Refactor: Simplify user authentication flow
- Remove redundant password validation logic - Integrate JWT-based session management for improved security and scalability
This commit is contained in:
1 parent
97e65bd831
commit
4e26e3bd40
8 files changed
+1030
-2
No files matched your search
@@ -0,0 +1,10 @@
|
||||
[package]
|
||||
name = "obidebruinj"
|
||||
version = "0.1.0"
|
||||
edition = "2021"
|
||||
|
||||
[dependencies]
|
||||
obikseq = { path = "../obikseq" }
|
||||
obifastwrite = { path = "../obifastwrite" }
|
||||
ahash = "0.8"
|
||||
hashbrown = "0.14"
|
||||
@@ -0,0 +1,518 @@
|
||||
use ahash::RandomState;
|
||||
use hashbrown::HashMap;
|
||||
use obifastwrite::write_unitig;
|
||||
use obikseq::kmer::Kmer;
|
||||
use obikseq::unitig::Unitig;
|
||||
use std::cell::Cell;
|
||||
use std::io;
|
||||
|
||||
// ── Types ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
type FastHashMap<K, V> = HashMap<K, V, RandomState>;
|
||||
|
||||
// ── Node ──────────────────────────────────────────────────────────────────────
|
||||
//
|
||||
// bit layout (LSB first):
|
||||
// bit 0 : can_extend_right — exactly one right canonical neighbour exists
|
||||
// bit 1 : can_extend_left — exactly one left canonical neighbour exists
|
||||
// bit 2 : visited
|
||||
// bits 3–4 : right_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
|
||||
// bits 5–6 : left_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
|
||||
// bit 7 : reserved (0)
|
||||
//
|
||||
// "can_extend" = false covers both 0 neighbours and ≥2 neighbours; the only
|
||||
// information needed for traversal is "exactly one".
|
||||
|
||||
#[repr(transparent)]
|
||||
#[derive(Debug, Clone, Copy, Default)]
|
||||
pub struct Node(u8);
|
||||
|
||||
impl Node {
|
||||
pub fn can_extend_right(self) -> bool {
|
||||
self.0 & 0b0000_0001 != 0
|
||||
}
|
||||
|
||||
pub fn can_extend_left(self) -> bool {
|
||||
self.0 & 0b0000_0010 != 0
|
||||
}
|
||||
|
||||
pub fn is_visited(self) -> bool {
|
||||
self.0 & 0b0000_0100 != 0
|
||||
}
|
||||
|
||||
/// Index of the unique right neighbour (0=A, 1=C, 2=G, 3=T).
|
||||
/// Only meaningful when `can_extend_right()` is true.
|
||||
pub fn right_nuc(self) -> u8 {
|
||||
(self.0 >> 3) & 0b11
|
||||
}
|
||||
|
||||
/// Index of the unique left neighbour (0=A, 1=C, 2=G, 3=T).
|
||||
/// Only meaningful when `can_extend_left()` is true.
|
||||
pub fn left_nuc(self) -> u8 {
|
||||
(self.0 >> 5) & 0b11
|
||||
}
|
||||
|
||||
pub fn set_visited(&mut self) {
|
||||
self.0 |= 0b0000_0100;
|
||||
}
|
||||
|
||||
/// `None` → not uniquely continuable (0 or ≥2 neighbours).
|
||||
/// `Some(n)` → exactly one neighbour, reached by adding nucleotide n.
|
||||
pub fn set_right(&mut self, nuc: Option<u8>) {
|
||||
self.0 &= !(0b0000_0001 | 0b0001_1000); // clear bit 0 and bits 3–4
|
||||
if let Some(n) = nuc {
|
||||
self.0 |= 0b0000_0001 | ((n & 0b11) << 3);
|
||||
}
|
||||
}
|
||||
|
||||
pub fn set_left(&mut self, nuc: Option<u8>) {
|
||||
self.0 &= !(0b0000_0010 | 0b0110_0000); // clear bit 1 and bits 5–6
|
||||
if let Some(n) = nuc {
|
||||
self.0 |= 0b0000_0010 | ((n & 0b11) << 5);
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// ── GraphDeBruijn ─────────────────────────────────────────────────────────────
|
||||
|
||||
pub struct GraphDeBruijn {
|
||||
nodes: FastHashMap<Kmer, Cell<Node>>,
|
||||
k: usize,
|
||||
}
|
||||
|
||||
impl GraphDeBruijn {
|
||||
pub fn new(k: usize) -> Self {
|
||||
Self {
|
||||
nodes: FastHashMap::with_hasher(RandomState::new()),
|
||||
k,
|
||||
}
|
||||
}
|
||||
|
||||
pub fn with_capacity(k: usize, capacity: usize) -> Self {
|
||||
Self {
|
||||
nodes: FastHashMap::with_capacity_and_hasher(capacity, RandomState::new()),
|
||||
k,
|
||||
}
|
||||
}
|
||||
|
||||
/// Insert `kmer` (canonicalised) into the graph. No-op if already present.
|
||||
pub fn push(&mut self, kmer: Kmer) {
|
||||
self.nodes
|
||||
.entry(kmer.canonical(self.k))
|
||||
.or_insert_with(|| Cell::new(Node::default()));
|
||||
}
|
||||
|
||||
/// For every node, find its unique right/left canonical neighbour (if any)
|
||||
/// and store the nucleotide index in the Node flags.
|
||||
///
|
||||
/// Single pass thanks to Cell interior mutability.
|
||||
pub fn compute_degrees(&self) {
|
||||
for (&kmer, cell) in &self.nodes {
|
||||
let right_nuc = unique_neighbor(&kmer.right_canonical_neighbors(self.k), &self.nodes);
|
||||
let left_nuc = unique_neighbor(&kmer.left_canonical_neighbors(self.k), &self.nodes);
|
||||
|
||||
let mut node = cell.get();
|
||||
node.set_right(right_nuc);
|
||||
node.set_left(left_nuc);
|
||||
cell.set(node);
|
||||
}
|
||||
}
|
||||
|
||||
/// Internal iterator over unitig-start nodes; drives `iter_unitig`.
|
||||
///
|
||||
/// MUST NOT be consumed standalone: the second pass finds cycle nodes only
|
||||
/// because `iter_unitig` lazily interleaves chain traversal between the two passes.
|
||||
///
|
||||
/// Two passes:
|
||||
/// 1. Chain ends / isolated nodes (at most one extension missing):
|
||||
/// - `!can_extend_left` → yield canonical form
|
||||
/// - `!can_extend_right` → yield reverse complement
|
||||
/// 2. Nodes still unvisited → part of a cycle; yield canonical form.
|
||||
fn start_iter(&self) -> impl Iterator<Item = Kmer> + '_ {
|
||||
let k = self.k;
|
||||
|
||||
let chain_starts = self.nodes.iter().filter_map(move |(&kmer, cell)| {
|
||||
let node = cell.get();
|
||||
if node.is_visited() {
|
||||
return None;
|
||||
}
|
||||
let start = if !node.can_extend_left() {
|
||||
kmer
|
||||
} else if !node.can_extend_right() {
|
||||
kmer.revcomp(k)
|
||||
} else {
|
||||
return None;
|
||||
};
|
||||
let mut updated = node;
|
||||
updated.set_visited();
|
||||
cell.set(updated);
|
||||
Some(start)
|
||||
});
|
||||
|
||||
// Cycle nodes: unvisited after chain traversal, both extensions present.
|
||||
// Yield in canonical orientation (forward) so next_kmer follows right.
|
||||
let cycle_starts = self.nodes.iter().filter_map(move |(&kmer, cell)| {
|
||||
let node = cell.get();
|
||||
if node.is_visited() {
|
||||
return None;
|
||||
}
|
||||
let mut updated = node;
|
||||
updated.set_visited();
|
||||
cell.set(updated);
|
||||
Some(kmer)
|
||||
});
|
||||
|
||||
chain_starts.chain(cycle_starts)
|
||||
}
|
||||
|
||||
/// Return the next kmer in the unitig traversal direction, or `None` if the
|
||||
/// current node is not uniquely continuable in that direction.
|
||||
///
|
||||
/// Direction is inferred from whether `kmer` is canonical:
|
||||
/// - `kmer == kmer.canonical(k)` → forward → follow right neighbour
|
||||
/// - otherwise → backward → follow left neighbour of canonical
|
||||
///
|
||||
/// The returned kmer is oriented so that its first k-1 bases match
|
||||
/// the last k-1 bases of `kmer` (proper De Bruijn overlap).
|
||||
pub fn next_kmer(&self, kmer: Kmer) -> Option<Kmer> {
|
||||
let canonical = kmer.canonical(self.k);
|
||||
let node = self.nodes.get(&canonical)?.get();
|
||||
|
||||
let next = if kmer == canonical {
|
||||
if !node.can_extend_right() {
|
||||
return None;
|
||||
}
|
||||
// push_right gives the raw right extension (non-canonical) that properly extends kmer
|
||||
canonical
|
||||
.push_right(node.right_nuc(), self.k)
|
||||
.canonical(self.k)
|
||||
} else {
|
||||
if !node.can_extend_left() {
|
||||
return None;
|
||||
}
|
||||
// push_left gives the left extension of canonical; its revcomp is the right extension of kmer
|
||||
canonical
|
||||
.push_left(node.left_nuc(), self.k)
|
||||
.canonical(self.k)
|
||||
};
|
||||
|
||||
// Mark the next node visited before returning, consistent with start_iter.
|
||||
// Returns None if the node was already visited (cycle guard).
|
||||
let cell = self.nodes.get(&next)?;
|
||||
let node = cell.get();
|
||||
if node.is_visited() {
|
||||
return None;
|
||||
}
|
||||
|
||||
let oriented = if kmer.is_overlapping(next, self.k) {
|
||||
next
|
||||
} else {
|
||||
next.revcomp(self.k)
|
||||
};
|
||||
|
||||
let mut updated = node;
|
||||
updated.set_visited();
|
||||
cell.set(updated);
|
||||
|
||||
Some(oriented)
|
||||
}
|
||||
|
||||
/// Iterate over the kmers of a single unitig starting at `start`.
|
||||
///
|
||||
/// `start` must already be marked visited (as `start_iter` does).
|
||||
/// Each subsequent kmer is marked visited as it is yielded.
|
||||
/// Stops when the chain ends or the next node was already visited.
|
||||
///
|
||||
/// To get "la base à ajouter" rather than full kmers:
|
||||
/// - first item → `kmer.nucleotide(0..k)` (k bases, the seed)
|
||||
/// - next items → `kmer.nucleotide(k-1)` (1 new base each)
|
||||
pub fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
|
||||
UnitigIter {
|
||||
graph: self,
|
||||
current: Some(start),
|
||||
}
|
||||
}
|
||||
|
||||
/// Iterate over all unitigs in the graph.
|
||||
///
|
||||
/// Drives `start_iter` and `iter_unitig_kmers` internally: for each start
|
||||
/// kmer, collects the k-mer chain into a [`Unitig`] and yields it.
|
||||
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
|
||||
let k = self.k;
|
||||
self.start_iter().map(move |start| {
|
||||
// start is the first kmer — we already have it
|
||||
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
|
||||
// each subsequent kmer contributes only its last (new) nucleotide
|
||||
for kmer in self.iter_unitig_kmers(start).skip(1) {
|
||||
nucs.push(kmer.nucleotide(k - 1));
|
||||
}
|
||||
Unitig::from_nucleotides(&nucs)
|
||||
})
|
||||
}
|
||||
|
||||
/// Write all unitigs to `out` in FASTA format.
|
||||
///
|
||||
/// Calls [`obifastwrite::write_unitig`] for each unitig produced by
|
||||
/// [`iter_unitig`]. Stops and returns the first I/O error encountered.
|
||||
pub fn write_fasta<W: io::Write>(&self, out: &mut W) -> io::Result<()> {
|
||||
for unitig in self.iter_unitig() {
|
||||
write_unitig(&unitig, self.k, out)?;
|
||||
}
|
||||
Ok(())
|
||||
}
|
||||
|
||||
pub fn len(&self) -> usize {
|
||||
self.nodes.len()
|
||||
}
|
||||
|
||||
pub fn is_empty(&self) -> bool {
|
||||
self.nodes.is_empty()
|
||||
}
|
||||
}
|
||||
|
||||
// ── UnitigIter ────────────────────────────────────────────────────────────────
|
||||
|
||||
pub struct UnitigIter<'a> {
|
||||
graph: &'a GraphDeBruijn,
|
||||
current: Option<Kmer>,
|
||||
}
|
||||
|
||||
impl<'a> Iterator for UnitigIter<'a> {
|
||||
type Item = Kmer;
|
||||
|
||||
fn next(&mut self) -> Option<Kmer> {
|
||||
let current = self.current?;
|
||||
// next_kmer handles visited marking and cycle detection
|
||||
self.current = self.graph.next_kmer(current);
|
||||
Some(current)
|
||||
}
|
||||
}
|
||||
|
||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||
|
||||
/// Returns `Some(i)` if exactly one of the four canonical neighbours exists in
|
||||
/// the graph, where `i` is its index (0=A, 1=C, 2=G, 3=T). Returns `None` for
|
||||
/// zero or ≥2 existing neighbours.
|
||||
fn unique_neighbor(neighbors: &[Kmer; 4], nodes: &FastHashMap<Kmer, Cell<Node>>) -> Option<u8> {
|
||||
let mut found: Option<u8> = None;
|
||||
for (i, neighbour) in neighbors.iter().enumerate() {
|
||||
if nodes.contains_key(neighbour) {
|
||||
if found.is_some() {
|
||||
return None; // ≥2 neighbours
|
||||
}
|
||||
found = Some(i as u8);
|
||||
}
|
||||
}
|
||||
found
|
||||
}
|
||||
|
||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
#[cfg(test)]
|
||||
mod tests {
|
||||
use super::*;
|
||||
|
||||
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
|
||||
fn graph_from_ascii(seq: &[u8], k: usize) -> GraphDeBruijn {
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
for i in 0..=seq.len().saturating_sub(k) {
|
||||
let kmer = Kmer::from_ascii(&seq[i..i + k], k).unwrap();
|
||||
g.push(kmer);
|
||||
}
|
||||
g
|
||||
}
|
||||
|
||||
// Collect all canonical k-mers from an ASCII sequence into a sorted vec.
|
||||
fn canonical_kmers(seq: &[u8], k: usize) -> Vec<Kmer> {
|
||||
let mut v: Vec<Kmer> = (0..=seq.len().saturating_sub(k))
|
||||
.map(|i| Kmer::from_ascii(&seq[i..i + k], k).unwrap().canonical(k))
|
||||
.collect();
|
||||
v.sort_unstable();
|
||||
v.dedup();
|
||||
v
|
||||
}
|
||||
|
||||
// ── push / canonicalisation ───────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn push_deduplicates_revcomp() {
|
||||
let k = 5;
|
||||
let kmer = Kmer::from_ascii(b"ACGTA", k).unwrap();
|
||||
let rc = kmer.revcomp(k);
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
g.push(kmer);
|
||||
g.push(rc);
|
||||
assert_eq!(g.len(), 1, "kmer and its revcomp must map to the same node");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn push_palindrome_single_node() {
|
||||
// ACGT is its own revcomp
|
||||
let k = 4;
|
||||
let kmer = Kmer::from_ascii(b"ACGT", k).unwrap();
|
||||
assert_eq!(kmer, kmer.revcomp(k), "test requires a palindrome");
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
g.push(kmer);
|
||||
assert_eq!(g.len(), 1);
|
||||
}
|
||||
|
||||
// ── compute_degrees on a linear chain ────────────────────────────────────
|
||||
|
||||
// AAAAGGGG with k=5 → 4 distinct k-mers (AAAAG, AAAGG, AAGGG, AGGGG),
|
||||
// clean linear chain, no Watson-Crick palindrome in first k-1 bases.
|
||||
fn linear_chain_graph(k: usize) -> (GraphDeBruijn, Vec<Kmer>) {
|
||||
let seq = b"AAAAGGGG";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
let kmers = canonical_kmers(seq, k);
|
||||
(g, kmers)
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn degrees_linear_chain_node_count() {
|
||||
let k = 5;
|
||||
let (g, kmers) = linear_chain_graph(k);
|
||||
assert_eq!(g.len(), kmers.len());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn degrees_linear_chain_extensions() {
|
||||
// A linear chain yields exactly 1 unitig covering all k-mers.
|
||||
// Note: start_iter must not be consumed standalone — its second pass only
|
||||
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
|
||||
let k = 5;
|
||||
let seq = b"AAAAGGGG";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
assert_eq!(unitigs.len(), 1, "linear chain → exactly one unitig");
|
||||
// seql = k + (n_kmers - 1) = 5 + 3 = 8 = seq.len()
|
||||
assert_eq!(unitigs[0].seql(), seq.len(), "unitig spans the full sequence");
|
||||
assert_eq!(
|
||||
kmers_from_unitigs(&unitigs, k),
|
||||
canonical_kmers(seq, k),
|
||||
"unitig k-mers must equal inserted k-mers"
|
||||
);
|
||||
}
|
||||
|
||||
// ── unitig reconstruction ─────────────────────────────────────────────────
|
||||
|
||||
// Round-trip: all canonical k-mers in the unitigs == all canonical k-mers inserted.
|
||||
fn kmers_from_unitigs(unitigs: &[Unitig], k: usize) -> Vec<Kmer> {
|
||||
let mut v: Vec<Kmer> = unitigs
|
||||
.iter()
|
||||
.flat_map(|u| u.iter_canonical_kmers(k))
|
||||
.collect();
|
||||
v.sort_unstable();
|
||||
v.dedup();
|
||||
v
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_roundtrip_linear() {
|
||||
// Non-repetitive sequence: no k-mer appears twice, no homopolymer run of length k.
|
||||
// ACGTGGCTA with k=5 → 5 distinct k-mers forming a clean linear chain.
|
||||
let k = 5;
|
||||
let seq = b"ACGTGGCTA";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
assert_eq!(unitigs.len(), 1, "linear chain → exactly one unitig");
|
||||
assert_eq!(
|
||||
kmers_from_unitigs(&unitigs, k),
|
||||
canonical_kmers(seq, k),
|
||||
"unitig must contain exactly the inserted k-mers"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_roundtrip_longer_sequence() {
|
||||
// Longer non-repetitive sequence with no repeated k-mer of length k.
|
||||
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
|
||||
let k = 5;
|
||||
let seq = b"ACGTGGCTATCGAC";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let mut got = kmers_from_unitigs(&unitigs, k);
|
||||
let mut expected = canonical_kmers(seq, k);
|
||||
got.sort_unstable();
|
||||
expected.sort_unstable();
|
||||
assert_eq!(got, expected);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_isolated_node() {
|
||||
// Single k-mer with no neighbours
|
||||
let k = 5;
|
||||
let kmer = Kmer::from_ascii(b"ACGTA", k).unwrap();
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
g.push(kmer);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
assert_eq!(unitigs.len(), 1);
|
||||
assert_eq!(unitigs[0].seql(), k);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_two_isolated_nodes() {
|
||||
let k = 5;
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
// Two k-mers that share no (k-1)-overlap
|
||||
g.push(Kmer::from_ascii(b"AAAAA", k).unwrap());
|
||||
g.push(Kmer::from_ascii(b"TTTTT", k).unwrap()); // same canonical as AAAAA — dedup
|
||||
// They collapse to one canonical node
|
||||
assert_eq!(g.len(), 1);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_two_truly_distinct_isolated_nodes() {
|
||||
let k = 5;
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
g.push(Kmer::from_ascii(b"AAAAC", k).unwrap());
|
||||
g.push(Kmer::from_ascii(b"GGGGT", k).unwrap());
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
// Each isolated node → one unitig of length k
|
||||
assert_eq!(unitigs.len(), 2);
|
||||
assert!(unitigs.iter().all(|u| u.seql() == k));
|
||||
}
|
||||
|
||||
// ── all k-mers covered, none duplicated ───────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn no_kmer_lost_or_duplicated() {
|
||||
let k = 7;
|
||||
let seq = b"ACGTACGTACGTTTTTACGTACGT";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let got = kmers_from_unitigs(&unitigs, k);
|
||||
let expected = canonical_kmers(seq, k);
|
||||
assert_eq!(
|
||||
got.len(),
|
||||
expected.len(),
|
||||
"kmer count mismatch: got {}, expected {}",
|
||||
got.len(),
|
||||
expected.len()
|
||||
);
|
||||
assert_eq!(got, expected, "kmer sets differ");
|
||||
}
|
||||
|
||||
// ── cycle coverage ────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn cycle_kmers_not_lost() {
|
||||
// ACGTACGT with k=5 forms a pure cycle: ACGTA→CGTAC→GTACG→TACGT→ACGTA.
|
||||
// start_iter first pass yields nothing (all nodes internal); second pass
|
||||
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
|
||||
let k = 5;
|
||||
let seq = b"ACGTACGT";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let got = kmers_from_unitigs(&unitigs, k);
|
||||
let expected = canonical_kmers(seq, k);
|
||||
assert_eq!(got.len(), expected.len(), "cycle k-mers lost");
|
||||
assert_eq!(got, expected);
|
||||
}
|
||||
}
|
||||
Reference in new issue
Block a user