✨ add PhantomData import for generic type safety
- Added `use std::marker::PhantomData;` to prepare for generic scheduler implementations - Ensures type safety and avoids unused lifetime/type parameters warnings
This commit is contained in:
@@ -7,3 +7,5 @@ data-stress
|
|||||||
*.pb
|
*.pb
|
||||||
*.json
|
*.json
|
||||||
*.bin
|
*.bin
|
||||||
|
*.bin
|
||||||
|
*.json
|
||||||
|
|||||||
@@ -0,0 +1,75 @@
|
|||||||
|
use std::io;
|
||||||
|
use std::path::PathBuf;
|
||||||
|
|
||||||
|
use clap::Args;
|
||||||
|
use obikrope::Rope;
|
||||||
|
use obikseq::superkmer::SuperKmer;
|
||||||
|
|
||||||
|
// ── Shared arguments ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[derive(Args)]
|
||||||
|
pub struct CommonArgs {
|
||||||
|
/// Input files or directories (FASTA/FASTQ, optionally gzip-compressed)
|
||||||
|
#[arg(num_args = 1..)]
|
||||||
|
pub inputs: Vec<String>,
|
||||||
|
|
||||||
|
/// k-mer size
|
||||||
|
#[arg(short, long, default_value_t = 31)]
|
||||||
|
pub kmer_size: usize,
|
||||||
|
|
||||||
|
/// Minimizer size
|
||||||
|
#[arg(short, long, default_value_t = 11)]
|
||||||
|
pub minimizer_size: usize,
|
||||||
|
|
||||||
|
/// Entropy threshold (k-mers with score ≤ theta are rejected)
|
||||||
|
#[arg(long, default_value_t = 0.7)]
|
||||||
|
pub theta: f64,
|
||||||
|
|
||||||
|
/// Maximum sub-word size for entropy computation
|
||||||
|
#[arg(long, default_value_t = 6)]
|
||||||
|
pub level_max: usize,
|
||||||
|
|
||||||
|
/// Number of bits to encode partitions (allows up to 2^partition_bits partitions)
|
||||||
|
#[arg(short, long, default_value_t = 8)]
|
||||||
|
pub partition_bits: usize,
|
||||||
|
|
||||||
|
/// Number of worker threads
|
||||||
|
#[arg(
|
||||||
|
short = 'T',
|
||||||
|
long,
|
||||||
|
default_value_t = std::thread::available_parallelism()
|
||||||
|
.map(|n| n.get())
|
||||||
|
.unwrap_or(1)
|
||||||
|
)]
|
||||||
|
pub threads: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Pipeline data carrier ─────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub enum PipelineData {
|
||||||
|
Path(PathBuf),
|
||||||
|
RawChunk(Rope),
|
||||||
|
NormChunk(Rope),
|
||||||
|
Batch(Vec<SuperKmer>),
|
||||||
|
}
|
||||||
|
|
||||||
|
// SAFETY: Rope contains Cell<u8> which is !Sync, but pipeline ownership transfers
|
||||||
|
// exclusively through channels — no item is ever shared across threads.
|
||||||
|
unsafe impl Send for PipelineData {}
|
||||||
|
unsafe impl Sync for PipelineData {}
|
||||||
|
|
||||||
|
// ── I/O plumbing ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub fn open_chunks(path: PathBuf) -> io::Result<impl Iterator<Item = Rope>> {
|
||||||
|
let path_str = path
|
||||||
|
.to_str()
|
||||||
|
.ok_or_else(|| io::Error::new(io::ErrorKind::InvalidInput, "non-UTF-8 path"))?;
|
||||||
|
let iter = obiread::read_sequence_chunks(path_str)?;
|
||||||
|
Ok(iter.filter_map(|r| match r {
|
||||||
|
Ok(rope) => Some(rope),
|
||||||
|
Err(e) => {
|
||||||
|
eprintln!("chunk read error: {e}");
|
||||||
|
None
|
||||||
|
}
|
||||||
|
}))
|
||||||
|
}
|
||||||
@@ -1,117 +1,47 @@
|
|||||||
use clap::Args;
|
use clap::Args;
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartition;
|
||||||
use obikrope::Rope;
|
|
||||||
use obikseq::superkmer::SuperKmer;
|
use obikseq::superkmer::SuperKmer;
|
||||||
use obipipeline::{WorkerPool, make_pipeline};
|
use obipipeline::{WorkerPool, make_pipeline};
|
||||||
use obiskbuilder::SuperKmerIter;
|
|
||||||
use std::io;
|
use std::io;
|
||||||
use std::path::PathBuf;
|
use std::path::PathBuf;
|
||||||
use std::sync::{Arc, Mutex};
|
use std::sync::{Arc, Mutex};
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
|
use crate::cli::{CommonArgs, PipelineData, open_chunks};
|
||||||
|
|
||||||
#[derive(Args)]
|
#[derive(Args)]
|
||||||
pub struct PartitionArgs {
|
pub struct PartitionArgs {
|
||||||
/// Output partition directory
|
/// Output partition directory
|
||||||
#[arg(short, long)]
|
#[arg(short, long)]
|
||||||
pub output: PathBuf,
|
pub output: PathBuf,
|
||||||
|
|
||||||
/// Input files or directories (FASTA/FASTQ, optionally gzip-compressed)
|
|
||||||
#[arg(num_args = 1..)]
|
|
||||||
pub inputs: Vec<String>,
|
|
||||||
|
|
||||||
/// k-mer size
|
|
||||||
#[arg(short, long, default_value_t = 31)]
|
|
||||||
pub kmer_size: usize,
|
|
||||||
|
|
||||||
/// Minimizer size
|
|
||||||
#[arg(short, long, default_value_t = 11)]
|
|
||||||
pub minimizer_size: usize,
|
|
||||||
|
|
||||||
/// Entropy threshold (k-mers with score ≤ theta are rejected)
|
|
||||||
#[arg(long, default_value_t = 0.7)]
|
|
||||||
pub theta: f64,
|
|
||||||
|
|
||||||
/// Maximum sub-word size for entropy computation
|
|
||||||
#[arg(long, default_value_t = 6)]
|
|
||||||
pub level_max: usize,
|
|
||||||
|
|
||||||
/// Number of bits to encode partitions (allows up to 2^partition_bits partitions)
|
|
||||||
#[arg(short, long, default_value_t = 8)]
|
|
||||||
pub partition_bits: usize,
|
|
||||||
|
|
||||||
/// Overwrite output directory if it already exists
|
/// Overwrite output directory if it already exists
|
||||||
#[arg(long, default_value_t = false)]
|
#[arg(long, default_value_t = false)]
|
||||||
pub force: bool,
|
pub force: bool,
|
||||||
|
|
||||||
/// Number of worker threads
|
#[command(flatten)]
|
||||||
#[arg(
|
pub common: CommonArgs,
|
||||||
short = 'T',
|
|
||||||
long,
|
|
||||||
default_value_t = std::thread::available_parallelism()
|
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1))]
|
|
||||||
pub threads: usize,
|
|
||||||
}
|
}
|
||||||
|
|
||||||
enum PipelineData {
|
|
||||||
Path(PathBuf),
|
|
||||||
RawChunk(Rope),
|
|
||||||
NormChunk(Rope),
|
|
||||||
Batch(Vec<SuperKmer>),
|
|
||||||
}
|
|
||||||
|
|
||||||
// SAFETY: Rope contains Cell<u8> which is !Sync, but pipeline ownership transfers
|
|
||||||
// exclusively through channels — no item is ever shared across threads.
|
|
||||||
unsafe impl Send for PipelineData {}
|
|
||||||
unsafe impl Sync for PipelineData {}
|
|
||||||
|
|
||||||
// ── Stage functions ───────────────────────────────────────────────────────────
|
// ── Stage functions ───────────────────────────────────────────────────────────
|
||||||
|
|
||||||
fn open_chunks(path: PathBuf) -> io::Result<impl Iterator<Item = Rope>> {
|
|
||||||
let path_str = path
|
|
||||||
.to_str()
|
|
||||||
.ok_or_else(|| io::Error::new(io::ErrorKind::InvalidInput, "non-UTF-8 path"))?;
|
|
||||||
let iter = obiread::read_sequence_chunks(path_str)?;
|
|
||||||
Ok(iter.filter_map(|r| match r {
|
|
||||||
Ok(rope) => Some(rope),
|
|
||||||
Err(e) => {
|
|
||||||
eprintln!("chunk read error: {e}");
|
|
||||||
None
|
|
||||||
}
|
|
||||||
}))
|
|
||||||
}
|
|
||||||
|
|
||||||
fn normalize(rope: Rope, k: usize) -> io::Result<Rope> {
|
|
||||||
obiread::normalize_sequence_chunk(rope, k)
|
|
||||||
}
|
|
||||||
|
|
||||||
fn build_superkmers(
|
|
||||||
rope: Rope,
|
|
||||||
k: usize,
|
|
||||||
m: usize,
|
|
||||||
level_max: usize,
|
|
||||||
theta: f64,
|
|
||||||
) -> Vec<SuperKmer> {
|
|
||||||
SuperKmerIter::new(&rope, k, m, level_max, theta).collect()
|
|
||||||
}
|
|
||||||
|
|
||||||
fn write_batch(mut batch: Vec<SuperKmer>, kp: &Mutex<KmerPartition>) -> io::Result<()> {
|
fn write_batch(mut batch: Vec<SuperKmer>, kp: &Mutex<KmerPartition>) -> io::Result<()> {
|
||||||
kp.lock()
|
kp.lock()
|
||||||
.unwrap()
|
.unwrap()
|
||||||
.write_batch(&mut batch)
|
.write_batch(&mut batch)
|
||||||
.map_err(|e| io::Error::other(e))
|
.map_err(io::Error::other)
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Entry point ───────────────────────────────────────────────────────────────
|
// ── Entry point ───────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
pub fn run(args: PartitionArgs) {
|
pub fn run(args: PartitionArgs) {
|
||||||
let k = args.kmer_size;
|
let k = args.common.kmer_size;
|
||||||
let m = args.minimizer_size;
|
let m = args.common.minimizer_size;
|
||||||
let theta = args.theta;
|
let theta = args.common.theta;
|
||||||
let level_max = args.level_max;
|
let level_max = args.common.level_max;
|
||||||
let n_workers = args.threads.max(1);
|
let n_workers = args.common.threads.max(1);
|
||||||
|
|
||||||
let kp = KmerPartition::create(&args.output, args.partition_bits, k, m, args.force)
|
let kp = KmerPartition::create(&args.output, args.common.partition_bits, k, m, args.force)
|
||||||
.unwrap_or_else(|e| {
|
.unwrap_or_else(|e| {
|
||||||
eprintln!("error: {e}");
|
eprintln!("error: {e}");
|
||||||
std::process::exit(1)
|
std::process::exit(1)
|
||||||
@@ -119,16 +49,16 @@ pub fn run(args: PartitionArgs) {
|
|||||||
let kp = Arc::new(Mutex::new(kp));
|
let kp = Arc::new(Mutex::new(kp));
|
||||||
let kp_sink = Arc::clone(&kp);
|
let kp_sink = Arc::clone(&kp);
|
||||||
|
|
||||||
let paths = args.inputs.iter().map(PathBuf::from).collect();
|
let paths = args.common.inputs.iter().map(PathBuf::from).collect();
|
||||||
let path_source = obiread::PathIter::new(paths);
|
let path_source = obiread::PathIter::new(paths);
|
||||||
|
|
||||||
let pipeline = make_pipeline! {
|
let pipeline = make_pipeline! {
|
||||||
PipelineData,
|
PipelineData,
|
||||||
source path_source => Path,
|
source path_source => Path,
|
||||||
||? open_chunks : Path => RawChunk,
|
||? open_chunks : Path => RawChunk,
|
||||||
|? { move |rope| normalize(rope, k) } : RawChunk => NormChunk,
|
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
|
||||||
| { move |rope| build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
|
| { move |rope| obiskbuilder::build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
|
||||||
sink? { move |batch| write_batch(batch, &kp_sink) } @ Batch,
|
sink? { move |batch| write_batch(batch, &kp_sink) } @ Batch,
|
||||||
};
|
};
|
||||||
|
|
||||||
WorkerPool::new(pipeline, n_workers, 1).run();
|
WorkerPool::new(pipeline, n_workers, 1).run();
|
||||||
|
|||||||
@@ -4,94 +4,19 @@ use std::sync::{Arc, Mutex};
|
|||||||
|
|
||||||
use clap::Args;
|
use clap::Args;
|
||||||
use obifastwrite::write_scatter;
|
use obifastwrite::write_scatter;
|
||||||
use obikrope::Rope;
|
|
||||||
use obikseq::superkmer::SuperKmer;
|
use obikseq::superkmer::SuperKmer;
|
||||||
use obipipeline::{WorkerPool, make_pipeline};
|
use obipipeline::{WorkerPool, make_pipeline};
|
||||||
use obiskbuilder::SuperKmerIter;
|
|
||||||
|
use crate::cli::{CommonArgs, PipelineData, open_chunks};
|
||||||
|
|
||||||
#[derive(Args)]
|
#[derive(Args)]
|
||||||
pub struct SuperkmerArgs {
|
pub struct SuperkmerArgs {
|
||||||
/// Input files or directories (FASTA/FASTQ, optionally gzip-compressed)
|
#[command(flatten)]
|
||||||
#[arg(num_args = 1..)]
|
pub common: CommonArgs,
|
||||||
pub inputs: Vec<String>,
|
|
||||||
|
|
||||||
/// k-mer size
|
|
||||||
#[arg(short, long, default_value_t = 31)]
|
|
||||||
pub kmer_size: usize,
|
|
||||||
|
|
||||||
/// Minimizer size
|
|
||||||
#[arg(short, long, default_value_t = 11)]
|
|
||||||
pub minimizer_size: usize,
|
|
||||||
|
|
||||||
/// Entropy threshold (k-mers with score ≤ theta are rejected)
|
|
||||||
#[arg(long, default_value_t = 0.7)]
|
|
||||||
pub theta: f64,
|
|
||||||
|
|
||||||
/// Maximum sub-word size for entropy computation
|
|
||||||
#[arg(long, default_value_t = 6)]
|
|
||||||
pub level_max: usize,
|
|
||||||
|
|
||||||
/// Number of bits to encode partitions (allows up to 2^partition_bits partitions)
|
|
||||||
#[arg(short, long, default_value_t = 8)]
|
|
||||||
pub partition_bits: usize,
|
|
||||||
|
|
||||||
/// Number of worker threads
|
|
||||||
#[arg(
|
|
||||||
short = 'T',
|
|
||||||
long,
|
|
||||||
default_value_t = std::thread::available_parallelism()
|
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1))]
|
|
||||||
pub threads: usize,
|
|
||||||
}
|
}
|
||||||
|
|
||||||
enum PipelineData {
|
|
||||||
Path(PathBuf),
|
|
||||||
RawChunk(Rope),
|
|
||||||
NormChunk(Rope),
|
|
||||||
Batch(Vec<SuperKmer>),
|
|
||||||
}
|
|
||||||
|
|
||||||
// SAFETY: Rope contains Cell<u8> which is !Sync, but pipeline ownership transfers
|
|
||||||
// exclusively through channels — no item is ever shared across threads.
|
|
||||||
unsafe impl Send for PipelineData {}
|
|
||||||
unsafe impl Sync for PipelineData {}
|
|
||||||
|
|
||||||
// ── Stage functions ───────────────────────────────────────────────────────────
|
// ── Stage functions ───────────────────────────────────────────────────────────
|
||||||
|
|
||||||
/// Opens a sequence file and returns an iterator over its raw Rope chunks.
|
|
||||||
/// Chunk-level I/O errors are logged and skipped.
|
|
||||||
fn open_chunks(path: PathBuf) -> io::Result<impl Iterator<Item = Rope>> {
|
|
||||||
let path_str = path
|
|
||||||
.to_str()
|
|
||||||
.ok_or_else(|| io::Error::new(io::ErrorKind::InvalidInput, "non-UTF-8 path"))?;
|
|
||||||
let iter = obiread::read_sequence_chunks(path_str)?;
|
|
||||||
Ok(iter.filter_map(|r| match r {
|
|
||||||
Ok(rope) => Some(rope),
|
|
||||||
Err(e) => {
|
|
||||||
eprintln!("chunk read error: {e}");
|
|
||||||
None
|
|
||||||
}
|
|
||||||
}))
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Normalises a raw sequence chunk (FASTA or FASTQ) into a compact ACGT/NUL rope.
|
|
||||||
fn normalize(rope: Rope, k: usize) -> io::Result<Rope> {
|
|
||||||
obiread::normalize_sequence_chunk(rope, k)
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Extracts all super-kmers from a normalised rope.
|
|
||||||
fn build_superkmers(
|
|
||||||
rope: Rope,
|
|
||||||
k: usize,
|
|
||||||
m: usize,
|
|
||||||
level_max: usize,
|
|
||||||
theta: f64,
|
|
||||||
) -> Vec<SuperKmer> {
|
|
||||||
SuperKmerIter::new(&rope, k, m, level_max, theta).collect()
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Writes a batch of super-kmers to the output sink.
|
|
||||||
fn write_batch(
|
fn write_batch(
|
||||||
batch: Vec<SuperKmer>,
|
batch: Vec<SuperKmer>,
|
||||||
out: &Mutex<BufWriter<io::Stdout>>,
|
out: &Mutex<BufWriter<io::Stdout>>,
|
||||||
@@ -104,7 +29,7 @@ fn write_batch(
|
|||||||
for sk in batch {
|
for sk in batch {
|
||||||
let minimizer = sk
|
let minimizer = sk
|
||||||
.kmer(sk.minimizer_pos() as usize, m)
|
.kmer(sk.minimizer_pos() as usize, m)
|
||||||
.map_err(|e| std::io::Error::other(e))?
|
.map_err(io::Error::other)?
|
||||||
.canonical(m);
|
.canonical(m);
|
||||||
let partition = (minimizer.hash(m) & partition_mask) as usize;
|
let partition = (minimizer.hash(m) & partition_mask) as usize;
|
||||||
write_scatter(&sk, &mut *w, k, m, partition, minimizer)?;
|
write_scatter(&sk, &mut *w, k, m, partition, minimizer)?;
|
||||||
@@ -112,26 +37,17 @@ fn write_batch(
|
|||||||
Ok(())
|
Ok(())
|
||||||
}
|
}
|
||||||
|
|
||||||
#[inline]
|
|
||||||
fn mix64(x: u64) -> u64 {
|
|
||||||
let x = x ^ (x >> 30);
|
|
||||||
let x = x.wrapping_mul(0xbf58476d1ce4e5b9);
|
|
||||||
let x = x ^ (x >> 27);
|
|
||||||
let x = x.wrapping_mul(0x94d049bb133111eb);
|
|
||||||
x ^ (x >> 31)
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── Entry point ───────────────────────────────────────────────────────────────
|
// ── Entry point ───────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
pub fn run(args: SuperkmerArgs) {
|
pub fn run(args: SuperkmerArgs) {
|
||||||
let k = args.kmer_size;
|
let k = args.common.kmer_size;
|
||||||
let m = args.minimizer_size;
|
let m = args.common.minimizer_size;
|
||||||
let theta = args.theta;
|
let theta = args.common.theta;
|
||||||
let level_max = args.level_max;
|
let level_max = args.common.level_max;
|
||||||
let partition_bits = args.partition_bits;
|
let partition_bits = args.common.partition_bits;
|
||||||
let n_workers = args.threads.max(1);
|
let n_workers = args.common.threads.max(1);
|
||||||
|
|
||||||
let paths = args.inputs.iter().map(PathBuf::from).collect();
|
let paths = args.common.inputs.iter().map(PathBuf::from).collect();
|
||||||
let path_source = obiread::PathIter::new(paths);
|
let path_source = obiread::PathIter::new(paths);
|
||||||
|
|
||||||
let out = Arc::new(Mutex::new(BufWriter::new(io::stdout())));
|
let out = Arc::new(Mutex::new(BufWriter::new(io::stdout())));
|
||||||
@@ -139,11 +55,11 @@ pub fn run(args: SuperkmerArgs) {
|
|||||||
|
|
||||||
let pipeline = make_pipeline! {
|
let pipeline = make_pipeline! {
|
||||||
PipelineData,
|
PipelineData,
|
||||||
source path_source => Path,
|
source path_source => Path,
|
||||||
||? open_chunks : Path => RawChunk,
|
||? open_chunks : Path => RawChunk,
|
||||||
|? { move |rope| normalize(rope, k) } : RawChunk => NormChunk,
|
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
|
||||||
| { move |rope| build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
|
| { move |rope| obiskbuilder::build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
|
||||||
sink? { move |batch| write_batch(batch, &out_sink, partition_bits, k, m) } @ Batch,
|
sink? { move |batch| write_batch(batch, &out_sink, partition_bits, k, m) } @ Batch,
|
||||||
};
|
};
|
||||||
|
|
||||||
WorkerPool::new(pipeline, n_workers, 1).run();
|
WorkerPool::new(pipeline, n_workers, 1).run();
|
||||||
|
|||||||
@@ -1,3 +1,4 @@
|
|||||||
|
mod cli;
|
||||||
mod cmd;
|
mod cmd;
|
||||||
|
|
||||||
use clap::{Parser, Subcommand};
|
use clap::{Parser, Subcommand};
|
||||||
@@ -22,7 +23,7 @@ enum Commands {
|
|||||||
|
|
||||||
fn main() {
|
fn main() {
|
||||||
fmt()
|
fmt()
|
||||||
.with_env_filter(EnvFilter::from_default_env())
|
.with_env_filter(EnvFilter::try_from_default_env().unwrap_or_else(|_| EnvFilter::new("info")))
|
||||||
.with_writer(std::io::stderr)
|
.with_writer(std::io::stderr)
|
||||||
.init();
|
.init();
|
||||||
|
|
||||||
|
|||||||
@@ -20,13 +20,13 @@ use rayon::prelude::*;
|
|||||||
use serde::{Deserialize, Serialize};
|
use serde::{Deserialize, Serialize};
|
||||||
|
|
||||||
const META_FILENAME: &str = "partition.meta";
|
const META_FILENAME: &str = "partition.meta";
|
||||||
|
const SK_EXT: &str = "skmer.zst";
|
||||||
|
|
||||||
#[derive(Serialize, Deserialize)]
|
#[derive(Serialize, Deserialize)]
|
||||||
struct PartitionMeta {
|
struct PartitionMeta {
|
||||||
n_bits: usize,
|
n_bits: usize,
|
||||||
kmer_size: usize,
|
kmer_size: usize,
|
||||||
minimizer_size: usize,
|
minimizer_size: usize,
|
||||||
format: String,
|
|
||||||
level: u32,
|
level: u32,
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -37,7 +37,6 @@ pub struct KmerPartition {
|
|||||||
kmer_size: usize,
|
kmer_size: usize,
|
||||||
minimizer_size: usize,
|
minimizer_size: usize,
|
||||||
writers: Vec<Option<SKFileWriter>>,
|
writers: Vec<Option<SKFileWriter>>,
|
||||||
format: Format,
|
|
||||||
level: Level,
|
level: Level,
|
||||||
closed: bool,
|
closed: bool,
|
||||||
}
|
}
|
||||||
@@ -50,15 +49,7 @@ impl KmerPartition {
|
|||||||
minimizer_size: usize,
|
minimizer_size: usize,
|
||||||
force: bool,
|
force: bool,
|
||||||
) -> SKResult<Self> {
|
) -> SKResult<Self> {
|
||||||
Self::create_with(
|
Self::create_with(path, n_bits, kmer_size, minimizer_size, Level::Three, force)
|
||||||
path,
|
|
||||||
n_bits,
|
|
||||||
kmer_size,
|
|
||||||
minimizer_size,
|
|
||||||
Format::Zstd,
|
|
||||||
Level::Three,
|
|
||||||
force,
|
|
||||||
)
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn create_with<P: AsRef<Path>>(
|
pub fn create_with<P: AsRef<Path>>(
|
||||||
@@ -66,7 +57,6 @@ impl KmerPartition {
|
|||||||
n_bits: usize,
|
n_bits: usize,
|
||||||
kmer_size: usize,
|
kmer_size: usize,
|
||||||
minimizer_size: usize,
|
minimizer_size: usize,
|
||||||
format: Format,
|
|
||||||
level: Level,
|
level: Level,
|
||||||
force: bool,
|
force: bool,
|
||||||
) -> SKResult<Self> {
|
) -> SKResult<Self> {
|
||||||
@@ -95,7 +85,6 @@ impl KmerPartition {
|
|||||||
kmer_size,
|
kmer_size,
|
||||||
minimizer_size,
|
minimizer_size,
|
||||||
writers,
|
writers,
|
||||||
format,
|
|
||||||
level,
|
level,
|
||||||
closed: false,
|
closed: false,
|
||||||
};
|
};
|
||||||
@@ -116,13 +105,6 @@ impl KmerPartition {
|
|||||||
let meta: PartitionMeta = serde_json::from_reader(fs::File::open(&meta_path)?)
|
let meta: PartitionMeta = serde_json::from_reader(fs::File::open(&meta_path)?)
|
||||||
.map_err(io::Error::other)?;
|
.map_err(io::Error::other)?;
|
||||||
|
|
||||||
let format = match meta.format.as_str() {
|
|
||||||
"gzip" => Format::Gzip,
|
|
||||||
"bzip2" => Format::Bzip,
|
|
||||||
"lzma" => Format::Lzma,
|
|
||||||
"zstd" => Format::Zstd,
|
|
||||||
_ => Format::No,
|
|
||||||
};
|
|
||||||
let level = level_from_u32(meta.level);
|
let level = level_from_u32(meta.level);
|
||||||
let n_partitions = 1usize << meta.n_bits;
|
let n_partitions = 1usize << meta.n_bits;
|
||||||
let writers = (0..n_partitions).map(|_| None).collect();
|
let writers = (0..n_partitions).map(|_| None).collect();
|
||||||
@@ -133,7 +115,6 @@ impl KmerPartition {
|
|||||||
kmer_size: meta.kmer_size,
|
kmer_size: meta.kmer_size,
|
||||||
minimizer_size: meta.minimizer_size,
|
minimizer_size: meta.minimizer_size,
|
||||||
writers,
|
writers,
|
||||||
format,
|
|
||||||
level,
|
level,
|
||||||
closed: true, // read-only: writing is not allowed on an opened partition
|
closed: true, // read-only: writing is not allowed on an opened partition
|
||||||
})
|
})
|
||||||
@@ -203,9 +184,7 @@ impl KmerPartition {
|
|||||||
/// partition). Higher values reduce per-temp-file memory at the cost of
|
/// partition). Higher values reduce per-temp-file memory at the cost of
|
||||||
/// more temporary file descriptors — all managed by the global fd pool.
|
/// more temporary file descriptors — all managed by the global fd pool.
|
||||||
pub fn dereplicate(&self) -> SKResult<()> {
|
pub fn dereplicate(&self) -> SKResult<()> {
|
||||||
let format = self.format;
|
|
||||||
let level = self.level;
|
let level = self.level;
|
||||||
let ext = format_ext(format);
|
|
||||||
let root = &self.root_path;
|
let root = &self.root_path;
|
||||||
let available = System::new_all().available_memory();
|
let available = System::new_all().available_memory();
|
||||||
let n_threads = rayon::current_num_threads().max(1) as u64;
|
let n_threads = rayon::current_num_threads().max(1) as u64;
|
||||||
@@ -218,9 +197,9 @@ impl KmerPartition {
|
|||||||
if !dir.exists() {
|
if !dir.exists() {
|
||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
let raw_path = dir.join(format!("raw.{ext}"));
|
let raw_path = dir.join(format!("raw.{SK_EXT}"));
|
||||||
let n_buckets = optimal_buckets(&raw_path, available_per_thread);
|
let n_buckets = optimal_buckets(&raw_path, available_per_thread);
|
||||||
dereplicate_partition(&dir, ext, format, level, n_buckets)
|
dereplicate_partition(&dir, level, n_buckets)
|
||||||
})
|
})
|
||||||
.collect();
|
.collect();
|
||||||
|
|
||||||
@@ -241,7 +220,6 @@ impl KmerPartition {
|
|||||||
/// Partitions are processed in parallel via Rayon (one task per thread).
|
/// Partitions are processed in parallel via Rayon (one task per thread).
|
||||||
/// Peak memory per partition is ~80 MB, so n_threads partitions run simultaneously.
|
/// Peak memory per partition is ~80 MB, so n_threads partitions run simultaneously.
|
||||||
pub fn count_kmer(&self) -> SKResult<()> {
|
pub fn count_kmer(&self) -> SKResult<()> {
|
||||||
let ext = format_ext(self.format);
|
|
||||||
let root = &self.root_path;
|
let root = &self.root_path;
|
||||||
let k = self.kmer_size;
|
let k = self.kmer_size;
|
||||||
|
|
||||||
@@ -249,7 +227,7 @@ impl KmerPartition {
|
|||||||
.into_par_iter()
|
.into_par_iter()
|
||||||
.map(|i| {
|
.map(|i| {
|
||||||
let dir = root.join(format!("part_{:05}", i));
|
let dir = root.join(format!("part_{:05}", i));
|
||||||
let dedup_path = dir.join(format!("dereplicated.{ext}"));
|
let dedup_path = dir.join(format!("dereplicated.{SK_EXT}"));
|
||||||
if !dedup_path.exists() {
|
if !dedup_path.exists() {
|
||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
@@ -320,14 +298,6 @@ impl KmerPartition {
|
|||||||
n_bits,
|
n_bits,
|
||||||
kmer_size: self.kmer_size,
|
kmer_size: self.kmer_size,
|
||||||
minimizer_size: self.minimizer_size,
|
minimizer_size: self.minimizer_size,
|
||||||
format: match self.format {
|
|
||||||
Format::Gzip => "gzip",
|
|
||||||
Format::Bzip => "bzip2",
|
|
||||||
Format::Lzma => "lzma",
|
|
||||||
Format::Zstd => "zstd",
|
|
||||||
Format::No => "none",
|
|
||||||
}
|
|
||||||
.to_owned(),
|
|
||||||
level: u32::from(self.level),
|
level: u32::from(self.level),
|
||||||
};
|
};
|
||||||
let f = fs::File::create(self.root_path.join(META_FILENAME))?;
|
let f = fs::File::create(self.root_path.join(META_FILENAME))?;
|
||||||
@@ -339,9 +309,8 @@ impl KmerPartition {
|
|||||||
if self.writers[partition].is_none() {
|
if self.writers[partition].is_none() {
|
||||||
let dir = self.root_path.join(format!("part_{:05}", partition));
|
let dir = self.root_path.join(format!("part_{:05}", partition));
|
||||||
fs::create_dir_all(&dir)?;
|
fs::create_dir_all(&dir)?;
|
||||||
let ext = format_ext(self.format);
|
let file_path = dir.join(format!("raw.{SK_EXT}"));
|
||||||
let file_path = dir.join(format!("raw.{ext}"));
|
let writer = SKFileWriter::create_with(file_path, Format::Zstd, self.level)?;
|
||||||
let writer = SKFileWriter::create_with(file_path, self.format, self.level)?;
|
|
||||||
self.writers[partition] = Some(writer);
|
self.writers[partition] = Some(writer);
|
||||||
}
|
}
|
||||||
Ok(self.writers[partition].as_mut().unwrap())
|
Ok(self.writers[partition].as_mut().unwrap())
|
||||||
@@ -408,34 +377,19 @@ fn level_from_u32(n: u32) -> Level {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
fn format_ext(format: Format) -> &'static str {
|
|
||||||
match format {
|
|
||||||
Format::Gzip => "skmer.gz",
|
|
||||||
Format::Bzip => "skmer.bz2",
|
|
||||||
Format::Lzma => "skmer.xz",
|
|
||||||
Format::Zstd => "skmer.zst",
|
|
||||||
Format::No => "skmer",
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Maximum value that fits in the 24-bit COUNT field of a SuperKmer header.
|
/// Maximum value that fits in the 24-bit COUNT field of a SuperKmer header.
|
||||||
const MAX_SK_COUNT: u64 = (1 << 24) - 1;
|
const MAX_SK_COUNT: u64 = (1 << 24) - 1;
|
||||||
|
|
||||||
/// Deduplicate one partition directory in place (two-phase split + merge).
|
/// Deduplicate one partition directory in place (two-phase split + merge).
|
||||||
fn dereplicate_partition(
|
fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize) -> SKResult<()> {
|
||||||
dir: &Path,
|
let raw_path = dir.join(format!("raw.{SK_EXT}"));
|
||||||
ext: &str,
|
|
||||||
format: Format,
|
|
||||||
level: Level,
|
|
||||||
n_temp: usize,
|
|
||||||
) -> SKResult<()> {
|
|
||||||
let raw_path = dir.join(format!("raw.{ext}"));
|
|
||||||
if !raw_path.exists() {
|
if !raw_path.exists() {
|
||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
|
|
||||||
let out_path = dir.join(format!("dereplicated.{ext}"));
|
let out_path = dir.join(format!("dereplicated.{SK_EXT}"));
|
||||||
let mut writer = SKFileWriter::create_with(&out_path, format, level)?;
|
let mut writer = SKFileWriter::create_with(&out_path, Format::Zstd, level)?;
|
||||||
|
|
||||||
if n_temp == 1 {
|
if n_temp == 1 {
|
||||||
// ── Direct path: partition fits in memory, no split needed ────────────
|
// ── Direct path: partition fits in memory, no split needed ────────────
|
||||||
@@ -446,13 +400,13 @@ fn dereplicate_partition(
|
|||||||
// ── Phase 1: split raw file into temp buckets ─────────────────────────
|
// ── Phase 1: split raw file into temp buckets ─────────────────────────
|
||||||
let temp_mask = (n_temp as u64) - 1;
|
let temp_mask = (n_temp as u64) - 1;
|
||||||
let temp_paths: Vec<PathBuf> = (0..n_temp)
|
let temp_paths: Vec<PathBuf> = (0..n_temp)
|
||||||
.map(|j| dir.join(format!("temp_{j:04}.{ext}")))
|
.map(|j| dir.join(format!("temp_{j:04}.{SK_EXT}")))
|
||||||
.collect();
|
.collect();
|
||||||
|
|
||||||
{
|
{
|
||||||
let mut writers: Vec<SKFileWriter> = temp_paths
|
let mut writers: Vec<SKFileWriter> = temp_paths
|
||||||
.iter()
|
.iter()
|
||||||
.map(|p| SKFileWriter::create_with(p, format, level))
|
.map(|p| SKFileWriter::create_with(p, Format::Zstd, level))
|
||||||
.collect::<SKResult<_>>()?;
|
.collect::<SKResult<_>>()?;
|
||||||
|
|
||||||
let mut reader = SKFileReader::open(&raw_path)?;
|
let mut reader = SKFileReader::open(&raw_path)?;
|
||||||
@@ -530,12 +484,8 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
|
|||||||
let mut reader = SKFileReader::open(dedup_path)?;
|
let mut reader = SKFileReader::open(dedup_path)?;
|
||||||
while let Some(sk) = reader.read()? {
|
while let Some(sk) = reader.read()? {
|
||||||
pass1_superkmers += 1;
|
pass1_superkmers += 1;
|
||||||
let seql = sk.seql();
|
for kmer in sk.iter_canonical_kmers(k) {
|
||||||
if seql < k {
|
seen.insert(kmer);
|
||||||
continue;
|
|
||||||
}
|
|
||||||
for pos in 0..=(seql - k) {
|
|
||||||
seen.insert(sk.kmer(pos, k).map_err(io::Error::other)?.canonical(k));
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -583,8 +533,7 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
|
|||||||
continue;
|
continue;
|
||||||
}
|
}
|
||||||
pass2_count_sum += sk_count as u64;
|
pass2_count_sum += sk_count as u64;
|
||||||
for pos in 0..=(seql - k) {
|
for kmer in sk.iter_canonical_kmers(k) {
|
||||||
let kmer = sk.kmer(pos, k).map_err(io::Error::other)?.canonical(k);
|
|
||||||
if let Some(idx) = mphf.get(&kmer) {
|
if let Some(idx) = mphf.get(&kmer) {
|
||||||
counts[idx as usize] = counts[idx as usize].saturating_add(sk_count);
|
counts[idx as usize] = counts[idx as usize].saturating_add(sk_count);
|
||||||
pass2_kmer_hits += 1;
|
pass2_kmer_hits += 1;
|
||||||
|
|||||||
@@ -27,7 +27,7 @@
|
|||||||
//! ```
|
//! ```
|
||||||
//! use obikrope::{Rope, RopeCursor};
|
//! use obikrope::{Rope, RopeCursor};
|
||||||
//!
|
//!
|
||||||
//! let mut rope = Rope::new();
|
//! let mut rope = Rope::new(None);
|
||||||
//! rope.push(b"ACGT".to_vec());
|
//! rope.push(b"ACGT".to_vec());
|
||||||
//!
|
//!
|
||||||
//! let cursor = rope.fw_cursor();
|
//! let cursor = rope.fw_cursor();
|
||||||
|
|||||||
@@ -333,8 +333,6 @@ impl SuperKmer {
|
|||||||
|
|
||||||
/// Extract the canonical kmer of length k starting at nucleotide position i (0-based).
|
/// Extract the canonical kmer of length k starting at nucleotide position i (0-based).
|
||||||
///
|
///
|
||||||
/// Equivalent to `self.kmer(i, k)?.canonical(k)` but avoids the redundant `revcomp` call
|
|
||||||
/// when the super-kmer is already in canonical form (which is the normal case).
|
|
||||||
/// Returns an error if k is invalid (0 or > 32) or if position i + k exceeds the sequence length.
|
/// Returns an error if k is invalid (0 or > 32) or if position i + k exceeds the sequence length.
|
||||||
pub fn canonical_kmer(&self, i: usize, k: usize) -> Result<Kmer, KmerError> {
|
pub fn canonical_kmer(&self, i: usize, k: usize) -> Result<Kmer, KmerError> {
|
||||||
Ok(self.kmer(i, k)?.canonical(k))
|
Ok(self.kmer(i, k)?.canonical(k))
|
||||||
@@ -367,6 +365,16 @@ impl SuperKmer {
|
|||||||
true
|
true
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Iterate over all kmers of length `k` in order, yielding each as a left-aligned [`Kmer`].
|
||||||
|
pub fn iter_kmers(&self, k: usize) -> impl Iterator<Item = Kmer> + '_ {
|
||||||
|
SKKmerIter::new(self, k)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Iterate over all canonical kmers of length `k` in order.
|
||||||
|
pub fn iter_canonical_kmers(&self, k: usize) -> impl Iterator<Item = Kmer> + '_ {
|
||||||
|
self.iter_kmers(k).map(move |km| km.canonical(k))
|
||||||
|
}
|
||||||
|
|
||||||
/// Returns the XXH3 hash of the super-kmer sequence.
|
/// Returns the XXH3 hash of the super-kmer sequence.
|
||||||
pub fn hash(&self) -> u64 {
|
pub fn hash(&self) -> u64 {
|
||||||
if self.is_canonical() {
|
if self.is_canonical() {
|
||||||
@@ -379,6 +387,53 @@ impl SuperKmer {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
struct SKKmerIter<'a> {
|
||||||
|
skmer: &'a SuperKmer,
|
||||||
|
mask: u64,
|
||||||
|
lshift: usize,
|
||||||
|
current: u64,
|
||||||
|
pos: usize,
|
||||||
|
max_pos: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl<'a> SKKmerIter<'a> {
|
||||||
|
fn new(skmer: &'a SuperKmer, k: usize) -> Self {
|
||||||
|
let seql = skmer.seql();
|
||||||
|
let lshift = 64 - k * 2;
|
||||||
|
let mask = ((!0u128) << (lshift + 2)) as u64;
|
||||||
|
Self {
|
||||||
|
skmer,
|
||||||
|
mask,
|
||||||
|
lshift,
|
||||||
|
current: if seql >= k { skmer.kmer(0, k).unwrap().raw() } else { 0 },
|
||||||
|
pos: k,
|
||||||
|
max_pos: seql,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
impl<'a> Iterator for SKKmerIter<'a> {
|
||||||
|
type Item = Kmer;
|
||||||
|
|
||||||
|
fn next(&mut self) -> Option<Self::Item> {
|
||||||
|
if self.pos > self.max_pos {
|
||||||
|
return None;
|
||||||
|
}
|
||||||
|
// Emit current kmer first, then slide the window forward.
|
||||||
|
let result = Kmer::from_raw(self.current);
|
||||||
|
if self.pos < self.max_pos {
|
||||||
|
let byte_pos = self.pos / 4;
|
||||||
|
// Nucleotide at position r within its byte occupies bits 7-2r (MSB) and 6-2r (LSB).
|
||||||
|
// Extract right-aligned, then place at lshift.
|
||||||
|
let inner_shift = 6 - 2 * (self.pos & 3);
|
||||||
|
let nuc = (((self.skmer.seq[byte_pos] >> inner_shift) & 3) as u64) << self.lshift;
|
||||||
|
self.current = ((self.current << 2) & self.mask) | nuc;
|
||||||
|
}
|
||||||
|
self.pos += 1;
|
||||||
|
Some(result)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
fn complement(base: u8) -> u8 {
|
fn complement(base: u8) -> u8 {
|
||||||
@@ -755,4 +810,121 @@ mod tests {
|
|||||||
sk.set_minimizer_pos(3);
|
sk.set_minimizer_pos(3);
|
||||||
assert_eq!(sk.to_ascii(), ascii);
|
assert_eq!(sk.to_ascii(), ascii);
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── iter_kmers ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_count() {
|
||||||
|
let ascii = b"ACGTACGTACGT";
|
||||||
|
let sk = SuperKmer::from_ascii(ascii);
|
||||||
|
for k in [1usize, 3, 4, 5, 8, 12] {
|
||||||
|
let n = sk.iter_kmers(k).count();
|
||||||
|
assert_eq!(n, ascii.len() - k + 1, "count mismatch for k={k}");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_first_is_kmer_0() {
|
||||||
|
let ascii = b"ACGTACGT";
|
||||||
|
let sk = SuperKmer::from_ascii(ascii);
|
||||||
|
for k in 1..=ascii.len() {
|
||||||
|
let first = sk.iter_kmers(k).next().unwrap();
|
||||||
|
assert_eq!(first, sk.kmer(0, k).unwrap(), "k={k}");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_matches_kmer_at_each_position() {
|
||||||
|
let ascii = b"ACGTACGTACGT";
|
||||||
|
let sk = SuperKmer::from_ascii(ascii);
|
||||||
|
let k = 4;
|
||||||
|
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||||
|
assert_eq!(kmers.len(), ascii.len() - k + 1);
|
||||||
|
for (i, &km) in kmers.iter().enumerate() {
|
||||||
|
assert_eq!(km, sk.kmer(i, k).unwrap(), "mismatch at pos {i}");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_single_when_seql_eq_k() {
|
||||||
|
let ascii = b"ACGTACGT";
|
||||||
|
let sk = SuperKmer::from_ascii(ascii);
|
||||||
|
let k = ascii.len();
|
||||||
|
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||||
|
assert_eq!(kmers.len(), 1);
|
||||||
|
assert_eq!(kmers[0], sk.kmer(0, k).unwrap());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_two_when_seql_eq_k_plus_one() {
|
||||||
|
let ascii = b"ACGTACGT";
|
||||||
|
let sk = SuperKmer::from_ascii(ascii);
|
||||||
|
let k = ascii.len() - 1;
|
||||||
|
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||||
|
assert_eq!(kmers.len(), 2);
|
||||||
|
assert_eq!(kmers[0], sk.kmer(0, k).unwrap());
|
||||||
|
assert_eq!(kmers[1], sk.kmer(1, k).unwrap());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_all_k_values() {
|
||||||
|
// For every valid k, each yielded kmer must match kmer(i, k).
|
||||||
|
let ascii = b"ACGTACGTACGT";
|
||||||
|
let sk = SuperKmer::from_ascii(ascii);
|
||||||
|
let seql = ascii.len();
|
||||||
|
for k in 1..=seql {
|
||||||
|
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||||
|
assert_eq!(kmers.len(), seql - k + 1, "k={k}");
|
||||||
|
for (i, &km) in kmers.iter().enumerate() {
|
||||||
|
assert_eq!(km, sk.kmer(i, k).unwrap(), "k={k}, pos={i}");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_crosses_byte_boundary() {
|
||||||
|
// Positions 3→4 and 7→8 cross a 4-nucleotide byte boundary.
|
||||||
|
let ascii = b"ACGTACGTACGT";
|
||||||
|
let sk = SuperKmer::from_ascii(ascii);
|
||||||
|
let k = 3;
|
||||||
|
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||||
|
for boundary in [3usize, 4, 7, 8] {
|
||||||
|
if boundary + 1 < kmers.len() {
|
||||||
|
assert_eq!(
|
||||||
|
kmers[boundary],
|
||||||
|
sk.kmer(boundary, k).unwrap(),
|
||||||
|
"pos={boundary}"
|
||||||
|
);
|
||||||
|
assert_eq!(
|
||||||
|
kmers[boundary + 1],
|
||||||
|
sk.kmer(boundary + 1, k).unwrap(),
|
||||||
|
"pos={}",
|
||||||
|
boundary + 1
|
||||||
|
);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_k1_yields_all_nucleotides() {
|
||||||
|
let ascii = b"ACGT";
|
||||||
|
let sk = SuperKmer::from_ascii(ascii);
|
||||||
|
let kmers: Vec<Kmer> = sk.iter_kmers(1).collect();
|
||||||
|
assert_eq!(kmers.len(), 4);
|
||||||
|
for (i, &km) in kmers.iter().enumerate() {
|
||||||
|
assert_eq!(km, sk.kmer(i, 1).unwrap(), "pos={i}");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_kmers_long_sequence() {
|
||||||
|
let ascii = make_seq(20);
|
||||||
|
let sk = SuperKmer::from_ascii(&ascii);
|
||||||
|
let k = 7;
|
||||||
|
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||||
|
assert_eq!(kmers.len(), ascii.len() - k + 1);
|
||||||
|
for (i, &km) in kmers.iter().enumerate() {
|
||||||
|
assert_eq!(km, sk.kmer(i, k).unwrap(), "pos={i}");
|
||||||
|
}
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -168,39 +168,43 @@ mod tests {
|
|||||||
.collect()
|
.collect()
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
|
||||||
|
const K: usize = 11;
|
||||||
|
const M: usize = 5;
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn single_segment_one_superkmer() {
|
fn single_segment_one_superkmer() {
|
||||||
let out = run_nofilter(b"ACGTACGT\x00", 4, 2);
|
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K, M);
|
||||||
assert!(!out.is_empty());
|
assert!(!out.is_empty());
|
||||||
let total: Vec<u8> = out.into_iter().flatten().collect();
|
let total: Vec<u8> = out.into_iter().flatten().collect();
|
||||||
assert!(total.len() >= 4);
|
assert!(total.len() >= K);
|
||||||
}
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn segment_shorter_than_k_emits_nothing() {
|
fn segment_shorter_than_k_emits_nothing() {
|
||||||
let out = run_nofilter(b"ACG\x00", 4, 2);
|
let out = run_nofilter(b"ACGTACGT\x00", K, M);
|
||||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||||
}
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn empty_input_emits_nothing() {
|
fn empty_input_emits_nothing() {
|
||||||
let out = run_nofilter(b"", 4, 2);
|
let out = run_nofilter(b"", K, M);
|
||||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||||
}
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn two_segments_both_emitted() {
|
fn two_segments_both_emitted() {
|
||||||
let out = run_nofilter(b"ACGTACGT\x00TTTTTTTT\x00", 4, 2);
|
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K, M);
|
||||||
assert!(!out.is_empty());
|
assert!(!out.is_empty());
|
||||||
}
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn low_complexity_kmer_is_rejected() {
|
fn low_complexity_kmer_is_rejected() {
|
||||||
let out_pass = run_nofilter(b"AAAAAAAAACGT\x00", 4, 2);
|
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K, M);
|
||||||
assert!(!out_pass.is_empty());
|
assert!(!out_pass.is_empty());
|
||||||
|
|
||||||
let rope = make_rope(b"AAAAAAAA\x00");
|
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
|
||||||
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, 4, 2, 6, 0.9)
|
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, M, 6, 0.9)
|
||||||
.map(|sk| sk.to_ascii())
|
.map(|sk| sk.to_ascii())
|
||||||
.collect();
|
.collect();
|
||||||
assert!(out_reject.is_empty());
|
assert!(out_reject.is_empty());
|
||||||
@@ -208,12 +212,12 @@ mod tests {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn multi_slice_rope() {
|
fn multi_slice_rope() {
|
||||||
let data = b"ACGTACGTACGT\x00";
|
let data = b"ACGTACGTACGTACGTACGT\x00";
|
||||||
let mid = data.len() / 2;
|
let mid = data.len() / 2;
|
||||||
let mut rope = Rope::new(None);
|
let mut rope = Rope::new(None);
|
||||||
rope.push(data[..mid].to_vec());
|
rope.push(data[..mid].to_vec());
|
||||||
rope.push(data[mid..].to_vec());
|
rope.push(data[mid..].to_vec());
|
||||||
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, 4, 2, 1, 0.0)
|
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, M, 1, 0.0)
|
||||||
.map(|sk| sk.to_ascii())
|
.map(|sk| sk.to_ascii())
|
||||||
.collect();
|
.collect();
|
||||||
assert!(!out.is_empty());
|
assert!(!out.is_empty());
|
||||||
@@ -221,8 +225,8 @@ mod tests {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn yields_minimizer_value() {
|
fn yields_minimizer_value() {
|
||||||
let rope = make_rope(b"ACGTACGT\x00");
|
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
|
||||||
let results: Vec<SuperKmer> = SuperKmerIter::new(&rope, 4, 2, 1, 0.0).collect();
|
let results: Vec<SuperKmer> = SuperKmerIter::new(&rope, K, M, 1, 0.0).collect();
|
||||||
assert!(!results.is_empty());
|
assert!(!results.is_empty());
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -14,3 +14,11 @@ pub(crate) mod rolling_stat;
|
|||||||
|
|
||||||
pub use iter::SuperKmerIter;
|
pub use iter::SuperKmerIter;
|
||||||
pub use scratch::SuperKmerScratch;
|
pub use scratch::SuperKmerScratch;
|
||||||
|
|
||||||
|
use obikrope::Rope;
|
||||||
|
use obikseq::superkmer::SuperKmer;
|
||||||
|
|
||||||
|
/// Collect all super-kmers from a normalised rope chunk.
|
||||||
|
pub fn build_superkmers(rope: Rope, k: usize, m: usize, level_max: usize, theta: f64) -> Vec<SuperKmer> {
|
||||||
|
SuperKmerIter::new(&rope, k, m, level_max, theta).collect()
|
||||||
|
}
|
||||||
|
|||||||
Reference in New Issue
Block a user