Ordering};
use std::sync::{Arc, Mutex};
use cacheline_ef::{CachelineEf, CachelineEfVec};
use epserde::prelude::*;
use indicatif::{ProgressBar, ProgressStyle};
use obicompactvec::PersistentCompactIntMatrix;
use obicompactvec::PersistentCompactIntVec;
use obidebruinj::GraphDeBruijn;
use obikpartitionner::KmerPartition;
use obilayeredmap::layer::Layer;
use obiskio::{SKFileMeta, SKFileReader};
use obisys::{Reporter, Stage};
use ptr_hash::{PtrHash, bucket_fn::CubicEps, hash::Xx64};
use rayon::prelude::*;
use tracing::info;
type Mphf = PtrHash<u64, CubicEps, CachelineEfVec<Vec<CachelineEf>>, Xx64, Vec<u8>>;
/// Build the layered MPHF index for all partitions in parallel.
///
/// Default mode (with_counts = false): set membership only (`Layer<()>`).
/// With counts (with_counts = true): count matrix per kmer (`Layer<PersistentCompactIntMatrix>`).
///
/// Skips any partition whose `index/layer_0/mphf.bin` already exists (resume).
/// Reports the "index" stage to `rep`.
pub fn build_index(
kp: &KmerPartition,
min_ab: u32,
max_ab: Option<u32>,
with_counts: bool,
keep_intermediate: bool,
rep: &mut Reporter,
) {
let n = kp.n_partitions();
let t = Stage::start("index");
let total_kmers = AtomicUsize::new(0);
let filter_active = min_ab > 1 || max_ab.is_some();
let need_counts = filter_active || with_counts;
let pb = Arc::new(Mutex::new(
ProgressBar::new(n as u64).with_style(
ProgressStyle::with_template("index — [{bar:20}] {pos}/{len} | {msg}").unwrap(),
),
));
(0..n).into_par_iter().for_each(|i| {
let part_dir = kp.part_dir(i);
let dedup_path = part_dir.join("dereplicated.skmer.zst");
if !dedup_path.exists() {
return;
}
let layer_dir = part_dir.join("index").join("layer_0");
if layer_dir.join("mphf.bin").exists() {
return;
}
// Load partition MPHF + counts when needed for filtering or count payload
let mphf1_opt: Option<Mphf> = if need_counts {
let p = part_dir.join("mphf1.bin");
p.exists().then(|| Mphf::load_full(&p).ok()).flatten()
} else {
None
};
let counts1_opt: Option<PersistentCompactIntVec> = if need_counts {
let p = part_dir.join("counts1.bin");
p.exists()
.then(|| PersistentCompactIntVec::open(&p).ok())
.flatten()
} else {
None
};
// Build de Bruijn graph with optional abundance filter
let mut g = GraphDeBruijn::new();
let mut reader = SKFileReader::open(&dedup_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", dedup_path.display());
std::process::exit(1);
});
for sk in reader.iter() {
for kmer in sk.iter_canonical_kmers() {
let accept = if filter_active {
match (&mphf1_opt, &counts1_opt) {
(Some(mphf), Some(counts)) => {
let ab = counts.get(mphf.index(&kmer.raw()));
ab >= min_ab && max_ab.map_or(true, |max| ab <= max)
}
_ => true,
}
} else {
true
};
if accept {
g.push(kmer);
}
}
}
let n_kmers = g.len();
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
g.compute_degrees();
// Write unitigs to layer_0/unitigs.bin
fs::create_dir_all(&layer_dir).unwrap_or_else(|e| {
eprintln!("error creating {}: {e}", layer_dir.display());
std::process::exit(1);
});
let mut uw = Layer::<()>::unitig_writer(&layer_dir).unwrap_or_else(|e| {
eprintln!("error creating unitig writer (partition {i}): {e}");
std::process::exit(1);
});
for unitig in g.iter_unitig() {
uw.write(&unitig).unwrap_or_else(|e| {
eprintln!("error writing unitig (partition {i}): {e}");
std::process::exit(1);
});
}
uw.close().unwrap_or_else(|e| {
eprintln!("error closing unitig writer (partition {i}): {e}");
std::process::exit(1);
});
// Build MPHF layer — mode depends on --with-counts
if with_counts {
Layer::<PersistentCompactIntMatrix>::build(&layer_dir, |kmer| {
match (&mphf1_opt, &counts1_opt) {
(Some(mphf), Some(counts)) => counts.get(mphf.index(&kmer.raw())),
_ => 1,
}
})
.unwrap_or_else(|e| {
eprintln!("error building count layer (partition {i}): {e}");
std::process::exit(1);
});
} else {
Layer::<()>::build(&layer_dir).unwrap_or_else(|e| {
eprintln!("error building set layer (partition {i}): {e}");
std::process::exit(1);
});
}
let pb = pb.lock().unwrap();
pb.inc(1);
pb.set_message(format!("{i}: {n_kmers} kmers"));
});
pb.lock().unwrap().finish_and_clear();
info!(
"done — {} total kmers indexed",
total_kmers.load(Ordering::Relaxed)
);
// ── Cleanup intermediate build files ──────────────────────────────────────
if !keep_intermediate {
for i in 0..n {
let part_dir = kp.part_dir(i);
remove_if_exists(&part_dir.join("dereplicated.skmer.zst"));
remove_if_exists(&SKFileMeta::sidecar_path(&part_dir.join("dereplicated.skmer.zst")));
remove_if_exists(&part_dir.join("mphf1.bin"));
remove_if_exists(&part_dir.join("counts1.bin"));
}
}
rep.push(t.stop());
}
fn remove_if_exists(path: &Path) {
if let Err(e) = fs::remove_file(path) {
if e.kind() != std::io::ErrorKind::NotFound {
eprintln!("warning: could not remove {}: {e}", path.display());
}
}
}
@@ -1,13 +0,0 @@
use obikpartitionner::KmerPartition;
use obisys::{Reporter, Stage};
/// Dereplicate then count kmers. Reports each stage to `rep`.
pub fn dereplicate_and_count(kp: &KmerPartition, rep: &mut Reporter) {
let t = Stage::start("dereplicate");
kp.dereplicate().expect("dereplicate error");
rep.push(t.stop());
let t = Stage::start("count_kmer");
kp.count_kmer().expect("count kmer error");
rep.push(t.stop());
}
-4
View File
@@ -1,7 +1,3 @@
mod build_index;
mod dereplicate_and_count;
mod scatter;
pub use build_index::build_index;
pub use dereplicate_and_count::dereplicate_and_count;
pub use scatter::scatter;