feat: implement persistent layered index and chunked binary format
Introduce the `obilayeredmap` specification and persistent MPHF-based index architecture for incremental multi-dataset indexing. Implement chunked binary serialization with a fixed `u8` k-mer count limit (256) and overlapping super-kmer segments. Add memory-mapped I/O and a companion `.idx` index file for allocation-free, O(1) unitig access. Update MkDocs navigation, enhance the k-mer comparison script, and add comprehensive tests for serialization, partitioning, and file I/O pipelines.
This commit is contained in:
@@ -49,7 +49,7 @@ Build a new MPHF over the filtered kmer set only, with the exact key count avail
|
|||||||
|
|
||||||
**Phase 1** (provisional, discarded after spectrum computation): FMPHGO. Tolerates overestimated capacity, compact, no need to optimise for query speed on a temporary structure.
|
**Phase 1** (provisional, discarded after spectrum computation): FMPHGO. Tolerates overestimated capacity, compact, no need to optimise for query speed on a temporary structure.
|
||||||
|
|
||||||
**Phase 2** (persistent, queried repeatedly): open between FMPHGO and ptr_hash. Exact key count is available, so both operate optimally. ptr_hash's query speed advantage (2.1–3.3×) is meaningful for the persistent index but carries the risk of a very young crate. FMPHGO is the conservative default; ptr_hash is worth revisiting once it has broader production use.
|
**Phase 2** (persistent, queried repeatedly): **ptr_hash**. Exact key count is available at phase 2, so ptr_hash operates optimally. Its query speed (≥2.1× over FMPHGO) and construction speed (≥3.1×) are meaningful for the persistent index; the space overhead at 2.4 bits/key is acceptable. The crate's youth (Feb 2025) was previously a concern; it is now accepted given the performance profile and the fact that each layer MPHF is independently rebuildable from its unitig file if needed.
|
||||||
|
|
||||||
boomphf is effectively eliminated: its space overhead is the largest and its streaming-construction advantage does not apply here.
|
boomphf is effectively eliminated: its space overhead is the largest and its streaming-construction advantage does not apply here.
|
||||||
|
|
||||||
@@ -73,9 +73,64 @@ All three are in-memory structures. Their internal representation is flat bit ar
|
|||||||
|
|
||||||
No established Rust crate provides a natively on-disk MPHF. **SSHash** (Sparse and Skew Hash) is a complete kmer dictionary designed for disk access and is order-preserving (overlapping kmers receive consecutive indices → cache-friendly count access), but it is C++-only and covers more than just the MPHF layer.
|
No established Rust crate provides a natively on-disk MPHF. **SSHash** (Sparse and Skew Hash) is a complete kmer dictionary designed for disk access and is order-preserving (overlapping kmers receive consecutive indices → cache-friendly count access), but it is C++-only and covers more than just the MPHF layer.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Multilayer index architecture
|
||||||
|
|
||||||
|
### Motivation
|
||||||
|
|
||||||
|
An index built from a single dataset A can be extended with a new dataset B without rebuilding. This supports incremental construction (adding species, samples, or sequencing runs) and enables set operations across heterogeneous sources.
|
||||||
|
|
||||||
|
### Layer structure
|
||||||
|
|
||||||
|
Each layer is a self-contained unit:
|
||||||
|
|
||||||
|
```
|
||||||
|
layer_i/
|
||||||
|
unitigs.bin — packed 2-bit nucleotide sequences
|
||||||
|
mphf.bin — ptr_hash index (phase-2, exact key count)
|
||||||
|
evidence.bin — [(unitig_id, rank)] per MPHF slot (see unitig_evidence.md)
|
||||||
|
counts.bin — [u32] per MPHF slot
|
||||||
|
```
|
||||||
|
|
||||||
|
Layers are **disjoint**: a canonical kmer belongs to exactly one layer. Layer 0 is built from dataset A. Adding dataset B proceeds as follows:
|
||||||
|
|
||||||
|
1. For each kmer in B: query layer 0 — if found, accumulate count into `counts_0[MPHF_0(kmer)]`.
|
||||||
|
2. Collect all kmers of B not present in any existing layer → set `B \ A`.
|
||||||
|
3. Build layer 1 from `B \ A` using the standard two-phase pipeline (spectrum, filter, ptr_hash).
|
||||||
|
|
||||||
|
Adding a third dataset C repeats the process: probe layer 0, then layer 1, then build layer 2 from `C \ A \ B`.
|
||||||
|
|
||||||
|
### Membership verification
|
||||||
|
|
||||||
|
ptr_hash maps any input to a valid slot — it does not natively detect absent keys. Membership is verified using the evidence entry: decode the kmer from `(unitig_id, rank)` and compare to the query. A mismatch means the kmer is absent from this layer; probe the next layer.
|
||||||
|
|
||||||
|
This makes the evidence layer load-bearing for correctness, not only for locality.
|
||||||
|
|
||||||
|
### Query algorithm
|
||||||
|
|
||||||
|
```
|
||||||
|
fn query(kmer) → Option<count>:
|
||||||
|
for layer in layers:
|
||||||
|
slot = layer.mphf.query(kmer)
|
||||||
|
if layer.evidence.decode(slot) == kmer:
|
||||||
|
return Some(layer.counts[slot])
|
||||||
|
return None
|
||||||
|
```
|
||||||
|
|
||||||
|
Expected probe depth: 1 for kmers present in layer 0, increasing for rare kmers added in later layers. In practice, the dominant dataset (largest A) should be layer 0 to minimise average probe depth.
|
||||||
|
|
||||||
|
### Layer count and probe cost
|
||||||
|
|
||||||
|
Each probe is a ptr_hash lookup (~10 ns) plus one evidence decode (two array accesses). For L layers the worst case is L probes + 1 None. In practice L is small (2–5 for typical multi-species databases). No global data structure is needed to route queries; the layer chain is traversed in order.
|
||||||
|
|
||||||
|
### Merging layers
|
||||||
|
|
||||||
|
Two layer chains can be merged by re-indexing their union through the standard pipeline. This is expensive (full rebuild) but produces an optimal single-layer index. Merge is a maintenance operation, not a query-path requirement.
|
||||||
|
|
||||||
## Open questions
|
## Open questions
|
||||||
|
|
||||||
- Confirm actual partition sizes and overestimation factor on representative metagenomic datasets.
|
- Confirm actual partition sizes and overestimation factor on representative metagenomic datasets.
|
||||||
- Revisit ptr_hash for phase 2 once the crate has broader production track record.
|
- **rkyv integration**: all flat arrays in a layer (evidence, counts, presence/absence matrix) map trivially to `rkyv::Archive` — fixed-size element types, no heap indirection. The presence/absence matrix is the strongest case: at 10 M kmers × 1 000 samples ≈ 1.25 GB per partition, zero-copy mmap via rkyv avoids loading the entire matrix at open time, letting the OS page cache serve only accessed pages. ptr_hash itself is internally a flat bit array and is structurally compatible with rkyv, but requires either native crate support or a wrapper. Assess the wrapper cost and whether ptr_hash is willing to adopt rkyv upstream.
|
||||||
- Assess rkyv integration cost for FMPHGO if true zero-copy mmap becomes necessary for the persistent index.
|
|
||||||
- Keep SSHash in mind if the indexing architecture is reconsidered at a higher level.
|
- Keep SSHash in mind if the indexing architecture is reconsidered at a higher level.
|
||||||
|
- Determine optimal layer ordering heuristic (by kmer count? by query frequency?) for multi-species databases.
|
||||||
|
|||||||
@@ -0,0 +1,168 @@
|
|||||||
|
# obilayeredmap — layered kmer index crate
|
||||||
|
|
||||||
|
## Purpose
|
||||||
|
|
||||||
|
`obilayeredmap` implements a persistent, incrementally extensible kmer index. The index is organised in three levels: **collection → partition → layer**. Each layer covers a disjoint kmer set (kmers absent from all earlier layers), wrapping a `ptr_hash` MPHF with associated per-slot data. Adding a new dataset never rebuilds existing layers.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Three-level hierarchy
|
||||||
|
|
||||||
|
```
|
||||||
|
index_root/ ← LayeredMap (collection)
|
||||||
|
meta.json
|
||||||
|
part_00000/ ← Partition
|
||||||
|
layer_0/ ← Layer
|
||||||
|
mphf.bin
|
||||||
|
unitigs.bin
|
||||||
|
evidence.bin
|
||||||
|
counts.bin
|
||||||
|
presence.bin
|
||||||
|
layer_1/
|
||||||
|
...
|
||||||
|
part_00001/
|
||||||
|
layer_0/
|
||||||
|
layer_1/
|
||||||
|
...
|
||||||
|
```
|
||||||
|
|
||||||
|
**Collection** (`index_root/`): global metadata — kmer size k, number of partitions, layer count, sample registry.
|
||||||
|
|
||||||
|
**Partition** (`part_XXXXX/`): one directory per hash bucket. All kmers whose canonical minimiser hashes to bucket X land in `part_XXXXX`. Partitions are independent and can be processed in parallel. The partition count and routing scheme (minimiser → bucket) are fixed at collection creation and recorded in `meta.json`.
|
||||||
|
|
||||||
|
**Layer** (`layer_N/`): within a partition, a layer is the MPHF and its associated data for one dataset addition. Layer 0 is built from the first dataset A; layer 1 covers kmers in B not present in layer 0; and so on. Layers within a partition are disjoint: each kmer belongs to exactly one layer.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Layer file layout
|
||||||
|
|
||||||
|
```
|
||||||
|
layer_N/
|
||||||
|
mphf.bin — ptr_hash MPHF (exact key count, phase-2 construction)
|
||||||
|
unitigs.bin — packed 2-bit nucleotide sequences (concatenated, variable-length)
|
||||||
|
unitig_offsets.bin — u32 per unitig: nucleotide offset of unitig j in unitigs.bin
|
||||||
|
evidence.bin — u32 per MPHF slot: (unitig_id: 25 | rank: 7)
|
||||||
|
counts.bin — u32 per MPHF slot (total kmer occurrences)
|
||||||
|
presence.bin — bit matrix: n_slots × n_samples [optional]
|
||||||
|
```
|
||||||
|
|
||||||
|
Unitigs have variable lengths. Each record in `unitigs.bin` is self-delimiting: it begins with a varint `seql` (sequence length in nucleotides) followed by `(seql+3)/4` packed bytes — the streaming format defined in `obiskio`. Sequential scan is always possible using the in-record `seql`.
|
||||||
|
|
||||||
|
For O(1) random access, `unitig_offsets.bin` is a **precomputed derived index**: a u32 array of byte offsets into `unitigs.bin`, with n_unitigs + 1 entries (sentinel = total byte size). Built once at construction by a single sequential scan; reconstructible from `unitigs.bin` if lost. Access: `unitigs.bin[offsets[j] .. offsets[j+1]]`.
|
||||||
|
|
||||||
|
All files except `mphf.bin` are flat arrays of fixed-size elements, serialised with **rkyv** for zero-copy mmap access. `mphf.bin` uses ptr_hash's native serialisation; rkyv integration is deferred (see open questions).
|
||||||
|
|
||||||
|
### Evidence encoding
|
||||||
|
|
||||||
|
Evidence maps each MPHF slot to its kmer's location in the unitig file. It serves two roles: membership verification (ptr_hash maps any input to a valid slot; decoding evidence and comparing to the query detects absent keys) and kmer reconstruction.
|
||||||
|
|
||||||
|
```
|
||||||
|
slot s → unitig_id: u25 | rank: u7
|
||||||
|
```
|
||||||
|
|
||||||
|
Packed into a `u32` (29 bits used, 3 spare). Decoding:
|
||||||
|
|
||||||
|
```
|
||||||
|
kmer = unitigs[unitig_id][rank .. rank + k] // 2-bit packed slice
|
||||||
|
```
|
||||||
|
|
||||||
|
`rank` is the kmer's 0-based index within the unitig (kmer units, not nucleotides). For k=31, m=11, the structural maximum is k − m + 1 = 21 kmers per unitig; the empirical maximum observed is ~46 kmers. A `u7` (0–127) is sufficient.
|
||||||
|
|
||||||
|
### Presence/absence matrix
|
||||||
|
|
||||||
|
Column-major bit matrix: column j (sample j) is a contiguous `n_slots`-bit array. This layout makes per-sample operations (union, intersection, diff over a column) cache-friendly. For large matrices (e.g. 10 M slots × 1 000 samples ≈ 1.25 GB per partition), rkyv + mmap avoids loading the full matrix at open time.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Query path
|
||||||
|
|
||||||
|
A kmer query routes through all three levels:
|
||||||
|
|
||||||
|
1. **Partition routing**: hash canonical minimiser of the query kmer → partition index → open `part_XXXXX/`.
|
||||||
|
2. **Layer probing**: iterate layers in order within the partition; for each layer compute `slot = mphf.query(kmer)`, then verify `evidence.decode(slot) == kmer`. First match wins.
|
||||||
|
3. **Data access**: read `counts[slot]` and/or `presence[slot]` from the matching layer.
|
||||||
|
|
||||||
|
```
|
||||||
|
fn query(kmer) → Option<Hit>:
|
||||||
|
part = partition_of(kmer)
|
||||||
|
for (i, layer) in part.layers.iter().enumerate():
|
||||||
|
slot = layer.mphf.query(kmer)
|
||||||
|
if layer.evidence.decode(slot) == kmer:
|
||||||
|
return Some(Hit { layer: i, slot })
|
||||||
|
return None
|
||||||
|
```
|
||||||
|
|
||||||
|
Expected probe depth: 1 for kmers in layer 0, increasing for later layers. In practice the dominant dataset should be layer 0.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Add-layer algorithm
|
||||||
|
|
||||||
|
When adding dataset B to an existing index:
|
||||||
|
|
||||||
|
1. For each partition, iterate kmers of B routed to that partition.
|
||||||
|
2. Probe existing layers; collect kmers absent from all layers → `B \ index`.
|
||||||
|
3. Build a new layer from `B \ index` using the two-phase pipeline (FMPHGO provisional → ptr_hash definitive).
|
||||||
|
4. Append the new layer directory under each `part_XXXXX/`.
|
||||||
|
5. Update `meta.json` (layer count, sample registry).
|
||||||
|
|
||||||
|
Each partition's new layer is built independently; the operation is fully parallel across partitions.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Core API (sketch)
|
||||||
|
|
||||||
|
```rust
|
||||||
|
// Open an existing index
|
||||||
|
let map = LayeredMap::open(path)?;
|
||||||
|
|
||||||
|
// Query a canonical kmer across all partitions and layers
|
||||||
|
match map.query(kmer) {
|
||||||
|
Some(hit) => {
|
||||||
|
let count = hit.count();
|
||||||
|
let present = hit.presence_row(); // bit slice over samples
|
||||||
|
}
|
||||||
|
None => { /* absent */ }
|
||||||
|
}
|
||||||
|
|
||||||
|
// Non-destructive extension with a new dataset
|
||||||
|
// unitigs produced by the two-phase pipeline, one per partition
|
||||||
|
let layer_idx = map.add_layer(unitigs_dir, counts_dir, presence_path)?;
|
||||||
|
```
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Dependencies
|
||||||
|
|
||||||
|
| crate | role |
|
||||||
|
|---|---|
|
||||||
|
| `ptr_hash` | phase-2 MPHF per layer |
|
||||||
|
| `ph` (FMPHGO) | phase-1 provisional MPHF during layer construction |
|
||||||
|
| `rkyv` | zero-copy serialisation of flat arrays (evidence, counts, presence) |
|
||||||
|
| `memmap2` | mmap of layer files |
|
||||||
|
| `bitm` | bit-packed presence matrix |
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Serialisation strategy
|
||||||
|
|
||||||
|
All flat arrays use `rkyv::Archive`:
|
||||||
|
|
||||||
|
```rust
|
||||||
|
#[derive(Archive, Serialize, Deserialize)]
|
||||||
|
struct Evidence { slots: Vec<u32> } // packed (unitig_id: 25 | rank: 7)
|
||||||
|
|
||||||
|
#[derive(Archive, Serialize, Deserialize)]
|
||||||
|
struct Counts { data: Vec<u32> }
|
||||||
|
```
|
||||||
|
|
||||||
|
At open time, each file is mmapped and cast to its archived type — no allocation, no copy. The MPHF is loaded via ptr_hash's own API; a rkyv wrapper is a future refinement.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Open questions
|
||||||
|
|
||||||
|
- **ptr_hash + rkyv**: ptr_hash's internals are flat bit arrays; a rkyv-compatible wrapper is structurally feasible. Assess upstream willingness or implement a thin newtype wrapper.
|
||||||
|
- **Presence matrix layout**: column-major favours per-sample operations; row-major favours per-kmer queries. Decide based on dominant access pattern.
|
||||||
|
- **Layer merge**: merging two `LayeredMap` instances into a single-layer index requires full rebuild. Define API and cost model; maintenance operation, not query-path.
|
||||||
|
- **Canonical kmer orientation**: evidence stores canonical kmer; strand recovery requires one 64-bit revcomp comparison at query time.
|
||||||
@@ -69,7 +69,9 @@ Consequence for `u8` capacity:
|
|||||||
| nucleotides | 255 nuc | 225 kmers |
|
| nucleotides | 255 nuc | 225 kmers |
|
||||||
| **kmers** | **255 kmers** | **285 nuc** |
|
| **kmers** | **255 kmers** | **285 nuc** |
|
||||||
|
|
||||||
On *Betula nana* (k=31, 256 partitions), m_u ≈ 37.9 kmers/unitig on average; no unitig length distribution data measured yet. The `rank` field (kmer index within the unitig) fits in a `u8` as long as no unitig exceeds 255 kmers — guaranteed by the split strategy below.
|
**Structural maximum from superkmer construction.** For k=31 and m=11, the maximum number of consecutive kmers sharing the same minimiser is k − m + 1 = **21 kmers** (the minimiser traverses from position k−m to 0 as the window slides). A unitig that is a single full superkmer therefore has exactly 21 kmers. This is confirmed by a bimodal distribution in empirical data: a sharp peak at 21 kmers appears in all partitions, including the anomalous partition 145. The observed maximum is ~46 kmers (unitigs spanning more than one superkmer), well within u8 range.
|
||||||
|
|
||||||
|
On *Betula nana* (k=31, 256 partitions), m_u ≈ 37.9 kmers/unitig on average. The `rank` field (kmer index within the unitig) fits in a `u8` as long as no unitig exceeds 255 kmers — guaranteed by the split strategy below and amply satisfied by empirical maximums (~46 kmers observed).
|
||||||
|
|
||||||
### Split strategy for long unitigs
|
### Split strategy for long unitigs
|
||||||
|
|
||||||
|
|||||||
@@ -44,6 +44,7 @@ nav:
|
|||||||
- On-disk storage: implementation/storage.md
|
- On-disk storage: implementation/storage.md
|
||||||
- MPHF selection: implementation/mphf.md
|
- MPHF selection: implementation/mphf.md
|
||||||
- Unitig evidence encoding: implementation/unitig_evidence.md
|
- Unitig evidence encoding: implementation/unitig_evidence.md
|
||||||
|
- obilayeredmap crate: implementation/obilayeredmap.md
|
||||||
- Architecture:
|
- Architecture:
|
||||||
- Sequences: architecture/sequences/invariant.md
|
- Sequences: architecture/sequences/invariant.md
|
||||||
|
|
||||||
|
|||||||
@@ -75,7 +75,12 @@ def main():
|
|||||||
parser.add_argument("file_a", help="First FASTA file (reference)")
|
parser.add_argument("file_a", help="First FASTA file (reference)")
|
||||||
parser.add_argument("file_b", help="Second FASTA file (to compare)")
|
parser.add_argument("file_b", help="Second FASTA file (to compare)")
|
||||||
parser.add_argument(
|
parser.add_argument(
|
||||||
"-k", "--kmer-size", type=int, default=31, metavar="K", help="k-mer size (default: 31)"
|
"-k",
|
||||||
|
"--kmer-size",
|
||||||
|
type=int,
|
||||||
|
default=31,
|
||||||
|
metavar="K",
|
||||||
|
help="k-mer size (default: 31)",
|
||||||
)
|
)
|
||||||
args = parser.parse_args()
|
args = parser.parse_args()
|
||||||
|
|
||||||
@@ -104,6 +109,10 @@ def main():
|
|||||||
|
|
||||||
if only_a or only_b:
|
if only_a or only_b:
|
||||||
print("\nSets differ.", file=sys.stderr)
|
print("\nSets differ.", file=sys.stderr)
|
||||||
|
if len(only_a) > 0 and len(only_b) <= 10:
|
||||||
|
print(f"\nOnly in A: {only_a}")
|
||||||
|
if len(only_b) > 0 and len(only_b) <= 10:
|
||||||
|
print(f"\nOnly in B: {only_b}")
|
||||||
sys.exit(1)
|
sys.exit(1)
|
||||||
else:
|
else:
|
||||||
print("\nSets are identical.")
|
print("\nSets are identical.")
|
||||||
|
|||||||
Generated
+5
@@ -1615,7 +1615,10 @@ version = "0.1.0"
|
|||||||
dependencies = [
|
dependencies = [
|
||||||
"memmap2",
|
"memmap2",
|
||||||
"niffler 3.0.0",
|
"niffler 3.0.0",
|
||||||
|
"obikrope",
|
||||||
"obikseq",
|
"obikseq",
|
||||||
|
"obiread",
|
||||||
|
"obiskbuilder",
|
||||||
"obiskio",
|
"obiskio",
|
||||||
"ph",
|
"ph",
|
||||||
"rayon",
|
"rayon",
|
||||||
@@ -1623,6 +1626,7 @@ dependencies = [
|
|||||||
"serde",
|
"serde",
|
||||||
"serde_json",
|
"serde_json",
|
||||||
"sysinfo 0.33.1",
|
"sysinfo 0.33.1",
|
||||||
|
"tempfile",
|
||||||
"tracing",
|
"tracing",
|
||||||
]
|
]
|
||||||
|
|
||||||
@@ -1679,6 +1683,7 @@ name = "obiskio"
|
|||||||
version = "0.1.0"
|
version = "0.1.0"
|
||||||
dependencies = [
|
dependencies = [
|
||||||
"lru",
|
"lru",
|
||||||
|
"memmap2",
|
||||||
"niffler 3.0.0",
|
"niffler 3.0.0",
|
||||||
"obikseq",
|
"obikseq",
|
||||||
"rustix",
|
"rustix",
|
||||||
|
|||||||
@@ -3,6 +3,13 @@ name = "obikpartitionner"
|
|||||||
version = "0.1.0"
|
version = "0.1.0"
|
||||||
edition = "2024"
|
edition = "2024"
|
||||||
|
|
||||||
|
[dev-dependencies]
|
||||||
|
tempfile = "3"
|
||||||
|
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||||
|
obiskbuilder = { path = "../obiskbuilder" }
|
||||||
|
obiread = { path = "../obiread" }
|
||||||
|
obikrope = { path = "../obikrope" }
|
||||||
|
|
||||||
[dependencies]
|
[dependencies]
|
||||||
niffler = "3.0.0"
|
niffler = "3.0.0"
|
||||||
remove_dir_all = "0.8"
|
remove_dir_all = "0.8"
|
||||||
|
|||||||
@@ -616,3 +616,119 @@ impl Drop for KmerPartition {
|
|||||||
let _ = self.close();
|
let _ = self.close();
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── integration tests ─────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[cfg(test)]
|
||||||
|
mod tests {
|
||||||
|
use super::*;
|
||||||
|
use std::collections::HashMap;
|
||||||
|
|
||||||
|
use obikrope::Rope;
|
||||||
|
use obikseq::SuperKmer;
|
||||||
|
use obiskbuilder::build_superkmers;
|
||||||
|
|
||||||
|
const K: usize = 11;
|
||||||
|
const M: usize = 5;
|
||||||
|
|
||||||
|
fn setup() {
|
||||||
|
obikseq::params::set_k(K);
|
||||||
|
obikseq::params::set_m(M);
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Direct canonical k-mer counts from ASCII sequences — ground truth.
|
||||||
|
fn direct_counts(seqs: &[&[u8]]) -> (u64, u64) {
|
||||||
|
let mut counts: HashMap<Vec<u8>, u64> = HashMap::new();
|
||||||
|
for seq in seqs {
|
||||||
|
for i in 0..seq.len().saturating_sub(K - 1) {
|
||||||
|
let km = SuperKmer::from_ascii(&seq[i..i + K]).to_ascii();
|
||||||
|
*counts.entry(km).or_insert(0) += 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
let f0 = counts.len() as u64;
|
||||||
|
let f1: u64 = counts.values().sum();
|
||||||
|
(f0, f1)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Run the full pipeline on a list of sequences and return (f0, f1) from
|
||||||
|
/// the `kmer_spectrum_raw.json` produced by `count_partition`.
|
||||||
|
fn pipeline_counts(seqs: &[&[u8]]) -> (u64, u64) {
|
||||||
|
setup();
|
||||||
|
|
||||||
|
let mut rope_data: Vec<u8> = Vec::new();
|
||||||
|
for seq in seqs {
|
||||||
|
rope_data.extend_from_slice(seq);
|
||||||
|
rope_data.push(0x00);
|
||||||
|
}
|
||||||
|
let mut rope = Rope::new(None);
|
||||||
|
rope.push(rope_data);
|
||||||
|
|
||||||
|
let superkmers: Vec<_> = build_superkmers(rope, K, 1, 0.0);
|
||||||
|
|
||||||
|
let dir = tempfile::tempdir().unwrap();
|
||||||
|
let mut kp = KmerPartition::create(dir.path(), 0, K, M, true).unwrap();
|
||||||
|
kp.write_batch(superkmers).unwrap();
|
||||||
|
kp.close().unwrap();
|
||||||
|
kp.dereplicate().unwrap();
|
||||||
|
|
||||||
|
let part_dir = dir.path().join("part_00000");
|
||||||
|
let dedup_path = part_dir.join("dereplicated.skmer.zst");
|
||||||
|
if !dedup_path.exists() {
|
||||||
|
return (0, 0);
|
||||||
|
}
|
||||||
|
count_partition(&part_dir, &dedup_path, K).unwrap();
|
||||||
|
|
||||||
|
let spec: serde_json::Value = serde_json::from_reader(
|
||||||
|
fs::File::open(part_dir.join("kmer_spectrum_raw.json")).unwrap(),
|
||||||
|
).unwrap();
|
||||||
|
let f0 = spec["f0"].as_u64().unwrap_or(0);
|
||||||
|
let f1 = spec["f1"].as_u64().unwrap_or(0);
|
||||||
|
(f0, f1)
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn single_sequence_f0_f1_match() {
|
||||||
|
let seqs: &[&[u8]] = &[b"ACGTACGTACGTACGTACGT"];
|
||||||
|
let (ef0, ef1) = direct_counts(seqs);
|
||||||
|
let (gf0, gf1) = pipeline_counts(seqs);
|
||||||
|
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
|
||||||
|
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn two_sequences_f0_f1_match() {
|
||||||
|
let seqs: &[&[u8]] = &[
|
||||||
|
b"ACGTACGTACGTACGTACGT",
|
||||||
|
b"TGCATGCATGCATGCATGCA",
|
||||||
|
];
|
||||||
|
let (ef0, ef1) = direct_counts(seqs);
|
||||||
|
let (gf0, gf1) = pipeline_counts(seqs);
|
||||||
|
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
|
||||||
|
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn repeated_sequence_f1_doubles() {
|
||||||
|
let seq = b"ACGTACGTACGTACGTACGT";
|
||||||
|
let seqs: &[&[u8]] = &[seq, seq];
|
||||||
|
let (ef0, ef1) = direct_counts(seqs);
|
||||||
|
let (gf0, gf1) = pipeline_counts(seqs);
|
||||||
|
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
|
||||||
|
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn many_sequences_f0_f1_match() {
|
||||||
|
// 20 distinct sequences of length 40 — forces multiple super-kmers and
|
||||||
|
// multiple minimizer boundaries per sequence.
|
||||||
|
let bases = b"ACGT";
|
||||||
|
let seqs: Vec<Vec<u8>> = (0..20u32)
|
||||||
|
.map(|i| (0..40).map(|j| bases[((i * 7 + j * 3) % 4) as usize]).collect())
|
||||||
|
.collect();
|
||||||
|
let seq_refs: Vec<&[u8]> = seqs.iter().map(|v| v.as_slice()).collect();
|
||||||
|
let (ef0, ef1) = direct_counts(&seq_refs);
|
||||||
|
let (gf0, gf1) = pipeline_counts(&seq_refs);
|
||||||
|
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
|
||||||
|
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|||||||
@@ -21,6 +21,7 @@ pub mod unitig;
|
|||||||
|
|
||||||
pub use annotations::Annotation;
|
pub use annotations::Annotation;
|
||||||
pub use kmer::{CanonicalKmer, Kmer, Minimizer, hash_kmer};
|
pub use kmer::{CanonicalKmer, Kmer, Minimizer, hash_kmer};
|
||||||
|
pub use packed_seq::MAX_KMERS_PER_CHUNK;
|
||||||
pub use params::{k, m, set_k, set_m};
|
pub use params::{k, m, set_k, set_m};
|
||||||
pub use routable::RoutableSuperKmer;
|
pub use routable::RoutableSuperKmer;
|
||||||
pub use sequence::Sequence;
|
pub use sequence::Sequence;
|
||||||
|
|||||||
@@ -22,6 +22,9 @@ use crate::kmer::{CanonicalKmer, Kmer, KmerError, KLen, KmerLength, KmerOf, MLen
|
|||||||
use crate::params::k;
|
use crate::params::k;
|
||||||
use crate::revcomp_lookup::REVCOMP4;
|
use crate::revcomp_lookup::REVCOMP4;
|
||||||
|
|
||||||
|
/// Maximum kmers per stored chunk. Enforces the u8 max-kmer-index field in the binary format.
|
||||||
|
pub const MAX_KMERS_PER_CHUNK: usize = 256;
|
||||||
|
|
||||||
// ── PackedSeq ─────────────────────────────────────────────────────────────────
|
// ── PackedSeq ─────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
/// 2-bit packed DNA sequence of arbitrary length ≥ 1.
|
/// 2-bit packed DNA sequence of arbitrary length ≥ 1.
|
||||||
@@ -229,22 +232,36 @@ impl PackedSeq {
|
|||||||
self.iter_kmers().map(|km| km.canonical())
|
self.iter_kmers().map(|km| km.canonical())
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Serialise to a compact binary representation.
|
/// Extract nucleotides `[start, end)` as a new [`PackedSeq`]. Allocates.
|
||||||
|
pub fn sub(&self, start: usize, end: usize) -> Self {
|
||||||
|
debug_assert!(end > start && end <= self.seql());
|
||||||
|
let nucs: Vec<u8> = (start..end).map(|i| self.nucleotide(i)).collect();
|
||||||
|
Self::from_nucleotides(&nucs)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Serialise one chunk to binary.
|
||||||
///
|
///
|
||||||
/// Format: varint(seql) followed by raw packed bytes.
|
/// Format: `[u8: n_kmers−1][packed bytes]`.
|
||||||
/// `tail` and `byte_len` are both derivable from `seql` and need not be stored.
|
/// The caller must ensure `seql ≥ k` and `seql − k + 1 ≤ MAX_KMERS_PER_CHUNK`.
|
||||||
|
/// Use [`SuperKmer::write_to_binary`] for sequences that may exceed one chunk.
|
||||||
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
|
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
|
||||||
write_varint(w, self.seql() as u64)?;
|
let k = crate::params::k();
|
||||||
|
let seql = self.seql();
|
||||||
|
debug_assert!(seql >= k, "sequence shorter than k");
|
||||||
|
debug_assert!(
|
||||||
|
seql - k + 1 <= MAX_KMERS_PER_CHUNK,
|
||||||
|
"chunk exceeds MAX_KMERS_PER_CHUNK; split before calling write_to_binary"
|
||||||
|
);
|
||||||
|
w.write_all(&[(seql - k) as u8])?;
|
||||||
w.write_all(&self.seq)
|
w.write_all(&self.seq)
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Deserialise from the compact binary format produced by [`write_to_binary`].
|
/// Deserialise one chunk from the binary format produced by [`write_to_binary`].
|
||||||
/// Allocates exactly one `Box<[u8]>` for the packed bytes.
|
/// Allocates exactly one `Box<[u8]>` for the packed bytes.
|
||||||
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
|
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
|
||||||
let seql = read_varint(r)? as usize;
|
let mut buf = [0u8; 1];
|
||||||
if seql == 0 {
|
r.read_exact(&mut buf)?;
|
||||||
return Err(io::Error::new(io::ErrorKind::InvalidData, "empty sequence"));
|
let seql = buf[0] as usize + crate::params::k();
|
||||||
}
|
|
||||||
let byte_len = (seql + 3) / 4;
|
let byte_len = (seql + 3) / 4;
|
||||||
let tail = (seql % 4) as u8;
|
let tail = (seql % 4) as u8;
|
||||||
let mut seq = vec![0u8; byte_len];
|
let mut seq = vec![0u8; byte_len];
|
||||||
|
|||||||
@@ -12,7 +12,7 @@ use xxhash_rust::xxh3::xxh3_64;
|
|||||||
use crate::Annotation;
|
use crate::Annotation;
|
||||||
use crate::Sequence;
|
use crate::Sequence;
|
||||||
use crate::kmer::{CanonicalKmer, Kmer, KmerError};
|
use crate::kmer::{CanonicalKmer, Kmer, KmerError};
|
||||||
use crate::packed_seq::{PackedSeq, read_varint, write_varint};
|
use crate::packed_seq::{MAX_KMERS_PER_CHUNK, PackedSeq, read_varint, write_varint};
|
||||||
|
|
||||||
// ── SKAnnotation ──────────────────────────────────────────────────────────────
|
// ── SKAnnotation ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -91,13 +91,37 @@ impl SuperKmer {
|
|||||||
Self { count: 1, inner }
|
Self { count: 1, inner }
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Serialise to compact binary. Format: varint(count) + varint((byte_len << 2) | tail) + bytes.
|
/// Serialise to compact binary: `[varint(count)][u8: n_kmers−1][packed bytes]` per chunk.
|
||||||
|
///
|
||||||
|
/// Sequences with more than [`MAX_KMERS_PER_CHUNK`] kmers are transparently split into
|
||||||
|
/// overlapping chunks (k−1 nucleotide overlap, same count per chunk). Each chunk is an
|
||||||
|
/// independent, self-contained record — one [`read_from_binary`] call reads exactly one.
|
||||||
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
|
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
|
||||||
write_varint(w, self.count as u64)?;
|
let k = crate::params::k();
|
||||||
self.inner.write_to_binary(w)
|
let seql = self.seql();
|
||||||
|
debug_assert!(seql >= k, "super-kmer shorter than k");
|
||||||
|
let n_kmers = seql - k + 1;
|
||||||
|
if n_kmers <= MAX_KMERS_PER_CHUNK {
|
||||||
|
write_varint(w, self.count as u64)?;
|
||||||
|
self.inner.write_to_binary(w)
|
||||||
|
} else {
|
||||||
|
let chunk_nucl = MAX_KMERS_PER_CHUNK + k - 1;
|
||||||
|
let stride = MAX_KMERS_PER_CHUNK;
|
||||||
|
let mut start = 0;
|
||||||
|
loop {
|
||||||
|
let end = (start + chunk_nucl).min(seql);
|
||||||
|
let mut chunk = self.inner.sub(start, end);
|
||||||
|
chunk.canonicalize();
|
||||||
|
write_varint(w, self.count as u64)?;
|
||||||
|
chunk.write_to_binary(w)?;
|
||||||
|
if end == seql { break; }
|
||||||
|
start += stride;
|
||||||
|
}
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Deserialise from the binary format produced by [`write_to_binary`].
|
/// Deserialise one chunk from the binary format produced by [`write_to_binary`].
|
||||||
/// Allocates exactly one `Box<[u8]>` for the packed bytes.
|
/// Allocates exactly one `Box<[u8]>` for the packed bytes.
|
||||||
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
|
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
|
||||||
let count = read_varint(r)? as u32;
|
let count = read_varint(r)? as u32;
|
||||||
|
|||||||
@@ -67,27 +67,57 @@ fn seql_roundtrip() {
|
|||||||
|
|
||||||
// ── binary serialisation ──────────────────────────────────────────────────────
|
// ── binary serialisation ──────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
fn binary_test_lengths(k: usize) -> Vec<usize> {
|
||||||
|
use crate::packed_seq::MAX_KMERS_PER_CHUNK;
|
||||||
|
// Only single-chunk lengths: seql in [k, MAX_KMERS_PER_CHUNK+k-1].
|
||||||
|
(k..=k + 5).chain([255, 256, 257, MAX_KMERS_PER_CHUNK + k - 1]).collect()
|
||||||
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn binary_roundtrip() {
|
fn binary_roundtrip() {
|
||||||
for len in all_lengths() {
|
set_k(4);
|
||||||
|
let k = crate::params::k();
|
||||||
|
for len in binary_test_lengths(k) {
|
||||||
let mut sk = SuperKmer::from_ascii(&make_seq(len));
|
let mut sk = SuperKmer::from_ascii(&make_seq(len));
|
||||||
sk.set_count(42);
|
sk.set_count(42);
|
||||||
let mut buf = Vec::new();
|
let mut buf = Vec::new();
|
||||||
sk.write_to_binary(&mut buf).unwrap();
|
sk.write_to_binary(&mut buf).unwrap();
|
||||||
let sk2 = SuperKmer::read_from_binary(&mut buf.as_slice()).unwrap();
|
let sk2 = SuperKmer::read_from_binary(&mut buf.as_slice()).unwrap();
|
||||||
assert_eq!(
|
assert_eq!(sk.to_ascii(), sk2.to_ascii(), "sequence mismatch for len={len}");
|
||||||
sk.to_ascii(),
|
|
||||||
sk2.to_ascii(),
|
|
||||||
"sequence mismatch for len={len}"
|
|
||||||
);
|
|
||||||
assert_eq!(sk2.count(), 42, "count mismatch for len={len}");
|
assert_eq!(sk2.count(), 42, "count mismatch for len={len}");
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn binary_split_roundtrip() {
|
||||||
|
// A super-kmer > MAX_KMERS_PER_CHUNK kmers is split into multiple records on write.
|
||||||
|
use crate::packed_seq::MAX_KMERS_PER_CHUNK;
|
||||||
|
set_k(4);
|
||||||
|
let k = crate::params::k();
|
||||||
|
// seql = MAX_KMERS_PER_CHUNK + k = 260 → n_kmers = 257 > 256 → 2 chunks
|
||||||
|
let seql = MAX_KMERS_PER_CHUNK + k;
|
||||||
|
let mut sk = SuperKmer::from_ascii(&make_seq(seql));
|
||||||
|
sk.set_count(7);
|
||||||
|
let mut buf = Vec::new();
|
||||||
|
sk.write_to_binary(&mut buf).unwrap();
|
||||||
|
// Read all records back.
|
||||||
|
let mut slice = buf.as_slice();
|
||||||
|
let chunk0 = SuperKmer::read_from_binary(&mut slice).unwrap();
|
||||||
|
let chunk1 = SuperKmer::read_from_binary(&mut slice).unwrap();
|
||||||
|
assert!(slice.is_empty(), "unexpected trailing bytes");
|
||||||
|
assert_eq!(chunk0.count(), 7);
|
||||||
|
assert_eq!(chunk1.count(), 7);
|
||||||
|
// Chunks cover the original sequence with k-1 overlap — no kmer lost.
|
||||||
|
assert_eq!(chunk0.seql(), MAX_KMERS_PER_CHUNK + k - 1); // 259
|
||||||
|
assert_eq!(chunk1.seql(), k); // 4 (1 kmer)
|
||||||
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn binary_packed_seq_roundtrip() {
|
fn binary_packed_seq_roundtrip() {
|
||||||
use crate::packed_seq::PackedSeq;
|
use crate::packed_seq::PackedSeq;
|
||||||
for len in all_lengths() {
|
set_k(4);
|
||||||
|
let k = crate::params::k();
|
||||||
|
for len in binary_test_lengths(k) {
|
||||||
let ps = PackedSeq::from_ascii(&make_seq(len));
|
let ps = PackedSeq::from_ascii(&make_seq(len));
|
||||||
let mut buf = Vec::new();
|
let mut buf = Vec::new();
|
||||||
ps.write_to_binary(&mut buf).unwrap();
|
ps.write_to_binary(&mut buf).unwrap();
|
||||||
@@ -98,7 +128,8 @@ fn binary_packed_seq_roundtrip() {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn binary_size_is_compact() {
|
fn binary_size_is_compact() {
|
||||||
// seql=4 (1 byte packed): varint(count=1, 1 byte) + varint((1<<2)|0=4, 1 byte) + 1 byte = 3 bytes
|
// ACGT with k=4: varint(count=1, 1 byte) + u8(n_kmers-1=0, 1 byte) + 1 packed byte = 3 bytes
|
||||||
|
set_k(4);
|
||||||
let sk = SuperKmer::from_ascii(b"ACGT");
|
let sk = SuperKmer::from_ascii(b"ACGT");
|
||||||
let mut buf = Vec::new();
|
let mut buf = Vec::new();
|
||||||
sk.write_to_binary(&mut buf).unwrap();
|
sk.write_to_binary(&mut buf).unwrap();
|
||||||
|
|||||||
@@ -160,7 +160,12 @@ mod tests {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn binary_roundtrip_all_lengths() {
|
fn binary_roundtrip_all_lengths() {
|
||||||
for len in test_lengths() {
|
// write_to_binary encodes a single chunk: seql must be in [k, MAX_KMERS_PER_CHUNK+k-1].
|
||||||
|
use crate::packed_seq::MAX_KMERS_PER_CHUNK;
|
||||||
|
set_k(4);
|
||||||
|
let k = crate::params::k();
|
||||||
|
let valid_lengths: Vec<usize> = (k..=9).chain([255, 256, 257, MAX_KMERS_PER_CHUNK + k - 1]).collect();
|
||||||
|
for len in valid_lengths {
|
||||||
let u = Unitig::from_ascii(&make_seq(len));
|
let u = Unitig::from_ascii(&make_seq(len));
|
||||||
let mut buf = Vec::new();
|
let mut buf = Vec::new();
|
||||||
u.write_to_binary(&mut buf).unwrap();
|
u.write_to_binary(&mut buf).unwrap();
|
||||||
|
|||||||
@@ -96,7 +96,7 @@ impl Iterator for SuperKmerIter<'_> {
|
|||||||
}
|
}
|
||||||
|
|
||||||
// ── 1. Entropy check ─────────────────────────────────────────────
|
// ── 1. Entropy check ─────────────────────────────────────────────
|
||||||
if self.stat.normalized_entropy().unwrap_or(1.0) <= self.theta {
|
if self.stat.normalized_entropy().unwrap_or(1.0) < self.theta {
|
||||||
let result = self.try_emit();
|
let result = self.try_emit();
|
||||||
self.cursor.rewind(self.k - 1).ok();
|
self.cursor.rewind(self.k - 1).ok();
|
||||||
self.reset();
|
self.reset();
|
||||||
@@ -168,6 +168,70 @@ mod tests {
|
|||||||
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
|
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
|
||||||
const K: usize = 11;
|
const K: usize = 11;
|
||||||
|
|
||||||
|
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
|
||||||
|
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
|
||||||
|
(0..seq.len().saturating_sub(K - 1))
|
||||||
|
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
|
||||||
|
.collect()
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
|
||||||
|
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
|
||||||
|
SuperKmerIter::new(rope, K, 1, 0.0)
|
||||||
|
.flat_map(|rsk| {
|
||||||
|
rsk.superkmer()
|
||||||
|
.iter_canonical_kmers()
|
||||||
|
.map(|km| km.to_ascii())
|
||||||
|
.collect::<Vec<_>>()
|
||||||
|
})
|
||||||
|
.collect()
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn coverage_single_segment() {
|
||||||
|
setup();
|
||||||
|
let seq = b"ACGTACGTACGTACGTACGT";
|
||||||
|
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
|
||||||
|
let direct = direct_canonical_kmers(seq);
|
||||||
|
let from_iter = iter_canonical_kmers(&rope);
|
||||||
|
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||||
|
assert!(
|
||||||
|
missing.is_empty(),
|
||||||
|
"k-mers perdus dans segment unique : {missing:?}"
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn coverage_two_segments() {
|
||||||
|
setup();
|
||||||
|
let seg1 = b"ACGTACGTACGTACGTACGT";
|
||||||
|
let seg2 = b"TGCATGCATGCATGCATGCA";
|
||||||
|
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
|
||||||
|
let mut direct = direct_canonical_kmers(seg1);
|
||||||
|
direct.extend(direct_canonical_kmers(seg2));
|
||||||
|
let from_iter = iter_canonical_kmers(&rope);
|
||||||
|
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||||
|
assert!(
|
||||||
|
missing.is_empty(),
|
||||||
|
"k-mers perdus dans deux segments : {missing:?}"
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn coverage_minimizer_boundary() {
|
||||||
|
setup();
|
||||||
|
// sequence assez longue pour forcer plusieurs changements de minimiseur
|
||||||
|
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
|
||||||
|
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
|
||||||
|
let direct = direct_canonical_kmers(&seq);
|
||||||
|
let from_iter = iter_canonical_kmers(&rope);
|
||||||
|
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||||
|
assert!(
|
||||||
|
missing.is_empty(),
|
||||||
|
"k-mers perdus à la frontière de minimiseur : {missing:?}"
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn single_segment_one_superkmer() {
|
fn single_segment_one_superkmer() {
|
||||||
setup();
|
setup();
|
||||||
|
|||||||
@@ -10,6 +10,7 @@ lru = "0.12"
|
|||||||
serde = { version = "1", features = ["derive"] }
|
serde = { version = "1", features = ["derive"] }
|
||||||
serde_json = "1"
|
serde_json = "1"
|
||||||
|
|
||||||
|
memmap2 = "0.9"
|
||||||
obikseq = { path = "../obikseq" }
|
obikseq = { path = "../obikseq" }
|
||||||
|
|
||||||
[dev-dependencies]
|
[dev-dependencies]
|
||||||
|
|||||||
@@ -17,63 +17,5 @@ pub(crate) fn read_superkmer<R: Read>(r: &mut R) -> io::Result<Option<SuperKmer>
|
|||||||
}
|
}
|
||||||
|
|
||||||
#[cfg(test)]
|
#[cfg(test)]
|
||||||
mod tests {
|
#[path = "tests/codec.rs"]
|
||||||
use super::*;
|
mod tests;
|
||||||
use std::io::Cursor;
|
|
||||||
|
|
||||||
fn make_sk(ascii: &[u8]) -> SuperKmer {
|
|
||||||
SuperKmer::from_ascii(ascii)
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn roundtrip_single() {
|
|
||||||
let sk = make_sk(b"ACGTACGT");
|
|
||||||
let mut buf = Vec::new();
|
|
||||||
write_superkmer(&mut buf, &sk).unwrap();
|
|
||||||
|
|
||||||
let mut cur = Cursor::new(&buf);
|
|
||||||
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
|
||||||
assert_eq!(sk.to_ascii(), got.to_ascii());
|
|
||||||
assert_eq!(sk.seql(), got.seql());
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn roundtrip_all_lengths() {
|
|
||||||
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
|
|
||||||
let k = 11;
|
|
||||||
for len in (k..=k + 8).chain([255, 256, 257]) {
|
|
||||||
let sk = make_sk(&bases[..len]);
|
|
||||||
let mut buf = Vec::new();
|
|
||||||
write_superkmer(&mut buf, &sk).unwrap();
|
|
||||||
|
|
||||||
let mut cur = Cursor::new(&buf);
|
|
||||||
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
|
||||||
assert_eq!(sk.to_ascii(), got.to_ascii(), "len={len}");
|
|
||||||
assert_eq!(sk.seql(), got.seql(), "len={len}");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn eof_returns_none() {
|
|
||||||
let buf: Vec<u8> = vec![];
|
|
||||||
let mut cur = Cursor::new(&buf);
|
|
||||||
assert!(read_superkmer(&mut cur).unwrap().is_none());
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn multiple_records() {
|
|
||||||
let seqs: &[&[u8]] = &[b"AAAA", b"CCCC", b"GGGG", b"TTTT"];
|
|
||||||
let mut buf = Vec::new();
|
|
||||||
for s in seqs {
|
|
||||||
write_superkmer(&mut buf, &make_sk(s)).unwrap();
|
|
||||||
}
|
|
||||||
|
|
||||||
let mut cur = Cursor::new(&buf);
|
|
||||||
for s in seqs {
|
|
||||||
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
|
||||||
let expected = make_sk(s);
|
|
||||||
assert_eq!(expected.to_ascii(), got.to_ascii());
|
|
||||||
}
|
|
||||||
assert!(read_superkmer(&mut cur).unwrap().is_none());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|||||||
@@ -4,8 +4,10 @@ pub mod limits;
|
|||||||
pub mod meta;
|
pub mod meta;
|
||||||
pub mod pool;
|
pub mod pool;
|
||||||
pub mod reader;
|
pub mod reader;
|
||||||
|
pub mod unitig_index;
|
||||||
|
|
||||||
pub use error::{SKError, SKResult};
|
pub use error::{SKError, SKResult};
|
||||||
pub use meta::SKFileMeta;
|
pub use meta::SKFileMeta;
|
||||||
pub use pool::{create_token, create_token_with, SKFilePool, SharedPool, SKFileWriter};
|
pub use pool::{create_token, create_token_with, SKFilePool, SharedPool, SKFileWriter};
|
||||||
pub use reader::{SKFileIter, SKFileReader};
|
pub use reader::{SKFileIter, SKFileReader};
|
||||||
|
pub use unitig_index::{UnitigFileReader, UnitigFileWriter};
|
||||||
|
|||||||
+2
-226
@@ -428,229 +428,5 @@ impl Drop for SKFileWriter {
|
|||||||
// ── tests ──────────────────────────────────────────────────────────────────────
|
// ── tests ──────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
#[cfg(test)]
|
#[cfg(test)]
|
||||||
mod tests {
|
#[path = "tests/pool.rs"]
|
||||||
use super::*;
|
mod tests;
|
||||||
use crate::reader::SKFileReader;
|
|
||||||
use obikseq::{SuperKmer, set_k};
|
|
||||||
use tempfile::{NamedTempFile, TempDir};
|
|
||||||
|
|
||||||
const TEST_K: usize = 4;
|
|
||||||
|
|
||||||
fn make_sk(seed: usize) -> SuperKmer {
|
|
||||||
let bases: Vec<u8> = (0..8).map(|j| b"ACGT"[(seed + j) % 4]).collect();
|
|
||||||
SuperKmer::from_ascii(&bases)
|
|
||||||
}
|
|
||||||
|
|
||||||
fn pool(max_open: usize) -> SharedPool {
|
|
||||||
Arc::new(Mutex::new(SKFilePool::new(max_open)))
|
|
||||||
}
|
|
||||||
|
|
||||||
fn open_token(t: &mut SKFileWriter, sk: &SuperKmer) {
|
|
||||||
t.set_flush_threshold(1);
|
|
||||||
t.write(sk).unwrap(); // pending ≥ 1 → drain → fd opened
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn creation_holds_no_fd() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let dir = TempDir::new().unwrap();
|
|
||||||
let p = pool(3);
|
|
||||||
for i in 0..10 {
|
|
||||||
create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap();
|
|
||||||
}
|
|
||||||
assert_eq!(p.lock().unwrap().open_count(), 0);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn pool_limits_open_fds() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let dir = TempDir::new().unwrap();
|
|
||||||
let p = pool(3);
|
|
||||||
let sk = make_sk(0);
|
|
||||||
|
|
||||||
let mut tokens: Vec<SKFileWriter> = (0..6)
|
|
||||||
.map(|i| create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap())
|
|
||||||
.collect();
|
|
||||||
|
|
||||||
for t in tokens.iter_mut() {
|
|
||||||
open_token(t, &sk);
|
|
||||||
}
|
|
||||||
|
|
||||||
assert!(
|
|
||||||
p.lock().unwrap().open_count() <= 3,
|
|
||||||
"open={}",
|
|
||||||
p.lock().unwrap().open_count()
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn evicted_token_stays_logically_open() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let dir = TempDir::new().unwrap();
|
|
||||||
let p = pool(1);
|
|
||||||
let sk = make_sk(0);
|
|
||||||
|
|
||||||
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
|
||||||
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
|
||||||
|
|
||||||
open_token(&mut t0, &sk); // t0 fd open, pool full
|
|
||||||
open_token(&mut t1, &sk); // evicts t0, t1 fd open
|
|
||||||
|
|
||||||
assert!(t0.is_open(), "t0 must remain logically open after eviction");
|
|
||||||
assert_eq!(p.lock().unwrap().open_count(), 1);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn evicted_data_readable_after_close_all() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let dir = TempDir::new().unwrap();
|
|
||||||
let p = pool(1);
|
|
||||||
let sk = make_sk(0);
|
|
||||||
|
|
||||||
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
|
||||||
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
|
||||||
|
|
||||||
t0.set_flush_threshold(1);
|
|
||||||
t0.write(&sk).unwrap(); // t0 fd open, pool full
|
|
||||||
t1.set_flush_threshold(1);
|
|
||||||
t1.write(&sk).unwrap(); // evicts t0, t1 fd open
|
|
||||||
|
|
||||||
// t0 still has the record in pending (eviction just closed fd, pending stays in token)
|
|
||||||
// Actually: t0's pending was drained before drain() returned (drain clears pending).
|
|
||||||
// So t0 wrote its record, then was evicted (fd closed).
|
|
||||||
|
|
||||||
drop(t0);
|
|
||||||
drop(t1);
|
|
||||||
p.lock().unwrap().close_all().unwrap();
|
|
||||||
|
|
||||||
for name in &["a.zst", "b.zst"] {
|
|
||||||
let mut r = SKFileReader::open(dir.path().join(name)).unwrap();
|
|
||||||
let got = r.read_batch(10).unwrap();
|
|
||||||
assert_eq!(got.len(), 1, "{name}: expected 1 record");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn touch_moves_to_mru_so_lru_is_evicted() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let dir = TempDir::new().unwrap();
|
|
||||||
let p = pool(2);
|
|
||||||
let sk = make_sk(0);
|
|
||||||
|
|
||||||
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
|
||||||
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
|
||||||
let mut t2 = create_token(&p, dir.path().join("c.zst")).unwrap();
|
|
||||||
|
|
||||||
open_token(&mut t0, &sk); // t0 open
|
|
||||||
open_token(&mut t1, &sk); // t1 open, t0 LRU
|
|
||||||
|
|
||||||
// Write to t0 again → t0 becomes MRU, t1 becomes LRU
|
|
||||||
t0.set_flush_threshold(1);
|
|
||||||
t0.write(&sk).unwrap();
|
|
||||||
|
|
||||||
// Writing to t2 fills pool (cap=2) → evicts LRU = t1
|
|
||||||
open_token(&mut t2, &sk);
|
|
||||||
|
|
||||||
let open_count = p.lock().unwrap().open_count();
|
|
||||||
assert!(open_count <= 2, "open_count={open_count}");
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn close_all_produces_readable_files() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let dir = TempDir::new().unwrap();
|
|
||||||
let p = pool(8);
|
|
||||||
let paths: Vec<_> = (0..4)
|
|
||||||
.map(|i| dir.path().join(format!("{i}.zst")))
|
|
||||||
.collect();
|
|
||||||
|
|
||||||
let mut tokens: Vec<SKFileWriter> = paths
|
|
||||||
.iter()
|
|
||||||
.map(|path| create_token(&p, path.clone()).unwrap())
|
|
||||||
.collect();
|
|
||||||
|
|
||||||
for (i, t) in tokens.iter_mut().enumerate() {
|
|
||||||
t.write(&make_sk(i)).unwrap();
|
|
||||||
}
|
|
||||||
// close tokens first so pending bytes are flushed and Zstd frames finalized
|
|
||||||
for t in tokens.iter_mut() {
|
|
||||||
t.close().unwrap();
|
|
||||||
}
|
|
||||||
p.lock().unwrap().close_all().unwrap();
|
|
||||||
|
|
||||||
for path in &paths {
|
|
||||||
let mut r = SKFileReader::open(path).unwrap();
|
|
||||||
let got = r.read_batch(10).unwrap();
|
|
||||||
assert_eq!(got.len(), 1);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn write_batch_roundtrip() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let dir = TempDir::new().unwrap();
|
|
||||||
let p = pool(4);
|
|
||||||
let sks: Vec<_> = (0..50).map(make_sk).collect();
|
|
||||||
let path = dir.path().join("batch.zst");
|
|
||||||
|
|
||||||
let mut t = create_token(&p, path.clone()).unwrap();
|
|
||||||
t.write_batch(&sks).unwrap();
|
|
||||||
t.close().unwrap();
|
|
||||||
|
|
||||||
let mut r = SKFileReader::open(&path).unwrap();
|
|
||||||
let got = r.read_batch(100).unwrap();
|
|
||||||
assert_eq!(got.len(), 50);
|
|
||||||
for (a, b) in sks.iter().zip(got.iter()) {
|
|
||||||
assert_eq!(a.to_ascii(), b.to_ascii());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn from_system_limits_bounded() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let pool = SKFilePool::from_system_limits();
|
|
||||||
assert!(pool.max_open() >= 16);
|
|
||||||
assert!(pool.max_open() <= MAX_POOL_SIZE);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn standalone_roundtrip_zstd() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let tmp = NamedTempFile::new().unwrap();
|
|
||||||
let sks: Vec<_> = (0..100).map(make_sk).collect();
|
|
||||||
{
|
|
||||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
|
||||||
w.write_batch(&sks).unwrap();
|
|
||||||
w.close().unwrap();
|
|
||||||
}
|
|
||||||
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
|
||||||
let got = r.read_batch(200).unwrap();
|
|
||||||
assert_eq!(got.len(), 100);
|
|
||||||
for (a, b) in sks.iter().zip(got.iter()) {
|
|
||||||
assert_eq!(a.to_ascii(), b.to_ascii());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn standalone_close_prevents_write() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let tmp = NamedTempFile::new().unwrap();
|
|
||||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
|
||||||
w.close().unwrap();
|
|
||||||
assert!(!w.is_open());
|
|
||||||
assert!(w.write(&make_sk(0)).is_err());
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn standalone_is_physically_open() {
|
|
||||||
set_k(TEST_K);
|
|
||||||
let tmp = NamedTempFile::new().unwrap();
|
|
||||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
|
||||||
assert!(!w.is_physically_open()); // fd deferred until first drain
|
|
||||||
w.set_flush_threshold(1);
|
|
||||||
w.write(&make_sk(0)).unwrap(); // triggers drain → fd opened
|
|
||||||
assert!(w.is_physically_open());
|
|
||||||
w.close().unwrap();
|
|
||||||
assert!(!w.is_physically_open());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|||||||
@@ -143,70 +143,5 @@ impl Iterator for SKFileIter<'_> {
|
|||||||
}
|
}
|
||||||
|
|
||||||
#[cfg(test)]
|
#[cfg(test)]
|
||||||
mod tests {
|
#[path = "tests/reader.rs"]
|
||||||
use super::*;
|
mod tests;
|
||||||
use crate::pool::SKFileWriter;
|
|
||||||
use tempfile::NamedTempFile;
|
|
||||||
|
|
||||||
const TEST_K: usize = 4; // test sequences are 8 bases; k=4 gives n_kmers=5
|
|
||||||
|
|
||||||
fn setup() {
|
|
||||||
obikseq::params::set_k(TEST_K);
|
|
||||||
}
|
|
||||||
|
|
||||||
fn make_sks(n: usize) -> Vec<SuperKmer> {
|
|
||||||
(0..n)
|
|
||||||
.map(|i| {
|
|
||||||
let bases: Vec<u8> = (0..8).map(|j| b"ACGT"[(i + j) % 4]).collect();
|
|
||||||
SuperKmer::from_ascii(&bases)
|
|
||||||
})
|
|
||||||
.collect()
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn iter_all() {
|
|
||||||
setup();
|
|
||||||
let tmp = NamedTempFile::new().unwrap();
|
|
||||||
let sks = make_sks(50);
|
|
||||||
|
|
||||||
{
|
|
||||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
|
||||||
w.write_batch(&sks).unwrap();
|
|
||||||
}
|
|
||||||
|
|
||||||
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
|
||||||
let got: Vec<_> = r.iter().collect();
|
|
||||||
assert_eq!(got.len(), 50);
|
|
||||||
for (a, b) in sks.iter().zip(got.iter()) {
|
|
||||||
assert_eq!(a.to_ascii(), b.to_ascii());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn reopen_and_seek() {
|
|
||||||
setup();
|
|
||||||
let tmp = NamedTempFile::new().unwrap();
|
|
||||||
let sks = make_sks(20);
|
|
||||||
|
|
||||||
{
|
|
||||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
|
||||||
w.write_batch(&sks).unwrap();
|
|
||||||
}
|
|
||||||
|
|
||||||
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
|
||||||
// Read 10, then simulate pool eviction + re-access
|
|
||||||
let first = r.read_batch(10).unwrap();
|
|
||||||
r.close();
|
|
||||||
r.reopen_and_seek().unwrap();
|
|
||||||
// Continue from position 10
|
|
||||||
let rest = r.read_batch(20).unwrap();
|
|
||||||
assert_eq!(first.len(), 10);
|
|
||||||
assert_eq!(rest.len(), 10);
|
|
||||||
for (a, b) in sks[..10].iter().zip(first.iter()) {
|
|
||||||
assert_eq!(a.to_ascii(), b.to_ascii());
|
|
||||||
}
|
|
||||||
for (a, b) in sks[10..].iter().zip(rest.iter()) {
|
|
||||||
assert_eq!(a.to_ascii(), b.to_ascii());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|||||||
@@ -0,0 +1,64 @@
|
|||||||
|
use super::*;
|
||||||
|
use obikseq::set_k;
|
||||||
|
use std::io::Cursor;
|
||||||
|
|
||||||
|
fn make_sk(ascii: &[u8]) -> SuperKmer {
|
||||||
|
SuperKmer::from_ascii(ascii)
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn roundtrip_single() {
|
||||||
|
set_k(4);
|
||||||
|
let sk = make_sk(b"ACGTACGT");
|
||||||
|
let mut buf = Vec::new();
|
||||||
|
write_superkmer(&mut buf, &sk).unwrap();
|
||||||
|
|
||||||
|
let mut cur = Cursor::new(&buf);
|
||||||
|
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
||||||
|
assert_eq!(sk.to_ascii(), got.to_ascii());
|
||||||
|
assert_eq!(sk.seql(), got.seql());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn roundtrip_all_lengths() {
|
||||||
|
set_k(11);
|
||||||
|
let k: usize = 11;
|
||||||
|
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
|
||||||
|
// With k=11, seql=257 → n_kmers=247 ≤ 256: single chunk, no split.
|
||||||
|
for len in (k..=k + 8).chain([255, 256, 257]) {
|
||||||
|
let sk = make_sk(&bases[..len]);
|
||||||
|
let mut buf = Vec::new();
|
||||||
|
write_superkmer(&mut buf, &sk).unwrap();
|
||||||
|
|
||||||
|
let mut cur = Cursor::new(&buf);
|
||||||
|
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
||||||
|
assert_eq!(sk.to_ascii(), got.to_ascii(), "len={len}");
|
||||||
|
assert_eq!(sk.seql(), got.seql(), "len={len}");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn eof_returns_none() {
|
||||||
|
set_k(4);
|
||||||
|
let buf: Vec<u8> = vec![];
|
||||||
|
let mut cur = Cursor::new(&buf);
|
||||||
|
assert!(read_superkmer(&mut cur).unwrap().is_none());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn multiple_records() {
|
||||||
|
set_k(4);
|
||||||
|
let seqs: &[&[u8]] = &[b"AAAA", b"CCCC", b"GGGG", b"TTTT"];
|
||||||
|
let mut buf = Vec::new();
|
||||||
|
for s in seqs {
|
||||||
|
write_superkmer(&mut buf, &make_sk(s)).unwrap();
|
||||||
|
}
|
||||||
|
|
||||||
|
let mut cur = Cursor::new(&buf);
|
||||||
|
for s in seqs {
|
||||||
|
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
||||||
|
let expected = make_sk(s);
|
||||||
|
assert_eq!(expected.to_ascii(), got.to_ascii());
|
||||||
|
}
|
||||||
|
assert!(read_superkmer(&mut cur).unwrap().is_none());
|
||||||
|
}
|
||||||
@@ -0,0 +1,217 @@
|
|||||||
|
use super::*;
|
||||||
|
use crate::reader::SKFileReader;
|
||||||
|
use obikseq::{SuperKmer, set_k};
|
||||||
|
use tempfile::{NamedTempFile, TempDir};
|
||||||
|
|
||||||
|
const TEST_K: usize = 4;
|
||||||
|
|
||||||
|
fn make_sk(seed: usize) -> SuperKmer {
|
||||||
|
let bases: Vec<u8> = (0..8).map(|j| b"ACGT"[(seed + j) % 4]).collect();
|
||||||
|
SuperKmer::from_ascii(&bases)
|
||||||
|
}
|
||||||
|
|
||||||
|
fn pool(max_open: usize) -> SharedPool {
|
||||||
|
Arc::new(Mutex::new(SKFilePool::new(max_open)))
|
||||||
|
}
|
||||||
|
|
||||||
|
fn open_token(t: &mut SKFileWriter, sk: &SuperKmer) {
|
||||||
|
t.set_flush_threshold(1);
|
||||||
|
t.write(sk).unwrap();
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn creation_holds_no_fd() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let dir = TempDir::new().unwrap();
|
||||||
|
let p = pool(3);
|
||||||
|
for i in 0..10 {
|
||||||
|
create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap();
|
||||||
|
}
|
||||||
|
assert_eq!(p.lock().unwrap().open_count(), 0);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn pool_limits_open_fds() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let dir = TempDir::new().unwrap();
|
||||||
|
let p = pool(3);
|
||||||
|
let sk = make_sk(0);
|
||||||
|
|
||||||
|
let mut tokens: Vec<SKFileWriter> = (0..6)
|
||||||
|
.map(|i| create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap())
|
||||||
|
.collect();
|
||||||
|
|
||||||
|
for t in tokens.iter_mut() {
|
||||||
|
open_token(t, &sk);
|
||||||
|
}
|
||||||
|
|
||||||
|
assert!(
|
||||||
|
p.lock().unwrap().open_count() <= 3,
|
||||||
|
"open={}",
|
||||||
|
p.lock().unwrap().open_count()
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn evicted_token_stays_logically_open() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let dir = TempDir::new().unwrap();
|
||||||
|
let p = pool(1);
|
||||||
|
let sk = make_sk(0);
|
||||||
|
|
||||||
|
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
||||||
|
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
||||||
|
|
||||||
|
open_token(&mut t0, &sk);
|
||||||
|
open_token(&mut t1, &sk);
|
||||||
|
|
||||||
|
assert!(t0.is_open(), "t0 must remain logically open after eviction");
|
||||||
|
assert_eq!(p.lock().unwrap().open_count(), 1);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn evicted_data_readable_after_close_all() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let dir = TempDir::new().unwrap();
|
||||||
|
let p = pool(1);
|
||||||
|
let sk = make_sk(0);
|
||||||
|
|
||||||
|
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
||||||
|
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
||||||
|
|
||||||
|
t0.set_flush_threshold(1);
|
||||||
|
t0.write(&sk).unwrap();
|
||||||
|
t1.set_flush_threshold(1);
|
||||||
|
t1.write(&sk).unwrap();
|
||||||
|
|
||||||
|
drop(t0);
|
||||||
|
drop(t1);
|
||||||
|
p.lock().unwrap().close_all().unwrap();
|
||||||
|
|
||||||
|
for name in &["a.zst", "b.zst"] {
|
||||||
|
let mut r = SKFileReader::open(dir.path().join(name)).unwrap();
|
||||||
|
let got = r.read_batch(10).unwrap();
|
||||||
|
assert_eq!(got.len(), 1, "{name}: expected 1 record");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn touch_moves_to_mru_so_lru_is_evicted() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let dir = TempDir::new().unwrap();
|
||||||
|
let p = pool(2);
|
||||||
|
let sk = make_sk(0);
|
||||||
|
|
||||||
|
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
||||||
|
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
||||||
|
let mut t2 = create_token(&p, dir.path().join("c.zst")).unwrap();
|
||||||
|
|
||||||
|
open_token(&mut t0, &sk);
|
||||||
|
open_token(&mut t1, &sk);
|
||||||
|
|
||||||
|
t0.set_flush_threshold(1);
|
||||||
|
t0.write(&sk).unwrap();
|
||||||
|
|
||||||
|
open_token(&mut t2, &sk);
|
||||||
|
|
||||||
|
let open_count = p.lock().unwrap().open_count();
|
||||||
|
assert!(open_count <= 2, "open_count={open_count}");
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn close_all_produces_readable_files() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let dir = TempDir::new().unwrap();
|
||||||
|
let p = pool(8);
|
||||||
|
let paths: Vec<_> = (0..4)
|
||||||
|
.map(|i| dir.path().join(format!("{i}.zst")))
|
||||||
|
.collect();
|
||||||
|
|
||||||
|
let mut tokens: Vec<SKFileWriter> = paths
|
||||||
|
.iter()
|
||||||
|
.map(|path| create_token(&p, path.clone()).unwrap())
|
||||||
|
.collect();
|
||||||
|
|
||||||
|
for (i, t) in tokens.iter_mut().enumerate() {
|
||||||
|
t.write(&make_sk(i)).unwrap();
|
||||||
|
}
|
||||||
|
for t in tokens.iter_mut() {
|
||||||
|
t.close().unwrap();
|
||||||
|
}
|
||||||
|
p.lock().unwrap().close_all().unwrap();
|
||||||
|
|
||||||
|
for path in &paths {
|
||||||
|
let mut r = SKFileReader::open(path).unwrap();
|
||||||
|
let got = r.read_batch(10).unwrap();
|
||||||
|
assert_eq!(got.len(), 1);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn write_batch_roundtrip() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let dir = TempDir::new().unwrap();
|
||||||
|
let p = pool(4);
|
||||||
|
let sks: Vec<_> = (0..50).map(make_sk).collect();
|
||||||
|
let path = dir.path().join("batch.zst");
|
||||||
|
|
||||||
|
let mut t = create_token(&p, path.clone()).unwrap();
|
||||||
|
t.write_batch(&sks).unwrap();
|
||||||
|
t.close().unwrap();
|
||||||
|
|
||||||
|
let mut r = SKFileReader::open(&path).unwrap();
|
||||||
|
let got = r.read_batch(100).unwrap();
|
||||||
|
assert_eq!(got.len(), 50);
|
||||||
|
for (a, b) in sks.iter().zip(got.iter()) {
|
||||||
|
assert_eq!(a.to_ascii(), b.to_ascii());
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn from_system_limits_bounded() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let pool = SKFilePool::from_system_limits();
|
||||||
|
assert!(pool.max_open() >= 16);
|
||||||
|
assert!(pool.max_open() <= MAX_POOL_SIZE);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn standalone_roundtrip_zstd() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let tmp = NamedTempFile::new().unwrap();
|
||||||
|
let sks: Vec<_> = (0..100).map(make_sk).collect();
|
||||||
|
{
|
||||||
|
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||||
|
w.write_batch(&sks).unwrap();
|
||||||
|
w.close().unwrap();
|
||||||
|
}
|
||||||
|
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
||||||
|
let got = r.read_batch(200).unwrap();
|
||||||
|
assert_eq!(got.len(), 100);
|
||||||
|
for (a, b) in sks.iter().zip(got.iter()) {
|
||||||
|
assert_eq!(a.to_ascii(), b.to_ascii());
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn standalone_close_prevents_write() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let tmp = NamedTempFile::new().unwrap();
|
||||||
|
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||||
|
w.close().unwrap();
|
||||||
|
assert!(!w.is_open());
|
||||||
|
assert!(w.write(&make_sk(0)).is_err());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn standalone_is_physically_open() {
|
||||||
|
set_k(TEST_K);
|
||||||
|
let tmp = NamedTempFile::new().unwrap();
|
||||||
|
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||||
|
assert!(!w.is_physically_open());
|
||||||
|
w.set_flush_threshold(1);
|
||||||
|
w.write(&make_sk(0)).unwrap();
|
||||||
|
assert!(w.is_physically_open());
|
||||||
|
w.close().unwrap();
|
||||||
|
assert!(!w.is_physically_open());
|
||||||
|
}
|
||||||
@@ -0,0 +1,63 @@
|
|||||||
|
use super::*;
|
||||||
|
use crate::pool::SKFileWriter;
|
||||||
|
use tempfile::NamedTempFile;
|
||||||
|
|
||||||
|
const TEST_K: usize = 4;
|
||||||
|
|
||||||
|
fn setup() {
|
||||||
|
obikseq::params::set_k(TEST_K);
|
||||||
|
}
|
||||||
|
|
||||||
|
fn make_sks(n: usize) -> Vec<SuperKmer> {
|
||||||
|
(0..n)
|
||||||
|
.map(|i| {
|
||||||
|
let bases: Vec<u8> = (0..8).map(|j| b"ACGT"[(i + j) % 4]).collect();
|
||||||
|
SuperKmer::from_ascii(&bases)
|
||||||
|
})
|
||||||
|
.collect()
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn iter_all() {
|
||||||
|
setup();
|
||||||
|
let tmp = NamedTempFile::new().unwrap();
|
||||||
|
let sks = make_sks(50);
|
||||||
|
|
||||||
|
{
|
||||||
|
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||||
|
w.write_batch(&sks).unwrap();
|
||||||
|
}
|
||||||
|
|
||||||
|
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
||||||
|
let got: Vec<_> = r.iter().collect();
|
||||||
|
assert_eq!(got.len(), 50);
|
||||||
|
for (a, b) in sks.iter().zip(got.iter()) {
|
||||||
|
assert_eq!(a.to_ascii(), b.to_ascii());
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn reopen_and_seek() {
|
||||||
|
setup();
|
||||||
|
let tmp = NamedTempFile::new().unwrap();
|
||||||
|
let sks = make_sks(20);
|
||||||
|
|
||||||
|
{
|
||||||
|
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||||
|
w.write_batch(&sks).unwrap();
|
||||||
|
}
|
||||||
|
|
||||||
|
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
||||||
|
let first = r.read_batch(10).unwrap();
|
||||||
|
r.close();
|
||||||
|
r.reopen_and_seek().unwrap();
|
||||||
|
let rest = r.read_batch(20).unwrap();
|
||||||
|
assert_eq!(first.len(), 10);
|
||||||
|
assert_eq!(rest.len(), 10);
|
||||||
|
for (a, b) in sks[..10].iter().zip(first.iter()) {
|
||||||
|
assert_eq!(a.to_ascii(), b.to_ascii());
|
||||||
|
}
|
||||||
|
for (a, b) in sks[10..].iter().zip(rest.iter()) {
|
||||||
|
assert_eq!(a.to_ascii(), b.to_ascii());
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,169 @@
|
|||||||
|
use super::*;
|
||||||
|
use obikseq::{Kmer, Sequence as _, Unitig, set_k};
|
||||||
|
use tempfile::tempdir;
|
||||||
|
|
||||||
|
fn make_unitig(ascii: &[u8]) -> Unitig {
|
||||||
|
Unitig::from_ascii(ascii)
|
||||||
|
}
|
||||||
|
|
||||||
|
fn canonical_of(ascii: &[u8]) -> CanonicalKmer {
|
||||||
|
Kmer::from_ascii(ascii).unwrap().canonical()
|
||||||
|
}
|
||||||
|
|
||||||
|
fn write_read(seqs: &[&[u8]]) -> (tempfile::TempDir, UnitigFileReader) {
|
||||||
|
let dir = tempdir().unwrap();
|
||||||
|
let path = dir.path().join("unitigs.bin");
|
||||||
|
let mut w = UnitigFileWriter::create(&path).unwrap();
|
||||||
|
for s in seqs {
|
||||||
|
w.write(&make_unitig(s)).unwrap();
|
||||||
|
}
|
||||||
|
w.close().unwrap();
|
||||||
|
let r = UnitigFileReader::open(&path).unwrap();
|
||||||
|
(dir, r)
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── I/O round-trip ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn roundtrip_empty_index() {
|
||||||
|
set_k(4);
|
||||||
|
let dir = tempdir().unwrap();
|
||||||
|
let path = dir.path().join("unitigs.bin");
|
||||||
|
let w = UnitigFileWriter::create(&path).unwrap();
|
||||||
|
w.close().unwrap();
|
||||||
|
let r = UnitigFileReader::open(&path).unwrap();
|
||||||
|
assert_eq!(r.len(), 0);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn roundtrip_unitigs() {
|
||||||
|
set_k(4);
|
||||||
|
let seqs: &[&[u8]] = &[b"ACGTACGT", b"TTTTCCCC", b"GGGAAA"];
|
||||||
|
let (_dir, r) = write_read(seqs);
|
||||||
|
assert_eq!(r.len(), seqs.len());
|
||||||
|
for (i, s) in seqs.iter().enumerate() {
|
||||||
|
assert_eq!(r.unitig(i), make_unitig(s), "unitig {i} mismatch");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Bit extraction ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn extract_kmer_raw_basic() {
|
||||||
|
// ACGT = 00 01 10 11 = 0x1B; k=4, j=0 → 0x1B << 56
|
||||||
|
let bytes = [0x1Bu8];
|
||||||
|
assert_eq!(extract_kmer_raw(&bytes, 0, 4), 0x1Bu64 << 56);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn extract_kmer_raw_intra_byte_offset() {
|
||||||
|
// ACGT, j=1, k=3 → CGT = 01 10 11 = 0x1B (6 bits) → 0x1B << 58
|
||||||
|
let bytes = [0x1Bu8];
|
||||||
|
assert_eq!(extract_kmer_raw(&bytes, 1, 3), 0x1Bu64 << 58);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn extract_kmer_raw_cross_byte() {
|
||||||
|
// Two bytes: ACGT | ACGT = [0x1B, 0x1B]
|
||||||
|
// j=3, k=4: nucleotides 3..7 = T A C G = 11 00 01 10 = 0b11000110 = 0xC6
|
||||||
|
let bytes = [0x1Bu8, 0x1Bu8];
|
||||||
|
assert_eq!(extract_kmer_raw(&bytes, 3, 4), 0xC6u64 << 56);
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── revcomp / canonical ───────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn revcomp_palindrome() {
|
||||||
|
// ACGT is its own reverse complement
|
||||||
|
let raw = 0x1Bu64 << 56; // ACGT, k=4
|
||||||
|
assert_eq!(revcomp_raw(raw, 4), raw);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn revcomp_asymmetric() {
|
||||||
|
// revcomp(TTTG) = CAAA
|
||||||
|
// TTTG = 11 11 11 10 = 0xFE → 0xFE << 56
|
||||||
|
// CAAA = 01 00 00 00 = 0x40 → 0x40 << 56
|
||||||
|
let tttg = 0xFEu64 << 56;
|
||||||
|
let caaa = 0x40u64 << 56;
|
||||||
|
assert_eq!(revcomp_raw(tttg, 4), caaa);
|
||||||
|
assert_eq!(revcomp_raw(caaa, 4), tttg);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn canonical_raw_selects_minimum() {
|
||||||
|
let tttg = 0xFEu64 << 56;
|
||||||
|
let caaa = 0x40u64 << 56;
|
||||||
|
assert_eq!(canonical_raw(tttg, 4), caaa); // TTTG → canonical is CAAA
|
||||||
|
assert_eq!(canonical_raw(caaa, 4), caaa); // CAAA already canonical
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── verify_canonical_kmer ─────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn verify_forward_canonical() {
|
||||||
|
// CAAA is canonical (< TTTG); stored forward in the unitig → direct match
|
||||||
|
set_k(4);
|
||||||
|
let (_dir, r) = write_read(&[b"CAAAACGT"]);
|
||||||
|
let query = canonical_of(b"CAAA");
|
||||||
|
assert!(r.verify_canonical_kmer(0, 0, query));
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn verify_reverse_complement_stored() {
|
||||||
|
// TTTG stored in the unitig; canonical form is CAAA
|
||||||
|
// verify must recognise the match despite the stored orientation being non-canonical
|
||||||
|
set_k(4);
|
||||||
|
let (_dir, r) = write_read(&[b"TTTGACGT"]);
|
||||||
|
let query = canonical_of(b"CAAA"); // == canonical_of(b"TTTG")
|
||||||
|
assert!(r.verify_canonical_kmer(0, 0, query));
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn verify_wrong_kmer_returns_false() {
|
||||||
|
set_k(4);
|
||||||
|
let (_dir, r) = write_read(&[b"TTTGACGT"]);
|
||||||
|
let wrong = canonical_of(b"AAAC");
|
||||||
|
assert!(!r.verify_canonical_kmer(0, 0, wrong));
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn verify_second_unitig_second_position() {
|
||||||
|
// Two unitigs; check kmer at j=1 of unitig 1 ("TTTGACGT")
|
||||||
|
// j=1 → nucleotides 1..5 = TTGA
|
||||||
|
set_k(4);
|
||||||
|
let (_dir, r) = write_read(&[b"ACGTACGT", b"TTTGACGT"]);
|
||||||
|
let query = canonical_of(b"TTGA");
|
||||||
|
assert!(r.verify_canonical_kmer(1, 1, query));
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Splitting ─────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn short_unitig_not_split() {
|
||||||
|
// seql=259 → n_kmers=256 = MAX_KMERS_PER_CHUNK → no split
|
||||||
|
set_k(4);
|
||||||
|
let seq: Vec<u8> = (0..259_usize).map(|i| b"ACGT"[i % 4]).collect();
|
||||||
|
let (_dir, r) = write_read(&[&seq]);
|
||||||
|
assert_eq!(r.len(), 1);
|
||||||
|
assert_eq!(r.seql(0), 259);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn long_unitig_split_no_kmer_lost() {
|
||||||
|
// seql=260 → n_kmers=257 > MAX_KMERS_PER_CHUNK(256) → 2 chunks
|
||||||
|
// chunk_nucl=259, stride=256
|
||||||
|
// Chunk 0: nucl 0..259 (259 nucl, 256 kmers)
|
||||||
|
// Chunk 1: nucl 256..260 (4 nucl, 1 kmer)
|
||||||
|
set_k(4);
|
||||||
|
let seq: Vec<u8> = (0..260_usize).map(|i| b"ACGT"[i % 4]).collect();
|
||||||
|
let (_dir, r) = write_read(&[&seq]);
|
||||||
|
assert_eq!(r.len(), 2);
|
||||||
|
assert_eq!(r.seql(0), 259);
|
||||||
|
assert_eq!(r.seql(1), 4);
|
||||||
|
// k-1=3 nucleotide overlap → 0 kmers duplicated, 0 kmers lost.
|
||||||
|
// Last kmer of chunk 0 = original nucl 255..259.
|
||||||
|
assert!(r.verify_canonical_kmer(0, 255, canonical_of(&seq[255..259])));
|
||||||
|
// First kmer of chunk 1 = original nucl 256..260 — a different, adjacent kmer.
|
||||||
|
assert!(r.verify_canonical_kmer(1, 0, canonical_of(&seq[256..260])));
|
||||||
|
}
|
||||||
@@ -0,0 +1,286 @@
|
|||||||
|
use std::fs::File;
|
||||||
|
use std::io::{BufWriter, Write as _};
|
||||||
|
use std::path::{Path, PathBuf};
|
||||||
|
|
||||||
|
use memmap2::Mmap;
|
||||||
|
use obikseq::{CanonicalKmer, Unitig};
|
||||||
|
|
||||||
|
pub use obikseq::MAX_KMERS_PER_CHUNK;
|
||||||
|
|
||||||
|
use crate::error::{SKError, SKResult};
|
||||||
|
|
||||||
|
// ── Index file format ─────────────────────────────────────────────────────────
|
||||||
|
//
|
||||||
|
// magic: [u8; 4] = b"UIDX"
|
||||||
|
// n_unitigs: u32 LE
|
||||||
|
// seqls: [u8; n_unitigs] max kmer index per chunk (= n_kmers − 1)
|
||||||
|
// packed_offsets: [u32; n_unitigs + 1] byte offsets to packed bytes in the
|
||||||
|
// sequence file; last entry is sentinel
|
||||||
|
//
|
||||||
|
// Each sequence record in the binary file: [u8: n_kmers−1][packed bytes].
|
||||||
|
// Offsets point to the first packed byte of each record, past the leading u8.
|
||||||
|
// Unitigs with more than MAX_KMERS_PER_CHUNK kmers are transparently split by the
|
||||||
|
// writer into overlapping chunks (k-1 nucleotide overlap) so no kmer is lost.
|
||||||
|
|
||||||
|
const MAGIC: [u8; 4] = *b"UIDX";
|
||||||
|
|
||||||
|
fn idx_path(path: &Path) -> PathBuf {
|
||||||
|
let mut s = path.as_os_str().to_owned();
|
||||||
|
s.push(".idx");
|
||||||
|
PathBuf::from(s)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Extract a sub-sequence [start, end) nucleotides from a unitig.
|
||||||
|
fn sub_unitig(unitig: &Unitig, start: usize, end: usize) -> Unitig {
|
||||||
|
unitig.sub(start, end)
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Writer ────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Writes a sequence of [`Unitig`] to an uncompressed binary file and builds
|
||||||
|
/// an offset index at close time.
|
||||||
|
///
|
||||||
|
/// Unitigs with more than [`MAX_KMERS_PER_CHUNK`] kmers are transparently split
|
||||||
|
/// into overlapping chunks (k-1 nucleotide overlap) so no kmer is lost.
|
||||||
|
///
|
||||||
|
/// The companion index file (`path.idx`) is written on [`close`].
|
||||||
|
/// The binary format per record is `[u8: n_kmers−1][packed 2-bit bytes]`.
|
||||||
|
pub struct UnitigFileWriter {
|
||||||
|
path: PathBuf,
|
||||||
|
file: BufWriter<File>,
|
||||||
|
seqls: Vec<u8>,
|
||||||
|
packed_offsets: Vec<u32>,
|
||||||
|
next_offset: u32,
|
||||||
|
k: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl UnitigFileWriter {
|
||||||
|
pub fn create(path: &Path) -> SKResult<Self> {
|
||||||
|
let file = File::create(path).map_err(SKError::Io)?;
|
||||||
|
Ok(Self {
|
||||||
|
path: path.to_owned(),
|
||||||
|
file: BufWriter::new(file),
|
||||||
|
seqls: Vec::new(),
|
||||||
|
packed_offsets: Vec::new(),
|
||||||
|
next_offset: 0,
|
||||||
|
k: obikseq::params::k(),
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Write a unitig, splitting it into chunks if it exceeds [`MAX_KMERS_PER_CHUNK`].
|
||||||
|
pub fn write(&mut self, unitig: &Unitig) -> SKResult<()> {
|
||||||
|
let seql = unitig.seql();
|
||||||
|
let k = self.k;
|
||||||
|
|
||||||
|
if seql < k {
|
||||||
|
return Ok(());
|
||||||
|
}
|
||||||
|
|
||||||
|
let n_kmers = seql - k + 1;
|
||||||
|
if n_kmers <= MAX_KMERS_PER_CHUNK {
|
||||||
|
return self.write_chunk(unitig);
|
||||||
|
}
|
||||||
|
|
||||||
|
// Split into overlapping chunks of MAX_KMERS_PER_CHUNK kmers.
|
||||||
|
// Overlap of k-1 nucleotides ensures no kmer is lost at boundaries.
|
||||||
|
let chunk_nucl = MAX_KMERS_PER_CHUNK + k - 1;
|
||||||
|
let stride = MAX_KMERS_PER_CHUNK;
|
||||||
|
let mut start = 0;
|
||||||
|
while start < seql {
|
||||||
|
let end = (start + chunk_nucl).min(seql);
|
||||||
|
self.write_chunk(&sub_unitig(unitig, start, end))?;
|
||||||
|
if end == seql {
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
start += stride;
|
||||||
|
}
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
|
||||||
|
fn write_chunk(&mut self, unitig: &Unitig) -> SKResult<()> {
|
||||||
|
let seql = unitig.seql();
|
||||||
|
let byte_len = (seql + 3) / 4;
|
||||||
|
|
||||||
|
// Header is 1 byte (u8: n_kmers − 1 = seql − k); packed bytes follow.
|
||||||
|
self.packed_offsets.push(self.next_offset + 1);
|
||||||
|
self.seqls.push((seql - self.k) as u8);
|
||||||
|
|
||||||
|
unitig
|
||||||
|
.write_to_binary(&mut self.file)
|
||||||
|
.map_err(SKError::Io)?;
|
||||||
|
|
||||||
|
self.next_offset += 1 + byte_len as u32;
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Flush the sequence file and write the companion `.idx`.
|
||||||
|
pub fn close(mut self) -> SKResult<()> {
|
||||||
|
self.file.flush().map_err(SKError::Io)?;
|
||||||
|
drop(self.file);
|
||||||
|
|
||||||
|
// Sentinel: byte offset past the last record's packed bytes.
|
||||||
|
let sentinel = match (self.packed_offsets.last(), self.seqls.last()) {
|
||||||
|
(Some(&last_off), Some(&last_seql)) => {
|
||||||
|
let seql = last_seql as u32 + self.k as u32;
|
||||||
|
last_off + (seql + 3) / 4
|
||||||
|
}
|
||||||
|
_ => 0,
|
||||||
|
};
|
||||||
|
self.packed_offsets.push(sentinel);
|
||||||
|
|
||||||
|
write_idx(&idx_path(&self.path), &self.seqls, &self.packed_offsets)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn len(&self) -> usize {
|
||||||
|
self.seqls.len()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn is_empty(&self) -> bool {
|
||||||
|
self.seqls.is_empty()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
fn write_idx(path: &Path, seqls: &[u8], packed_offsets: &[u32]) -> SKResult<()> {
|
||||||
|
let mut w = BufWriter::new(File::create(path).map_err(SKError::Io)?);
|
||||||
|
w.write_all(&MAGIC).map_err(SKError::Io)?;
|
||||||
|
w.write_all(&(seqls.len() as u32).to_le_bytes()).map_err(SKError::Io)?;
|
||||||
|
w.write_all(seqls).map_err(SKError::Io)?;
|
||||||
|
for &off in packed_offsets {
|
||||||
|
w.write_all(&off.to_le_bytes()).map_err(SKError::Io)?;
|
||||||
|
}
|
||||||
|
w.flush().map_err(SKError::Io)
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Reader ────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Read-only random-access view of a unitig file.
|
||||||
|
///
|
||||||
|
/// The sequence file is memory-mapped; the index is loaded into RAM on open.
|
||||||
|
/// All per-kmer operations are O(1) and allocation-free.
|
||||||
|
pub struct UnitigFileReader {
|
||||||
|
mmap: Mmap,
|
||||||
|
seqls: Vec<u8>,
|
||||||
|
packed_offsets: Vec<u32>,
|
||||||
|
k: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl UnitigFileReader {
|
||||||
|
pub fn open(path: &Path) -> SKResult<Self> {
|
||||||
|
let file = File::open(path).map_err(SKError::Io)?;
|
||||||
|
let mmap = unsafe { Mmap::map(&file).map_err(SKError::Io)? };
|
||||||
|
let (seqls, packed_offsets) = read_idx(&idx_path(path))?;
|
||||||
|
let k = obikseq::params::k();
|
||||||
|
Ok(Self { mmap, seqls, packed_offsets, k })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn len(&self) -> usize {
|
||||||
|
self.seqls.len()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn is_empty(&self) -> bool {
|
||||||
|
self.seqls.is_empty()
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Return the nucleotide length of chunk `i`.
|
||||||
|
#[inline]
|
||||||
|
pub fn seql(&self, i: usize) -> usize {
|
||||||
|
self.seqls[i] as usize + self.k
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Reconstruct chunk `i` as a [`Unitig`]. Allocates a copy of the packed bytes.
|
||||||
|
pub fn unitig(&self, i: usize) -> Unitig {
|
||||||
|
let seql = self.seqls[i] as usize + self.k;
|
||||||
|
let start = self.packed_offsets[i] as usize;
|
||||||
|
let byte_len = (seql + 3) / 4;
|
||||||
|
let tail = (seql % 4) as u8;
|
||||||
|
let bytes = self.mmap[start..start + byte_len].to_vec().into_boxed_slice();
|
||||||
|
Unitig::new(tail, bytes)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Extract the raw left-aligned u64 of the kmer at position `j` within chunk `i`.
|
||||||
|
#[inline]
|
||||||
|
pub fn raw_kmer(&self, i: usize, j: usize) -> u64 {
|
||||||
|
let start = self.packed_offsets[i] as usize;
|
||||||
|
extract_kmer_raw(&self.mmap[start..], j, self.k)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Return `true` iff the kmer at position `j` of chunk `i` equals `query`.
|
||||||
|
///
|
||||||
|
/// O(1), zero allocation. The chunk may store either orientation of the kmer;
|
||||||
|
/// canonicalization is applied before comparison.
|
||||||
|
#[inline]
|
||||||
|
pub fn verify_canonical_kmer(&self, i: usize, j: usize, query: CanonicalKmer) -> bool {
|
||||||
|
canonical_raw(self.raw_kmer(i, j), self.k) == query.raw()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
fn read_idx(path: &Path) -> SKResult<(Vec<u8>, Vec<u32>)> {
|
||||||
|
let data = std::fs::read(path).map_err(SKError::Io)?;
|
||||||
|
let mut pos = 0;
|
||||||
|
|
||||||
|
if &data[pos..pos + 4] != &MAGIC {
|
||||||
|
return Err(SKError::Io(std::io::Error::new(
|
||||||
|
std::io::ErrorKind::InvalidData,
|
||||||
|
"unitig index: bad magic",
|
||||||
|
)));
|
||||||
|
}
|
||||||
|
pos += 4;
|
||||||
|
|
||||||
|
let n = u32::from_le_bytes(data[pos..pos + 4].try_into().unwrap()) as usize;
|
||||||
|
pos += 4;
|
||||||
|
|
||||||
|
let seqls = data[pos..pos + n].to_vec();
|
||||||
|
pos += n;
|
||||||
|
|
||||||
|
let mut packed_offsets = Vec::with_capacity(n + 1);
|
||||||
|
for _ in 0..=n {
|
||||||
|
packed_offsets.push(u32::from_le_bytes(data[pos..pos + 4].try_into().unwrap()));
|
||||||
|
pos += 4;
|
||||||
|
}
|
||||||
|
|
||||||
|
Ok((seqls, packed_offsets))
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Kmer utilities ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Reverse complement of a left-aligned 2-bit kmer (same algorithm as [`KmerOf::revcomp`]).
|
||||||
|
#[inline]
|
||||||
|
fn revcomp_raw(raw: u64, k: usize) -> u64 {
|
||||||
|
let x = !raw;
|
||||||
|
let x = x.swap_bytes();
|
||||||
|
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
|
||||||
|
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
|
||||||
|
x << (64 - 2 * k)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Canonical form of a left-aligned 2-bit kmer: `min(kmer, revcomp(kmer))`.
|
||||||
|
#[inline]
|
||||||
|
fn canonical_raw(raw: u64, k: usize) -> u64 {
|
||||||
|
raw.min(revcomp_raw(raw, k))
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Bit extraction ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Extract the kmer at nucleotide position `j` from MSB-first 2-bit packed `bytes`.
|
||||||
|
/// Returns a left-aligned u64 matching [`KmerOf`]'s internal representation.
|
||||||
|
#[inline]
|
||||||
|
fn extract_kmer_raw(bytes: &[u8], j: usize, k: usize) -> u64 {
|
||||||
|
let bit_start = j * 2;
|
||||||
|
let byte_start = bit_start / 8;
|
||||||
|
let bit_offset = bit_start % 8; // always 0, 2, 4, or 6
|
||||||
|
let bytes_needed = (bit_offset + 2 * k + 7) / 8; // ≤ 9 for k ≤ 32
|
||||||
|
|
||||||
|
let mut acc = 0u128;
|
||||||
|
for idx in 0..bytes_needed {
|
||||||
|
acc = (acc << 8) | bytes.get(byte_start + idx).copied().unwrap_or(0) as u128;
|
||||||
|
}
|
||||||
|
|
||||||
|
let shift = bytes_needed * 8 - bit_offset - 2 * k;
|
||||||
|
let mask = !0u64 >> (64 - 2 * k);
|
||||||
|
let raw = (acc >> shift) as u64 & mask;
|
||||||
|
raw << (64 - 2 * k)
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cfg(test)]
|
||||||
|
#[path = "tests/unitig_index.rs"]
|
||||||
|
mod tests;
|
||||||
Reference in New Issue
Block a user