Introduce compare_sparse CLI tool to verify index consistency

Adds a new binary that validates bit-level consistency between dense and sparse K-mer index representations by sampling slots across partitions and reporting discrepancies. Refactors sibling cache matrix initialization into a centralized factory method to simplify control flow and standardize error handling. Introduces diagnostic configurations, benchmark scripts, and an ignored test case to support k-mer resolution analysis.
This commit is contained in:
Eric Coissac committed 2026-08-17 11:16:42 +02:00
1 parent 128db64564
commit 1f9c6388eb
14 files changed
+776 -26

No files matched your search

+10
View File
@@ -493,6 +493,16 @@ dependencies = [
"impl-tools",
]
[[package]]
name = "compare_sparse"
version = "0.1.0"
dependencies = [
"anyhow",
"fastrand",
"obicompactvec",
"obikindex",
]
[[package]]
name = "console"
version = "0.15.11"
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace]
resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy", "obikphylo"]
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy", "obikphylo", "compare_sparse"]
[profile.release]
debug = 1
+130
View File
@@ -0,0 +1,130 @@
use std::path::PathBuf;
use obicompactvec::{BinaryMatrix, PersistentBitMatrix, PersistentSparseBitMatrix};
use obikindex::KmerIndex;
fn main() -> anyhow::Result<()> {
let orig_root = std::env::args().nth(1).expect("usage: compare_sparse <orig_dense> <sparse>");
let sparse_root = std::env::args().nth(2).expect("usage: compare_sparse <orig_dense> <sparse>");
let orig = KmerIndex::open(&orig_root)?;
let sparse = KmerIndex::open(&sparse_root)?;
let n_parts = orig.n_partitions();
let n_layers = orig.n_layers_per_partition()?;
let n_genomes = orig.meta().genomes.len();
println!("index orig: {} partitions, {} layers, {} genomes", n_parts, n_layers, n_genomes);
println!("index sparse:{} partitions, {} layers, {} genomes", sparse.n_partitions(), sparse.n_layers_per_partition()?, sparse.meta().genomes.len());
let mut total_layers = 0usize;
let mut mismatches = 0usize;
let mut slot_checked = 0usize;
for part in 0..n_parts {
let part_dir_orig = orig.partition().part_dir(part);
let part_dir_sparse = sparse.partition().part_dir(part);
if !part_dir_orig.join("index").exists() || !part_dir_sparse.join("index").exists() {
continue;
}
for layer in 0..n_layers {
let layer_dir_orig = part_dir_orig.join("index").join(format!("layer_{layer}"));
let layer_dir_sparse = part_dir_sparse.join("index").join(format!("layer_{layer}"));
if !layer_dir_orig.exists() || !layer_dir_sparse.exists() {
continue;
}
let presence_orig = layer_dir_orig.join("presence");
let presence_sparse = layer_dir_sparse.join("presence");
if !presence_orig.exists() || !presence_sparse.exists() {
continue;
}
// Ouvrir la matrice dense (PackedBitMatrix) depuis l'original
let dense = match PersistentBitMatrix::open(&presence_orig) {
Ok(m) => m,
Err(e) => {
eprintln!("ERREUR ouverture dense part={part} layer={layer}: {e}");
continue;
}
};
// Ouvrir la matrice sparse
let sp = match PersistentSparseBitMatrix::open(&presence_sparse) {
Ok(m) => m,
Err(e) => {
eprintln!("ERREUR ouverture sparse part={part} layer={layer}: {e}");
continue;
}
};
if dense.n_cols() != sp.n_cols() {
eprintln!("ERREUR n_cols différent part={part} layer={layer}: dense={} sparse={}", dense.n_cols(), sp.n_cols());
continue;
}
let n = dense.n();
if n != sp.n() {
eprintln!("ERREUR n différent part={part} layer={layer}: dense={} sparse={}", n, sp.n());
continue;
}
if n == 0 {
continue;
}
// Échantillon de 100 slots aléatoires par layer
let mut rng = fastrand::Rng::with_seed(part as u64 * 1000 + layer as u64);
let sample_size = 100.min(n);
let mut checked_any = false;
for _ in 0..sample_size {
let slot = rng.usize(0..n);
let mut dense_row = vec![0u32; dense.n_cols()];
let mut sparse_row = vec![0u32; sp.n_cols()];
dense.fill_row(slot, &mut dense_row);
sp.fill_row(slot, &mut sparse_row);
if dense_row != sparse_row {
// Premier mismatch pour ce layer : diagnostiquer la colonne A
if !checked_any {
let a_col = 0; // A est la colonne 0
let mut a_dense = 0u32;
let mut a_sparse = 0u32;
// scanner tous les slots pour compter les différences sur la colonne A
let mut diff_a = 0usize;
for s in 0..n {
let mut d = vec![0u32; dense.n_cols()];
let mut s2 = vec![0u32; sp.n_cols()];
dense.fill_row(s, &mut d);
sp.fill_row(s, &mut s2);
if d[a_col] != s2[a_col] {
diff_a += 1;
}
}
eprintln!("MISMATCH part={part} layer={layer} slot={slot}: colonne A différente sur {diff_a}/{n} slots");
mismatches += 1;
checked_any = true;
}
}
slot_checked += 1;
}
total_layers += 1;
}
}
println!("Vérifié {} layers, {} slots échantillonnés", total_layers, slot_checked);
if mismatches == 0 {
println!("OK : aucune différence détectée.");
} else {
println!("MISMATCHES détectés dans {} layers", mismatches);
}
Ok(())
}
+14
View File
@@ -0,0 +1,14 @@
[package]
name = "compare_sparse"
version = "0.1.0"
edition = "2021"
[[bin]]
name = "compare_sparse"
path = "src/main.rs"
[dependencies]
obikindex = { path = "../obikindex" }
obicompactvec = { path = "../obicompactvec" }
anyhow = "1"
fastrand = "2"
+100
View File
@@ -0,0 +1,100 @@
use obicompactvec::{PersistentBitMatrix, PersistentSparseBitMatrix};
use obikindex::KmerIndex;
fn main() -> anyhow::Result<()> {
let sparse_root = std::env::args().nth(1).expect("usage: compare_full <sparse> <orig_dense>");
let dense_root = std::env::args().nth(2).expect("usage: compare_full <sparse> <orig_dense>");
let sparse = KmerIndex::open(&sparse_root)?;
let dense = KmerIndex::open(&dense_root)?;
let n_parts = sparse.n_partitions();
let n_layers = sparse.n_layers_per_partition()?;
println!("index sparse: {} partitions, {} layers", sparse.n_partitions(), n_layers);
println!("index dense: {} partitions, {} layers", dense.n_partitions(), dense.n_layers_per_partition()?);
let mut total_layers = 0usize;
let mut total_cells = 0usize;
let mut mismatched_cells = 0usize;
let mut first_mismatch = None;
for part in 0..n_parts {
let part_dir_sparse = sparse.partition().part_dir(part);
let part_dir_dense = dense.partition().part_dir(part);
if !part_dir_sparse.join("index").exists() || !part_dir_dense.join("index").exists() {
continue;
}
for layer in 0..n_layers {
let layer_dir_sparse = part_dir_sparse.join("index").join(format!("layer_{layer}"));
let layer_dir_dense = part_dir_dense.join("index").join(format!("layer_{layer}"));
if !layer_dir_sparse.exists() || !layer_dir_dense.exists() {
continue;
}
let presence_sparse = layer_dir_sparse.join("presence");
let presence_dense = layer_dir_dense.join("presence");
if !presence_sparse.exists() || !presence_dense.exists() {
continue;
}
let sp = match PersistentSparseBitMatrix::open(&presence_sparse) {
Ok(m) => m,
Err(e) => {
eprintln!("ERREUR ouverture sparse part={part} layer={layer}: {e}");
continue;
}
};
let dn = match PersistentBitMatrix::open(&layer_dir_dense) {
Ok(m) => m,
Err(e) => {
eprintln!("ERREUR ouverture dense part={part} layer={layer}: {e}");
continue;
}
};
if dn.n_cols() != sp.n_cols() || dn.n() != sp.n() || dn.n() == 0 {
continue;
}
let n = dn.n();
let n_cols = dn.n_cols();
// Vérification exhaustive : tous les slots, toutes les colonnes
let mut dense_row = vec![0u32; n_cols];
let mut sparse_row = vec![0u32; n_cols];
for slot in 0..n {
dn.fill_row(slot, &mut dense_row);
sp.fill_row(slot, &mut sparse_row);
for c in 0..n_cols {
total_cells += 1;
if dense_row[c] != sparse_row[c] {
mismatched_cells += 1;
if first_mismatch.is_none() {
first_mismatch = Some((part, layer, slot, c, dense_row[c], sparse_row[c]));
}
}
}
}
total_layers += 1;
}
}
println!("Vérifié {} layers, {} cellules totales", total_layers, total_cells);
if let Some((part, layer, slot, col, d, s)) = first_mismatch {
eprintln!("PREMIER MISMATCH : part={part} layer={layer} slot={slot} col={col} dense={d} sparse={s}");
println!("MISMATCHES : {} cellules différentes", mismatched_cells);
} else {
println!("OK : toutes les {} cellules sont identiques entre dense et sparse.", total_cells);
}
Ok(())
}
+30 -17
View File
@@ -1,10 +1,12 @@
use rayon::prelude::*;
use std::path::Path;
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix, PersistentSparseBitMatrix};
use obikpartitionner::KmerPartition;
use obikseq::CanonicalKmer;
use obilayeredmap::Layer;
use obilayeredmap::meta::PartitionMeta;
use obilayeredmap::{Layer, OLMResult};
use obilayeredmap::meta::{IndexMode, PartitionMeta};
use obisys::progress_bar;
use obikindex::OKIResult;
@@ -50,6 +52,31 @@ pub(super) enum Mat {
}
impl Mat {
/// Open one layer's matrix, auto-detecting count vs. dense-presence vs.
/// sparse-presence from what is actually on disk — the single source of
/// truth for *every* caller that opens a layer's own matrix (this
/// module's cross-partition [`PartitionCache::build`] and
/// `family_scan::scan_layer_families`'s own-layer lookup alike), so the
/// two can never disagree about which format a layer's `presence/` was
/// packed to. Before this existed, `scan_layer_families` open-coded its
/// own (non-sparse-aware) copy of this decision: on a `pack --sparse`d
/// layer, `presence/matrix.pbmx` no longer exists (removed by
/// `pack_sparse_bit_matrix`), so a caller that only checks for it and
/// otherwise unconditionally opens `PersistentBitMatrix` doesn't error —
/// `PersistentBitMatrix::open`'s own auto-detection falls all the way
/// through to the `Implicit` (mono-genome, all-present) case, silently
/// corrupting every read.
pub(super) fn open(layer_dir: &Path, mode: &IndexMode, with_counts: bool) -> OLMResult<Self> {
if with_counts && layer_dir.join("counts").exists() {
return Layer::<PersistentCompactIntMatrix>::open(layer_dir, mode).map(Mat::Count);
}
if layer_dir.join("presence").join("is_multi.prsb").exists() {
Layer::<PersistentSparseBitMatrix>::open(layer_dir, mode).map(Mat::SparsePresence)
} else {
Layer::<PersistentBitMatrix>::open(layer_dir, mode).map(Mat::Presence)
}
}
fn find_slot(&self, kmer: CanonicalKmer) -> Option<usize> {
match self {
Mat::Count(l) => l.find_slot(kmer),
@@ -156,21 +183,7 @@ impl PartitionCache {
let mut mats = Vec::with_capacity(meta.n_layers);
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let use_counts = with_counts && layer_dir.join("counts").exists();
// `pack --sparse` converts a layer's `presence/` directory
// in place, leaving `is_multi.prsb` as the on-disk marker
// that distinguishes the sparse format
// (`obicompactvec::PersistentSparseBitMatrix`) from the
// dense one — see `bitmatrix/sparse.rs`'s module docs.
let is_sparse = layer_dir.join("presence").join("is_multi.prsb").exists();
let mat = if use_counts {
Layer::<PersistentCompactIntMatrix>::open(&layer_dir, &meta.mode).ok().map(Mat::Count)
} else if is_sparse {
Layer::<PersistentSparseBitMatrix>::open(&layer_dir, &meta.mode).ok().map(Mat::SparsePresence)
} else {
Layer::<PersistentBitMatrix>::open(&layer_dir, &meta.mode).ok().map(Mat::Presence)
};
let Some(mat) = mat else { continue };
let Ok(mat) = Mat::open(&layer_dir, &meta.mode, with_counts) else { continue };
mats.push(mat);
}
pb.inc(1);
+1 -8
View File
@@ -53,9 +53,7 @@ use std::sync::atomic::{AtomicU8, Ordering};
use rayon::prelude::*;
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
use obikseq::CanonicalKmer;
use obilayeredmap::Layer;
use obilayeredmap::meta::PartitionMeta;
use obipipeline::{ThrottleGuard, throttle};
@@ -195,12 +193,7 @@ pub(super) fn scan_layer_families(
let meta = PartitionMeta::load(index_dir).map_err(olm_to_ok)?;
let annex = Arc::new(SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME))?);
let use_counts = with_counts && layer_dir.join("counts").exists();
let mat = if use_counts {
Mat::Count(Layer::<PersistentCompactIntMatrix>::open(layer_dir, &meta.mode).map_err(olm_to_ok)?)
} else {
Mat::Presence(Layer::<PersistentBitMatrix>::open(layer_dir, &meta.mode).map_err(olm_to_ok)?)
};
let mat = Mat::open(layer_dir, &meta.mode, with_counts).map_err(olm_to_ok)?;
let n_cols = mat.n_cols().min(n_genomes);
let ctx = Arc::new(LayerCtx { mat, n_parts, n_genomes, n_cols, k });
+93
View File
@@ -1089,3 +1089,96 @@ fn bench_real_persistent_sparse_bit_matrix_on_disk_size() {
let _ = std::fs::remove_dir_all(&out_dir);
}
#[test]
#[ignore]
fn diag_real_index_verify_kmer_resolution() {
use std::sync::Arc;
let idx = KmerIndex::open("/Users/coissac/Sync/travail/__MOI__/obikmer/benchmark/global_index_presence")
.expect("open real index");
let n_parts = idx.n_partitions();
let n_genomes = idx.meta().genomes.len();
let with_counts = idx.meta().config.with_counts;
let k = idx.kmer_size();
let n_bits = n_parts.trailing_zeros() as usize;
let partition = obikpartitionner::KmerPartition::open_with_config(
idx.root_path(), idx.kmer_size(), idx.minimizer_size(), n_bits,
).unwrap();
let cache = Arc::new(super::cache::PartitionCache::build(&partition, n_parts, with_counts).unwrap());
// The k-mer with A+other (mask 0b0011 = A+C)
let kmer_str = "AGCTAGCTATTGAGCCTGGTCCGTATGAAAC";
let kmer = CanonicalKmer::from_str(kmer_str, k).unwrap();
let rc = kmer.revcomp();
let rc_str = kmer_to_string(&rc, k);
println!("kmer_forward={} kmer_revcomp={}", kmer_str, rc_str);
println!("kmer partition={}", kmer.partition(n_parts));
// Check if this k-mer is found in its own partition
let dest_part = kmer.partition(n_parts);
if let Some(layer) = cache.find(dest_part, kmer) {
println!("FOUND in partition {} layer {}", dest_part, layer);
} else {
println!("NOT FOUND in partition {}", dest_part);
}
// Now check the variant with A at central position
// The mask is 0b0011 = A+C, so there should be a variant with A
// Let's generate the canonical neighbors and check which one has A
let mut found_variants = Vec::new();
for variant in kmer.central_canonical_neighbors() {
if variant == kmer {
continue;
}
let base = central_base(variant, k);
if base == 0 { // A
let v_part = variant.partition(n_parts);
println!("variant with A: partition={} found={}", v_part, cache.find(v_part, variant).is_some());
found_variants.push(variant);
}
}
// Also check the C variant
for variant in kmer.central_canonical_neighbors() {
if variant == kmer {
continue;
}
let base = central_base(variant, k);
if base == 1 { // C
let v_part = variant.partition(n_parts);
println!("variant with C: partition={} found={}", v_part, cache.find(v_part, variant).is_some());
}
}
}
fn kmer_to_string(kmer: &CanonicalKmer, k: usize) -> String {
let mut s = String::with_capacity(k);
for i in 0..k {
let n = kmer.nucleotide(i);
s.push(match n {
0 => 'A',
1 => 'C',
2 => 'G',
3 => 'T',
_ => unreachable!(),
});
}
s
}
fn kmer_revcomp_to_string(kmer: &CanonicalKmer, k: usize) -> String {
let rc = kmer.revcomp();
let mut s = String::with_capacity(k);
for i in 0..k {
let n = rc.nucleotide(i);
s.push(match n {
0 => 'A',
1 => 'C',
2 => 'G',
3 => 'T',
_ => unreachable!(),
});
}
s
}
+167
View File
@@ -0,0 +1,167 @@
ratio_ceiling: 0.5
cardinality_transitions:
- from: 0
to: 0
count: 122014779
probability: 0.870049812090934
- from: 0
to: 1
count: 17966272
probability: 0.12811195254940888
- from: 0
to: 2
count: 233683
probability: 0.001666321505518981
- from: 0
to: 3
count: 24109
probability: 0.00017191385413811494
- from: 0
to: 4
count: 0
probability: 0.0
- from: 1
to: 0
count: 17966272
probability: 0.967023782579572
- from: 1
to: 1
count: 602798
probability: 0.03244523972983381
- from: 1
to: 2
count: 9562
probability: 0.0005146688978673966
- from: 1
to: 3
count: 303
probability: 0.00001630879272681669
- from: 1
to: 4
count: 0
probability: 0.0
- from: 2
to: 0
count: 233683
probability: 0.9585500516842502
- from: 2
to: 1
count: 9562
probability: 0.039222603245442765
- from: 2
to: 2
count: 438
probability: 0.0017966429848885097
- from: 2
to: 3
count: 105
probability: 0.00043070208541847837
- from: 2
to: 4
count: 0
probability: 0.0
- from: 3
to: 0
count: 24109
probability: 0.9827171564831044
- from: 3
to: 1
count: 303
probability: 0.012350711286838137
- from: 3
to: 2
count: 105
probability: 0.004279949455834998
- from: 3
to: 3
count: 16
probability: 0.0006521827742224758
- from: 3
to: 4
count: 0
probability: 0.0
- from: 4
to: 0
count: 0
probability: 0.0
- from: 4
to: 1
count: 0
probability: 0.0
- from: 4
to: 2
count: 0
probability: 0.0
- from: 4
to: 3
count: 0
probability: 0.0
- from: 4
to: 4
count: 0
probability: 0.0
composition_transitions:
- from: 'A'
to: 'A'
count: 0
probability: 0.0
- from: 'A'
to: 'C'
count: 0
probability: 0.0
- from: 'A'
to: 'G'
count: 0
probability: 0.0
- from: 'A'
to: 'T'
count: 0
probability: 0.0
- from: 'C'
to: 'A'
count: 0
probability: 0.0
- from: 'C'
to: 'C'
count: 96389
probability: 0.9663832688335907
- from: 'C'
to: 'G'
count: 1290
probability: 0.012933368089671353
- from: 'C'
to: 'T'
count: 2063
probability: 0.020683363076737984
- from: 'G'
to: 'A'
count: 0
probability: 0.0
- from: 'G'
to: 'C'
count: 1290
probability: 0.005696948820201646
- from: 'G'
to: 'G'
count: 222720
probability: 0.9835848381669073
- from: 'G'
to: 'T'
count: 2427
probability: 0.010718213012891003
- from: 'T'
to: 'A'
count: 0
probability: 0.0
- from: 'T'
to: 'C'
count: 2063
probability: 0.007305266661709142
- from: 'T'
to: 'G'
count: 2427
probability: 0.008594223067362136
- from: 'T'
to: 'T'
count: 277909
probability: 0.9841005102709287