fix: resolve test race conditions, add logging, and fix CI deadlock

Re-enables the `numa` feature in CI workflows to prevent container/cgroup deadlocks while preserving validation correctness. Fixes concurrent test race conditions by replacing thread-local parameter storage with process-wide atomics and mutex locks. Integrates `tracing-subscriber` for structured logging and adds thread-ID tracking to debug worker lifecycles. Additionally bumps the crate version, updates `.gitignore`, documents experimental evolutionary distance pipelines, and refactors hardcoded test constants.

src/obidebruinj/src/tests/debruijn.rs

@@ -1,6 +1,17 @@
 use super::*;
 use obikseq::{k, set_k, unitig::Unitig, Kmer};
 
+// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
+// file don't all use the same `k` (`push_palindrome_single_node` needs an
+// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
+// use k=5), and they run concurrently by default. Serialize the
+// set_k-through-use critical section across this file's tests so one test's
+// `k` can never be overwritten mid-flight by another.
+static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
+fn lock_k() -> std::sync::MutexGuard<'static, ()> {
+    K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
+}
+
 // Build a graph from an ASCII sequence, inserting all canonical k-mers.
 fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
     let mut g = GraphDeBruijn::new();
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
 #[test]
 fn push_deduplicates_revcomp() {
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
     let mut g = GraphDeBruijn::new();
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
 fn push_palindrome_single_node() {
     // ACGT is its own revcomp
     let k = 4;
+    let _guard = lock_k();
     set_k(k);
     let kmer = Kmer::from_ascii(b"ACGT").unwrap();
     assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
 #[test]
 fn degrees_linear_chain_node_count() {
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let (g, kmers) = linear_chain_graph();
     assert_eq!(g.len(), kmers.len());
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
     // Note: start_iter must not be consumed standalone — its second pass only
     // finds true cycle nodes when interleaved with chain traversal (iter_unitig).
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let seq = b"AAAAGGGG";
     let g = graph_from_ascii(seq);
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
 fn unitig_roundtrip_linear() {
     // Non-repetitive sequence: all k-mers must be recovered across unitigs.
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let seq = b"ACCTGGCTA";
     let g = graph_from_ascii(seq);
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
     // Longer non-repetitive sequence with no repeated k-mer of length k.
     // ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let seq = b"ACGTGGCTATCGAC";
     let g = graph_from_ascii(seq);
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
 fn unitig_isolated_node() {
     // Single k-mer with no neighbours
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
     let mut g = GraphDeBruijn::new();
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
 #[test]
 fn unitig_two_isolated_nodes() {
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let mut g = GraphDeBruijn::new();
     // Two k-mers that share no (k-1)-overlap
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
 #[test]
 fn unitig_two_truly_distinct_isolated_nodes() {
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let mut g = GraphDeBruijn::new();
     g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
 
 #[test]
 fn no_kmer_lost_or_duplicated() {
-    let k = 7;
+    let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let seq = b"ACGTACGTACGTTTTTACGTACGT";
     let g = graph_from_ascii(seq);
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
     // start_iter first pass yields nothing (all nodes internal); second pass
     // picks up cycle entries. All 4 k-mers must appear in the unitigs.
     let k = 5;
+    let _guard = lock_k();
     set_k(k);
     let seq = b"ACGTACGT";
     let g = graph_from_ascii(seq);
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
     // Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
     // We use long non-repetitive sequences and extract only the required kmers.
     let k: usize = 5;
+    let _guard = lock_k();
     set_k(k);
     let mut g = GraphDeBruijn::new();