Compare commits
3
Commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
fd2c23e7df | ||
|
|
912f788f7f | ||
|
|
e725523898 |
+32
-16
@@ -1,6 +1,6 @@
|
||||
# Kmer entropy filter
|
||||
|
||||
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for two sources of bias: the small number of observations within a single kmer, and the unequal sizes of circular equivalence classes.
|
||||
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for one source of bias: the small number of observations within a single kmer relative to the number of possible sub-words.
|
||||
|
||||
## Sub-word frequencies
|
||||
|
||||
@@ -8,17 +8,15 @@ For a kmer of length k and a sub-word size ws (1 ≤ ws ≤ ws_max, typically ws
|
||||
|
||||
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
|
||||
|
||||
Each sub-word is mapped to its **circular canonical form**: the lexicographic minimum among all cyclic rotations of the word **and all cyclic rotations of its reverse complement**. This extended equivalence relation ensures that entropy(K) = entropy(revcomp(K)) — the filter is strand-symmetric. Let $s_j$ be the size of equivalence class $j$ (number of distinct raw words mapping to canonical form $j$), and $f_j$ the count of canonical form $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$).
|
||||
Each sub-word is tallied under its own raw 2-bit-packed value — **no canonicalization**. Let $f_j$ be the count of raw word $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$), over the $4^{ws}$ possible raw words.
|
||||
|
||||
An earlier version of this filter first folded each sub-word into a circular+reverse-complement equivalence class, then "unfolded" the observed class frequency back onto its members to correct for unequal class sizes. That machinery bought nothing it was claimed for — see *Why no equivalence classes* below — while measurably weakening detection of the very sequences the filter exists to catch, so it was removed.
|
||||
|
||||
## Corrected Shannon entropy
|
||||
|
||||
The circular equivalence classes have unequal sizes: under a uniform distribution over all $4^{ws}$ raw words, class $j$ is visited with probability $s_j / 4^{ws}$, not $1/n_a$. Computing entropy directly over canonical classes therefore underestimates the entropy of a random sequence.
|
||||
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j$$
|
||||
|
||||
The correction "unfolds" each canonical class back to its member raw words, redistributing each observation of class $j$ equally among its $s_j$ members:
|
||||
|
||||
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j + \frac{1}{n_{\text{words}}} \sum_j f_j \log s_j$$
|
||||
|
||||
The last term is the correction for unequal class sizes. For a uniformly random sequence ($f_j \approx n_{\text{words}} \cdot s_j / 4^{ws}$), this gives $H_{\text{corr}} \approx \log(4^{ws}) = 2 \cdot ws \cdot \log 2$, the maximum entropy over raw words.
|
||||
This is a plain Shannon entropy over the observed raw-word frequencies.
|
||||
|
||||
## Maximum entropy correction for small samples
|
||||
|
||||
@@ -42,27 +40,45 @@ $$\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)$$
|
||||
|
||||
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
|
||||
|
||||
## Why no equivalence classes
|
||||
|
||||
A prior design folded each sub-word into the canonical form of its circular-rotation + reverse-complement equivalence class before tallying, on the reasoning that (a) it guarantees $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, and (b) collapsing phase-shifted repeats (e.g. `ATG` ≡ `TGA` ≡ `GAT`) into one class better reflects that they are "the same" low-complexity pattern.
|
||||
|
||||
Both properties already hold for the raw, unfolded entropy above, without any class machinery:
|
||||
|
||||
- **Reverse complement**: for any K of length n, window $j$ of $\text{revcomp}(K)$ equals $\text{revcomp}$ of window $(n{-}ws{-}j)$ of K. This is a bijection between the window sets under which each window maps to its own revcomp — and revcomp is itself a bijection (involution) on the space of raw ws-mers. So the multiset of raw-word frequencies for $\text{revcomp}(K)$ is exactly a relabeling of the multiset for K, and Shannon entropy — a function of the frequency multiset alone — is exactly invariant. No folding required, for any K.
|
||||
- **Tandem repeats**: a period-p repeat sampled by a stride-1 sliding window naturally cycles through its own rotations as raw tokens (e.g. `ATGATGATG…` yields the raw words `ATG`, `TGA`, `GAT` in rotation as the window slides). The low diversity this represents (few distinct raw words out of $4^{ws}$ possible) is already visible in the raw frequency distribution — no folding needed to detect it.
|
||||
|
||||
What the fold-then-unfold step actually did was credit each observed class with the frequency of equivalence-class members that were **never observed on the read strand**, inflating $H_{\text{corr}}$ for genuine repeats. Worked example: k=31, ws=3, kmer = `ATG` repeated ($n_{\text{words}}=29$, all 29 windows fall into one class of size 6 under the old scheme — 3 rotations × forward/revcomp):
|
||||
|
||||
| | $H_{\text{corr}}$ | normalized |
|
||||
|---|---|---|
|
||||
| old (folded, class size 6) | $\log 6 \approx 1.79$ | $\approx 0.53$ |
|
||||
| current (raw, unfolded) | $\log 3 \approx 1.10$ | $\approx 0.33$ |
|
||||
|
||||
The gap is not a rounding artifact: per sub-word order, the folded score for this same repeat swings from 0.53 (ws=3, aligned with the period) up to **1.03** (ws=5, misaligned with the period) — i.e. a period-3 repeat could score *above* the theoretical maximum for a random sequence, depending on which ws happens to divide the repeat's period. The raw formula stays flat at ≈0.33–0.40 across ws=2..6 regardless of alignment, which is the robustness the "minimum across ws" design was meant to provide in the first place.
|
||||
|
||||
## Interpretation as an effective number of classes
|
||||
|
||||
$H_{\text{corr}}$ is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable classes that would yield the same entropy.
|
||||
$H_{\text{corr}}$ is a standard Shannon entropy over raw words, so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable raw words that would yield the same entropy.
|
||||
|
||||
For the normalised score $\hat{H}$, dividing by $H_{\text{max}}$ changes the logarithm base:
|
||||
For the normalised score $\hat{H}$, dividing by $H_{\max}$ changes the logarithm base:
|
||||
|
||||
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\text{max}}} = \log_{N_{\text{max}}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\text{max}}^{\,\hat{H}}$$
|
||||
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\max}} = \log_{N_{\max}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\max}^{\,\hat{H}}$$
|
||||
|
||||
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\text{max}}$) of the effective number of equi-represented classes.
|
||||
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\max}$) of the effective number of equi-represented raw words.
|
||||
|
||||
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\text{max}} \approx 4^{ws}$, giving:
|
||||
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\max} \approx 4^{ws}$, giving:
|
||||
|
||||
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
|
||||
|
||||
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective classes out of 16 are occupied.
|
||||
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective words out of 16 are occupied.
|
||||
|
||||
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\text{max}} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\text{max}}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
|
||||
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\max} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\max}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
|
||||
|
||||
## Properties
|
||||
|
||||
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
|
||||
|
||||
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, guaranteed by the strand-symmetric canonical form.
|
||||
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$ — see *Why no equivalence classes* above for why this holds without any explicit strand-folding step.
|
||||
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
|
||||
|
||||
@@ -3,10 +3,14 @@
|
||||
|
||||
## Code couvert
|
||||
|
||||
- `obiskbuilder/src/entropy_table.rs` — filtre Shannon sur les kmers à basse complexité
|
||||
- `obiskbuilder/src/lib.rs` — application du filtre lors du scatter (phase 1)
|
||||
- `obikentropy/src/table.rs`, `obikentropy/src/tracker.rs` — formule d'entropie et tables de correction petits effectifs
|
||||
- `obikentropy/src/kmer_entropy.rs` — entropie d'un kmer isolé (`KmerEntropy`)
|
||||
- `obiskbuilder/src/rolling_stat.rs` — composition de `obikentropy::EntropyTracker` dans le suivi streaming (sélection de minimiseur + entropie)
|
||||
- `obiskbuilder/src/iter.rs`, `obiskbuilder/src/stream_iter.rs` — application du filtre lors du scatter (phase 1)
|
||||
|
||||
## Notes
|
||||
|
||||
Document théorique stable. Vérifier que les paramètres `theta` et `level_max` dans le CLI
|
||||
Le repli en classes d'équivalence circulaires + brin inverse (décrit dans une version antérieure de ce document) a été supprimé : voir la section « Why no equivalence classes » de `entropy.md` pour la justification théorique et numérique.
|
||||
|
||||
Vérifier que les paramètres `theta` et `level_max` dans le CLI
|
||||
(`obikmer/src/cli.rs` → `CommonArgs`) correspondent bien à ce qui est décrit.
|
||||
|
||||
Generated
+11
-1
@@ -1682,6 +1682,13 @@ dependencies = [
|
||||
"xxhash-rust",
|
||||
]
|
||||
|
||||
[[package]]
|
||||
name = "obikentropy"
|
||||
version = "0.1.0"
|
||||
dependencies = [
|
||||
"obikseq",
|
||||
]
|
||||
|
||||
[[package]]
|
||||
name = "obikindex"
|
||||
version = "0.1.0"
|
||||
@@ -1704,7 +1711,7 @@ dependencies = [
|
||||
|
||||
[[package]]
|
||||
name = "obikmer"
|
||||
version = "1.1.38"
|
||||
version = "1.1.39"
|
||||
dependencies = [
|
||||
"clap",
|
||||
"csv",
|
||||
@@ -1742,6 +1749,7 @@ dependencies = [
|
||||
"niffler 3.0.0",
|
||||
"obicompactvec",
|
||||
"obidebruinj",
|
||||
"obikentropy",
|
||||
"obikrope",
|
||||
"obikseq",
|
||||
"obilayeredmap",
|
||||
@@ -1824,7 +1832,9 @@ dependencies = [
|
||||
name = "obiskbuilder"
|
||||
version = "0.1.0"
|
||||
dependencies = [
|
||||
"criterion2",
|
||||
"lazy_static",
|
||||
"obikentropy",
|
||||
"obikrope",
|
||||
"obikseq",
|
||||
"obiread",
|
||||
|
||||
+1
-1
@@ -1,5 +1,5 @@
|
||||
[workspace]
|
||||
resolver = "3"
|
||||
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"]
|
||||
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy"]
|
||||
[profile.release]
|
||||
debug = 1
|
||||
|
||||
@@ -0,0 +1,10 @@
|
||||
[package]
|
||||
name = "obikentropy"
|
||||
version = "0.1.0"
|
||||
edition = "2024"
|
||||
|
||||
[dependencies]
|
||||
obikseq = { path = "../obikseq" }
|
||||
|
||||
[dev-dependencies]
|
||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||
@@ -4,57 +4,6 @@ use std::path::PathBuf;
|
||||
const K_MAX: usize = 32;
|
||||
const WS_MAX: usize = 6;
|
||||
|
||||
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
|
||||
let mask = (1u64 << (ws * 2)) - 1;
|
||||
let mut canonical = kmer & mask;
|
||||
let mut current = canonical;
|
||||
for _ in 0..ws - 1 {
|
||||
let top = (current >> ((ws - 1) * 2)) & 3;
|
||||
current = ((current << 2) | top) & mask;
|
||||
if current < canonical {
|
||||
canonical = current;
|
||||
}
|
||||
}
|
||||
canonical
|
||||
}
|
||||
|
||||
fn revcomp_raw(x: u64, k: usize) -> u64 {
|
||||
let x = !x;
|
||||
let x = x.swap_bytes();
|
||||
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
|
||||
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
|
||||
x << (64 - 2 * k)
|
||||
}
|
||||
|
||||
fn build_normalized_kmer(k: usize) -> Vec<u64> {
|
||||
let n = 1usize << (k * 2);
|
||||
let shift = 64 - k * 2;
|
||||
let mut result = vec![0u64; n];
|
||||
for i in 0..n {
|
||||
let la = (i as u64) << shift;
|
||||
let ra = i as u64;
|
||||
let rc_ra = revcomp_raw(la, k) >> shift;
|
||||
let circ = normalize_circular(ra, k);
|
||||
let circ_rc = normalize_circular(rc_ra, k);
|
||||
result[i] = if circ < circ_rc { circ } else { circ_rc };
|
||||
}
|
||||
result
|
||||
}
|
||||
|
||||
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
|
||||
let n = norm.len();
|
||||
let mut sizes = vec![0u32; n];
|
||||
for &c in norm {
|
||||
sizes[c as usize] += 1;
|
||||
}
|
||||
norm.iter()
|
||||
.map(|&c| {
|
||||
let s = sizes[c as usize];
|
||||
if s > 0 { (s as f64).ln() } else { 0.0 }
|
||||
})
|
||||
.collect()
|
||||
}
|
||||
|
||||
fn build_n_log_n() -> [f64; K_MAX + 1] {
|
||||
let mut t = [0.0f64; K_MAX + 1];
|
||||
for n in 1..=K_MAX {
|
||||
@@ -63,6 +12,9 @@ fn build_n_log_n() -> [f64; K_MAX + 1] {
|
||||
t
|
||||
}
|
||||
|
||||
/// Max achievable entropy over `4^ws` raw sub-words given only `nwords`
|
||||
/// observations (most-uniform integer partition), per
|
||||
/// `docmd/theory/entropy.md`.
|
||||
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
|
||||
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
|
||||
for k in 2..=K_MAX {
|
||||
@@ -125,13 +77,6 @@ fn main() {
|
||||
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
|
||||
let mut out = String::new();
|
||||
|
||||
for k in 1..=6usize {
|
||||
let n = 1usize << (k * 2);
|
||||
let norm = build_normalized_kmer(k);
|
||||
let ln_class = build_ln_class(&norm);
|
||||
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
|
||||
}
|
||||
|
||||
let n_log_n = build_n_log_n();
|
||||
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
|
||||
|
||||
@@ -141,5 +86,5 @@ fn main() {
|
||||
let log_nwords = build_log_nwords();
|
||||
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
|
||||
|
||||
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap();
|
||||
fs::write(out_dir.join("entropy_tables.rs"), out).unwrap();
|
||||
}
|
||||
@@ -0,0 +1,41 @@
|
||||
//! Normalized entropy of an isolated, already-built k-mer (e.g. one
|
||||
//! reconstructed from an index's `unitigs.bin`, with no surrounding
|
||||
//! sequence) — drives the window through [`EntropyTracker`] one base at a
|
||||
//! time, exactly like the streaming path, so a `theta` threshold means the
|
||||
//! same thing whether applied during index construction or after the fact
|
||||
//! (e.g. `obikmer filter`).
|
||||
|
||||
use obikseq::CanonicalKmer;
|
||||
|
||||
use crate::tracker::EntropyTracker;
|
||||
|
||||
/// Extension trait: compute the normalized entropy of a single canonical
|
||||
/// k-mer, independent of any surrounding sequence.
|
||||
pub trait KmerEntropy {
|
||||
/// Normalized entropy across sub-word orders `1..=level_max` (the
|
||||
/// minimum is taken across orders). Lower means less complex; `theta`
|
||||
/// in `index`/`filter` rejects k-mers with a score `< theta`.
|
||||
fn entropy(&self, level_max: usize) -> f64;
|
||||
}
|
||||
|
||||
impl KmerEntropy for CanonicalKmer {
|
||||
fn entropy(&self, level_max: usize) -> f64 {
|
||||
let raw = self.raw(); // left-aligned, 2 bits/base, MSB-first
|
||||
let k = obikseq::params::k();
|
||||
let mask = (!0u64) >> (64 - k * 2);
|
||||
|
||||
let mut tracker = EntropyTracker::new(k);
|
||||
let mut rolling: u64 = 0;
|
||||
for i in 0..k {
|
||||
let shift = 64 - 2 * (i + 1);
|
||||
let base = (raw >> shift) & 3;
|
||||
rolling = ((rolling << 2) | base) & mask;
|
||||
tracker.push(i + 1, rolling);
|
||||
}
|
||||
tracker.normalized_entropy(level_max)
|
||||
}
|
||||
}
|
||||
|
||||
#[cfg(test)]
|
||||
#[path = "tests/kmer_entropy.rs"]
|
||||
mod tests;
|
||||
@@ -0,0 +1,17 @@
|
||||
//! Normalized k-mer entropy: formulas, tables, and a streaming tracker.
|
||||
//!
|
||||
//! This crate holds every piece of the entropy computation described in
|
||||
//! `docmd/theory/entropy.md`: the compile-time tables ([`table`], private),
|
||||
//! the incremental accumulator ([`EntropyTracker`]) that callers compose
|
||||
//! into their own streaming state, and the [`KmerEntropy`] convenience trait
|
||||
//! for scoring a single, already-built k-mer.
|
||||
|
||||
#![deny(missing_docs)]
|
||||
|
||||
mod kmer_entropy;
|
||||
mod ring;
|
||||
mod table;
|
||||
mod tracker;
|
||||
|
||||
pub use kmer_entropy::KmerEntropy;
|
||||
pub use tracker::EntropyTracker;
|
||||
@@ -0,0 +1,40 @@
|
||||
//! Stack-allocated ring buffer backing the sliding sub-word windows.
|
||||
|
||||
/// Fixed-capacity ring buffer backed by a stack array.
|
||||
/// N must be a power of two; operations are branchless via `% N`.
|
||||
pub(crate) struct Ring<T: Copy + Default, const N: usize> {
|
||||
buf: [T; N],
|
||||
head: usize,
|
||||
len: usize,
|
||||
}
|
||||
|
||||
impl<T: Copy + Default, const N: usize> Ring<T, N> {
|
||||
#[inline]
|
||||
pub(crate) fn new() -> Self {
|
||||
Self {
|
||||
buf: [T::default(); N],
|
||||
head: 0,
|
||||
len: 0,
|
||||
}
|
||||
}
|
||||
|
||||
#[inline]
|
||||
pub(crate) fn clear(&mut self) {
|
||||
self.len = 0;
|
||||
self.head = 0;
|
||||
}
|
||||
|
||||
#[inline]
|
||||
pub(crate) fn push_back(&mut self, val: T) {
|
||||
self.buf[(self.head + self.len) % N] = val;
|
||||
self.len += 1;
|
||||
}
|
||||
|
||||
#[inline]
|
||||
pub(crate) fn pop_front(&mut self) -> T {
|
||||
let val = self.buf[self.head];
|
||||
self.head = (self.head + 1) % N;
|
||||
self.len -= 1;
|
||||
val
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,30 @@
|
||||
//! Compile-time tables backing the normalized k-mer entropy formula: the
|
||||
//! max-entropy correction for small samples. See `docmd/theory/entropy.md`.
|
||||
//!
|
||||
//! Entropy is computed directly on raw (non-canonicalized) sub-words — no
|
||||
//! equivalence-class folding. Empirically (see the discussion that produced
|
||||
//! this crate's history), folding sub-words into circular/revcomp classes
|
||||
//! before unfolding them back buys nothing for the invariances it was meant
|
||||
//! to guarantee (both hold for raw sub-word entropy already, by a direct
|
||||
//! bijection argument for revcomp and by the sliding window's own dynamics
|
||||
//! for tandem repeats), while it measurably *weakens* detection of the
|
||||
//! low-complexity sequences the filter exists to catch.
|
||||
|
||||
include!(concat!(env!("OUT_DIR"), "/entropy_tables.rs"));
|
||||
|
||||
pub(crate) const WS_MAX: usize = 6;
|
||||
|
||||
#[inline(always)]
|
||||
pub(crate) const fn n_log_n(n: usize) -> f64 {
|
||||
N_LOG_N[n]
|
||||
}
|
||||
|
||||
#[inline(always)]
|
||||
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
|
||||
EMAX[k][ws]
|
||||
}
|
||||
|
||||
#[inline(always)]
|
||||
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
|
||||
LOG_NWORDS[k][ws]
|
||||
}
|
||||
@@ -0,0 +1,52 @@
|
||||
use super::*;
|
||||
use obikseq::Sequence;
|
||||
use obikseq::kmer::Kmer;
|
||||
|
||||
const K: usize = 21;
|
||||
const LEVEL_MAX: usize = 6;
|
||||
|
||||
fn kmer_from_ascii(seq: &[u8]) -> CanonicalKmer {
|
||||
obikseq::set_k(K);
|
||||
Kmer::from_ascii(seq).expect("valid k-mer sequence").canonical()
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn homopolymer_scores_lower_than_diverse_sequence() {
|
||||
let homopolymer = kmer_from_ascii(b"AAAAAAAAAAAAAAAAAAAAA"); // 21 bases
|
||||
let diverse = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT"); // 21 bases, same as used elsewhere in this workspace's tests
|
||||
|
||||
let e_homopolymer = homopolymer.entropy(LEVEL_MAX);
|
||||
let e_diverse = diverse.entropy(LEVEL_MAX);
|
||||
|
||||
assert!(
|
||||
e_homopolymer < e_diverse,
|
||||
"homopolymer ({e_homopolymer}) should score lower than a diverse sequence ({e_diverse})"
|
||||
);
|
||||
// A pure homopolymer is the most degenerate case representable — its
|
||||
// score should sit near the bottom of the range, not just "somewhat lower".
|
||||
assert!(e_homopolymer < 0.3, "homopolymer entropy unexpectedly high: {e_homopolymer}");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn entropy_is_deterministic_for_the_same_kmer() {
|
||||
let a = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
|
||||
let b = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
|
||||
assert_eq!(a.entropy(LEVEL_MAX), b.entropy(LEVEL_MAX));
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn entropy_is_within_zero_one_range() {
|
||||
let mut repeat = "AT".repeat(K / 2 + 1);
|
||||
repeat.truncate(K);
|
||||
|
||||
for seq in [
|
||||
"AAAAAAAAAAAAAAAAAAAAA".to_string(),
|
||||
repeat,
|
||||
"CATTAGCGTACCTGATCAGGT".to_string(),
|
||||
] {
|
||||
assert_eq!(seq.len(), K, "test sequence must be exactly K bases: {seq:?}");
|
||||
let kmer = kmer_from_ascii(seq.as_bytes());
|
||||
let e = kmer.entropy(LEVEL_MAX);
|
||||
assert!((0.0..=1.0).contains(&e), "entropy {e} out of [0,1] for {seq:?}");
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,255 @@
|
||||
//! Incremental (streaming) normalized k-mer entropy.
|
||||
//!
|
||||
//! [`EntropyTracker`] maintains, over a sliding window of the last `k` bases,
|
||||
//! the per-sub-word-size raw-word frequency statistics needed to evaluate
|
||||
//! the corrected Shannon entropy described in `docmd/theory/entropy.md`,
|
||||
//! updated in O(1) per base rather than recomputed from scratch. No
|
||||
//! canonicalization is applied — each sub-word is tallied under its own raw
|
||||
//! 2-bit-packed value; only the small-sample max-entropy correction departs
|
||||
//! from a textbook Shannon entropy.
|
||||
//!
|
||||
//! It carries no notion of minimizers or superkmer segmentation — callers
|
||||
//! that need both (e.g. `obiskbuilder::RollingStat`) compose an
|
||||
//! `EntropyTracker` as a plain field alongside their own state, so the two
|
||||
//! concerns update in the same streaming pass without being conflated in one
|
||||
//! struct.
|
||||
|
||||
use crate::ring::Ring;
|
||||
use crate::table::{WS_MAX, emax, log_nwords, n_log_n};
|
||||
|
||||
/// Incremental normalized-entropy accumulator over a sliding window of `k`
|
||||
/// bases. Composed as a plain field by callers that also need other
|
||||
/// per-base state (e.g. minimizer selection) in the same streaming pass.
|
||||
pub struct EntropyTracker {
|
||||
k: usize,
|
||||
steady: bool,
|
||||
|
||||
// Sliding-window queues over the last `k` raw sub-words, one per word
|
||||
// size — stack-allocated, capacity ≤ k ≤ 31.
|
||||
k1q: Ring<u64, 32>,
|
||||
k2q: Ring<u64, 32>,
|
||||
k3q: Ring<u64, 32>,
|
||||
k4q: Ring<u64, 32>,
|
||||
k5q: Ring<u64, 32>,
|
||||
k6q: Ring<u64, 32>,
|
||||
|
||||
// Frequency count arrays, indexed by the raw sub-word value (2 bits per
|
||||
// base). Max count per cell ≤ k ≤ 31 → u8 is sufficient.
|
||||
k1c: [u8; 4],
|
||||
k2c: [u8; 16],
|
||||
k3c: [u8; 64],
|
||||
k4c: [u8; 256],
|
||||
k5c: [u8; 1024],
|
||||
k6c: [u8; 4096],
|
||||
|
||||
sum_f_log_f: [f64; WS_MAX + 1],
|
||||
}
|
||||
|
||||
impl EntropyTracker {
|
||||
/// New tracker for a window of `k` bases (1..=31).
|
||||
pub fn new(k: usize) -> Self {
|
||||
Self {
|
||||
k,
|
||||
steady: false,
|
||||
k1q: Ring::new(),
|
||||
k2q: Ring::new(),
|
||||
k3q: Ring::new(),
|
||||
k4q: Ring::new(),
|
||||
k5q: Ring::new(),
|
||||
k6q: Ring::new(),
|
||||
k1c: [0; 4],
|
||||
k2c: [0; 16],
|
||||
k3c: [0; 64],
|
||||
k4c: [0; 256],
|
||||
k5c: [0; 1024],
|
||||
k6c: [0; 4096],
|
||||
sum_f_log_f: [0.0; WS_MAX + 1],
|
||||
}
|
||||
}
|
||||
|
||||
/// Clear all accumulated state, ready to track a new window from
|
||||
/// scratch (`k` is unchanged).
|
||||
pub fn reset(&mut self) {
|
||||
self.steady = false;
|
||||
|
||||
self.k1c.fill(0);
|
||||
self.k2c.fill(0);
|
||||
self.k3c.fill(0);
|
||||
self.k4c.fill(0);
|
||||
self.k5c.fill(0);
|
||||
self.k6c.fill(0);
|
||||
|
||||
self.k1q.clear();
|
||||
self.k2q.clear();
|
||||
self.k3q.clear();
|
||||
self.k4q.clear();
|
||||
self.k5q.clear();
|
||||
self.k6q.clear();
|
||||
|
||||
self.sum_f_log_f = [0.0; WS_MAX + 1];
|
||||
}
|
||||
|
||||
#[inline]
|
||||
fn update_sums_decrement<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], f: usize) {
|
||||
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
|
||||
}
|
||||
|
||||
#[inline]
|
||||
fn update_sums_increment<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], g: usize) {
|
||||
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
|
||||
}
|
||||
|
||||
/// Advance the window by one base. `received` is the caller's running
|
||||
/// count of bases pushed so far (1-based, i.e. after this base);
|
||||
/// `rolling_kmer` is the current right-aligned, 2-bit-packed k-mer
|
||||
/// window (same convention as `obiskbuilder::RollingStat::rolling_k`).
|
||||
pub fn push(&mut self, received: usize, rolling_kmer: u64) {
|
||||
let raw1 = rolling_kmer & 3;
|
||||
let raw2 = rolling_kmer & 15;
|
||||
let raw3 = rolling_kmer & 63;
|
||||
let raw4 = rolling_kmer & 255;
|
||||
let raw5 = rolling_kmer & 1023;
|
||||
let raw6 = rolling_kmer & 4095;
|
||||
|
||||
if received > self.k {
|
||||
let old1 = self.k1q.pop_front();
|
||||
let f1 = self.k1c[old1 as usize] as usize;
|
||||
Self::update_sums_decrement::<1>(&mut self.sum_f_log_f, f1);
|
||||
self.k1c[old1 as usize] -= 1;
|
||||
|
||||
let old2 = self.k2q.pop_front();
|
||||
let f2 = self.k2c[old2 as usize] as usize;
|
||||
Self::update_sums_decrement::<2>(&mut self.sum_f_log_f, f2);
|
||||
self.k2c[old2 as usize] -= 1;
|
||||
|
||||
let old3 = self.k3q.pop_front();
|
||||
let f3 = self.k3c[old3 as usize] as usize;
|
||||
Self::update_sums_decrement::<3>(&mut self.sum_f_log_f, f3);
|
||||
self.k3c[old3 as usize] -= 1;
|
||||
|
||||
let old4 = self.k4q.pop_front();
|
||||
let f4 = self.k4c[old4 as usize] as usize;
|
||||
Self::update_sums_decrement::<4>(&mut self.sum_f_log_f, f4);
|
||||
self.k4c[old4 as usize] -= 1;
|
||||
|
||||
let old5 = self.k5q.pop_front();
|
||||
let f5 = self.k5c[old5 as usize] as usize;
|
||||
Self::update_sums_decrement::<5>(&mut self.sum_f_log_f, f5);
|
||||
self.k5c[old5 as usize] -= 1;
|
||||
|
||||
let old6 = self.k6q.pop_front();
|
||||
let f6 = self.k6c[old6 as usize] as usize;
|
||||
Self::update_sums_decrement::<6>(&mut self.sum_f_log_f, f6);
|
||||
self.k6c[old6 as usize] -= 1;
|
||||
}
|
||||
|
||||
if self.steady {
|
||||
let g1 = self.k1c[raw1 as usize] as usize;
|
||||
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
|
||||
self.k1c[raw1 as usize] += 1;
|
||||
self.k1q.push_back(raw1);
|
||||
|
||||
let g2 = self.k2c[raw2 as usize] as usize;
|
||||
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
|
||||
self.k2c[raw2 as usize] += 1;
|
||||
self.k2q.push_back(raw2);
|
||||
|
||||
let g3 = self.k3c[raw3 as usize] as usize;
|
||||
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
|
||||
self.k3c[raw3 as usize] += 1;
|
||||
self.k3q.push_back(raw3);
|
||||
|
||||
let g4 = self.k4c[raw4 as usize] as usize;
|
||||
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
|
||||
self.k4c[raw4 as usize] += 1;
|
||||
self.k4q.push_back(raw4);
|
||||
|
||||
let g5 = self.k5c[raw5 as usize] as usize;
|
||||
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
|
||||
self.k5c[raw5 as usize] += 1;
|
||||
self.k5q.push_back(raw5);
|
||||
|
||||
let g6 = self.k6c[raw6 as usize] as usize;
|
||||
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
|
||||
self.k6c[raw6 as usize] += 1;
|
||||
self.k6q.push_back(raw6);
|
||||
} else {
|
||||
self.push_warmup_increments(received, raw1, raw2, raw3, raw4, raw5, raw6);
|
||||
}
|
||||
}
|
||||
|
||||
#[cold]
|
||||
#[inline(never)]
|
||||
fn push_warmup_increments(
|
||||
&mut self,
|
||||
received: usize,
|
||||
raw1: u64, raw2: u64, raw3: u64,
|
||||
raw4: u64, raw5: u64, raw6: u64,
|
||||
) {
|
||||
let g1 = self.k1c[raw1 as usize] as usize;
|
||||
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
|
||||
self.k1c[raw1 as usize] += 1;
|
||||
self.k1q.push_back(raw1);
|
||||
|
||||
if received >= 2 {
|
||||
let g2 = self.k2c[raw2 as usize] as usize;
|
||||
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
|
||||
self.k2c[raw2 as usize] += 1;
|
||||
self.k2q.push_back(raw2);
|
||||
|
||||
if received >= 3 {
|
||||
let g3 = self.k3c[raw3 as usize] as usize;
|
||||
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
|
||||
self.k3c[raw3 as usize] += 1;
|
||||
self.k3q.push_back(raw3);
|
||||
|
||||
if received >= 4 {
|
||||
let g4 = self.k4c[raw4 as usize] as usize;
|
||||
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
|
||||
self.k4c[raw4 as usize] += 1;
|
||||
self.k4q.push_back(raw4);
|
||||
|
||||
if received >= 5 {
|
||||
let g5 = self.k5c[raw5 as usize] as usize;
|
||||
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
|
||||
self.k5c[raw5 as usize] += 1;
|
||||
self.k5q.push_back(raw5);
|
||||
|
||||
if received >= 6 {
|
||||
let g6 = self.k6c[raw6 as usize] as usize;
|
||||
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
|
||||
self.k6c[raw6 as usize] += 1;
|
||||
self.k6q.push_back(raw6);
|
||||
self.steady = true;
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
/// Normalized entropy at sub-word size `order` (1..=6). The caller is
|
||||
/// responsible for not calling this before the window is full (`k`
|
||||
/// bases pushed) — an empty/partial window yields a meaningless value.
|
||||
pub fn entropy(&self, order: usize) -> f64 {
|
||||
let k = self.k;
|
||||
let em = emax(k, order);
|
||||
if em <= 0.0 {
|
||||
return 1.0;
|
||||
}
|
||||
let nwords = k - order + 1;
|
||||
let log_nw = log_nwords(k, order);
|
||||
let nw_f = nwords as f64;
|
||||
let h_corr = log_nw - self.sum_f_log_f[order] / nw_f;
|
||||
(h_corr / em).max(0.0)
|
||||
}
|
||||
|
||||
/// Minimum of [`Self::entropy`] over sub-word sizes `1..=order_max`, same
|
||||
/// caller responsibility re: window readiness as `entropy`.
|
||||
pub fn normalized_entropy(&self, order_max: usize) -> f64 {
|
||||
let min_e = (1..=order_max)
|
||||
.map(|ws| self.entropy(ws))
|
||||
.fold(f64::MAX, f64::min);
|
||||
if min_e == f64::MAX { 1.0 } else { min_e }
|
||||
}
|
||||
}
|
||||
@@ -1,6 +1,6 @@
|
||||
[package]
|
||||
name = "obikmer"
|
||||
version = "1.1.38"
|
||||
version = "1.1.39"
|
||||
edition = "2024"
|
||||
|
||||
[[bin]]
|
||||
|
||||
@@ -2,14 +2,14 @@ use std::path::PathBuf;
|
||||
|
||||
use clap::Args;
|
||||
use obikindex::{KmerIndex, MergeMode};
|
||||
use obikpartitionner::filter::{MaxTotalCount, MinTotalCount};
|
||||
use obikpartitionner::filter::{MaxTotalCount, MinComplexity, MinTotalCount};
|
||||
use obisys::Reporter;
|
||||
use tracing::info;
|
||||
|
||||
use super::predicate::FilterArgs as KmerFilterArgs;
|
||||
|
||||
#[derive(Args)]
|
||||
pub struct FilterArgs {
|
||||
pub struct FilterCmdArgs {
|
||||
/// Source index directory
|
||||
pub source: PathBuf,
|
||||
|
||||
@@ -28,6 +28,18 @@ pub struct FilterArgs {
|
||||
#[arg(long)]
|
||||
pub max_total_count: Option<u32>,
|
||||
|
||||
/// Minimum normalized entropy (complexity) to keep a k-mer — same metric
|
||||
/// as `obikmer index`'s --theta, applied here to k-mers already committed
|
||||
/// to the source index (reconstructed from unitigs.bin). K-mers scoring
|
||||
/// below this are removed.
|
||||
#[arg(long)]
|
||||
pub min_complexity: Option<f64>,
|
||||
|
||||
/// Maximum sub-word size for the complexity computation (see `obikmer
|
||||
/// index`'s --level-max). Only used when --min-complexity is set.
|
||||
#[arg(long, default_value_t = 6)]
|
||||
pub complexity_level_max: usize,
|
||||
|
||||
/// Output as presence/absence instead of counts
|
||||
#[arg(long)]
|
||||
pub presence: bool,
|
||||
@@ -37,7 +49,7 @@ pub struct FilterArgs {
|
||||
pub force: bool,
|
||||
}
|
||||
|
||||
pub fn run(args: FilterArgs) {
|
||||
pub fn run(args: FilterCmdArgs) {
|
||||
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
|
||||
eprintln!("error opening source index: {e}");
|
||||
std::process::exit(1);
|
||||
@@ -62,6 +74,9 @@ pub fn run(args: FilterArgs) {
|
||||
if let Some(v) = args.max_total_count {
|
||||
filters.push(Box::new(MaxTotalCount { total: v }));
|
||||
}
|
||||
if let Some(theta) = args.min_complexity {
|
||||
filters.push(Box::new(MinComplexity { level_max: args.complexity_level_max, theta }));
|
||||
}
|
||||
|
||||
let mut rep = Reporter::new();
|
||||
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
|
||||
|
||||
@@ -21,7 +21,7 @@ enum Commands {
|
||||
/// Merge multiple built indexes into one
|
||||
Merge(cmd::merge::MergeArgs),
|
||||
/// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates
|
||||
Filter(cmd::filter::FilterArgs),
|
||||
Filter(cmd::filter::FilterCmdArgs),
|
||||
/// Project and/or aggregate genome columns into a new or in-place index
|
||||
Select(cmd::select::SelectArgs),
|
||||
/// Query an index with sequences and annotate matches
|
||||
|
||||
@@ -6,7 +6,6 @@ edition = "2024"
|
||||
[dev-dependencies]
|
||||
tempfile = "3"
|
||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||
obiskbuilder = { path = "../obiskbuilder" }
|
||||
obiread = { path = "../obiread" }
|
||||
obikrope = { path = "../obikrope" }
|
||||
|
||||
@@ -14,6 +13,8 @@ obikrope = { path = "../obikrope" }
|
||||
niffler = "3.0.0"
|
||||
remove_dir_all = "0.8"
|
||||
obikseq = { path = "../obikseq" }
|
||||
obikentropy = { path = "../obikentropy" }
|
||||
obiskbuilder = { path = "../obiskbuilder" }
|
||||
obiskio = { path = "../obiskio" }
|
||||
obidebruinj = { path = "../obidebruinj" }
|
||||
obilayeredmap = { path = "../obilayeredmap" }
|
||||
|
||||
@@ -62,7 +62,7 @@ impl KmerPartition {
|
||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||
if let Some(slot) = mphf.find(kmer) {
|
||||
let row = mat.row(slot);
|
||||
if passes_all(filters, &row, n_genomes) {
|
||||
if passes_all(filters, kmer, &row, n_genomes) {
|
||||
cont = cb(kmer, row);
|
||||
if !cont { break; }
|
||||
}
|
||||
@@ -75,7 +75,7 @@ impl KmerPartition {
|
||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||
if let Some(slot) = mphf.find(kmer) {
|
||||
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
||||
if passes_all(filters, &row, n_genomes) {
|
||||
if passes_all(filters, kmer, &row, n_genomes) {
|
||||
cont = cb(kmer, row);
|
||||
if !cont { break; }
|
||||
}
|
||||
@@ -83,18 +83,19 @@ impl KmerPartition {
|
||||
}
|
||||
cont
|
||||
} else {
|
||||
// No data matrix: implicit presence — all values are 1.
|
||||
// The filter result is identical for every kmer, so evaluate once.
|
||||
// No data matrix: implicit presence — all values are 1. `row`
|
||||
// is identical for every kmer, but a filter can still depend
|
||||
// on the kmer's own sequence (e.g. MinComplexity), so this
|
||||
// cannot be evaluated once for the whole layer — filters must
|
||||
// still be tested per kmer.
|
||||
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
||||
let mut cont = true;
|
||||
if passes_all(filters, &all_present, n_genomes) {
|
||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||
if mphf.find(kmer).is_some() {
|
||||
if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
|
||||
cont = cb(kmer, all_present.clone());
|
||||
if !cont { break; }
|
||||
}
|
||||
}
|
||||
}
|
||||
cont
|
||||
};
|
||||
|
||||
@@ -140,7 +141,7 @@ impl KmerPartition {
|
||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||
if let Some(slot) = mphf.find(kmer) {
|
||||
let row = mat.row(slot);
|
||||
if passes_all(filters, &row, n_genomes) {
|
||||
if passes_all(filters, kmer, &row, n_genomes) {
|
||||
cont = cb(part, layer, kmer, row);
|
||||
if !cont { break; }
|
||||
}
|
||||
@@ -153,7 +154,7 @@ impl KmerPartition {
|
||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||
if let Some(slot) = mphf.find(kmer) {
|
||||
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
||||
if passes_all(filters, &row, n_genomes) {
|
||||
if passes_all(filters, kmer, &row, n_genomes) {
|
||||
cont = cb(part, layer, kmer, row);
|
||||
if !cont { break; }
|
||||
}
|
||||
@@ -161,16 +162,17 @@ impl KmerPartition {
|
||||
}
|
||||
cont
|
||||
} else {
|
||||
// Same as iter_partition_kmers: row is constant but a filter
|
||||
// may still depend on the kmer's own sequence, so this must
|
||||
// be tested per kmer, not once for the whole layer.
|
||||
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
||||
let mut cont = true;
|
||||
if passes_all(filters, &all_present, n_genomes) {
|
||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||
if mphf.find(kmer).is_some() {
|
||||
if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
|
||||
cont = cb(part, layer, kmer, all_present.clone());
|
||||
if !cont { break; }
|
||||
}
|
||||
}
|
||||
}
|
||||
cont
|
||||
};
|
||||
|
||||
|
||||
@@ -1,17 +1,24 @@
|
||||
use obicompactvec::FilterMask;
|
||||
use obikseq::CanonicalKmer;
|
||||
|
||||
/// Trait for kmer row filters.
|
||||
/// Trait for kmer filters.
|
||||
///
|
||||
/// `kmer` is the k-mer's own canonical sequence, reconstructed from the
|
||||
/// source index's `unitigs.bin` (always present — see `rebuild_layer.rs`);
|
||||
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
|
||||
/// `n_genomes` equals `row.len()`.
|
||||
/// `n_genomes` equals `row.len()`. Most filters only need `row` — `kmer` is
|
||||
/// there for filters that reason about the k-mer's sequence itself (e.g.
|
||||
/// [`MinComplexity`]).
|
||||
pub trait KmerFilter: Send + Sync {
|
||||
fn passes(&self, row: &[u32], n_genomes: usize) -> bool;
|
||||
fn passes(&self, kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool;
|
||||
|
||||
/// Express this filter as a [`FilterMask`] column-operation expression.
|
||||
///
|
||||
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix
|
||||
/// column aggregates (no per-kmer row scan needed). Returns `None` if the
|
||||
/// filter requires row-level inspection.
|
||||
/// filter requires row-level inspection — always the case for a filter
|
||||
/// that needs the k-mer's sequence, since a `FilterMask` only expresses
|
||||
/// per-genome column aggregates, never per-slot sequence data.
|
||||
///
|
||||
/// `threshold` semantics in the returned mask use `>= threshold`, matching
|
||||
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
|
||||
@@ -23,8 +30,13 @@ pub trait KmerFilter: Send + Sync {
|
||||
|
||||
/// True when `row` passes every filter in `filters`.
|
||||
/// Returns `true` if `filters` is empty.
|
||||
pub fn passes_all(filters: &[Box<dyn KmerFilter>], row: &[u32], n_genomes: usize) -> bool {
|
||||
filters.iter().all(|f| f.passes(row, n_genomes))
|
||||
pub fn passes_all(
|
||||
filters: &[Box<dyn KmerFilter>],
|
||||
kmer: CanonicalKmer,
|
||||
row: &[u32],
|
||||
n_genomes: usize,
|
||||
) -> bool {
|
||||
filters.iter().all(|f| f.passes(kmer, row, n_genomes))
|
||||
}
|
||||
|
||||
// ── Quorum filters ─────────────────────────────────────────────────────────────
|
||||
@@ -40,7 +52,7 @@ pub struct MinGenomeFraction {
|
||||
}
|
||||
|
||||
impl KmerFilter for MinGenomeFraction {
|
||||
fn passes(&self, row: &[u32], n_genomes: usize) -> bool {
|
||||
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
|
||||
let p = present_count(row, self.threshold);
|
||||
p as f64 / n_genomes as f64 >= self.frac
|
||||
}
|
||||
@@ -63,7 +75,7 @@ pub struct MaxGenomeFraction {
|
||||
}
|
||||
|
||||
impl KmerFilter for MaxGenomeFraction {
|
||||
fn passes(&self, row: &[u32], n_genomes: usize) -> bool {
|
||||
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
|
||||
let p = present_count(row, self.threshold);
|
||||
p as f64 / n_genomes as f64 <= self.frac
|
||||
}
|
||||
@@ -86,7 +98,7 @@ pub struct MinGenomeCount {
|
||||
}
|
||||
|
||||
impl KmerFilter for MinGenomeCount {
|
||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||
present_count(row, self.threshold) >= self.count
|
||||
}
|
||||
|
||||
@@ -107,7 +119,7 @@ pub struct MaxGenomeCount {
|
||||
}
|
||||
|
||||
impl KmerFilter for MaxGenomeCount {
|
||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||
present_count(row, self.threshold) <= self.count
|
||||
}
|
||||
|
||||
@@ -129,7 +141,7 @@ pub struct MinTotalCount {
|
||||
}
|
||||
|
||||
impl KmerFilter for MinTotalCount {
|
||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||
row.iter().sum::<u32>() >= self.total
|
||||
}
|
||||
|
||||
@@ -147,7 +159,7 @@ pub struct MaxTotalCount {
|
||||
}
|
||||
|
||||
impl KmerFilter for MaxTotalCount {
|
||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||
row.iter().sum::<u32>() <= self.total
|
||||
}
|
||||
|
||||
@@ -212,7 +224,7 @@ impl GroupQuorumFilter {
|
||||
}
|
||||
|
||||
impl KmerFilter for GroupQuorumFilter {
|
||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||
if !self.ingroup_idx.is_empty() {
|
||||
let n = self.ingroup_idx.iter()
|
||||
.filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold)
|
||||
@@ -260,3 +272,27 @@ impl KmerFilter for GroupQuorumFilter {
|
||||
Some(FilterMask::And(parts))
|
||||
}
|
||||
}
|
||||
|
||||
// ── Complexity filter (post-hoc, sequence-based) ──────────────────────────────
|
||||
|
||||
/// Reject k-mers with normalized entropy below `theta` — the same complexity
|
||||
/// metric `obikmer index`'s `--theta`/`--level-max` apply *during* superkmer
|
||||
/// construction (see [`obikentropy::KmerEntropy`]), applied here after the
|
||||
/// fact, to k-mers already committed to a built index.
|
||||
///
|
||||
/// Unlike every other filter in this module, this one needs the k-mer's own
|
||||
/// sequence, not its per-genome row — `column_mask_expr` is never overridden
|
||||
/// (stays `None`), so this filter always forces the row-level scan path in
|
||||
/// `rebuild_layer.rs` (which reconstructs the sequence from `unitigs.bin`
|
||||
/// regardless, so no extra I/O beyond what filtering already requires).
|
||||
pub struct MinComplexity {
|
||||
pub level_max: usize,
|
||||
pub theta: f64,
|
||||
}
|
||||
|
||||
impl KmerFilter for MinComplexity {
|
||||
fn passes(&self, kmer: CanonicalKmer, _row: &[u32], _n_genomes: usize) -> bool {
|
||||
use obikentropy::KmerEntropy;
|
||||
kmer.entropy(self.level_max) >= self.theta
|
||||
}
|
||||
}
|
||||
|
||||
@@ -126,7 +126,7 @@ fn iter_src_kmers_masked(
|
||||
Some(m) => m.get(slot),
|
||||
None => {
|
||||
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
||||
filters.iter().all(|f| f.passes(&row, n_genomes))
|
||||
filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
|
||||
}
|
||||
};
|
||||
if passes { cb(kmer); }
|
||||
@@ -165,7 +165,7 @@ fn iter_src_layers(
|
||||
cb(kmer, row.into_boxed_slice());
|
||||
} else {
|
||||
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
||||
if filters.iter().all(|f| f.passes(&row, n_genomes)) {
|
||||
if filters.iter().all(|f| f.passes(kmer, &row, n_genomes)) {
|
||||
cb(kmer, row.into_boxed_slice());
|
||||
}
|
||||
}
|
||||
|
||||
@@ -7,7 +7,13 @@ edition = "2024"
|
||||
obikseq = { path = "../obikseq" }
|
||||
obikrope = { path = "../obikrope" }
|
||||
obiread = { path = "../obiread" }
|
||||
obikentropy = { path = "../obikentropy" }
|
||||
lazy_static = "1.5.0"
|
||||
|
||||
[dev-dependencies]
|
||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||
criterion2 = { version = "3", features = ["cargo_bench_support"] }
|
||||
|
||||
[[bench]]
|
||||
name = "superkmer_stream"
|
||||
harness = false
|
||||
|
||||
@@ -0,0 +1,58 @@
|
||||
//! Throughput of the streaming superkmer pipeline (`RollingStat`'s hot path:
|
||||
//! minimizer selection + entropy tracking fused in a single pass).
|
||||
//!
|
||||
//! Reference point for the `obikentropy` extraction: the entropy bookkeeping
|
||||
//! that used to live inline in `RollingStat` was pulled out into a composed
|
||||
//! `EntropyTracker`. This benchmark is run before and after that change to
|
||||
//! confirm no regression.
|
||||
|
||||
use criterion::{Criterion, Throughput, criterion_group, criterion_main};
|
||||
use obikrope::Rope;
|
||||
use obiskbuilder::SuperKmerIter;
|
||||
|
||||
const K: usize = 21;
|
||||
const M: usize = 9;
|
||||
const LEVEL_MAX: usize = 6;
|
||||
const THETA: f64 = 0.7;
|
||||
const SEQ_LEN: usize = 200_000;
|
||||
|
||||
/// Deterministic pseudo-random ACGT sequence — high enough complexity that
|
||||
/// the entropy filter rarely rejects, so the bench stays on the steady-state
|
||||
/// path rather than repeatedly resetting.
|
||||
fn make_sequence(len: usize) -> Vec<u8> {
|
||||
let mut state: u64 = 0x9E3779B97F4A7C15;
|
||||
(0..len)
|
||||
.map(|_| {
|
||||
state ^= state << 13;
|
||||
state ^= state >> 7;
|
||||
state ^= state << 17;
|
||||
b"ACGT"[(state % 4) as usize]
|
||||
})
|
||||
.collect()
|
||||
}
|
||||
|
||||
fn make_rope(seq: &[u8]) -> Rope {
|
||||
let mut rope = Rope::new(None);
|
||||
rope.push(seq.to_vec());
|
||||
rope
|
||||
}
|
||||
|
||||
fn bench_build_superkmers(c: &mut Criterion) {
|
||||
obikseq::set_k(K);
|
||||
obikseq::set_m(M);
|
||||
|
||||
let seq = make_sequence(SEQ_LEN);
|
||||
let rope = make_rope(&seq);
|
||||
|
||||
let mut group = c.benchmark_group("build_superkmers");
|
||||
group.throughput(Throughput::Bytes(SEQ_LEN as u64));
|
||||
group.bench_function("stream", |b| {
|
||||
b.iter(|| {
|
||||
SuperKmerIter::new(std::hint::black_box(&rope), K, LEVEL_MAX, THETA).count()
|
||||
});
|
||||
});
|
||||
group.finish();
|
||||
}
|
||||
|
||||
criterion_group!(benches, bench_build_superkmers);
|
||||
criterion_main!(benches);
|
||||
@@ -1,108 +0,0 @@
|
||||
pub(crate) const NORMK1: [u64; 4] = build_normalized_kmer::<4>();
|
||||
pub(crate) const NORMK2: [u64; 16] = build_normalized_kmer::<16>();
|
||||
pub(crate) const NORMK3: [u64; 64] = build_normalized_kmer::<64>();
|
||||
pub(crate) const NORMK4: [u64; 256] = build_normalized_kmer::<256>();
|
||||
pub(crate) const NORMK5: [u64; 1024] = build_normalized_kmer::<1024>();
|
||||
pub(crate) const NORMK6: [u64; 4096] = build_normalized_kmer::<4096>();
|
||||
|
||||
include!(concat!(env!("OUT_DIR"), "/ln_class_tables.rs"));
|
||||
|
||||
const fn normalize_circular(kmer: u64, ws: usize) -> u64 {
|
||||
let mask = (1u64 << (ws * 2)) - 1;
|
||||
let mut canonical = kmer & mask;
|
||||
let mut current = canonical;
|
||||
let mut i = 0;
|
||||
while i < (ws - 1) {
|
||||
let top = (current >> ((ws - 1) * 2)) & 3;
|
||||
current = ((current << 2) | top) & mask;
|
||||
if current < canonical {
|
||||
canonical = current;
|
||||
}
|
||||
i += 1;
|
||||
}
|
||||
canonical
|
||||
}
|
||||
|
||||
const fn build_normalized_kmer<const N: usize>() -> [u64; N] {
|
||||
let mut result = [0u64; N];
|
||||
let k = k_from_n::<N>();
|
||||
let shift = 64 - k * 2;
|
||||
let mut i = 0;
|
||||
while i < N {
|
||||
let la = (i as u64) << shift;
|
||||
let ra = i as u64;
|
||||
let rc_ra = revcomp_raw(la, k) >> shift;
|
||||
let circ = normalize_circular(ra, k);
|
||||
let circ_rc = normalize_circular(rc_ra, k);
|
||||
result[i] = if circ < circ_rc { circ } else { circ_rc };
|
||||
i += 1;
|
||||
}
|
||||
result
|
||||
}
|
||||
|
||||
const fn revcomp_raw(x: u64, k: usize) -> u64 {
|
||||
let x = !x;
|
||||
let x = x.swap_bytes();
|
||||
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
|
||||
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
|
||||
x << (64 - 2 * k)
|
||||
}
|
||||
|
||||
const fn k_from_n<const N: usize>() -> usize {
|
||||
match N {
|
||||
4 => 1,
|
||||
16 => 2,
|
||||
64 => 3,
|
||||
256 => 4,
|
||||
1024 => 5,
|
||||
4096 => 6,
|
||||
_ => panic!("N must be a power of 4"),
|
||||
}
|
||||
}
|
||||
|
||||
pub(crate) const WS_MAX: usize = 6;
|
||||
|
||||
#[inline(always)]
|
||||
pub(crate) const fn n_log_n(n: usize) -> f64 {
|
||||
N_LOG_N[n]
|
||||
}
|
||||
|
||||
#[inline(always)]
|
||||
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
|
||||
EMAX[k][ws]
|
||||
}
|
||||
|
||||
#[inline(always)]
|
||||
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
|
||||
LOG_NWORDS[k][ws]
|
||||
}
|
||||
|
||||
#[inline(always)]
|
||||
pub(crate) const fn entropy_norm_kmer<const LEFT: bool, const K: usize>(kmer: u64) -> u64 {
|
||||
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
|
||||
const NORM: [&[u64]; 7] = [&[], &NORMK1, &NORMK2, &NORMK3, &NORMK4, &NORMK5, &NORMK6];
|
||||
|
||||
let shift = SHIFT[K];
|
||||
let ra = if LEFT { kmer >> shift } else { kmer };
|
||||
let canonical_ra = NORM[K][ra as usize];
|
||||
if LEFT {
|
||||
canonical_ra << shift
|
||||
} else {
|
||||
canonical_ra
|
||||
}
|
||||
}
|
||||
|
||||
#[inline(always)]
|
||||
pub(crate) const fn ln_class_size<const LEFT: bool, const K: usize>(kmer: u64) -> f64 {
|
||||
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
|
||||
let ra = if LEFT { kmer >> SHIFT[K] } else { kmer };
|
||||
match K {
|
||||
1 => LN_CLASS1[ra as usize],
|
||||
2 => LN_CLASS2[ra as usize],
|
||||
3 => LN_CLASS3[ra as usize],
|
||||
4 => LN_CLASS4[ra as usize],
|
||||
5 => LN_CLASS5[ra as usize],
|
||||
6 => LN_CLASS6[ra as usize],
|
||||
_ => panic!("k must be 1..=6"),
|
||||
}
|
||||
}
|
||||
@@ -149,157 +149,5 @@ impl Iterator for SuperKmerIter<'_> {
|
||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
#[cfg(test)]
|
||||
mod tests {
|
||||
use super::*;
|
||||
use obikrope::Rope;
|
||||
|
||||
fn setup() {
|
||||
obikseq::params::set_k(K);
|
||||
obikseq::params::set_m(5);
|
||||
}
|
||||
|
||||
fn make_rope(data: &[u8]) -> Rope {
|
||||
let mut r = Rope::new(None);
|
||||
r.push(data.to_vec());
|
||||
r
|
||||
}
|
||||
|
||||
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
|
||||
let rope = make_rope(data);
|
||||
SuperKmerIter::new(&rope, k, 1, 0.0)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect()
|
||||
}
|
||||
|
||||
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
|
||||
const K: usize = 11;
|
||||
|
||||
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
|
||||
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
|
||||
(0..seq.len().saturating_sub(K - 1))
|
||||
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
|
||||
.collect()
|
||||
}
|
||||
|
||||
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
|
||||
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
|
||||
SuperKmerIter::new(rope, K, 1, 0.0)
|
||||
.flat_map(|rsk| {
|
||||
rsk.superkmer()
|
||||
.iter_canonical_kmers()
|
||||
.map(|km| km.to_ascii())
|
||||
.collect::<Vec<_>>()
|
||||
})
|
||||
.collect()
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn coverage_single_segment() {
|
||||
setup();
|
||||
let seq = b"ACGTACGTACGTACGTACGT";
|
||||
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
|
||||
let direct = direct_canonical_kmers(seq);
|
||||
let from_iter = iter_canonical_kmers(&rope);
|
||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||
assert!(
|
||||
missing.is_empty(),
|
||||
"k-mers perdus dans segment unique : {missing:?}"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn coverage_two_segments() {
|
||||
setup();
|
||||
let seg1 = b"ACGTACGTACGTACGTACGT";
|
||||
let seg2 = b"TGCATGCATGCATGCATGCA";
|
||||
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
|
||||
let mut direct = direct_canonical_kmers(seg1);
|
||||
direct.extend(direct_canonical_kmers(seg2));
|
||||
let from_iter = iter_canonical_kmers(&rope);
|
||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||
assert!(
|
||||
missing.is_empty(),
|
||||
"k-mers perdus dans deux segments : {missing:?}"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn coverage_minimizer_boundary() {
|
||||
setup();
|
||||
// sequence assez longue pour forcer plusieurs changements de minimiseur
|
||||
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
|
||||
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
|
||||
let direct = direct_canonical_kmers(&seq);
|
||||
let from_iter = iter_canonical_kmers(&rope);
|
||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||
assert!(
|
||||
missing.is_empty(),
|
||||
"k-mers perdus à la frontière de minimiseur : {missing:?}"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn single_segment_one_superkmer() {
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
|
||||
assert!(!out.is_empty());
|
||||
let total: Vec<u8> = out.into_iter().flatten().collect();
|
||||
assert!(total.len() >= K);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn segment_shorter_than_k_emits_nothing() {
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGT\x00", K);
|
||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn empty_input_emits_nothing() {
|
||||
setup();
|
||||
let out = run_nofilter(b"", K);
|
||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn two_segments_both_emitted() {
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
|
||||
assert!(!out.is_empty());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn low_complexity_kmer_is_rejected() {
|
||||
setup();
|
||||
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
|
||||
assert!(!out_pass.is_empty());
|
||||
|
||||
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
|
||||
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect();
|
||||
assert!(out_reject.is_empty());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn multi_slice_rope() {
|
||||
setup();
|
||||
let data = b"ACGTACGTACGTACGTACGT\x00";
|
||||
let mid = data.len() / 2;
|
||||
let mut rope = Rope::new(None);
|
||||
rope.push(data[..mid].to_vec());
|
||||
rope.push(data[mid..].to_vec());
|
||||
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect();
|
||||
assert!(!out.is_empty());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn yields_minimizer_value() {
|
||||
setup();
|
||||
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
|
||||
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
|
||||
assert!(!results.is_empty());
|
||||
}
|
||||
}
|
||||
#[path = "tests/iter.rs"]
|
||||
mod tests;
|
||||
|
||||
@@ -10,7 +10,6 @@ pub mod stream_iter;
|
||||
mod scratch;
|
||||
|
||||
pub(crate) mod encoding;
|
||||
pub(crate) mod entropy_table;
|
||||
pub(crate) mod rolling_stat;
|
||||
|
||||
pub use iter::SuperKmerIter;
|
||||
|
||||
@@ -1,8 +1,8 @@
|
||||
use obikentropy::EntropyTracker;
|
||||
use obikseq::kmer::{Minimizer, hash_kmer};
|
||||
use obikseq::params;
|
||||
|
||||
use crate::encoding::encode_nuc;
|
||||
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
|
||||
|
||||
// ── Stack-allocated ring buffer ───────────────────────────────────────────────
|
||||
|
||||
@@ -83,33 +83,19 @@ pub struct RollingStat {
|
||||
entropy_max_k: usize,
|
||||
k: usize,
|
||||
m: usize,
|
||||
steady: bool,
|
||||
rolling_k: u64,
|
||||
rolling_rck: u64,
|
||||
k_mask: u64,
|
||||
m_mask: u64,
|
||||
received: usize,
|
||||
|
||||
// Sliding-window queues — stack-allocated, capacity ≤ k ≤ 31.
|
||||
k1q: Ring<u64, 32>,
|
||||
k2q: Ring<u64, 32>,
|
||||
k3q: Ring<u64, 32>,
|
||||
k4q: Ring<u64, 32>,
|
||||
k5q: Ring<u64, 32>,
|
||||
k6q: Ring<u64, 32>,
|
||||
// Minimizer selection state.
|
||||
minimier: Ring<MmerItem, 32>,
|
||||
|
||||
// Frequency count arrays.
|
||||
// Max count per cell ≤ k ≤ 31 → u8 is sufficient.
|
||||
k1c: [u8; 4],
|
||||
k2c: [u8; 16],
|
||||
k3c: [u8; 64],
|
||||
k4c: [u8; 256],
|
||||
k5c: [u8; 1024],
|
||||
k6c: [u8; 4096],
|
||||
|
||||
sum_f_log_f: [f64; WS_MAX + 1],
|
||||
sum_f_log_s: [f64; WS_MAX + 1],
|
||||
// Entropy tracking, composed as a plain inline field so both concerns
|
||||
// update in the same streaming pass without being conflated in one
|
||||
// struct — see `obikentropy::EntropyTracker`.
|
||||
entropy: EntropyTracker,
|
||||
}
|
||||
|
||||
impl RollingStat {
|
||||
@@ -120,27 +106,13 @@ impl RollingStat {
|
||||
entropy_max_k,
|
||||
k,
|
||||
m,
|
||||
steady: false,
|
||||
rolling_k: 0,
|
||||
rolling_rck: 0,
|
||||
k_mask: (!0u64) >> (64 - k * 2),
|
||||
m_mask: (!0u64) >> (64 - m * 2),
|
||||
received: 0,
|
||||
k1q: Ring::new(),
|
||||
k2q: Ring::new(),
|
||||
k3q: Ring::new(),
|
||||
k4q: Ring::new(),
|
||||
k5q: Ring::new(),
|
||||
k6q: Ring::new(),
|
||||
minimier: Ring::new(),
|
||||
k1c: [0; 4],
|
||||
k2c: [0; 16],
|
||||
k3c: [0; 64],
|
||||
k4c: [0; 256],
|
||||
k5c: [0; 1024],
|
||||
k6c: [0; 4096],
|
||||
sum_f_log_f: [0.0; WS_MAX + 1],
|
||||
sum_f_log_s: [0.0; WS_MAX + 1],
|
||||
entropy: EntropyTracker::new(k),
|
||||
}
|
||||
}
|
||||
|
||||
@@ -148,54 +120,9 @@ impl RollingStat {
|
||||
self.rolling_k = 0;
|
||||
self.rolling_rck = 0;
|
||||
self.received = 0;
|
||||
self.steady = false;
|
||||
|
||||
// for i in self.k1q.iter() { self.k1c[i as usize] = 0; }
|
||||
// for i in self.k2q.iter() { self.k2c[i as usize] = 0; }
|
||||
// for i in self.k3q.iter() { self.k3c[i as usize] = 0; }
|
||||
// for i in self.k4q.iter() { self.k4c[i as usize] = 0; }
|
||||
// for i in self.k5q.iter() { self.k5c[i as usize] = 0; }
|
||||
// for i in self.k6q.iter() { self.k6c[i as usize] = 0; }
|
||||
|
||||
self.k1c.fill(0);
|
||||
self.k2c.fill(0);
|
||||
self.k3c.fill(0);
|
||||
self.k4c.fill(0);
|
||||
self.k5c.fill(0);
|
||||
self.k6c.fill(0);
|
||||
|
||||
self.k1q.clear();
|
||||
self.k2q.clear();
|
||||
self.k3q.clear();
|
||||
self.k4q.clear();
|
||||
self.k5q.clear();
|
||||
self.k6q.clear();
|
||||
self.minimier.clear();
|
||||
|
||||
self.sum_f_log_f = [0.0; WS_MAX + 1];
|
||||
self.sum_f_log_s = [0.0; WS_MAX + 1];
|
||||
}
|
||||
|
||||
#[inline]
|
||||
fn update_sums_decrement<const K: usize>(
|
||||
sum_f_log_f: &mut [f64; WS_MAX + 1],
|
||||
sum_f_log_s: &mut [f64; WS_MAX + 1],
|
||||
canonical: u64,
|
||||
f: usize,
|
||||
) {
|
||||
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
|
||||
sum_f_log_s[K] -= ln_class_size::<false, K>(canonical);
|
||||
}
|
||||
|
||||
#[inline]
|
||||
fn update_sums_increment<const K: usize>(
|
||||
sum_f_log_f: &mut [f64; WS_MAX + 1],
|
||||
sum_f_log_s: &mut [f64; WS_MAX + 1],
|
||||
canonical: u64,
|
||||
g: usize,
|
||||
) {
|
||||
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
|
||||
sum_f_log_s[K] += ln_class_size::<false, K>(canonical);
|
||||
self.entropy.reset();
|
||||
}
|
||||
|
||||
pub fn push(&mut self, nuc: u8) {
|
||||
@@ -209,13 +136,6 @@ impl RollingStat {
|
||||
self.rolling_rck =
|
||||
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
|
||||
|
||||
let canonical_k1 = entropy_norm_kmer::<false, 1>(self.rolling_k & 3);
|
||||
let canonical_k2 = entropy_norm_kmer::<false, 2>(self.rolling_k & 15);
|
||||
let canonical_k3 = entropy_norm_kmer::<false, 3>(self.rolling_k & 63);
|
||||
let canonical_k4 = entropy_norm_kmer::<false, 4>(self.rolling_k & 255);
|
||||
let canonical_k5 = entropy_norm_kmer::<false, 5>(self.rolling_k & 1023);
|
||||
let canonical_k6 = entropy_norm_kmer::<false, 6>(self.rolling_k & 4095);
|
||||
|
||||
self.received += 1;
|
||||
|
||||
if self.received >= m {
|
||||
@@ -248,153 +168,7 @@ impl RollingStat {
|
||||
}
|
||||
}
|
||||
|
||||
if self.received > k {
|
||||
let old1 = self.k1q.pop_front();
|
||||
let f1 = self.k1c[old1 as usize] as usize;
|
||||
Self::update_sums_decrement::<1>(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
old1,
|
||||
f1,
|
||||
);
|
||||
self.k1c[old1 as usize] -= 1;
|
||||
|
||||
let old2 = self.k2q.pop_front();
|
||||
let f2 = self.k2c[old2 as usize] as usize;
|
||||
Self::update_sums_decrement::<2>(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
old2,
|
||||
f2,
|
||||
);
|
||||
self.k2c[old2 as usize] -= 1;
|
||||
|
||||
let old3 = self.k3q.pop_front();
|
||||
let f3 = self.k3c[old3 as usize] as usize;
|
||||
Self::update_sums_decrement::<3>(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
old3,
|
||||
f3,
|
||||
);
|
||||
self.k3c[old3 as usize] -= 1;
|
||||
|
||||
let old4 = self.k4q.pop_front();
|
||||
let f4 = self.k4c[old4 as usize] as usize;
|
||||
Self::update_sums_decrement::<4>(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
old4,
|
||||
f4,
|
||||
);
|
||||
self.k4c[old4 as usize] -= 1;
|
||||
|
||||
let old5 = self.k5q.pop_front();
|
||||
let f5 = self.k5c[old5 as usize] as usize;
|
||||
Self::update_sums_decrement::<5>(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
old5,
|
||||
f5,
|
||||
);
|
||||
self.k5c[old5 as usize] -= 1;
|
||||
|
||||
let old6 = self.k6q.pop_front();
|
||||
let f6 = self.k6c[old6 as usize] as usize;
|
||||
Self::update_sums_decrement::<6>(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
old6,
|
||||
f6,
|
||||
);
|
||||
self.k6c[old6 as usize] -= 1;
|
||||
}
|
||||
|
||||
if self.steady {
|
||||
let g1 = self.k1c[canonical_k1 as usize] as usize;
|
||||
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
|
||||
self.k1c[canonical_k1 as usize] += 1;
|
||||
self.k1q.push_back(canonical_k1);
|
||||
|
||||
let g2 = self.k2c[canonical_k2 as usize] as usize;
|
||||
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
|
||||
self.k2c[canonical_k2 as usize] += 1;
|
||||
self.k2q.push_back(canonical_k2);
|
||||
|
||||
let g3 = self.k3c[canonical_k3 as usize] as usize;
|
||||
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
|
||||
self.k3c[canonical_k3 as usize] += 1;
|
||||
self.k3q.push_back(canonical_k3);
|
||||
|
||||
let g4 = self.k4c[canonical_k4 as usize] as usize;
|
||||
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
|
||||
self.k4c[canonical_k4 as usize] += 1;
|
||||
self.k4q.push_back(canonical_k4);
|
||||
|
||||
let g5 = self.k5c[canonical_k5 as usize] as usize;
|
||||
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
|
||||
self.k5c[canonical_k5 as usize] += 1;
|
||||
self.k5q.push_back(canonical_k5);
|
||||
|
||||
let g6 = self.k6c[canonical_k6 as usize] as usize;
|
||||
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
|
||||
self.k6c[canonical_k6 as usize] += 1;
|
||||
self.k6q.push_back(canonical_k6);
|
||||
} else {
|
||||
self.push_warmup_increments(
|
||||
canonical_k1, canonical_k2, canonical_k3,
|
||||
canonical_k4, canonical_k5, canonical_k6,
|
||||
);
|
||||
}
|
||||
}
|
||||
|
||||
#[cold]
|
||||
#[inline(never)]
|
||||
fn push_warmup_increments(
|
||||
&mut self,
|
||||
canonical_k1: u64, canonical_k2: u64, canonical_k3: u64,
|
||||
canonical_k4: u64, canonical_k5: u64, canonical_k6: u64,
|
||||
) {
|
||||
let g1 = self.k1c[canonical_k1 as usize] as usize;
|
||||
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
|
||||
self.k1c[canonical_k1 as usize] += 1;
|
||||
self.k1q.push_back(canonical_k1);
|
||||
|
||||
if self.received >= 2 {
|
||||
let g2 = self.k2c[canonical_k2 as usize] as usize;
|
||||
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
|
||||
self.k2c[canonical_k2 as usize] += 1;
|
||||
self.k2q.push_back(canonical_k2);
|
||||
|
||||
if self.received >= 3 {
|
||||
let g3 = self.k3c[canonical_k3 as usize] as usize;
|
||||
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
|
||||
self.k3c[canonical_k3 as usize] += 1;
|
||||
self.k3q.push_back(canonical_k3);
|
||||
|
||||
if self.received >= 4 {
|
||||
let g4 = self.k4c[canonical_k4 as usize] as usize;
|
||||
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
|
||||
self.k4c[canonical_k4 as usize] += 1;
|
||||
self.k4q.push_back(canonical_k4);
|
||||
|
||||
if self.received >= 5 {
|
||||
let g5 = self.k5c[canonical_k5 as usize] as usize;
|
||||
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
|
||||
self.k5c[canonical_k5 as usize] += 1;
|
||||
self.k5q.push_back(canonical_k5);
|
||||
|
||||
if self.received >= 6 {
|
||||
let g6 = self.k6c[canonical_k6 as usize] as usize;
|
||||
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
|
||||
self.k6c[canonical_k6 as usize] += 1;
|
||||
self.k6q.push_back(canonical_k6);
|
||||
self.steady = true;
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
self.entropy.push(self.received, self.rolling_k);
|
||||
}
|
||||
|
||||
pub fn ready(&self) -> bool {
|
||||
@@ -426,25 +200,13 @@ impl RollingStat {
|
||||
if !self.ready() {
|
||||
return None;
|
||||
}
|
||||
let k = self.k;
|
||||
let em = emax(k, order);
|
||||
if em <= 0.0 {
|
||||
return Some(1.0);
|
||||
}
|
||||
let nwords = k - order + 1;
|
||||
let log_nw = log_nwords(k, order);
|
||||
let nw_f = nwords as f64;
|
||||
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
|
||||
Some((h_corr / em).max(0.0))
|
||||
Some(self.entropy.entropy(order))
|
||||
}
|
||||
|
||||
pub fn normalized_entropy(&self) -> Option<f64> {
|
||||
if !self.ready() {
|
||||
return None;
|
||||
}
|
||||
let min_e = (1..=self.entropy_max_k)
|
||||
.filter_map(|ws| self.entropy(ws))
|
||||
.fold(f64::MAX, f64::min);
|
||||
Some(if min_e == f64::MAX { 1.0 } else { min_e })
|
||||
Some(self.entropy.normalized_entropy(self.entropy_max_k))
|
||||
}
|
||||
}
|
||||
|
||||
@@ -0,0 +1,152 @@
|
||||
use super::*;
|
||||
use obikrope::Rope;
|
||||
|
||||
fn setup() {
|
||||
obikseq::params::set_k(K);
|
||||
obikseq::params::set_m(5);
|
||||
}
|
||||
|
||||
fn make_rope(data: &[u8]) -> Rope {
|
||||
let mut r = Rope::new(None);
|
||||
r.push(data.to_vec());
|
||||
r
|
||||
}
|
||||
|
||||
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
|
||||
let rope = make_rope(data);
|
||||
SuperKmerIter::new(&rope, k, 1, 0.0)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect()
|
||||
}
|
||||
|
||||
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
|
||||
const K: usize = 11;
|
||||
|
||||
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
|
||||
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
|
||||
(0..seq.len().saturating_sub(K - 1))
|
||||
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
|
||||
.collect()
|
||||
}
|
||||
|
||||
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
|
||||
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
|
||||
SuperKmerIter::new(rope, K, 1, 0.0)
|
||||
.flat_map(|rsk| {
|
||||
rsk.superkmer()
|
||||
.iter_canonical_kmers()
|
||||
.map(|km| km.to_ascii())
|
||||
.collect::<Vec<_>>()
|
||||
})
|
||||
.collect()
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn coverage_single_segment() {
|
||||
setup();
|
||||
let seq = b"ACGTACGTACGTACGTACGT";
|
||||
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
|
||||
let direct = direct_canonical_kmers(seq);
|
||||
let from_iter = iter_canonical_kmers(&rope);
|
||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||
assert!(
|
||||
missing.is_empty(),
|
||||
"k-mers perdus dans segment unique : {missing:?}"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn coverage_two_segments() {
|
||||
setup();
|
||||
let seg1 = b"ACGTACGTACGTACGTACGT";
|
||||
let seg2 = b"TGCATGCATGCATGCATGCA";
|
||||
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
|
||||
let mut direct = direct_canonical_kmers(seg1);
|
||||
direct.extend(direct_canonical_kmers(seg2));
|
||||
let from_iter = iter_canonical_kmers(&rope);
|
||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||
assert!(
|
||||
missing.is_empty(),
|
||||
"k-mers perdus dans deux segments : {missing:?}"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn coverage_minimizer_boundary() {
|
||||
setup();
|
||||
// sequence assez longue pour forcer plusieurs changements de minimiseur
|
||||
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
|
||||
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
|
||||
let direct = direct_canonical_kmers(&seq);
|
||||
let from_iter = iter_canonical_kmers(&rope);
|
||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||
assert!(
|
||||
missing.is_empty(),
|
||||
"k-mers perdus à la frontière de minimiseur : {missing:?}"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn single_segment_one_superkmer() {
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
|
||||
assert!(!out.is_empty());
|
||||
let total: Vec<u8> = out.into_iter().flatten().collect();
|
||||
assert!(total.len() >= K);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn segment_shorter_than_k_emits_nothing() {
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGT\x00", K);
|
||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn empty_input_emits_nothing() {
|
||||
setup();
|
||||
let out = run_nofilter(b"", K);
|
||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn two_segments_both_emitted() {
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
|
||||
assert!(!out.is_empty());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn low_complexity_kmer_is_rejected() {
|
||||
setup();
|
||||
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
|
||||
assert!(!out_pass.is_empty());
|
||||
|
||||
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
|
||||
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect();
|
||||
assert!(out_reject.is_empty());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn multi_slice_rope() {
|
||||
setup();
|
||||
let data = b"ACGTACGTACGTACGTACGT\x00";
|
||||
let mid = data.len() / 2;
|
||||
let mut rope = Rope::new(None);
|
||||
rope.push(data[..mid].to_vec());
|
||||
rope.push(data[mid..].to_vec());
|
||||
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect();
|
||||
assert!(!out.is_empty());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn yields_minimizer_value() {
|
||||
setup();
|
||||
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
|
||||
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
|
||||
assert!(!results.is_empty());
|
||||
}
|
||||
Reference in New Issue
Block a user