add PhantomData import for generic type safety

- Added `use std::marker::PhantomData;` to prepare for generic scheduler implementations
- Ensures type safety and avoids unused lifetime/type parameters warnings
This commit is contained in:
Eric Coissac
2026-04-27 23:27:42 +02:00
parent ebbfe35cbc
commit 4c19882f03
10 changed files with 328 additions and 271 deletions
+75
View File
@@ -0,0 +1,75 @@
use std::io;
use std::path::PathBuf;
use clap::Args;
use obikrope::Rope;
use obikseq::superkmer::SuperKmer;
// ── Shared arguments ──────────────────────────────────────────────────────────
#[derive(Args)]
pub struct CommonArgs {
/// Input files or directories (FASTA/FASTQ, optionally gzip-compressed)
#[arg(num_args = 1..)]
pub inputs: Vec<String>,
/// k-mer size
#[arg(short, long, default_value_t = 31)]
pub kmer_size: usize,
/// Minimizer size
#[arg(short, long, default_value_t = 11)]
pub minimizer_size: usize,
/// Entropy threshold (k-mers with score ≤ theta are rejected)
#[arg(long, default_value_t = 0.7)]
pub theta: f64,
/// Maximum sub-word size for entropy computation
#[arg(long, default_value_t = 6)]
pub level_max: usize,
/// Number of bits to encode partitions (allows up to 2^partition_bits partitions)
#[arg(short, long, default_value_t = 8)]
pub partition_bits: usize,
/// Number of worker threads
#[arg(
short = 'T',
long,
default_value_t = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1)
)]
pub threads: usize,
}
// ── Pipeline data carrier ─────────────────────────────────────────────────────
pub enum PipelineData {
Path(PathBuf),
RawChunk(Rope),
NormChunk(Rope),
Batch(Vec<SuperKmer>),
}
// SAFETY: Rope contains Cell<u8> which is !Sync, but pipeline ownership transfers
// exclusively through channels — no item is ever shared across threads.
unsafe impl Send for PipelineData {}
unsafe impl Sync for PipelineData {}
// ── I/O plumbing ──────────────────────────────────────────────────────────────
pub fn open_chunks(path: PathBuf) -> io::Result<impl Iterator<Item = Rope>> {
let path_str = path
.to_str()
.ok_or_else(|| io::Error::new(io::ErrorKind::InvalidInput, "non-UTF-8 path"))?;
let iter = obiread::read_sequence_chunks(path_str)?;
Ok(iter.filter_map(|r| match r {
Ok(rope) => Some(rope),
Err(e) => {
eprintln!("chunk read error: {e}");
None
}
}))
}
+17 -87
View File
@@ -1,117 +1,47 @@
use clap::Args;
use obikpartitionner::KmerPartition;
use obikrope::Rope;
use obikseq::superkmer::SuperKmer;
use obipipeline::{WorkerPool, make_pipeline};
use obiskbuilder::SuperKmerIter;
use std::io;
use std::path::PathBuf;
use std::sync::{Arc, Mutex};
use tracing::info;
use crate::cli::{CommonArgs, PipelineData, open_chunks};
#[derive(Args)]
pub struct PartitionArgs {
/// Output partition directory
#[arg(short, long)]
pub output: PathBuf,
/// Input files or directories (FASTA/FASTQ, optionally gzip-compressed)
#[arg(num_args = 1..)]
pub inputs: Vec<String>,
/// k-mer size
#[arg(short, long, default_value_t = 31)]
pub kmer_size: usize,
/// Minimizer size
#[arg(short, long, default_value_t = 11)]
pub minimizer_size: usize,
/// Entropy threshold (k-mers with score ≤ theta are rejected)
#[arg(long, default_value_t = 0.7)]
pub theta: f64,
/// Maximum sub-word size for entropy computation
#[arg(long, default_value_t = 6)]
pub level_max: usize,
/// Number of bits to encode partitions (allows up to 2^partition_bits partitions)
#[arg(short, long, default_value_t = 8)]
pub partition_bits: usize,
/// Overwrite output directory if it already exists
#[arg(long, default_value_t = false)]
pub force: bool,
/// Number of worker threads
#[arg(
short = 'T',
long,
default_value_t = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1))]
pub threads: usize,
#[command(flatten)]
pub common: CommonArgs,
}
enum PipelineData {
Path(PathBuf),
RawChunk(Rope),
NormChunk(Rope),
Batch(Vec<SuperKmer>),
}
// SAFETY: Rope contains Cell<u8> which is !Sync, but pipeline ownership transfers
// exclusively through channels — no item is ever shared across threads.
unsafe impl Send for PipelineData {}
unsafe impl Sync for PipelineData {}
// ── Stage functions ───────────────────────────────────────────────────────────
fn open_chunks(path: PathBuf) -> io::Result<impl Iterator<Item = Rope>> {
let path_str = path
.to_str()
.ok_or_else(|| io::Error::new(io::ErrorKind::InvalidInput, "non-UTF-8 path"))?;
let iter = obiread::read_sequence_chunks(path_str)?;
Ok(iter.filter_map(|r| match r {
Ok(rope) => Some(rope),
Err(e) => {
eprintln!("chunk read error: {e}");
None
}
}))
}
fn normalize(rope: Rope, k: usize) -> io::Result<Rope> {
obiread::normalize_sequence_chunk(rope, k)
}
fn build_superkmers(
rope: Rope,
k: usize,
m: usize,
level_max: usize,
theta: f64,
) -> Vec<SuperKmer> {
SuperKmerIter::new(&rope, k, m, level_max, theta).collect()
}
fn write_batch(mut batch: Vec<SuperKmer>, kp: &Mutex<KmerPartition>) -> io::Result<()> {
kp.lock()
.unwrap()
.write_batch(&mut batch)
.map_err(|e| io::Error::other(e))
.map_err(io::Error::other)
}
// ── Entry point ───────────────────────────────────────────────────────────────
pub fn run(args: PartitionArgs) {
let k = args.kmer_size;
let m = args.minimizer_size;
let theta = args.theta;
let level_max = args.level_max;
let n_workers = args.threads.max(1);
let k = args.common.kmer_size;
let m = args.common.minimizer_size;
let theta = args.common.theta;
let level_max = args.common.level_max;
let n_workers = args.common.threads.max(1);
let kp = KmerPartition::create(&args.output, args.partition_bits, k, m, args.force)
let kp = KmerPartition::create(&args.output, args.common.partition_bits, k, m, args.force)
.unwrap_or_else(|e| {
eprintln!("error: {e}");
std::process::exit(1)
@@ -119,16 +49,16 @@ pub fn run(args: PartitionArgs) {
let kp = Arc::new(Mutex::new(kp));
let kp_sink = Arc::clone(&kp);
let paths = args.inputs.iter().map(PathBuf::from).collect();
let paths = args.common.inputs.iter().map(PathBuf::from).collect();
let path_source = obiread::PathIter::new(paths);
let pipeline = make_pipeline! {
PipelineData,
source path_source => Path,
||? open_chunks : Path => RawChunk,
|? { move |rope| normalize(rope, k) } : RawChunk => NormChunk,
| { move |rope| build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
sink? { move |batch| write_batch(batch, &kp_sink) } @ Batch,
source path_source => Path,
||? open_chunks : Path => RawChunk,
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
| { move |rope| obiskbuilder::build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
sink? { move |batch| write_batch(batch, &kp_sink) } @ Batch,
};
WorkerPool::new(pipeline, n_workers, 1).run();
+17 -101
View File
@@ -4,94 +4,19 @@ use std::sync::{Arc, Mutex};
use clap::Args;
use obifastwrite::write_scatter;
use obikrope::Rope;
use obikseq::superkmer::SuperKmer;
use obipipeline::{WorkerPool, make_pipeline};
use obiskbuilder::SuperKmerIter;
use crate::cli::{CommonArgs, PipelineData, open_chunks};
#[derive(Args)]
pub struct SuperkmerArgs {
/// Input files or directories (FASTA/FASTQ, optionally gzip-compressed)
#[arg(num_args = 1..)]
pub inputs: Vec<String>,
/// k-mer size
#[arg(short, long, default_value_t = 31)]
pub kmer_size: usize,
/// Minimizer size
#[arg(short, long, default_value_t = 11)]
pub minimizer_size: usize,
/// Entropy threshold (k-mers with score ≤ theta are rejected)
#[arg(long, default_value_t = 0.7)]
pub theta: f64,
/// Maximum sub-word size for entropy computation
#[arg(long, default_value_t = 6)]
pub level_max: usize,
/// Number of bits to encode partitions (allows up to 2^partition_bits partitions)
#[arg(short, long, default_value_t = 8)]
pub partition_bits: usize,
/// Number of worker threads
#[arg(
short = 'T',
long,
default_value_t = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1))]
pub threads: usize,
#[command(flatten)]
pub common: CommonArgs,
}
enum PipelineData {
Path(PathBuf),
RawChunk(Rope),
NormChunk(Rope),
Batch(Vec<SuperKmer>),
}
// SAFETY: Rope contains Cell<u8> which is !Sync, but pipeline ownership transfers
// exclusively through channels — no item is ever shared across threads.
unsafe impl Send for PipelineData {}
unsafe impl Sync for PipelineData {}
// ── Stage functions ───────────────────────────────────────────────────────────
/// Opens a sequence file and returns an iterator over its raw Rope chunks.
/// Chunk-level I/O errors are logged and skipped.
fn open_chunks(path: PathBuf) -> io::Result<impl Iterator<Item = Rope>> {
let path_str = path
.to_str()
.ok_or_else(|| io::Error::new(io::ErrorKind::InvalidInput, "non-UTF-8 path"))?;
let iter = obiread::read_sequence_chunks(path_str)?;
Ok(iter.filter_map(|r| match r {
Ok(rope) => Some(rope),
Err(e) => {
eprintln!("chunk read error: {e}");
None
}
}))
}
/// Normalises a raw sequence chunk (FASTA or FASTQ) into a compact ACGT/NUL rope.
fn normalize(rope: Rope, k: usize) -> io::Result<Rope> {
obiread::normalize_sequence_chunk(rope, k)
}
/// Extracts all super-kmers from a normalised rope.
fn build_superkmers(
rope: Rope,
k: usize,
m: usize,
level_max: usize,
theta: f64,
) -> Vec<SuperKmer> {
SuperKmerIter::new(&rope, k, m, level_max, theta).collect()
}
/// Writes a batch of super-kmers to the output sink.
fn write_batch(
batch: Vec<SuperKmer>,
out: &Mutex<BufWriter<io::Stdout>>,
@@ -104,7 +29,7 @@ fn write_batch(
for sk in batch {
let minimizer = sk
.kmer(sk.minimizer_pos() as usize, m)
.map_err(|e| std::io::Error::other(e))?
.map_err(io::Error::other)?
.canonical(m);
let partition = (minimizer.hash(m) & partition_mask) as usize;
write_scatter(&sk, &mut *w, k, m, partition, minimizer)?;
@@ -112,26 +37,17 @@ fn write_batch(
Ok(())
}
#[inline]
fn mix64(x: u64) -> u64 {
let x = x ^ (x >> 30);
let x = x.wrapping_mul(0xbf58476d1ce4e5b9);
let x = x ^ (x >> 27);
let x = x.wrapping_mul(0x94d049bb133111eb);
x ^ (x >> 31)
}
// ── Entry point ───────────────────────────────────────────────────────────────
pub fn run(args: SuperkmerArgs) {
let k = args.kmer_size;
let m = args.minimizer_size;
let theta = args.theta;
let level_max = args.level_max;
let partition_bits = args.partition_bits;
let n_workers = args.threads.max(1);
let k = args.common.kmer_size;
let m = args.common.minimizer_size;
let theta = args.common.theta;
let level_max = args.common.level_max;
let partition_bits = args.common.partition_bits;
let n_workers = args.common.threads.max(1);
let paths = args.inputs.iter().map(PathBuf::from).collect();
let paths = args.common.inputs.iter().map(PathBuf::from).collect();
let path_source = obiread::PathIter::new(paths);
let out = Arc::new(Mutex::new(BufWriter::new(io::stdout())));
@@ -139,11 +55,11 @@ pub fn run(args: SuperkmerArgs) {
let pipeline = make_pipeline! {
PipelineData,
source path_source => Path,
||? open_chunks : Path => RawChunk,
|? { move |rope| normalize(rope, k) } : RawChunk => NormChunk,
| { move |rope| build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
sink? { move |batch| write_batch(batch, &out_sink, partition_bits, k, m) } @ Batch,
source path_source => Path,
||? open_chunks : Path => RawChunk,
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
| { move |rope| obiskbuilder::build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
sink? { move |batch| write_batch(batch, &out_sink, partition_bits, k, m) } @ Batch,
};
WorkerPool::new(pipeline, n_workers, 1).run();
+2 -1
View File
@@ -1,3 +1,4 @@
mod cli;
mod cmd;
use clap::{Parser, Subcommand};
@@ -22,7 +23,7 @@ enum Commands {
fn main() {
fmt()
.with_env_filter(EnvFilter::from_default_env())
.with_env_filter(EnvFilter::try_from_default_env().unwrap_or_else(|_| EnvFilter::new("info")))
.with_writer(std::io::stderr)
.init();
+16 -67
View File
@@ -20,13 +20,13 @@ use rayon::prelude::*;
use serde::{Deserialize, Serialize};
const META_FILENAME: &str = "partition.meta";
const SK_EXT: &str = "skmer.zst";
#[derive(Serialize, Deserialize)]
struct PartitionMeta {
n_bits: usize,
kmer_size: usize,
minimizer_size: usize,
format: String,
level: u32,
}
@@ -37,7 +37,6 @@ pub struct KmerPartition {
kmer_size: usize,
minimizer_size: usize,
writers: Vec<Option<SKFileWriter>>,
format: Format,
level: Level,
closed: bool,
}
@@ -50,15 +49,7 @@ impl KmerPartition {
minimizer_size: usize,
force: bool,
) -> SKResult<Self> {
Self::create_with(
path,
n_bits,
kmer_size,
minimizer_size,
Format::Zstd,
Level::Three,
force,
)
Self::create_with(path, n_bits, kmer_size, minimizer_size, Level::Three, force)
}
pub fn create_with<P: AsRef<Path>>(
@@ -66,7 +57,6 @@ impl KmerPartition {
n_bits: usize,
kmer_size: usize,
minimizer_size: usize,
format: Format,
level: Level,
force: bool,
) -> SKResult<Self> {
@@ -95,7 +85,6 @@ impl KmerPartition {
kmer_size,
minimizer_size,
writers,
format,
level,
closed: false,
};
@@ -116,13 +105,6 @@ impl KmerPartition {
let meta: PartitionMeta = serde_json::from_reader(fs::File::open(&meta_path)?)
.map_err(io::Error::other)?;
let format = match meta.format.as_str() {
"gzip" => Format::Gzip,
"bzip2" => Format::Bzip,
"lzma" => Format::Lzma,
"zstd" => Format::Zstd,
_ => Format::No,
};
let level = level_from_u32(meta.level);
let n_partitions = 1usize << meta.n_bits;
let writers = (0..n_partitions).map(|_| None).collect();
@@ -133,7 +115,6 @@ impl KmerPartition {
kmer_size: meta.kmer_size,
minimizer_size: meta.minimizer_size,
writers,
format,
level,
closed: true, // read-only: writing is not allowed on an opened partition
})
@@ -203,9 +184,7 @@ impl KmerPartition {
/// partition). Higher values reduce per-temp-file memory at the cost of
/// more temporary file descriptors — all managed by the global fd pool.
pub fn dereplicate(&self) -> SKResult<()> {
let format = self.format;
let level = self.level;
let ext = format_ext(format);
let root = &self.root_path;
let available = System::new_all().available_memory();
let n_threads = rayon::current_num_threads().max(1) as u64;
@@ -218,9 +197,9 @@ impl KmerPartition {
if !dir.exists() {
return Ok(());
}
let raw_path = dir.join(format!("raw.{ext}"));
let raw_path = dir.join(format!("raw.{SK_EXT}"));
let n_buckets = optimal_buckets(&raw_path, available_per_thread);
dereplicate_partition(&dir, ext, format, level, n_buckets)
dereplicate_partition(&dir, level, n_buckets)
})
.collect();
@@ -241,7 +220,6 @@ impl KmerPartition {
/// Partitions are processed in parallel via Rayon (one task per thread).
/// Peak memory per partition is ~80 MB, so n_threads partitions run simultaneously.
pub fn count_kmer(&self) -> SKResult<()> {
let ext = format_ext(self.format);
let root = &self.root_path;
let k = self.kmer_size;
@@ -249,7 +227,7 @@ impl KmerPartition {
.into_par_iter()
.map(|i| {
let dir = root.join(format!("part_{:05}", i));
let dedup_path = dir.join(format!("dereplicated.{ext}"));
let dedup_path = dir.join(format!("dereplicated.{SK_EXT}"));
if !dedup_path.exists() {
return Ok(());
}
@@ -320,14 +298,6 @@ impl KmerPartition {
n_bits,
kmer_size: self.kmer_size,
minimizer_size: self.minimizer_size,
format: match self.format {
Format::Gzip => "gzip",
Format::Bzip => "bzip2",
Format::Lzma => "lzma",
Format::Zstd => "zstd",
Format::No => "none",
}
.to_owned(),
level: u32::from(self.level),
};
let f = fs::File::create(self.root_path.join(META_FILENAME))?;
@@ -339,9 +309,8 @@ impl KmerPartition {
if self.writers[partition].is_none() {
let dir = self.root_path.join(format!("part_{:05}", partition));
fs::create_dir_all(&dir)?;
let ext = format_ext(self.format);
let file_path = dir.join(format!("raw.{ext}"));
let writer = SKFileWriter::create_with(file_path, self.format, self.level)?;
let file_path = dir.join(format!("raw.{SK_EXT}"));
let writer = SKFileWriter::create_with(file_path, Format::Zstd, self.level)?;
self.writers[partition] = Some(writer);
}
Ok(self.writers[partition].as_mut().unwrap())
@@ -408,34 +377,19 @@ fn level_from_u32(n: u32) -> Level {
}
}
fn format_ext(format: Format) -> &'static str {
match format {
Format::Gzip => "skmer.gz",
Format::Bzip => "skmer.bz2",
Format::Lzma => "skmer.xz",
Format::Zstd => "skmer.zst",
Format::No => "skmer",
}
}
/// Maximum value that fits in the 24-bit COUNT field of a SuperKmer header.
const MAX_SK_COUNT: u64 = (1 << 24) - 1;
/// Deduplicate one partition directory in place (two-phase split + merge).
fn dereplicate_partition(
dir: &Path,
ext: &str,
format: Format,
level: Level,
n_temp: usize,
) -> SKResult<()> {
let raw_path = dir.join(format!("raw.{ext}"));
fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize) -> SKResult<()> {
let raw_path = dir.join(format!("raw.{SK_EXT}"));
if !raw_path.exists() {
return Ok(());
}
let out_path = dir.join(format!("dereplicated.{ext}"));
let mut writer = SKFileWriter::create_with(&out_path, format, level)?;
let out_path = dir.join(format!("dereplicated.{SK_EXT}"));
let mut writer = SKFileWriter::create_with(&out_path, Format::Zstd, level)?;
if n_temp == 1 {
// ── Direct path: partition fits in memory, no split needed ────────────
@@ -446,13 +400,13 @@ fn dereplicate_partition(
// ── Phase 1: split raw file into temp buckets ─────────────────────────
let temp_mask = (n_temp as u64) - 1;
let temp_paths: Vec<PathBuf> = (0..n_temp)
.map(|j| dir.join(format!("temp_{j:04}.{ext}")))
.map(|j| dir.join(format!("temp_{j:04}.{SK_EXT}")))
.collect();
{
let mut writers: Vec<SKFileWriter> = temp_paths
.iter()
.map(|p| SKFileWriter::create_with(p, format, level))
.map(|p| SKFileWriter::create_with(p, Format::Zstd, level))
.collect::<SKResult<_>>()?;
let mut reader = SKFileReader::open(&raw_path)?;
@@ -530,12 +484,8 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
let mut reader = SKFileReader::open(dedup_path)?;
while let Some(sk) = reader.read()? {
pass1_superkmers += 1;
let seql = sk.seql();
if seql < k {
continue;
}
for pos in 0..=(seql - k) {
seen.insert(sk.kmer(pos, k).map_err(io::Error::other)?.canonical(k));
for kmer in sk.iter_canonical_kmers(k) {
seen.insert(kmer);
}
}
}
@@ -583,8 +533,7 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
continue;
}
pass2_count_sum += sk_count as u64;
for pos in 0..=(seql - k) {
let kmer = sk.kmer(pos, k).map_err(io::Error::other)?.canonical(k);
for kmer in sk.iter_canonical_kmers(k) {
if let Some(idx) = mphf.get(&kmer) {
counts[idx as usize] = counts[idx as usize].saturating_add(sk_count);
pass2_kmer_hits += 1;
+1 -1
View File
@@ -27,7 +27,7 @@
//! ```
//! use obikrope::{Rope, RopeCursor};
//!
//! let mut rope = Rope::new();
//! let mut rope = Rope::new(None);
//! rope.push(b"ACGT".to_vec());
//!
//! let cursor = rope.fw_cursor();
+174 -2
View File
@@ -333,8 +333,6 @@ impl SuperKmer {
/// Extract the canonical kmer of length k starting at nucleotide position i (0-based).
///
/// Equivalent to `self.kmer(i, k)?.canonical(k)` but avoids the redundant `revcomp` call
/// when the super-kmer is already in canonical form (which is the normal case).
/// Returns an error if k is invalid (0 or > 32) or if position i + k exceeds the sequence length.
pub fn canonical_kmer(&self, i: usize, k: usize) -> Result<Kmer, KmerError> {
Ok(self.kmer(i, k)?.canonical(k))
@@ -367,6 +365,16 @@ impl SuperKmer {
true
}
/// Iterate over all kmers of length `k` in order, yielding each as a left-aligned [`Kmer`].
pub fn iter_kmers(&self, k: usize) -> impl Iterator<Item = Kmer> + '_ {
SKKmerIter::new(self, k)
}
/// Iterate over all canonical kmers of length `k` in order.
pub fn iter_canonical_kmers(&self, k: usize) -> impl Iterator<Item = Kmer> + '_ {
self.iter_kmers(k).map(move |km| km.canonical(k))
}
/// Returns the XXH3 hash of the super-kmer sequence.
pub fn hash(&self) -> u64 {
if self.is_canonical() {
@@ -379,6 +387,53 @@ impl SuperKmer {
}
}
struct SKKmerIter<'a> {
skmer: &'a SuperKmer,
mask: u64,
lshift: usize,
current: u64,
pos: usize,
max_pos: usize,
}
impl<'a> SKKmerIter<'a> {
fn new(skmer: &'a SuperKmer, k: usize) -> Self {
let seql = skmer.seql();
let lshift = 64 - k * 2;
let mask = ((!0u128) << (lshift + 2)) as u64;
Self {
skmer,
mask,
lshift,
current: if seql >= k { skmer.kmer(0, k).unwrap().raw() } else { 0 },
pos: k,
max_pos: seql,
}
}
}
impl<'a> Iterator for SKKmerIter<'a> {
type Item = Kmer;
fn next(&mut self) -> Option<Self::Item> {
if self.pos > self.max_pos {
return None;
}
// Emit current kmer first, then slide the window forward.
let result = Kmer::from_raw(self.current);
if self.pos < self.max_pos {
let byte_pos = self.pos / 4;
// Nucleotide at position r within its byte occupies bits 7-2r (MSB) and 6-2r (LSB).
// Extract right-aligned, then place at lshift.
let inner_shift = 6 - 2 * (self.pos & 3);
let nuc = (((self.skmer.seq[byte_pos] >> inner_shift) & 3) as u64) << self.lshift;
self.current = ((self.current << 2) & self.mask) | nuc;
}
self.pos += 1;
Some(result)
}
}
// ── helpers ───────────────────────────────────────────────────────────────────
fn complement(base: u8) -> u8 {
@@ -755,4 +810,121 @@ mod tests {
sk.set_minimizer_pos(3);
assert_eq!(sk.to_ascii(), ascii);
}
// ── iter_kmers ────────────────────────────────────────────────────────────
#[test]
fn iter_kmers_count() {
let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
for k in [1usize, 3, 4, 5, 8, 12] {
let n = sk.iter_kmers(k).count();
assert_eq!(n, ascii.len() - k + 1, "count mismatch for k={k}");
}
}
#[test]
fn iter_kmers_first_is_kmer_0() {
let ascii = b"ACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
for k in 1..=ascii.len() {
let first = sk.iter_kmers(k).next().unwrap();
assert_eq!(first, sk.kmer(0, k).unwrap(), "k={k}");
}
}
#[test]
fn iter_kmers_matches_kmer_at_each_position() {
let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
let k = 4;
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
assert_eq!(kmers.len(), ascii.len() - k + 1);
for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, sk.kmer(i, k).unwrap(), "mismatch at pos {i}");
}
}
#[test]
fn iter_kmers_single_when_seql_eq_k() {
let ascii = b"ACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
let k = ascii.len();
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
assert_eq!(kmers.len(), 1);
assert_eq!(kmers[0], sk.kmer(0, k).unwrap());
}
#[test]
fn iter_kmers_two_when_seql_eq_k_plus_one() {
let ascii = b"ACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
let k = ascii.len() - 1;
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
assert_eq!(kmers.len(), 2);
assert_eq!(kmers[0], sk.kmer(0, k).unwrap());
assert_eq!(kmers[1], sk.kmer(1, k).unwrap());
}
#[test]
fn iter_kmers_all_k_values() {
// For every valid k, each yielded kmer must match kmer(i, k).
let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
let seql = ascii.len();
for k in 1..=seql {
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
assert_eq!(kmers.len(), seql - k + 1, "k={k}");
for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, sk.kmer(i, k).unwrap(), "k={k}, pos={i}");
}
}
}
#[test]
fn iter_kmers_crosses_byte_boundary() {
// Positions 3→4 and 7→8 cross a 4-nucleotide byte boundary.
let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
let k = 3;
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
for boundary in [3usize, 4, 7, 8] {
if boundary + 1 < kmers.len() {
assert_eq!(
kmers[boundary],
sk.kmer(boundary, k).unwrap(),
"pos={boundary}"
);
assert_eq!(
kmers[boundary + 1],
sk.kmer(boundary + 1, k).unwrap(),
"pos={}",
boundary + 1
);
}
}
}
#[test]
fn iter_kmers_k1_yields_all_nucleotides() {
let ascii = b"ACGT";
let sk = SuperKmer::from_ascii(ascii);
let kmers: Vec<Kmer> = sk.iter_kmers(1).collect();
assert_eq!(kmers.len(), 4);
for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, sk.kmer(i, 1).unwrap(), "pos={i}");
}
}
#[test]
fn iter_kmers_long_sequence() {
let ascii = make_seq(20);
let sk = SuperKmer::from_ascii(&ascii);
let k = 7;
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
assert_eq!(kmers.len(), ascii.len() - k + 1);
for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, sk.kmer(i, k).unwrap(), "pos={i}");
}
}
}
+16 -12
View File
@@ -168,39 +168,43 @@ mod tests {
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
const M: usize = 5;
#[test]
fn single_segment_one_superkmer() {
let out = run_nofilter(b"ACGTACGT\x00", 4, 2);
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K, M);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= 4);
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
let out = run_nofilter(b"ACG\x00", 4, 2);
let out = run_nofilter(b"ACGTACGT\x00", K, M);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
let out = run_nofilter(b"", 4, 2);
let out = run_nofilter(b"", K, M);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
let out = run_nofilter(b"ACGTACGT\x00TTTTTTTT\x00", 4, 2);
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K, M);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
let out_pass = run_nofilter(b"AAAAAAAAACGT\x00", 4, 2);
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K, M);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, 4, 2, 6, 0.9)
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, M, 6, 0.9)
.map(|sk| sk.to_ascii())
.collect();
assert!(out_reject.is_empty());
@@ -208,12 +212,12 @@ mod tests {
#[test]
fn multi_slice_rope() {
let data = b"ACGTACGTACGT\x00";
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, 4, 2, 1, 0.0)
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, M, 1, 0.0)
.map(|sk| sk.to_ascii())
.collect();
assert!(!out.is_empty());
@@ -221,8 +225,8 @@ mod tests {
#[test]
fn yields_minimizer_value() {
let rope = make_rope(b"ACGTACGT\x00");
let results: Vec<SuperKmer> = SuperKmerIter::new(&rope, 4, 2, 1, 0.0).collect();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<SuperKmer> = SuperKmerIter::new(&rope, K, M, 1, 0.0).collect();
assert!(!results.is_empty());
}
}
+8
View File
@@ -14,3 +14,11 @@ pub(crate) mod rolling_stat;
pub use iter::SuperKmerIter;
pub use scratch::SuperKmerScratch;
use obikrope::Rope;
use obikseq::superkmer::SuperKmer;
/// Collect all super-kmers from a normalised rope chunk.
pub fn build_superkmers(rope: Rope, k: usize, m: usize, level_max: usize, theta: f64) -> Vec<SuperKmer> {
SuperKmerIter::new(&rope, k, m, level_max, theta).collect()
}