feat: implement persistent layered index and chunked binary format

Introduce the `obilayeredmap` specification and persistent MPHF-based index architecture for incremental multi-dataset indexing. Implement chunked binary serialization with a fixed `u8` k-mer count limit (256) and overlapping super-kmer segments. Add memory-mapped I/O and a companion `.idx` index file for allocation-free, O(1) unitig access. Update MkDocs navigation, enhance the k-mer comparison script, and add comprehensive tests for serialization, partitioning, and file I/O pipelines.
This commit is contained in:
Eric Coissac
2026-05-09 17:38:29 +08:00
parent 8c17bf958b
commit 5169f65dc9
24 changed files with 1342 additions and 382 deletions
+58 -3
View File
@@ -49,7 +49,7 @@ Build a new MPHF over the filtered kmer set only, with the exact key count avail
**Phase 1** (provisional, discarded after spectrum computation): FMPHGO. Tolerates overestimated capacity, compact, no need to optimise for query speed on a temporary structure. **Phase 1** (provisional, discarded after spectrum computation): FMPHGO. Tolerates overestimated capacity, compact, no need to optimise for query speed on a temporary structure.
**Phase 2** (persistent, queried repeatedly): open between FMPHGO and ptr_hash. Exact key count is available, so both operate optimally. ptr_hash's query speed advantage (2.13.3×) is meaningful for the persistent index but carries the risk of a very young crate. FMPHGO is the conservative default; ptr_hash is worth revisiting once it has broader production use. **Phase 2** (persistent, queried repeatedly): **ptr_hash**. Exact key count is available at phase 2, so ptr_hash operates optimally. Its query speed (≥2.1× over FMPHGO) and construction speed (≥3.1×) are meaningful for the persistent index; the space overhead at 2.4 bits/key is acceptable. The crate's youth (Feb 2025) was previously a concern; it is now accepted given the performance profile and the fact that each layer MPHF is independently rebuildable from its unitig file if needed.
boomphf is effectively eliminated: its space overhead is the largest and its streaming-construction advantage does not apply here. boomphf is effectively eliminated: its space overhead is the largest and its streaming-construction advantage does not apply here.
@@ -73,9 +73,64 @@ All three are in-memory structures. Their internal representation is flat bit ar
No established Rust crate provides a natively on-disk MPHF. **SSHash** (Sparse and Skew Hash) is a complete kmer dictionary designed for disk access and is order-preserving (overlapping kmers receive consecutive indices → cache-friendly count access), but it is C++-only and covers more than just the MPHF layer. No established Rust crate provides a natively on-disk MPHF. **SSHash** (Sparse and Skew Hash) is a complete kmer dictionary designed for disk access and is order-preserving (overlapping kmers receive consecutive indices → cache-friendly count access), but it is C++-only and covers more than just the MPHF layer.
---
## Multilayer index architecture
### Motivation
An index built from a single dataset A can be extended with a new dataset B without rebuilding. This supports incremental construction (adding species, samples, or sequencing runs) and enables set operations across heterogeneous sources.
### Layer structure
Each layer is a self-contained unit:
```
layer_i/
unitigs.bin — packed 2-bit nucleotide sequences
mphf.bin — ptr_hash index (phase-2, exact key count)
evidence.bin — [(unitig_id, rank)] per MPHF slot (see unitig_evidence.md)
counts.bin — [u32] per MPHF slot
```
Layers are **disjoint**: a canonical kmer belongs to exactly one layer. Layer 0 is built from dataset A. Adding dataset B proceeds as follows:
1. For each kmer in B: query layer 0 — if found, accumulate count into `counts_0[MPHF_0(kmer)]`.
2. Collect all kmers of B not present in any existing layer → set `B \ A`.
3. Build layer 1 from `B \ A` using the standard two-phase pipeline (spectrum, filter, ptr_hash).
Adding a third dataset C repeats the process: probe layer 0, then layer 1, then build layer 2 from `C \ A \ B`.
### Membership verification
ptr_hash maps any input to a valid slot — it does not natively detect absent keys. Membership is verified using the evidence entry: decode the kmer from `(unitig_id, rank)` and compare to the query. A mismatch means the kmer is absent from this layer; probe the next layer.
This makes the evidence layer load-bearing for correctness, not only for locality.
### Query algorithm
```
fn query(kmer) → Option<count>:
for layer in layers:
slot = layer.mphf.query(kmer)
if layer.evidence.decode(slot) == kmer:
return Some(layer.counts[slot])
return None
```
Expected probe depth: 1 for kmers present in layer 0, increasing for rare kmers added in later layers. In practice, the dominant dataset (largest A) should be layer 0 to minimise average probe depth.
### Layer count and probe cost
Each probe is a ptr_hash lookup (~10 ns) plus one evidence decode (two array accesses). For L layers the worst case is L probes + 1 None. In practice L is small (25 for typical multi-species databases). No global data structure is needed to route queries; the layer chain is traversed in order.
### Merging layers
Two layer chains can be merged by re-indexing their union through the standard pipeline. This is expensive (full rebuild) but produces an optimal single-layer index. Merge is a maintenance operation, not a query-path requirement.
## Open questions ## Open questions
- Confirm actual partition sizes and overestimation factor on representative metagenomic datasets. - Confirm actual partition sizes and overestimation factor on representative metagenomic datasets.
- Revisit ptr_hash for phase 2 once the crate has broader production track record. - **rkyv integration**: all flat arrays in a layer (evidence, counts, presence/absence matrix) map trivially to `rkyv::Archive` — fixed-size element types, no heap indirection. The presence/absence matrix is the strongest case: at 10 M kmers × 1 000 samples ≈ 1.25 GB per partition, zero-copy mmap via rkyv avoids loading the entire matrix at open time, letting the OS page cache serve only accessed pages. ptr_hash itself is internally a flat bit array and is structurally compatible with rkyv, but requires either native crate support or a wrapper. Assess the wrapper cost and whether ptr_hash is willing to adopt rkyv upstream.
- Assess rkyv integration cost for FMPHGO if true zero-copy mmap becomes necessary for the persistent index.
- Keep SSHash in mind if the indexing architecture is reconsidered at a higher level. - Keep SSHash in mind if the indexing architecture is reconsidered at a higher level.
- Determine optimal layer ordering heuristic (by kmer count? by query frequency?) for multi-species databases.
+168
View File
@@ -0,0 +1,168 @@
# obilayeredmap — layered kmer index crate
## Purpose
`obilayeredmap` implements a persistent, incrementally extensible kmer index. The index is organised in three levels: **collection → partition → layer**. Each layer covers a disjoint kmer set (kmers absent from all earlier layers), wrapping a `ptr_hash` MPHF with associated per-slot data. Adding a new dataset never rebuilds existing layers.
---
## Three-level hierarchy
```
index_root/ ← LayeredMap (collection)
meta.json
part_00000/ ← Partition
layer_0/ ← Layer
mphf.bin
unitigs.bin
evidence.bin
counts.bin
presence.bin
layer_1/
...
part_00001/
layer_0/
layer_1/
...
```
**Collection** (`index_root/`): global metadata — kmer size k, number of partitions, layer count, sample registry.
**Partition** (`part_XXXXX/`): one directory per hash bucket. All kmers whose canonical minimiser hashes to bucket X land in `part_XXXXX`. Partitions are independent and can be processed in parallel. The partition count and routing scheme (minimiser → bucket) are fixed at collection creation and recorded in `meta.json`.
**Layer** (`layer_N/`): within a partition, a layer is the MPHF and its associated data for one dataset addition. Layer 0 is built from the first dataset A; layer 1 covers kmers in B not present in layer 0; and so on. Layers within a partition are disjoint: each kmer belongs to exactly one layer.
---
## Layer file layout
```
layer_N/
mphf.bin — ptr_hash MPHF (exact key count, phase-2 construction)
unitigs.bin — packed 2-bit nucleotide sequences (concatenated, variable-length)
unitig_offsets.bin — u32 per unitig: nucleotide offset of unitig j in unitigs.bin
evidence.bin — u32 per MPHF slot: (unitig_id: 25 | rank: 7)
counts.bin — u32 per MPHF slot (total kmer occurrences)
presence.bin — bit matrix: n_slots × n_samples [optional]
```
Unitigs have variable lengths. Each record in `unitigs.bin` is self-delimiting: it begins with a varint `seql` (sequence length in nucleotides) followed by `(seql+3)/4` packed bytes — the streaming format defined in `obiskio`. Sequential scan is always possible using the in-record `seql`.
For O(1) random access, `unitig_offsets.bin` is a **precomputed derived index**: a u32 array of byte offsets into `unitigs.bin`, with n_unitigs + 1 entries (sentinel = total byte size). Built once at construction by a single sequential scan; reconstructible from `unitigs.bin` if lost. Access: `unitigs.bin[offsets[j] .. offsets[j+1]]`.
All files except `mphf.bin` are flat arrays of fixed-size elements, serialised with **rkyv** for zero-copy mmap access. `mphf.bin` uses ptr_hash's native serialisation; rkyv integration is deferred (see open questions).
### Evidence encoding
Evidence maps each MPHF slot to its kmer's location in the unitig file. It serves two roles: membership verification (ptr_hash maps any input to a valid slot; decoding evidence and comparing to the query detects absent keys) and kmer reconstruction.
```
slot s → unitig_id: u25 | rank: u7
```
Packed into a `u32` (29 bits used, 3 spare). Decoding:
```
kmer = unitigs[unitig_id][rank .. rank + k] // 2-bit packed slice
```
`rank` is the kmer's 0-based index within the unitig (kmer units, not nucleotides). For k=31, m=11, the structural maximum is k m + 1 = 21 kmers per unitig; the empirical maximum observed is ~46 kmers. A `u7` (0127) is sufficient.
### Presence/absence matrix
Column-major bit matrix: column j (sample j) is a contiguous `n_slots`-bit array. This layout makes per-sample operations (union, intersection, diff over a column) cache-friendly. For large matrices (e.g. 10 M slots × 1 000 samples ≈ 1.25 GB per partition), rkyv + mmap avoids loading the full matrix at open time.
---
## Query path
A kmer query routes through all three levels:
1. **Partition routing**: hash canonical minimiser of the query kmer → partition index → open `part_XXXXX/`.
2. **Layer probing**: iterate layers in order within the partition; for each layer compute `slot = mphf.query(kmer)`, then verify `evidence.decode(slot) == kmer`. First match wins.
3. **Data access**: read `counts[slot]` and/or `presence[slot]` from the matching layer.
```
fn query(kmer) → Option<Hit>:
part = partition_of(kmer)
for (i, layer) in part.layers.iter().enumerate():
slot = layer.mphf.query(kmer)
if layer.evidence.decode(slot) == kmer:
return Some(Hit { layer: i, slot })
return None
```
Expected probe depth: 1 for kmers in layer 0, increasing for later layers. In practice the dominant dataset should be layer 0.
---
## Add-layer algorithm
When adding dataset B to an existing index:
1. For each partition, iterate kmers of B routed to that partition.
2. Probe existing layers; collect kmers absent from all layers → `B \ index`.
3. Build a new layer from `B \ index` using the two-phase pipeline (FMPHGO provisional → ptr_hash definitive).
4. Append the new layer directory under each `part_XXXXX/`.
5. Update `meta.json` (layer count, sample registry).
Each partition's new layer is built independently; the operation is fully parallel across partitions.
---
## Core API (sketch)
```rust
// Open an existing index
let map = LayeredMap::open(path)?;
// Query a canonical kmer across all partitions and layers
match map.query(kmer) {
Some(hit) => {
let count = hit.count();
let present = hit.presence_row(); // bit slice over samples
}
None => { /* absent */ }
}
// Non-destructive extension with a new dataset
// unitigs produced by the two-phase pipeline, one per partition
let layer_idx = map.add_layer(unitigs_dir, counts_dir, presence_path)?;
```
---
## Dependencies
| crate | role |
|---|---|
| `ptr_hash` | phase-2 MPHF per layer |
| `ph` (FMPHGO) | phase-1 provisional MPHF during layer construction |
| `rkyv` | zero-copy serialisation of flat arrays (evidence, counts, presence) |
| `memmap2` | mmap of layer files |
| `bitm` | bit-packed presence matrix |
---
## Serialisation strategy
All flat arrays use `rkyv::Archive`:
```rust
#[derive(Archive, Serialize, Deserialize)]
struct Evidence { slots: Vec<u32> } // packed (unitig_id: 25 | rank: 7)
#[derive(Archive, Serialize, Deserialize)]
struct Counts { data: Vec<u32> }
```
At open time, each file is mmapped and cast to its archived type — no allocation, no copy. The MPHF is loaded via ptr_hash's own API; a rkyv wrapper is a future refinement.
---
## Open questions
- **ptr_hash + rkyv**: ptr_hash's internals are flat bit arrays; a rkyv-compatible wrapper is structurally feasible. Assess upstream willingness or implement a thin newtype wrapper.
- **Presence matrix layout**: column-major favours per-sample operations; row-major favours per-kmer queries. Decide based on dominant access pattern.
- **Layer merge**: merging two `LayeredMap` instances into a single-layer index requires full rebuild. Define API and cost model; maintenance operation, not query-path.
- **Canonical kmer orientation**: evidence stores canonical kmer; strand recovery requires one 64-bit revcomp comparison at query time.
+3 -1
View File
@@ -69,7 +69,9 @@ Consequence for `u8` capacity:
| nucleotides | 255 nuc | 225 kmers | | nucleotides | 255 nuc | 225 kmers |
| **kmers** | **255 kmers** | **285 nuc** | | **kmers** | **255 kmers** | **285 nuc** |
On *Betula nana* (k=31, 256 partitions), m_u ≈ 37.9 kmers/unitig on average; no unitig length distribution data measured yet. The `rank` field (kmer index within the unitig) fits in a `u8` as long as no unitig exceeds 255 kmers — guaranteed by the split strategy below. **Structural maximum from superkmer construction.** For k=31 and m=11, the maximum number of consecutive kmers sharing the same minimiser is k m + 1 = **21 kmers** (the minimiser traverses from position km to 0 as the window slides). A unitig that is a single full superkmer therefore has exactly 21 kmers. This is confirmed by a bimodal distribution in empirical data: a sharp peak at 21 kmers appears in all partitions, including the anomalous partition 145. The observed maximum is ~46 kmers (unitigs spanning more than one superkmer), well within u8 range.
On *Betula nana* (k=31, 256 partitions), m_u ≈ 37.9 kmers/unitig on average. The `rank` field (kmer index within the unitig) fits in a `u8` as long as no unitig exceeds 255 kmers — guaranteed by the split strategy below and amply satisfied by empirical maximums (~46 kmers observed).
### Split strategy for long unitigs ### Split strategy for long unitigs
+1
View File
@@ -44,6 +44,7 @@ nav:
- On-disk storage: implementation/storage.md - On-disk storage: implementation/storage.md
- MPHF selection: implementation/mphf.md - MPHF selection: implementation/mphf.md
- Unitig evidence encoding: implementation/unitig_evidence.md - Unitig evidence encoding: implementation/unitig_evidence.md
- obilayeredmap crate: implementation/obilayeredmap.md
- Architecture: - Architecture:
- Sequences: architecture/sequences/invariant.md - Sequences: architecture/sequences/invariant.md
+10 -1
View File
@@ -75,7 +75,12 @@ def main():
parser.add_argument("file_a", help="First FASTA file (reference)") parser.add_argument("file_a", help="First FASTA file (reference)")
parser.add_argument("file_b", help="Second FASTA file (to compare)") parser.add_argument("file_b", help="Second FASTA file (to compare)")
parser.add_argument( parser.add_argument(
"-k", "--kmer-size", type=int, default=31, metavar="K", help="k-mer size (default: 31)" "-k",
"--kmer-size",
type=int,
default=31,
metavar="K",
help="k-mer size (default: 31)",
) )
args = parser.parse_args() args = parser.parse_args()
@@ -104,6 +109,10 @@ def main():
if only_a or only_b: if only_a or only_b:
print("\nSets differ.", file=sys.stderr) print("\nSets differ.", file=sys.stderr)
if len(only_a) > 0 and len(only_b) <= 10:
print(f"\nOnly in A: {only_a}")
if len(only_b) > 0 and len(only_b) <= 10:
print(f"\nOnly in B: {only_b}")
sys.exit(1) sys.exit(1)
else: else:
print("\nSets are identical.") print("\nSets are identical.")
+5
View File
@@ -1615,7 +1615,10 @@ version = "0.1.0"
dependencies = [ dependencies = [
"memmap2", "memmap2",
"niffler 3.0.0", "niffler 3.0.0",
"obikrope",
"obikseq", "obikseq",
"obiread",
"obiskbuilder",
"obiskio", "obiskio",
"ph", "ph",
"rayon", "rayon",
@@ -1623,6 +1626,7 @@ dependencies = [
"serde", "serde",
"serde_json", "serde_json",
"sysinfo 0.33.1", "sysinfo 0.33.1",
"tempfile",
"tracing", "tracing",
] ]
@@ -1679,6 +1683,7 @@ name = "obiskio"
version = "0.1.0" version = "0.1.0"
dependencies = [ dependencies = [
"lru", "lru",
"memmap2",
"niffler 3.0.0", "niffler 3.0.0",
"obikseq", "obikseq",
"rustix", "rustix",
+7
View File
@@ -3,6 +3,13 @@ name = "obikpartitionner"
version = "0.1.0" version = "0.1.0"
edition = "2024" edition = "2024"
[dev-dependencies]
tempfile = "3"
obikseq = { path = "../obikseq", features = ["test-utils"] }
obiskbuilder = { path = "../obiskbuilder" }
obiread = { path = "../obiread" }
obikrope = { path = "../obikrope" }
[dependencies] [dependencies]
niffler = "3.0.0" niffler = "3.0.0"
remove_dir_all = "0.8" remove_dir_all = "0.8"
+116
View File
@@ -616,3 +616,119 @@ impl Drop for KmerPartition {
let _ = self.close(); let _ = self.close();
} }
} }
// ── integration tests ─────────────────────────────────────────────────────────
#[cfg(test)]
mod tests {
use super::*;
use std::collections::HashMap;
use obikrope::Rope;
use obikseq::SuperKmer;
use obiskbuilder::build_superkmers;
const K: usize = 11;
const M: usize = 5;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(M);
}
/// Direct canonical k-mer counts from ASCII sequences — ground truth.
fn direct_counts(seqs: &[&[u8]]) -> (u64, u64) {
let mut counts: HashMap<Vec<u8>, u64> = HashMap::new();
for seq in seqs {
for i in 0..seq.len().saturating_sub(K - 1) {
let km = SuperKmer::from_ascii(&seq[i..i + K]).to_ascii();
*counts.entry(km).or_insert(0) += 1;
}
}
let f0 = counts.len() as u64;
let f1: u64 = counts.values().sum();
(f0, f1)
}
/// Run the full pipeline on a list of sequences and return (f0, f1) from
/// the `kmer_spectrum_raw.json` produced by `count_partition`.
fn pipeline_counts(seqs: &[&[u8]]) -> (u64, u64) {
setup();
let mut rope_data: Vec<u8> = Vec::new();
for seq in seqs {
rope_data.extend_from_slice(seq);
rope_data.push(0x00);
}
let mut rope = Rope::new(None);
rope.push(rope_data);
let superkmers: Vec<_> = build_superkmers(rope, K, 1, 0.0);
let dir = tempfile::tempdir().unwrap();
let mut kp = KmerPartition::create(dir.path(), 0, K, M, true).unwrap();
kp.write_batch(superkmers).unwrap();
kp.close().unwrap();
kp.dereplicate().unwrap();
let part_dir = dir.path().join("part_00000");
let dedup_path = part_dir.join("dereplicated.skmer.zst");
if !dedup_path.exists() {
return (0, 0);
}
count_partition(&part_dir, &dedup_path, K).unwrap();
let spec: serde_json::Value = serde_json::from_reader(
fs::File::open(part_dir.join("kmer_spectrum_raw.json")).unwrap(),
).unwrap();
let f0 = spec["f0"].as_u64().unwrap_or(0);
let f1 = spec["f1"].as_u64().unwrap_or(0);
(f0, f1)
}
#[test]
fn single_sequence_f0_f1_match() {
let seqs: &[&[u8]] = &[b"ACGTACGTACGTACGTACGT"];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn two_sequences_f0_f1_match() {
let seqs: &[&[u8]] = &[
b"ACGTACGTACGTACGTACGT",
b"TGCATGCATGCATGCATGCA",
];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn repeated_sequence_f1_doubles() {
let seq = b"ACGTACGTACGTACGTACGT";
let seqs: &[&[u8]] = &[seq, seq];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn many_sequences_f0_f1_match() {
// 20 distinct sequences of length 40 — forces multiple super-kmers and
// multiple minimizer boundaries per sequence.
let bases = b"ACGT";
let seqs: Vec<Vec<u8>> = (0..20u32)
.map(|i| (0..40).map(|j| bases[((i * 7 + j * 3) % 4) as usize]).collect())
.collect();
let seq_refs: Vec<&[u8]> = seqs.iter().map(|v| v.as_slice()).collect();
let (ef0, ef1) = direct_counts(&seq_refs);
let (gf0, gf1) = pipeline_counts(&seq_refs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
}
+1
View File
@@ -21,6 +21,7 @@ pub mod unitig;
pub use annotations::Annotation; pub use annotations::Annotation;
pub use kmer::{CanonicalKmer, Kmer, Minimizer, hash_kmer}; pub use kmer::{CanonicalKmer, Kmer, Minimizer, hash_kmer};
pub use packed_seq::MAX_KMERS_PER_CHUNK;
pub use params::{k, m, set_k, set_m}; pub use params::{k, m, set_k, set_m};
pub use routable::RoutableSuperKmer; pub use routable::RoutableSuperKmer;
pub use sequence::Sequence; pub use sequence::Sequence;
+26 -9
View File
@@ -22,6 +22,9 @@ use crate::kmer::{CanonicalKmer, Kmer, KmerError, KLen, KmerLength, KmerOf, MLen
use crate::params::k; use crate::params::k;
use crate::revcomp_lookup::REVCOMP4; use crate::revcomp_lookup::REVCOMP4;
/// Maximum kmers per stored chunk. Enforces the u8 max-kmer-index field in the binary format.
pub const MAX_KMERS_PER_CHUNK: usize = 256;
// ── PackedSeq ───────────────────────────────────────────────────────────────── // ── PackedSeq ─────────────────────────────────────────────────────────────────
/// 2-bit packed DNA sequence of arbitrary length ≥ 1. /// 2-bit packed DNA sequence of arbitrary length ≥ 1.
@@ -229,22 +232,36 @@ impl PackedSeq {
self.iter_kmers().map(|km| km.canonical()) self.iter_kmers().map(|km| km.canonical())
} }
/// Serialise to a compact binary representation. /// Extract nucleotides `[start, end)` as a new [`PackedSeq`]. Allocates.
pub fn sub(&self, start: usize, end: usize) -> Self {
debug_assert!(end > start && end <= self.seql());
let nucs: Vec<u8> = (start..end).map(|i| self.nucleotide(i)).collect();
Self::from_nucleotides(&nucs)
}
/// Serialise one chunk to binary.
/// ///
/// Format: varint(seql) followed by raw packed bytes. /// Format: `[u8: n_kmers1][packed bytes]`.
/// `tail` and `byte_len` are both derivable from `seql` and need not be stored. /// The caller must ensure `seql ≥ k` and `seql k + 1 ≤ MAX_KMERS_PER_CHUNK`.
/// Use [`SuperKmer::write_to_binary`] for sequences that may exceed one chunk.
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> { pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
write_varint(w, self.seql() as u64)?; let k = crate::params::k();
let seql = self.seql();
debug_assert!(seql >= k, "sequence shorter than k");
debug_assert!(
seql - k + 1 <= MAX_KMERS_PER_CHUNK,
"chunk exceeds MAX_KMERS_PER_CHUNK; split before calling write_to_binary"
);
w.write_all(&[(seql - k) as u8])?;
w.write_all(&self.seq) w.write_all(&self.seq)
} }
/// Deserialise from the compact binary format produced by [`write_to_binary`]. /// Deserialise one chunk from the binary format produced by [`write_to_binary`].
/// Allocates exactly one `Box<[u8]>` for the packed bytes. /// Allocates exactly one `Box<[u8]>` for the packed bytes.
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> { pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
let seql = read_varint(r)? as usize; let mut buf = [0u8; 1];
if seql == 0 { r.read_exact(&mut buf)?;
return Err(io::Error::new(io::ErrorKind::InvalidData, "empty sequence")); let seql = buf[0] as usize + crate::params::k();
}
let byte_len = (seql + 3) / 4; let byte_len = (seql + 3) / 4;
let tail = (seql % 4) as u8; let tail = (seql % 4) as u8;
let mut seq = vec![0u8; byte_len]; let mut seq = vec![0u8; byte_len];
+29 -5
View File
@@ -12,7 +12,7 @@ use xxhash_rust::xxh3::xxh3_64;
use crate::Annotation; use crate::Annotation;
use crate::Sequence; use crate::Sequence;
use crate::kmer::{CanonicalKmer, Kmer, KmerError}; use crate::kmer::{CanonicalKmer, Kmer, KmerError};
use crate::packed_seq::{PackedSeq, read_varint, write_varint}; use crate::packed_seq::{MAX_KMERS_PER_CHUNK, PackedSeq, read_varint, write_varint};
// ── SKAnnotation ────────────────────────────────────────────────────────────── // ── SKAnnotation ──────────────────────────────────────────────────────────────
@@ -91,13 +91,37 @@ impl SuperKmer {
Self { count: 1, inner } Self { count: 1, inner }
} }
/// Serialise to compact binary. Format: varint(count) + varint((byte_len << 2) | tail) + bytes. /// Serialise to compact binary: `[varint(count)][u8: n_kmers1][packed bytes]` per chunk.
///
/// Sequences with more than [`MAX_KMERS_PER_CHUNK`] kmers are transparently split into
/// overlapping chunks (k1 nucleotide overlap, same count per chunk). Each chunk is an
/// independent, self-contained record — one [`read_from_binary`] call reads exactly one.
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> { pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
write_varint(w, self.count as u64)?; let k = crate::params::k();
self.inner.write_to_binary(w) let seql = self.seql();
debug_assert!(seql >= k, "super-kmer shorter than k");
let n_kmers = seql - k + 1;
if n_kmers <= MAX_KMERS_PER_CHUNK {
write_varint(w, self.count as u64)?;
self.inner.write_to_binary(w)
} else {
let chunk_nucl = MAX_KMERS_PER_CHUNK + k - 1;
let stride = MAX_KMERS_PER_CHUNK;
let mut start = 0;
loop {
let end = (start + chunk_nucl).min(seql);
let mut chunk = self.inner.sub(start, end);
chunk.canonicalize();
write_varint(w, self.count as u64)?;
chunk.write_to_binary(w)?;
if end == seql { break; }
start += stride;
}
Ok(())
}
} }
/// Deserialise from the binary format produced by [`write_to_binary`]. /// Deserialise one chunk from the binary format produced by [`write_to_binary`].
/// Allocates exactly one `Box<[u8]>` for the packed bytes. /// Allocates exactly one `Box<[u8]>` for the packed bytes.
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> { pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
let count = read_varint(r)? as u32; let count = read_varint(r)? as u32;
+39 -8
View File
@@ -67,27 +67,57 @@ fn seql_roundtrip() {
// ── binary serialisation ────────────────────────────────────────────────────── // ── binary serialisation ──────────────────────────────────────────────────────
fn binary_test_lengths(k: usize) -> Vec<usize> {
use crate::packed_seq::MAX_KMERS_PER_CHUNK;
// Only single-chunk lengths: seql in [k, MAX_KMERS_PER_CHUNK+k-1].
(k..=k + 5).chain([255, 256, 257, MAX_KMERS_PER_CHUNK + k - 1]).collect()
}
#[test] #[test]
fn binary_roundtrip() { fn binary_roundtrip() {
for len in all_lengths() { set_k(4);
let k = crate::params::k();
for len in binary_test_lengths(k) {
let mut sk = SuperKmer::from_ascii(&make_seq(len)); let mut sk = SuperKmer::from_ascii(&make_seq(len));
sk.set_count(42); sk.set_count(42);
let mut buf = Vec::new(); let mut buf = Vec::new();
sk.write_to_binary(&mut buf).unwrap(); sk.write_to_binary(&mut buf).unwrap();
let sk2 = SuperKmer::read_from_binary(&mut buf.as_slice()).unwrap(); let sk2 = SuperKmer::read_from_binary(&mut buf.as_slice()).unwrap();
assert_eq!( assert_eq!(sk.to_ascii(), sk2.to_ascii(), "sequence mismatch for len={len}");
sk.to_ascii(),
sk2.to_ascii(),
"sequence mismatch for len={len}"
);
assert_eq!(sk2.count(), 42, "count mismatch for len={len}"); assert_eq!(sk2.count(), 42, "count mismatch for len={len}");
} }
} }
#[test]
fn binary_split_roundtrip() {
// A super-kmer > MAX_KMERS_PER_CHUNK kmers is split into multiple records on write.
use crate::packed_seq::MAX_KMERS_PER_CHUNK;
set_k(4);
let k = crate::params::k();
// seql = MAX_KMERS_PER_CHUNK + k = 260 → n_kmers = 257 > 256 → 2 chunks
let seql = MAX_KMERS_PER_CHUNK + k;
let mut sk = SuperKmer::from_ascii(&make_seq(seql));
sk.set_count(7);
let mut buf = Vec::new();
sk.write_to_binary(&mut buf).unwrap();
// Read all records back.
let mut slice = buf.as_slice();
let chunk0 = SuperKmer::read_from_binary(&mut slice).unwrap();
let chunk1 = SuperKmer::read_from_binary(&mut slice).unwrap();
assert!(slice.is_empty(), "unexpected trailing bytes");
assert_eq!(chunk0.count(), 7);
assert_eq!(chunk1.count(), 7);
// Chunks cover the original sequence with k-1 overlap — no kmer lost.
assert_eq!(chunk0.seql(), MAX_KMERS_PER_CHUNK + k - 1); // 259
assert_eq!(chunk1.seql(), k); // 4 (1 kmer)
}
#[test] #[test]
fn binary_packed_seq_roundtrip() { fn binary_packed_seq_roundtrip() {
use crate::packed_seq::PackedSeq; use crate::packed_seq::PackedSeq;
for len in all_lengths() { set_k(4);
let k = crate::params::k();
for len in binary_test_lengths(k) {
let ps = PackedSeq::from_ascii(&make_seq(len)); let ps = PackedSeq::from_ascii(&make_seq(len));
let mut buf = Vec::new(); let mut buf = Vec::new();
ps.write_to_binary(&mut buf).unwrap(); ps.write_to_binary(&mut buf).unwrap();
@@ -98,7 +128,8 @@ fn binary_packed_seq_roundtrip() {
#[test] #[test]
fn binary_size_is_compact() { fn binary_size_is_compact() {
// seql=4 (1 byte packed): varint(count=1, 1 byte) + varint((1<<2)|0=4, 1 byte) + 1 byte = 3 bytes // ACGT with k=4: varint(count=1, 1 byte) + u8(n_kmers-1=0, 1 byte) + 1 packed byte = 3 bytes
set_k(4);
let sk = SuperKmer::from_ascii(b"ACGT"); let sk = SuperKmer::from_ascii(b"ACGT");
let mut buf = Vec::new(); let mut buf = Vec::new();
sk.write_to_binary(&mut buf).unwrap(); sk.write_to_binary(&mut buf).unwrap();
+6 -1
View File
@@ -160,7 +160,12 @@ mod tests {
#[test] #[test]
fn binary_roundtrip_all_lengths() { fn binary_roundtrip_all_lengths() {
for len in test_lengths() { // write_to_binary encodes a single chunk: seql must be in [k, MAX_KMERS_PER_CHUNK+k-1].
use crate::packed_seq::MAX_KMERS_PER_CHUNK;
set_k(4);
let k = crate::params::k();
let valid_lengths: Vec<usize> = (k..=9).chain([255, 256, 257, MAX_KMERS_PER_CHUNK + k - 1]).collect();
for len in valid_lengths {
let u = Unitig::from_ascii(&make_seq(len)); let u = Unitig::from_ascii(&make_seq(len));
let mut buf = Vec::new(); let mut buf = Vec::new();
u.write_to_binary(&mut buf).unwrap(); u.write_to_binary(&mut buf).unwrap();
+65 -1
View File
@@ -96,7 +96,7 @@ impl Iterator for SuperKmerIter<'_> {
} }
// ── 1. Entropy check ───────────────────────────────────────────── // ── 1. Entropy check ─────────────────────────────────────────────
if self.stat.normalized_entropy().unwrap_or(1.0) <= self.theta { if self.stat.normalized_entropy().unwrap_or(1.0) < self.theta {
let result = self.try_emit(); let result = self.try_emit();
self.cursor.rewind(self.k - 1).ok(); self.cursor.rewind(self.k - 1).ok();
self.reset(); self.reset();
@@ -168,6 +168,70 @@ mod tests {
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31]) // k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11; const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test] #[test]
fn single_segment_one_superkmer() { fn single_segment_one_superkmer() {
setup(); setup();
+1
View File
@@ -10,6 +10,7 @@ lru = "0.12"
serde = { version = "1", features = ["derive"] } serde = { version = "1", features = ["derive"] }
serde_json = "1" serde_json = "1"
memmap2 = "0.9"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
[dev-dependencies] [dev-dependencies]
+2 -60
View File
@@ -17,63 +17,5 @@ pub(crate) fn read_superkmer<R: Read>(r: &mut R) -> io::Result<Option<SuperKmer>
} }
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/codec.rs"]
use super::*; mod tests;
use std::io::Cursor;
fn make_sk(ascii: &[u8]) -> SuperKmer {
SuperKmer::from_ascii(ascii)
}
#[test]
fn roundtrip_single() {
let sk = make_sk(b"ACGTACGT");
let mut buf = Vec::new();
write_superkmer(&mut buf, &sk).unwrap();
let mut cur = Cursor::new(&buf);
let got = read_superkmer(&mut cur).unwrap().unwrap();
assert_eq!(sk.to_ascii(), got.to_ascii());
assert_eq!(sk.seql(), got.seql());
}
#[test]
fn roundtrip_all_lengths() {
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
let k = 11;
for len in (k..=k + 8).chain([255, 256, 257]) {
let sk = make_sk(&bases[..len]);
let mut buf = Vec::new();
write_superkmer(&mut buf, &sk).unwrap();
let mut cur = Cursor::new(&buf);
let got = read_superkmer(&mut cur).unwrap().unwrap();
assert_eq!(sk.to_ascii(), got.to_ascii(), "len={len}");
assert_eq!(sk.seql(), got.seql(), "len={len}");
}
}
#[test]
fn eof_returns_none() {
let buf: Vec<u8> = vec![];
let mut cur = Cursor::new(&buf);
assert!(read_superkmer(&mut cur).unwrap().is_none());
}
#[test]
fn multiple_records() {
let seqs: &[&[u8]] = &[b"AAAA", b"CCCC", b"GGGG", b"TTTT"];
let mut buf = Vec::new();
for s in seqs {
write_superkmer(&mut buf, &make_sk(s)).unwrap();
}
let mut cur = Cursor::new(&buf);
for s in seqs {
let got = read_superkmer(&mut cur).unwrap().unwrap();
let expected = make_sk(s);
assert_eq!(expected.to_ascii(), got.to_ascii());
}
assert!(read_superkmer(&mut cur).unwrap().is_none());
}
}
+2
View File
@@ -4,8 +4,10 @@ pub mod limits;
pub mod meta; pub mod meta;
pub mod pool; pub mod pool;
pub mod reader; pub mod reader;
pub mod unitig_index;
pub use error::{SKError, SKResult}; pub use error::{SKError, SKResult};
pub use meta::SKFileMeta; pub use meta::SKFileMeta;
pub use pool::{create_token, create_token_with, SKFilePool, SharedPool, SKFileWriter}; pub use pool::{create_token, create_token_with, SKFilePool, SharedPool, SKFileWriter};
pub use reader::{SKFileIter, SKFileReader}; pub use reader::{SKFileIter, SKFileReader};
pub use unitig_index::{UnitigFileReader, UnitigFileWriter};
+2 -226
View File
@@ -428,229 +428,5 @@ impl Drop for SKFileWriter {
// ── tests ────────────────────────────────────────────────────────────────────── // ── tests ──────────────────────────────────────────────────────────────────────
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/pool.rs"]
use super::*; mod tests;
use crate::reader::SKFileReader;
use obikseq::{SuperKmer, set_k};
use tempfile::{NamedTempFile, TempDir};
const TEST_K: usize = 4;
fn make_sk(seed: usize) -> SuperKmer {
let bases: Vec<u8> = (0..8).map(|j| b"ACGT"[(seed + j) % 4]).collect();
SuperKmer::from_ascii(&bases)
}
fn pool(max_open: usize) -> SharedPool {
Arc::new(Mutex::new(SKFilePool::new(max_open)))
}
fn open_token(t: &mut SKFileWriter, sk: &SuperKmer) {
t.set_flush_threshold(1);
t.write(sk).unwrap(); // pending ≥ 1 → drain → fd opened
}
#[test]
fn creation_holds_no_fd() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(3);
for i in 0..10 {
create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap();
}
assert_eq!(p.lock().unwrap().open_count(), 0);
}
#[test]
fn pool_limits_open_fds() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(3);
let sk = make_sk(0);
let mut tokens: Vec<SKFileWriter> = (0..6)
.map(|i| create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap())
.collect();
for t in tokens.iter_mut() {
open_token(t, &sk);
}
assert!(
p.lock().unwrap().open_count() <= 3,
"open={}",
p.lock().unwrap().open_count()
);
}
#[test]
fn evicted_token_stays_logically_open() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(1);
let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
open_token(&mut t0, &sk); // t0 fd open, pool full
open_token(&mut t1, &sk); // evicts t0, t1 fd open
assert!(t0.is_open(), "t0 must remain logically open after eviction");
assert_eq!(p.lock().unwrap().open_count(), 1);
}
#[test]
fn evicted_data_readable_after_close_all() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(1);
let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
t0.set_flush_threshold(1);
t0.write(&sk).unwrap(); // t0 fd open, pool full
t1.set_flush_threshold(1);
t1.write(&sk).unwrap(); // evicts t0, t1 fd open
// t0 still has the record in pending (eviction just closed fd, pending stays in token)
// Actually: t0's pending was drained before drain() returned (drain clears pending).
// So t0 wrote its record, then was evicted (fd closed).
drop(t0);
drop(t1);
p.lock().unwrap().close_all().unwrap();
for name in &["a.zst", "b.zst"] {
let mut r = SKFileReader::open(dir.path().join(name)).unwrap();
let got = r.read_batch(10).unwrap();
assert_eq!(got.len(), 1, "{name}: expected 1 record");
}
}
#[test]
fn touch_moves_to_mru_so_lru_is_evicted() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(2);
let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
let mut t2 = create_token(&p, dir.path().join("c.zst")).unwrap();
open_token(&mut t0, &sk); // t0 open
open_token(&mut t1, &sk); // t1 open, t0 LRU
// Write to t0 again → t0 becomes MRU, t1 becomes LRU
t0.set_flush_threshold(1);
t0.write(&sk).unwrap();
// Writing to t2 fills pool (cap=2) → evicts LRU = t1
open_token(&mut t2, &sk);
let open_count = p.lock().unwrap().open_count();
assert!(open_count <= 2, "open_count={open_count}");
}
#[test]
fn close_all_produces_readable_files() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(8);
let paths: Vec<_> = (0..4)
.map(|i| dir.path().join(format!("{i}.zst")))
.collect();
let mut tokens: Vec<SKFileWriter> = paths
.iter()
.map(|path| create_token(&p, path.clone()).unwrap())
.collect();
for (i, t) in tokens.iter_mut().enumerate() {
t.write(&make_sk(i)).unwrap();
}
// close tokens first so pending bytes are flushed and Zstd frames finalized
for t in tokens.iter_mut() {
t.close().unwrap();
}
p.lock().unwrap().close_all().unwrap();
for path in &paths {
let mut r = SKFileReader::open(path).unwrap();
let got = r.read_batch(10).unwrap();
assert_eq!(got.len(), 1);
}
}
#[test]
fn write_batch_roundtrip() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(4);
let sks: Vec<_> = (0..50).map(make_sk).collect();
let path = dir.path().join("batch.zst");
let mut t = create_token(&p, path.clone()).unwrap();
t.write_batch(&sks).unwrap();
t.close().unwrap();
let mut r = SKFileReader::open(&path).unwrap();
let got = r.read_batch(100).unwrap();
assert_eq!(got.len(), 50);
for (a, b) in sks.iter().zip(got.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
}
#[test]
fn from_system_limits_bounded() {
set_k(TEST_K);
let pool = SKFilePool::from_system_limits();
assert!(pool.max_open() >= 16);
assert!(pool.max_open() <= MAX_POOL_SIZE);
}
#[test]
fn standalone_roundtrip_zstd() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap();
let sks: Vec<_> = (0..100).map(make_sk).collect();
{
let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap();
w.close().unwrap();
}
let mut r = SKFileReader::open(tmp.path()).unwrap();
let got = r.read_batch(200).unwrap();
assert_eq!(got.len(), 100);
for (a, b) in sks.iter().zip(got.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
}
#[test]
fn standalone_close_prevents_write() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap();
let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.close().unwrap();
assert!(!w.is_open());
assert!(w.write(&make_sk(0)).is_err());
}
#[test]
fn standalone_is_physically_open() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap();
let mut w = SKFileWriter::create(tmp.path()).unwrap();
assert!(!w.is_physically_open()); // fd deferred until first drain
w.set_flush_threshold(1);
w.write(&make_sk(0)).unwrap(); // triggers drain → fd opened
assert!(w.is_physically_open());
w.close().unwrap();
assert!(!w.is_physically_open());
}
}
+2 -67
View File
@@ -143,70 +143,5 @@ impl Iterator for SKFileIter<'_> {
} }
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/reader.rs"]
use super::*; mod tests;
use crate::pool::SKFileWriter;
use tempfile::NamedTempFile;
const TEST_K: usize = 4; // test sequences are 8 bases; k=4 gives n_kmers=5
fn setup() {
obikseq::params::set_k(TEST_K);
}
fn make_sks(n: usize) -> Vec<SuperKmer> {
(0..n)
.map(|i| {
let bases: Vec<u8> = (0..8).map(|j| b"ACGT"[(i + j) % 4]).collect();
SuperKmer::from_ascii(&bases)
})
.collect()
}
#[test]
fn iter_all() {
setup();
let tmp = NamedTempFile::new().unwrap();
let sks = make_sks(50);
{
let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap();
}
let mut r = SKFileReader::open(tmp.path()).unwrap();
let got: Vec<_> = r.iter().collect();
assert_eq!(got.len(), 50);
for (a, b) in sks.iter().zip(got.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
}
#[test]
fn reopen_and_seek() {
setup();
let tmp = NamedTempFile::new().unwrap();
let sks = make_sks(20);
{
let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap();
}
let mut r = SKFileReader::open(tmp.path()).unwrap();
// Read 10, then simulate pool eviction + re-access
let first = r.read_batch(10).unwrap();
r.close();
r.reopen_and_seek().unwrap();
// Continue from position 10
let rest = r.read_batch(20).unwrap();
assert_eq!(first.len(), 10);
assert_eq!(rest.len(), 10);
for (a, b) in sks[..10].iter().zip(first.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
for (a, b) in sks[10..].iter().zip(rest.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
}
}
+64
View File
@@ -0,0 +1,64 @@
use super::*;
use obikseq::set_k;
use std::io::Cursor;
fn make_sk(ascii: &[u8]) -> SuperKmer {
SuperKmer::from_ascii(ascii)
}
#[test]
fn roundtrip_single() {
set_k(4);
let sk = make_sk(b"ACGTACGT");
let mut buf = Vec::new();
write_superkmer(&mut buf, &sk).unwrap();
let mut cur = Cursor::new(&buf);
let got = read_superkmer(&mut cur).unwrap().unwrap();
assert_eq!(sk.to_ascii(), got.to_ascii());
assert_eq!(sk.seql(), got.seql());
}
#[test]
fn roundtrip_all_lengths() {
set_k(11);
let k: usize = 11;
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
// With k=11, seql=257 → n_kmers=247 ≤ 256: single chunk, no split.
for len in (k..=k + 8).chain([255, 256, 257]) {
let sk = make_sk(&bases[..len]);
let mut buf = Vec::new();
write_superkmer(&mut buf, &sk).unwrap();
let mut cur = Cursor::new(&buf);
let got = read_superkmer(&mut cur).unwrap().unwrap();
assert_eq!(sk.to_ascii(), got.to_ascii(), "len={len}");
assert_eq!(sk.seql(), got.seql(), "len={len}");
}
}
#[test]
fn eof_returns_none() {
set_k(4);
let buf: Vec<u8> = vec![];
let mut cur = Cursor::new(&buf);
assert!(read_superkmer(&mut cur).unwrap().is_none());
}
#[test]
fn multiple_records() {
set_k(4);
let seqs: &[&[u8]] = &[b"AAAA", b"CCCC", b"GGGG", b"TTTT"];
let mut buf = Vec::new();
for s in seqs {
write_superkmer(&mut buf, &make_sk(s)).unwrap();
}
let mut cur = Cursor::new(&buf);
for s in seqs {
let got = read_superkmer(&mut cur).unwrap().unwrap();
let expected = make_sk(s);
assert_eq!(expected.to_ascii(), got.to_ascii());
}
assert!(read_superkmer(&mut cur).unwrap().is_none());
}
+217
View File
@@ -0,0 +1,217 @@
use super::*;
use crate::reader::SKFileReader;
use obikseq::{SuperKmer, set_k};
use tempfile::{NamedTempFile, TempDir};
const TEST_K: usize = 4;
fn make_sk(seed: usize) -> SuperKmer {
let bases: Vec<u8> = (0..8).map(|j| b"ACGT"[(seed + j) % 4]).collect();
SuperKmer::from_ascii(&bases)
}
fn pool(max_open: usize) -> SharedPool {
Arc::new(Mutex::new(SKFilePool::new(max_open)))
}
fn open_token(t: &mut SKFileWriter, sk: &SuperKmer) {
t.set_flush_threshold(1);
t.write(sk).unwrap();
}
#[test]
fn creation_holds_no_fd() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(3);
for i in 0..10 {
create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap();
}
assert_eq!(p.lock().unwrap().open_count(), 0);
}
#[test]
fn pool_limits_open_fds() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(3);
let sk = make_sk(0);
let mut tokens: Vec<SKFileWriter> = (0..6)
.map(|i| create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap())
.collect();
for t in tokens.iter_mut() {
open_token(t, &sk);
}
assert!(
p.lock().unwrap().open_count() <= 3,
"open={}",
p.lock().unwrap().open_count()
);
}
#[test]
fn evicted_token_stays_logically_open() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(1);
let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
open_token(&mut t0, &sk);
open_token(&mut t1, &sk);
assert!(t0.is_open(), "t0 must remain logically open after eviction");
assert_eq!(p.lock().unwrap().open_count(), 1);
}
#[test]
fn evicted_data_readable_after_close_all() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(1);
let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
t0.set_flush_threshold(1);
t0.write(&sk).unwrap();
t1.set_flush_threshold(1);
t1.write(&sk).unwrap();
drop(t0);
drop(t1);
p.lock().unwrap().close_all().unwrap();
for name in &["a.zst", "b.zst"] {
let mut r = SKFileReader::open(dir.path().join(name)).unwrap();
let got = r.read_batch(10).unwrap();
assert_eq!(got.len(), 1, "{name}: expected 1 record");
}
}
#[test]
fn touch_moves_to_mru_so_lru_is_evicted() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(2);
let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
let mut t2 = create_token(&p, dir.path().join("c.zst")).unwrap();
open_token(&mut t0, &sk);
open_token(&mut t1, &sk);
t0.set_flush_threshold(1);
t0.write(&sk).unwrap();
open_token(&mut t2, &sk);
let open_count = p.lock().unwrap().open_count();
assert!(open_count <= 2, "open_count={open_count}");
}
#[test]
fn close_all_produces_readable_files() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(8);
let paths: Vec<_> = (0..4)
.map(|i| dir.path().join(format!("{i}.zst")))
.collect();
let mut tokens: Vec<SKFileWriter> = paths
.iter()
.map(|path| create_token(&p, path.clone()).unwrap())
.collect();
for (i, t) in tokens.iter_mut().enumerate() {
t.write(&make_sk(i)).unwrap();
}
for t in tokens.iter_mut() {
t.close().unwrap();
}
p.lock().unwrap().close_all().unwrap();
for path in &paths {
let mut r = SKFileReader::open(path).unwrap();
let got = r.read_batch(10).unwrap();
assert_eq!(got.len(), 1);
}
}
#[test]
fn write_batch_roundtrip() {
set_k(TEST_K);
let dir = TempDir::new().unwrap();
let p = pool(4);
let sks: Vec<_> = (0..50).map(make_sk).collect();
let path = dir.path().join("batch.zst");
let mut t = create_token(&p, path.clone()).unwrap();
t.write_batch(&sks).unwrap();
t.close().unwrap();
let mut r = SKFileReader::open(&path).unwrap();
let got = r.read_batch(100).unwrap();
assert_eq!(got.len(), 50);
for (a, b) in sks.iter().zip(got.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
}
#[test]
fn from_system_limits_bounded() {
set_k(TEST_K);
let pool = SKFilePool::from_system_limits();
assert!(pool.max_open() >= 16);
assert!(pool.max_open() <= MAX_POOL_SIZE);
}
#[test]
fn standalone_roundtrip_zstd() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap();
let sks: Vec<_> = (0..100).map(make_sk).collect();
{
let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap();
w.close().unwrap();
}
let mut r = SKFileReader::open(tmp.path()).unwrap();
let got = r.read_batch(200).unwrap();
assert_eq!(got.len(), 100);
for (a, b) in sks.iter().zip(got.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
}
#[test]
fn standalone_close_prevents_write() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap();
let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.close().unwrap();
assert!(!w.is_open());
assert!(w.write(&make_sk(0)).is_err());
}
#[test]
fn standalone_is_physically_open() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap();
let mut w = SKFileWriter::create(tmp.path()).unwrap();
assert!(!w.is_physically_open());
w.set_flush_threshold(1);
w.write(&make_sk(0)).unwrap();
assert!(w.is_physically_open());
w.close().unwrap();
assert!(!w.is_physically_open());
}
+63
View File
@@ -0,0 +1,63 @@
use super::*;
use crate::pool::SKFileWriter;
use tempfile::NamedTempFile;
const TEST_K: usize = 4;
fn setup() {
obikseq::params::set_k(TEST_K);
}
fn make_sks(n: usize) -> Vec<SuperKmer> {
(0..n)
.map(|i| {
let bases: Vec<u8> = (0..8).map(|j| b"ACGT"[(i + j) % 4]).collect();
SuperKmer::from_ascii(&bases)
})
.collect()
}
#[test]
fn iter_all() {
setup();
let tmp = NamedTempFile::new().unwrap();
let sks = make_sks(50);
{
let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap();
}
let mut r = SKFileReader::open(tmp.path()).unwrap();
let got: Vec<_> = r.iter().collect();
assert_eq!(got.len(), 50);
for (a, b) in sks.iter().zip(got.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
}
#[test]
fn reopen_and_seek() {
setup();
let tmp = NamedTempFile::new().unwrap();
let sks = make_sks(20);
{
let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap();
}
let mut r = SKFileReader::open(tmp.path()).unwrap();
let first = r.read_batch(10).unwrap();
r.close();
r.reopen_and_seek().unwrap();
let rest = r.read_batch(20).unwrap();
assert_eq!(first.len(), 10);
assert_eq!(rest.len(), 10);
for (a, b) in sks[..10].iter().zip(first.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
for (a, b) in sks[10..].iter().zip(rest.iter()) {
assert_eq!(a.to_ascii(), b.to_ascii());
}
}
+169
View File
@@ -0,0 +1,169 @@
use super::*;
use obikseq::{Kmer, Sequence as _, Unitig, set_k};
use tempfile::tempdir;
fn make_unitig(ascii: &[u8]) -> Unitig {
Unitig::from_ascii(ascii)
}
fn canonical_of(ascii: &[u8]) -> CanonicalKmer {
Kmer::from_ascii(ascii).unwrap().canonical()
}
fn write_read(seqs: &[&[u8]]) -> (tempfile::TempDir, UnitigFileReader) {
let dir = tempdir().unwrap();
let path = dir.path().join("unitigs.bin");
let mut w = UnitigFileWriter::create(&path).unwrap();
for s in seqs {
w.write(&make_unitig(s)).unwrap();
}
w.close().unwrap();
let r = UnitigFileReader::open(&path).unwrap();
(dir, r)
}
// ── I/O round-trip ────────────────────────────────────────────────────────────
#[test]
fn roundtrip_empty_index() {
set_k(4);
let dir = tempdir().unwrap();
let path = dir.path().join("unitigs.bin");
let w = UnitigFileWriter::create(&path).unwrap();
w.close().unwrap();
let r = UnitigFileReader::open(&path).unwrap();
assert_eq!(r.len(), 0);
}
#[test]
fn roundtrip_unitigs() {
set_k(4);
let seqs: &[&[u8]] = &[b"ACGTACGT", b"TTTTCCCC", b"GGGAAA"];
let (_dir, r) = write_read(seqs);
assert_eq!(r.len(), seqs.len());
for (i, s) in seqs.iter().enumerate() {
assert_eq!(r.unitig(i), make_unitig(s), "unitig {i} mismatch");
}
}
// ── Bit extraction ────────────────────────────────────────────────────────────
#[test]
fn extract_kmer_raw_basic() {
// ACGT = 00 01 10 11 = 0x1B; k=4, j=0 → 0x1B << 56
let bytes = [0x1Bu8];
assert_eq!(extract_kmer_raw(&bytes, 0, 4), 0x1Bu64 << 56);
}
#[test]
fn extract_kmer_raw_intra_byte_offset() {
// ACGT, j=1, k=3 → CGT = 01 10 11 = 0x1B (6 bits) → 0x1B << 58
let bytes = [0x1Bu8];
assert_eq!(extract_kmer_raw(&bytes, 1, 3), 0x1Bu64 << 58);
}
#[test]
fn extract_kmer_raw_cross_byte() {
// Two bytes: ACGT | ACGT = [0x1B, 0x1B]
// j=3, k=4: nucleotides 3..7 = T A C G = 11 00 01 10 = 0b11000110 = 0xC6
let bytes = [0x1Bu8, 0x1Bu8];
assert_eq!(extract_kmer_raw(&bytes, 3, 4), 0xC6u64 << 56);
}
// ── revcomp / canonical ───────────────────────────────────────────────────────
#[test]
fn revcomp_palindrome() {
// ACGT is its own reverse complement
let raw = 0x1Bu64 << 56; // ACGT, k=4
assert_eq!(revcomp_raw(raw, 4), raw);
}
#[test]
fn revcomp_asymmetric() {
// revcomp(TTTG) = CAAA
// TTTG = 11 11 11 10 = 0xFE → 0xFE << 56
// CAAA = 01 00 00 00 = 0x40 → 0x40 << 56
let tttg = 0xFEu64 << 56;
let caaa = 0x40u64 << 56;
assert_eq!(revcomp_raw(tttg, 4), caaa);
assert_eq!(revcomp_raw(caaa, 4), tttg);
}
#[test]
fn canonical_raw_selects_minimum() {
let tttg = 0xFEu64 << 56;
let caaa = 0x40u64 << 56;
assert_eq!(canonical_raw(tttg, 4), caaa); // TTTG → canonical is CAAA
assert_eq!(canonical_raw(caaa, 4), caaa); // CAAA already canonical
}
// ── verify_canonical_kmer ─────────────────────────────────────────────────────
#[test]
fn verify_forward_canonical() {
// CAAA is canonical (< TTTG); stored forward in the unitig → direct match
set_k(4);
let (_dir, r) = write_read(&[b"CAAAACGT"]);
let query = canonical_of(b"CAAA");
assert!(r.verify_canonical_kmer(0, 0, query));
}
#[test]
fn verify_reverse_complement_stored() {
// TTTG stored in the unitig; canonical form is CAAA
// verify must recognise the match despite the stored orientation being non-canonical
set_k(4);
let (_dir, r) = write_read(&[b"TTTGACGT"]);
let query = canonical_of(b"CAAA"); // == canonical_of(b"TTTG")
assert!(r.verify_canonical_kmer(0, 0, query));
}
#[test]
fn verify_wrong_kmer_returns_false() {
set_k(4);
let (_dir, r) = write_read(&[b"TTTGACGT"]);
let wrong = canonical_of(b"AAAC");
assert!(!r.verify_canonical_kmer(0, 0, wrong));
}
#[test]
fn verify_second_unitig_second_position() {
// Two unitigs; check kmer at j=1 of unitig 1 ("TTTGACGT")
// j=1 → nucleotides 1..5 = TTGA
set_k(4);
let (_dir, r) = write_read(&[b"ACGTACGT", b"TTTGACGT"]);
let query = canonical_of(b"TTGA");
assert!(r.verify_canonical_kmer(1, 1, query));
}
// ── Splitting ─────────────────────────────────────────────────────────────────
#[test]
fn short_unitig_not_split() {
// seql=259 → n_kmers=256 = MAX_KMERS_PER_CHUNK → no split
set_k(4);
let seq: Vec<u8> = (0..259_usize).map(|i| b"ACGT"[i % 4]).collect();
let (_dir, r) = write_read(&[&seq]);
assert_eq!(r.len(), 1);
assert_eq!(r.seql(0), 259);
}
#[test]
fn long_unitig_split_no_kmer_lost() {
// seql=260 → n_kmers=257 > MAX_KMERS_PER_CHUNK(256) → 2 chunks
// chunk_nucl=259, stride=256
// Chunk 0: nucl 0..259 (259 nucl, 256 kmers)
// Chunk 1: nucl 256..260 (4 nucl, 1 kmer)
set_k(4);
let seq: Vec<u8> = (0..260_usize).map(|i| b"ACGT"[i % 4]).collect();
let (_dir, r) = write_read(&[&seq]);
assert_eq!(r.len(), 2);
assert_eq!(r.seql(0), 259);
assert_eq!(r.seql(1), 4);
// k-1=3 nucleotide overlap → 0 kmers duplicated, 0 kmers lost.
// Last kmer of chunk 0 = original nucl 255..259.
assert!(r.verify_canonical_kmer(0, 255, canonical_of(&seq[255..259])));
// First kmer of chunk 1 = original nucl 256..260 — a different, adjacent kmer.
assert!(r.verify_canonical_kmer(1, 0, canonical_of(&seq[256..260])));
}
+286
View File
@@ -0,0 +1,286 @@
use std::fs::File;
use std::io::{BufWriter, Write as _};
use std::path::{Path, PathBuf};
use memmap2::Mmap;
use obikseq::{CanonicalKmer, Unitig};
pub use obikseq::MAX_KMERS_PER_CHUNK;
use crate::error::{SKError, SKResult};
// ── Index file format ─────────────────────────────────────────────────────────
//
// magic: [u8; 4] = b"UIDX"
// n_unitigs: u32 LE
// seqls: [u8; n_unitigs] max kmer index per chunk (= n_kmers 1)
// packed_offsets: [u32; n_unitigs + 1] byte offsets to packed bytes in the
// sequence file; last entry is sentinel
//
// Each sequence record in the binary file: [u8: n_kmers1][packed bytes].
// Offsets point to the first packed byte of each record, past the leading u8.
// Unitigs with more than MAX_KMERS_PER_CHUNK kmers are transparently split by the
// writer into overlapping chunks (k-1 nucleotide overlap) so no kmer is lost.
const MAGIC: [u8; 4] = *b"UIDX";
fn idx_path(path: &Path) -> PathBuf {
let mut s = path.as_os_str().to_owned();
s.push(".idx");
PathBuf::from(s)
}
// Extract a sub-sequence [start, end) nucleotides from a unitig.
fn sub_unitig(unitig: &Unitig, start: usize, end: usize) -> Unitig {
unitig.sub(start, end)
}
// ── Writer ────────────────────────────────────────────────────────────────────
/// Writes a sequence of [`Unitig`] to an uncompressed binary file and builds
/// an offset index at close time.
///
/// Unitigs with more than [`MAX_KMERS_PER_CHUNK`] kmers are transparently split
/// into overlapping chunks (k-1 nucleotide overlap) so no kmer is lost.
///
/// The companion index file (`path.idx`) is written on [`close`].
/// The binary format per record is `[u8: n_kmers1][packed 2-bit bytes]`.
pub struct UnitigFileWriter {
path: PathBuf,
file: BufWriter<File>,
seqls: Vec<u8>,
packed_offsets: Vec<u32>,
next_offset: u32,
k: usize,
}
impl UnitigFileWriter {
pub fn create(path: &Path) -> SKResult<Self> {
let file = File::create(path).map_err(SKError::Io)?;
Ok(Self {
path: path.to_owned(),
file: BufWriter::new(file),
seqls: Vec::new(),
packed_offsets: Vec::new(),
next_offset: 0,
k: obikseq::params::k(),
})
}
/// Write a unitig, splitting it into chunks if it exceeds [`MAX_KMERS_PER_CHUNK`].
pub fn write(&mut self, unitig: &Unitig) -> SKResult<()> {
let seql = unitig.seql();
let k = self.k;
if seql < k {
return Ok(());
}
let n_kmers = seql - k + 1;
if n_kmers <= MAX_KMERS_PER_CHUNK {
return self.write_chunk(unitig);
}
// Split into overlapping chunks of MAX_KMERS_PER_CHUNK kmers.
// Overlap of k-1 nucleotides ensures no kmer is lost at boundaries.
let chunk_nucl = MAX_KMERS_PER_CHUNK + k - 1;
let stride = MAX_KMERS_PER_CHUNK;
let mut start = 0;
while start < seql {
let end = (start + chunk_nucl).min(seql);
self.write_chunk(&sub_unitig(unitig, start, end))?;
if end == seql {
break;
}
start += stride;
}
Ok(())
}
fn write_chunk(&mut self, unitig: &Unitig) -> SKResult<()> {
let seql = unitig.seql();
let byte_len = (seql + 3) / 4;
// Header is 1 byte (u8: n_kmers 1 = seql k); packed bytes follow.
self.packed_offsets.push(self.next_offset + 1);
self.seqls.push((seql - self.k) as u8);
unitig
.write_to_binary(&mut self.file)
.map_err(SKError::Io)?;
self.next_offset += 1 + byte_len as u32;
Ok(())
}
/// Flush the sequence file and write the companion `.idx`.
pub fn close(mut self) -> SKResult<()> {
self.file.flush().map_err(SKError::Io)?;
drop(self.file);
// Sentinel: byte offset past the last record's packed bytes.
let sentinel = match (self.packed_offsets.last(), self.seqls.last()) {
(Some(&last_off), Some(&last_seql)) => {
let seql = last_seql as u32 + self.k as u32;
last_off + (seql + 3) / 4
}
_ => 0,
};
self.packed_offsets.push(sentinel);
write_idx(&idx_path(&self.path), &self.seqls, &self.packed_offsets)
}
pub fn len(&self) -> usize {
self.seqls.len()
}
pub fn is_empty(&self) -> bool {
self.seqls.is_empty()
}
}
fn write_idx(path: &Path, seqls: &[u8], packed_offsets: &[u32]) -> SKResult<()> {
let mut w = BufWriter::new(File::create(path).map_err(SKError::Io)?);
w.write_all(&MAGIC).map_err(SKError::Io)?;
w.write_all(&(seqls.len() as u32).to_le_bytes()).map_err(SKError::Io)?;
w.write_all(seqls).map_err(SKError::Io)?;
for &off in packed_offsets {
w.write_all(&off.to_le_bytes()).map_err(SKError::Io)?;
}
w.flush().map_err(SKError::Io)
}
// ── Reader ────────────────────────────────────────────────────────────────────
/// Read-only random-access view of a unitig file.
///
/// The sequence file is memory-mapped; the index is loaded into RAM on open.
/// All per-kmer operations are O(1) and allocation-free.
pub struct UnitigFileReader {
mmap: Mmap,
seqls: Vec<u8>,
packed_offsets: Vec<u32>,
k: usize,
}
impl UnitigFileReader {
pub fn open(path: &Path) -> SKResult<Self> {
let file = File::open(path).map_err(SKError::Io)?;
let mmap = unsafe { Mmap::map(&file).map_err(SKError::Io)? };
let (seqls, packed_offsets) = read_idx(&idx_path(path))?;
let k = obikseq::params::k();
Ok(Self { mmap, seqls, packed_offsets, k })
}
pub fn len(&self) -> usize {
self.seqls.len()
}
pub fn is_empty(&self) -> bool {
self.seqls.is_empty()
}
/// Return the nucleotide length of chunk `i`.
#[inline]
pub fn seql(&self, i: usize) -> usize {
self.seqls[i] as usize + self.k
}
/// Reconstruct chunk `i` as a [`Unitig`]. Allocates a copy of the packed bytes.
pub fn unitig(&self, i: usize) -> Unitig {
let seql = self.seqls[i] as usize + self.k;
let start = self.packed_offsets[i] as usize;
let byte_len = (seql + 3) / 4;
let tail = (seql % 4) as u8;
let bytes = self.mmap[start..start + byte_len].to_vec().into_boxed_slice();
Unitig::new(tail, bytes)
}
/// Extract the raw left-aligned u64 of the kmer at position `j` within chunk `i`.
#[inline]
pub fn raw_kmer(&self, i: usize, j: usize) -> u64 {
let start = self.packed_offsets[i] as usize;
extract_kmer_raw(&self.mmap[start..], j, self.k)
}
/// Return `true` iff the kmer at position `j` of chunk `i` equals `query`.
///
/// O(1), zero allocation. The chunk may store either orientation of the kmer;
/// canonicalization is applied before comparison.
#[inline]
pub fn verify_canonical_kmer(&self, i: usize, j: usize, query: CanonicalKmer) -> bool {
canonical_raw(self.raw_kmer(i, j), self.k) == query.raw()
}
}
fn read_idx(path: &Path) -> SKResult<(Vec<u8>, Vec<u32>)> {
let data = std::fs::read(path).map_err(SKError::Io)?;
let mut pos = 0;
if &data[pos..pos + 4] != &MAGIC {
return Err(SKError::Io(std::io::Error::new(
std::io::ErrorKind::InvalidData,
"unitig index: bad magic",
)));
}
pos += 4;
let n = u32::from_le_bytes(data[pos..pos + 4].try_into().unwrap()) as usize;
pos += 4;
let seqls = data[pos..pos + n].to_vec();
pos += n;
let mut packed_offsets = Vec::with_capacity(n + 1);
for _ in 0..=n {
packed_offsets.push(u32::from_le_bytes(data[pos..pos + 4].try_into().unwrap()));
pos += 4;
}
Ok((seqls, packed_offsets))
}
// ── Kmer utilities ────────────────────────────────────────────────────────────
/// Reverse complement of a left-aligned 2-bit kmer (same algorithm as [`KmerOf::revcomp`]).
#[inline]
fn revcomp_raw(raw: u64, k: usize) -> u64 {
let x = !raw;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
/// Canonical form of a left-aligned 2-bit kmer: `min(kmer, revcomp(kmer))`.
#[inline]
fn canonical_raw(raw: u64, k: usize) -> u64 {
raw.min(revcomp_raw(raw, k))
}
// ── Bit extraction ────────────────────────────────────────────────────────────
/// Extract the kmer at nucleotide position `j` from MSB-first 2-bit packed `bytes`.
/// Returns a left-aligned u64 matching [`KmerOf`]'s internal representation.
#[inline]
fn extract_kmer_raw(bytes: &[u8], j: usize, k: usize) -> u64 {
let bit_start = j * 2;
let byte_start = bit_start / 8;
let bit_offset = bit_start % 8; // always 0, 2, 4, or 6
let bytes_needed = (bit_offset + 2 * k + 7) / 8; // ≤ 9 for k ≤ 32
let mut acc = 0u128;
for idx in 0..bytes_needed {
acc = (acc << 8) | bytes.get(byte_start + idx).copied().unwrap_or(0) as u128;
}
let shift = bytes_needed * 8 - bit_offset - 2 * k;
let mask = !0u64 >> (64 - 2 * k);
let raw = (acc >> shift) as u64 & mask;
raw << (64 - 2 * k)
}
#[cfg(test)]
#[path = "tests/unitig_index.rs"]
mod tests;