Compare commits
3
Commits
442f7a9e4c
...
v1.1.44
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
c95c47155e | ||
|
|
4f6d442688 | ||
|
|
e6f0ca472c |
@@ -25,12 +25,6 @@ jobs:
|
|||||||
~/.cargo/registry
|
~/.cargo/registry
|
||||||
~/.cargo/git
|
~/.cargo/git
|
||||||
src/target
|
src/target
|
||||||
# v2: bump this salt to force a clean cache when a stuck/killed job
|
|
||||||
# may have saved a corrupted incremental-compilation `src/target`
|
|
||||||
# (observed 2026-08-11: a stale test binary deadlocked in NUMA
|
|
||||||
# worker startup; a from-scratch rebuild of the same source fixed
|
|
||||||
# it instantly, pointing at cache corruption rather than a source
|
|
||||||
# bug).
|
|
||||||
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
|
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
|
||||||
restore-keys: ${{ runner.os }}-cargo-v2-
|
restore-keys: ${{ runner.os }}-cargo-v2-
|
||||||
|
|
||||||
|
|||||||
@@ -24,3 +24,5 @@ benchmark/reference_dist
|
|||||||
benchmark/obikmer_dist
|
benchmark/obikmer_dist
|
||||||
benchmark/specific_index_count
|
benchmark/specific_index_count
|
||||||
benchmark/specific_index_presence
|
benchmark/specific_index_presence
|
||||||
|
TNT
|
||||||
|
phyg
|
||||||
|
|||||||
@@ -377,6 +377,175 @@ the pairwise-distance projection preserves the phylogenetic signal;
|
|||||||
disagreement would pinpoint exactly what the projection to a single number
|
disagreement would pinpoint exactly what the projection to a single number
|
||||||
per pair loses. Not yet run.
|
per pair loses. Not yet run.
|
||||||
|
|
||||||
|
### A concrete Sankoff cost matrix for the 16-state alphabet
|
||||||
|
|
||||||
|
**Set-edit-distance formula.** For two states `X, Y ⊆ {A,C,G,T}`, split into
|
||||||
|
`seulement_X = X \ Y` (size `a`) and `seulement_Y = Y \ X` (size `b`).
|
||||||
|
Elements present in both cost nothing. Pair up to `min(a,b)` of the
|
||||||
|
remaining elements as **substitutions** (cheaper than treating them as an
|
||||||
|
unrelated loss + gain whenever `c_sub < 2*c_gl`, which any sane parameter
|
||||||
|
choice satisfies); whatever is left over after pairing is a pure
|
||||||
|
**gain/loss**:
|
||||||
|
|
||||||
|
```
|
||||||
|
cost(X,Y) = min(a,b)*c_sub + |a-b|*c_gl
|
||||||
|
```
|
||||||
|
|
||||||
|
Worked examples (`c_sub = c_gl = 1`): `{A}->{C}` = 1 (one substitution);
|
||||||
|
`{A}->{A,C}` = 1 (one gain, no substitution pair available since nothing is
|
||||||
|
only-in-Y that matches an only-in-X element after the shared `A` is
|
||||||
|
excluded); `{A,C}->{G,T}` = 2 (two substitution pairs, `A/C` vs `G/T`, both
|
||||||
|
same-size sets share nothing); `{A,C,G}->{A,C,T}` = 1 (`G`/`T` is the only
|
||||||
|
mismatched pair, `A,C` shared).
|
||||||
|
|
||||||
|
**`∅` is a flat-cost special case, not a instance of the general formula.**
|
||||||
|
Applying the formula naively to e.g. `{A,C,G} -> ∅` would charge `3*c_gl`
|
||||||
|
(three independent losses). Reject that: total context disappearance
|
||||||
|
(flank-breaking, or true structural loss) is plausibly **one** event, not
|
||||||
|
`|X|` of them, so:
|
||||||
|
|
||||||
|
```
|
||||||
|
cost(X, ∅) = cost(∅, X) = c_ctx (constant, independent of |X|)
|
||||||
|
cost(∅, ∅) = 0
|
||||||
|
```
|
||||||
|
|
||||||
|
`c_ctx` should not be guessed — it is exactly the value already derived for
|
||||||
|
the `>1` bucket in "Context, detectability, and a 3-way ordinal distance per
|
||||||
|
pair" above (`(2m*p_hat)/(1-(1-p_hat)^(2m)) + p_hat`), reused rather than
|
||||||
|
invented.
|
||||||
|
|
||||||
|
**Better construction method: shortest path in a small state graph, not the
|
||||||
|
closed-form formula directly.** Build a graph on the 16 states with two edge
|
||||||
|
types — substitution edges between same-cardinality sets differing by one
|
||||||
|
element (weight `c_sub`, or `c_ts`/`c_tv` if split further below), and
|
||||||
|
gain/loss edges between sets whose cardinality differs by one (weight
|
||||||
|
`c_gl`) — then define `cost(X,Y)` as shortest-path distance in that graph,
|
||||||
|
precomputed once (16 nodes, trivial) into a dense 16x16 matrix before
|
||||||
|
feeding it to Sankoff/TNT. Verified equivalent to the closed-form formula
|
||||||
|
above in the uniform-cost case (checked by hand on `{A}->{C,G,T}`: both give
|
||||||
|
`c_sub + 2*c_gl`). The graph construction is not just a reformulation for
|
||||||
|
its own sake: it is the version that generalises correctly once substitution
|
||||||
|
costs stop being uniform (next point) — the closed-form's `min(a,b)`
|
||||||
|
counting silently assumes *any* pairing costs the same, which breaks the
|
||||||
|
moment `c_sub` depends on which two bases are involved.
|
||||||
|
|
||||||
|
**Transition/transversion refinement.** Split `c_sub` into `c_ts` (A<->G or
|
||||||
|
C<->T) and `c_tv` (the other four pairs) — already well-defined in canonical
|
||||||
|
space (see "Canonical invariance" above: a transition maps to a transition,
|
||||||
|
a transversion to a transversion, regardless of orientation). This turns
|
||||||
|
"pick `min(a,b)` substitution pairs" into a genuine (tiny, <=4 elements per
|
||||||
|
side, trivially enumerable) minimum-cost bipartite matching problem instead
|
||||||
|
of a plain count — the state-graph shortest-path construction handles this
|
||||||
|
automatically, no separate logic needed. Calibration is not a guess either:
|
||||||
|
the "Sufficient statistic: 4x4 base-pair tally" section below already plans
|
||||||
|
to collect the joint `(centre_i, centre_j)` distribution over resolved (`0`
|
||||||
|
or `1`) sites — that tally directly gives the empirical Ts/Tv ratio, from
|
||||||
|
which `c_ts`/`c_tv` follow (e.g. `cost ∝ -log(observed rate)`, the standard
|
||||||
|
generalised-parsimony step-weighting heuristic), reusing a statistic already
|
||||||
|
planned rather than adding a new one.
|
||||||
|
|
||||||
|
**`gamma`/`mu` (i.e. `c_gl`/`c_sub`) sensitivity sweep before calibration.**
|
||||||
|
No strong prior on whether gain/loss events should cost more or less than a
|
||||||
|
point substitution — duplication/deletion rates are not a priori equal to
|
||||||
|
point-mutation rates, but the direction isn't obvious, and setting it too
|
||||||
|
high risks the parsimony search *eliminating* exactly the
|
||||||
|
heterozygosity/paralogy signal the design is meant to tolerate (see
|
||||||
|
"Heterozygosity, ploidy..." below). Cheap first step: run the topology at a
|
||||||
|
handful of ratios (`0.5, 1, 2, 5`) and check whether it's stable — a robust
|
||||||
|
topology across that range is far more trustworthy than one built on a
|
||||||
|
single, unvalidated guess. Empirical calibration of `c_gl` from the
|
||||||
|
family-size distribution already available (`sibling_annex_stats`) is a
|
||||||
|
natural follow-up once the sensitivity sweep shows the topology is worth
|
||||||
|
refining further.
|
||||||
|
|
||||||
|
**Caveat carried over from the `D_F = min(a,b)` rejection earlier:** this
|
||||||
|
cost matrix is only valid as **Sankoff step-cost input**, re-evaluated for
|
||||||
|
every branch of every candidate topology during tree search. Reusing
|
||||||
|
`cost(leaf_A, leaf_B)` directly as a standalone pairwise distance (bypassing
|
||||||
|
the tree) would reintroduce the exact circularity already rejected — the
|
||||||
|
`min(a,b)` pairing here is a locally-defined edit distance between two
|
||||||
|
states, not a claim about the true evolutionary history between two
|
||||||
|
specific genomes.
|
||||||
|
|
||||||
|
**Feasibility confirmed:** TNT's `costs` command accepts custom step
|
||||||
|
matrices for multistate characters, so this whole construction (16x16
|
||||||
|
matrix derived from the state graph, `c_ts`/`c_tv`/`c_gl`/`c_ctx` as
|
||||||
|
tunable parameters) is directly usable there — no new tooling required
|
||||||
|
before testing it.
|
||||||
|
|
||||||
|
### Experiment: TNT run on real data (2026-08-11)
|
||||||
|
|
||||||
|
**Status:** validated at genus/family/order scale within Bacteria; not
|
||||||
|
informative across domains with this character type. Exploratory only —
|
||||||
|
run entirely outside the repo (`/tmp/tnt_run`, TNT installed locally under
|
||||||
|
`TNT/`), no new Rust code. Kept here as the record of what was learned.
|
||||||
|
|
||||||
|
**Pipeline.** `obikmer distance --snp` emits one IUPAC-coded pseudo-alignment
|
||||||
|
row per genome (`snp_pseudo_alignment`, one column per family with
|
||||||
|
`family_size() >= 2`). A small external Python script decodes IUPAC back to
|
||||||
|
the 16-state bitmask, applies the set-edit-distance formula above, and
|
||||||
|
emits a complete TNT script (`xread` matrix + `smatrix` step-matrix + `hold`/
|
||||||
|
`mult` search). No new Rust code was needed for this pass.
|
||||||
|
|
||||||
|
**Calibration ("quick option").** Rather than modifying
|
||||||
|
`write_raw_snp_distance_csv` to emit raw counts, `c_ctx` was approximated as
|
||||||
|
the unweighted mean of the pairwise `snp/(snp+shared)` ratios already
|
||||||
|
present in `rawsnp.csv`, restricted to the relevant taxon subset. Used
|
||||||
|
values: `mu = gamma = 10`, `c_ctx = 18` (ratio `c_ctx/mu = 1.8`, consistent
|
||||||
|
with the observed pairwise ratios for genomes within Enterobacteriaceae/
|
||||||
|
Eubacteria, which cluster around 1.5-2 and barely move as the taxon set
|
||||||
|
widens — the context signal is stable, not sensitive to which subset is
|
||||||
|
chosen). The more principled route (raw counts, weighted `p_hat`, Ts/Tv
|
||||||
|
split) remains a follow-up, not yet done.
|
||||||
|
|
||||||
|
**Run 1 — Enterobacteriaceae (11 taxa: 4 *E. coli*, 4 *Salmonella enterica*,
|
||||||
|
3 *Klebsiella pneumoniae*).** All three genera recovered as monophyletic.
|
||||||
|
Initial read of the exported (unrooted, TNT/Nexus `[&U]`) tree as showing a
|
||||||
|
genus-arrangement disagreement with known systematics (*Escherichieae*:
|
||||||
|
*Escherichia*+*Salmonella* sister vs. more distant *Klebsielleae*) was
|
||||||
|
**wrong** — diagnosed via `force = (taxa);` monophyly-constraint test
|
||||||
|
(identical score constrained vs. free ⟹ no real disagreement). Root cause of
|
||||||
|
the misreading: with exactly 3 clades and no outgroup, an unrooted tree has
|
||||||
|
only **one possible topology** (a single trifurcation) — there is no
|
||||||
|
internal arrangement to get right or wrong. This run cannot test
|
||||||
|
inter-genus relationships at all; it can only test intra-genus monophyly
|
||||||
|
(which held).
|
||||||
|
|
||||||
|
**Run 2 — Eubacteria (18 taxa: run 1 + *Acidobacterium capsulatum*,
|
||||||
|
*Opitutus terrae*, *Bacillus subtilis*, *Shouchella clausii*, *Wolbachia*
|
||||||
|
endosymbiont, *Proteus mirabilis*, *Yersinia ruckeri*).** The
|
||||||
|
Enterobacteriaceae substructure from run 1 is reproduced identically, now
|
||||||
|
correctly rooted by real outgroups, resolving the tribal arrangement left
|
||||||
|
undetermined in run 1: *Escherichia*+*Salmonella* sister, *Klebsiella* more
|
||||||
|
distant — matching known systematics. Outgroup placement: `(Bacillus,
|
||||||
|
Shouchella)` sister pair (Firmicutes/*Bacillales*) splits from all
|
||||||
|
Proteobacteria — a correct phylum-level split; `Wolbachia`
|
||||||
|
(Alphaproteobacteria) splits from the Gammaproteobacteria block
|
||||||
|
(`Proteus`, `Yersinia`, Enterobacteriaceae) — a correct class-level split.
|
||||||
|
Lower confidence: the fine nested order `(Proteus, (Yersinia,
|
||||||
|
Enterobacteriaceae))` and the relative position of `Acidobacterium` vs.
|
||||||
|
`Opitutus` — plausible, not independently verified against current
|
||||||
|
Enterobacterales family-level literature.
|
||||||
|
|
||||||
|
**Run 3 — full domain set (20 taxa: run 2 + *Candidozyma auris* [yeast] and
|
||||||
|
*Saccharolobus islandicus* [archaeon]).** The bacterial clade from run 2 is
|
||||||
|
reproduced **unchanged and intact** — a real robustness signal, the method
|
||||||
|
does not fragment the ingroup when unrelated deep taxa are added. But the
|
||||||
|
result carries **no information on Bacteria/Archaea/Eukarya relationships**:
|
||||||
|
with exactly one eukaryote, one archaeon and one bacterial clade, the
|
||||||
|
unrooted tree is again forced into the single 3-clade trifurcation from run
|
||||||
|
1's caveat — there is no second representative of either outgroup domain to
|
||||||
|
resolve internal arrangement, so nothing about their relative position can
|
||||||
|
be read from the topology (a "ladder" ordering in the exported tree is
|
||||||
|
serialization, not signal). Independently, `rawsnp.csv` shows *why* this
|
||||||
|
character type cannot reach further: pairwise ratios involving
|
||||||
|
*Candidozyma*/*Saccharolobus* are almost all `NA` (no central-position
|
||||||
|
family shared at all) or saturated at `1.0` (every shared family differs) —
|
||||||
|
central-position families require literal 31 bp context conservation, which
|
||||||
|
simply does not survive domain-level divergence. Cross-domain placement
|
||||||
|
would need conserved-marker characters (rRNA, ribosomal proteins), not this
|
||||||
|
estimator.
|
||||||
|
|
||||||
## Heterozygosity, ploidy, and consensus-assembly inputs
|
## Heterozygosity, ploidy, and consensus-assembly inputs
|
||||||
|
|
||||||
A within-genome multiplicity signal (more than one of the 4 central forms
|
A within-genome multiplicity signal (more than one of the 4 central forms
|
||||||
|
|||||||
Generated
+2
-1
@@ -1711,11 +1711,12 @@ dependencies = [
|
|||||||
"serde_json",
|
"serde_json",
|
||||||
"tempfile",
|
"tempfile",
|
||||||
"tracing",
|
"tracing",
|
||||||
|
"tracing-subscriber",
|
||||||
]
|
]
|
||||||
|
|
||||||
[[package]]
|
[[package]]
|
||||||
name = "obikmer"
|
name = "obikmer"
|
||||||
version = "1.1.42"
|
version = "1.1.44"
|
||||||
dependencies = [
|
dependencies = [
|
||||||
"clap",
|
"clap",
|
||||||
"csv",
|
"csv",
|
||||||
|
|||||||
@@ -1,6 +1,17 @@
|
|||||||
use super::*;
|
use super::*;
|
||||||
use obikseq::{k, set_k, unitig::Unitig, Kmer};
|
use obikseq::{k, set_k, unitig::Unitig, Kmer};
|
||||||
|
|
||||||
|
// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
|
||||||
|
// file don't all use the same `k` (`push_palindrome_single_node` needs an
|
||||||
|
// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
|
||||||
|
// use k=5), and they run concurrently by default. Serialize the
|
||||||
|
// set_k-through-use critical section across this file's tests so one test's
|
||||||
|
// `k` can never be overwritten mid-flight by another.
|
||||||
|
static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
|
||||||
|
fn lock_k() -> std::sync::MutexGuard<'static, ()> {
|
||||||
|
K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
|
||||||
|
}
|
||||||
|
|
||||||
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
|
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
|
||||||
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
|
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
|
|||||||
#[test]
|
#[test]
|
||||||
fn push_deduplicates_revcomp() {
|
fn push_deduplicates_revcomp() {
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
|
|||||||
fn push_palindrome_single_node() {
|
fn push_palindrome_single_node() {
|
||||||
// ACGT is its own revcomp
|
// ACGT is its own revcomp
|
||||||
let k = 4;
|
let k = 4;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
|
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
|
||||||
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
|
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
|
||||||
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
|
|||||||
#[test]
|
#[test]
|
||||||
fn degrees_linear_chain_node_count() {
|
fn degrees_linear_chain_node_count() {
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let (g, kmers) = linear_chain_graph();
|
let (g, kmers) = linear_chain_graph();
|
||||||
assert_eq!(g.len(), kmers.len());
|
assert_eq!(g.len(), kmers.len());
|
||||||
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
|
|||||||
// Note: start_iter must not be consumed standalone — its second pass only
|
// Note: start_iter must not be consumed standalone — its second pass only
|
||||||
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
|
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"AAAAGGGG";
|
let seq = b"AAAAGGGG";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
|
|||||||
fn unitig_roundtrip_linear() {
|
fn unitig_roundtrip_linear() {
|
||||||
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
|
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"ACCTGGCTA";
|
let seq = b"ACCTGGCTA";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
|
|||||||
// Longer non-repetitive sequence with no repeated k-mer of length k.
|
// Longer non-repetitive sequence with no repeated k-mer of length k.
|
||||||
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
|
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"ACGTGGCTATCGAC";
|
let seq = b"ACGTGGCTATCGAC";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
|
|||||||
fn unitig_isolated_node() {
|
fn unitig_isolated_node() {
|
||||||
// Single k-mer with no neighbours
|
// Single k-mer with no neighbours
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
|
|||||||
#[test]
|
#[test]
|
||||||
fn unitig_two_isolated_nodes() {
|
fn unitig_two_isolated_nodes() {
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
// Two k-mers that share no (k-1)-overlap
|
// Two k-mers that share no (k-1)-overlap
|
||||||
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
|
|||||||
#[test]
|
#[test]
|
||||||
fn unitig_two_truly_distinct_isolated_nodes() {
|
fn unitig_two_truly_distinct_isolated_nodes() {
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
|
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
|
||||||
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn no_kmer_lost_or_duplicated() {
|
fn no_kmer_lost_or_duplicated() {
|
||||||
let k = 7;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"ACGTACGTACGTTTTTACGTACGT";
|
let seq = b"ACGTACGTACGTTTTTACGTACGT";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
|
|||||||
// start_iter first pass yields nothing (all nodes internal); second pass
|
// start_iter first pass yields nothing (all nodes internal); second pass
|
||||||
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
|
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"ACGTACGT";
|
let seq = b"ACGTACGT";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
|
|||||||
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
|
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
|
||||||
// We use long non-repetitive sequences and extract only the required kmers.
|
// We use long non-repetitive sequences and extract only the required kmers.
|
||||||
let k: usize = 5;
|
let k: usize = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
|
|
||||||
|
|||||||
@@ -24,6 +24,7 @@ hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], option
|
|||||||
[dev-dependencies]
|
[dev-dependencies]
|
||||||
obiread = { path = "../obiread" }
|
obiread = { path = "../obiread" }
|
||||||
tempfile = "3"
|
tempfile = "3"
|
||||||
|
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
|
||||||
|
|
||||||
[features]
|
[features]
|
||||||
default = ["numa"]
|
default = ["numa"]
|
||||||
|
|||||||
@@ -295,20 +295,27 @@ impl PartitionRunner {
|
|||||||
let pool = node.pool.clone();
|
let pool = node.pool.clone();
|
||||||
|
|
||||||
s.spawn(move || {
|
s.spawn(move || {
|
||||||
|
let tid = std::thread::current().id();
|
||||||
|
debug!(?tid, "PartitionRunner worker: waiting on activation");
|
||||||
if arx.recv().is_err() {
|
if arx.recv().is_err() {
|
||||||
|
debug!(?tid, "PartitionRunner worker: activation channel closed, exiting");
|
||||||
return;
|
return;
|
||||||
}
|
}
|
||||||
|
debug!(?tid, "PartitionRunner worker: activated");
|
||||||
if !cpu_ids.is_empty() {
|
if !cpu_ids.is_empty() {
|
||||||
pin_current_thread(cpu_ids);
|
pin_current_thread(cpu_ids);
|
||||||
}
|
}
|
||||||
for i in &prx {
|
for i in &prx {
|
||||||
|
debug!(?tid, partition = i, "PartitionRunner worker: picked partition");
|
||||||
let t = Instant::now();
|
let t = Instant::now();
|
||||||
let r = match &pool {
|
let r = match &pool {
|
||||||
Some(p) => p.install(|| f(i)),
|
Some(p) => p.install(|| f(i)),
|
||||||
None => f(i),
|
None => f(i),
|
||||||
};
|
};
|
||||||
|
debug!(?tid, partition = i, "PartitionRunner worker: partition done");
|
||||||
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
|
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
|
||||||
}
|
}
|
||||||
|
debug!(?tid, "PartitionRunner worker: no more partitions, exiting");
|
||||||
});
|
});
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -319,13 +326,18 @@ impl PartitionRunner {
|
|||||||
// ── Controller ────────────────────────────────────────────────────
|
// ── Controller ────────────────────────────────────────────────────
|
||||||
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
|
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
|
||||||
activation.activate_initial(INITIAL_DIVISOR, n_total);
|
activation.activate_initial(INITIAL_DIVISOR, n_total);
|
||||||
|
debug!(n_total, activated = activation.total(), "PartitionRunner controller: initial activation");
|
||||||
|
|
||||||
let mut cpu_sample = CpuSample::now();
|
let mut cpu_sample = CpuSample::now();
|
||||||
let mut io_sample = IoSample::now();
|
let mut io_sample = IoSample::now();
|
||||||
let mut completed = 0usize;
|
let mut completed = 0usize;
|
||||||
|
|
||||||
while completed < n_total {
|
while completed < n_total {
|
||||||
let Ok(event) = event_rx.recv() else { break };
|
debug!(completed, n_total, "PartitionRunner controller: waiting for an event");
|
||||||
|
let Ok(event) = event_rx.recv() else {
|
||||||
|
debug!("PartitionRunner controller: event channel closed, stopping");
|
||||||
|
break;
|
||||||
|
};
|
||||||
match event {
|
match event {
|
||||||
WorkerEvent::Completed(i, r, dur) => {
|
WorkerEvent::Completed(i, r, dur) => {
|
||||||
match r {
|
match r {
|
||||||
|
|||||||
@@ -976,7 +976,23 @@ mod tests {
|
|||||||
/// the same primitives `obikmer`'s `scatter` step uses (minus the
|
/// the same primitives `obikmer`'s `scatter` step uses (minus the
|
||||||
/// multi-file `obipipeline` wrapper — a single sequence needs none of
|
/// multi-file `obipipeline` wrapper — a single sequence needs none of
|
||||||
/// that): normalise -> build superkmers -> route -> write.
|
/// that): normalise -> build superkmers -> route -> write.
|
||||||
|
/// `cargo test` doesn't install a `tracing` subscriber the way `obikmer`'s
|
||||||
|
/// CLI does, so `debug!`/etc. are silent no-ops by default — including the
|
||||||
|
/// `PartitionRunner` instrumentation that would matter most for
|
||||||
|
/// re-diagnosing a hang here. `try_init` is idempotent across concurrently
|
||||||
|
/// running tests (later calls just find a subscriber already installed).
|
||||||
|
fn init_tracing() {
|
||||||
|
let _ = tracing_subscriber::fmt()
|
||||||
|
.with_env_filter(
|
||||||
|
tracing_subscriber::EnvFilter::try_from_default_env()
|
||||||
|
.unwrap_or_else(|_| tracing_subscriber::EnvFilter::new("info")),
|
||||||
|
)
|
||||||
|
.with_writer(std::io::stderr)
|
||||||
|
.try_init();
|
||||||
|
}
|
||||||
|
|
||||||
fn build_single_genome_index(dir: &Path, label: &str, seq: &[u8]) -> KmerIndex {
|
fn build_single_genome_index(dir: &Path, label: &str, seq: &[u8]) -> KmerIndex {
|
||||||
|
init_tracing();
|
||||||
let fasta_path = dir.join(format!("{label}.fasta"));
|
let fasta_path = dir.join(format!("{label}.fasta"));
|
||||||
let mut f = std::fs::File::create(&fasta_path).unwrap();
|
let mut f = std::fs::File::create(&fasta_path).unwrap();
|
||||||
writeln!(f, ">{label}").unwrap();
|
writeln!(f, ">{label}").unwrap();
|
||||||
|
|||||||
@@ -1,6 +1,6 @@
|
|||||||
[package]
|
[package]
|
||||||
name = "obikmer"
|
name = "obikmer"
|
||||||
version = "1.1.42"
|
version = "1.1.44"
|
||||||
edition = "2024"
|
edition = "2024"
|
||||||
|
|
||||||
[[bin]]
|
[[bin]]
|
||||||
|
|||||||
+33
-17
@@ -7,12 +7,28 @@
|
|||||||
//! different value panics. This prevents silent divergence between the global
|
//! different value panics. This prevents silent divergence between the global
|
||||||
//! parameter and the values used to build data structures.
|
//! parameter and the values used to build data structures.
|
||||||
//!
|
//!
|
||||||
//! In test builds (`#[cfg(test)]`) the same public API is backed by
|
//! In test builds (`#[cfg(test)]`) the same public API is backed by plain
|
||||||
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
|
//! process-wide atomics instead, freely overwritable (no write-once
|
||||||
//! independent copies of `K` and `M`, so tests can use arbitrary values
|
//! constraint) so tests don't need a reset mechanism between runs.
|
||||||
//! without coordinating with one another and without any reset mechanism.
|
//!
|
||||||
//! The `OnceLock` constraint is deliberately absent: test isolation is
|
//! An earlier version of this module used `thread_local!` `Cell`s here,
|
||||||
//! provided by thread locality, not by write-once semantics.
|
//! reasoning that "each test thread gets its own copy" gives isolation
|
||||||
|
//! between tests using different `k`/`m` values. That assumption broke as
|
||||||
|
//! soon as any code under test fanned work out to *other* threads it
|
||||||
|
//! doesn't control — `PartitionRunner`'s pre-spawned workers, or a bare
|
||||||
|
//! `rayon::par_iter()` — since a freshly spawned thread never inherits the
|
||||||
|
//! calling test thread's thread-local state, silently reading back `k=0`
|
||||||
|
//! there instead (surfaced as a `bitvec`/slice-indexing panic deep inside
|
||||||
|
//! whatever used the bogus length). Process-wide atomics make `k()`/`m()`
|
||||||
|
//! correct on *any* thread without every call site having to know to
|
||||||
|
//! re-propagate them. Unset still silently reads back as `0` (same as the
|
||||||
|
//! old `Cell` default) rather than panicking: several existing tests read
|
||||||
|
//! `m()` without ever calling `set_m` themselves, relying on that default.
|
||||||
|
//! The trade-off: tests that genuinely need different `k`/`m` values from
|
||||||
|
//! other tests must not run concurrently with them in the same process (in
|
||||||
|
//! practice: every test file in this workspace already uses one fixed
|
||||||
|
//! `k`/`m` pair for all its own tests, so this doesn't currently cost
|
||||||
|
//! anything).
|
||||||
|
|
||||||
// ── Production implementation ─────────────────────────────────────────────────
|
// ── Production implementation ─────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -44,22 +60,22 @@ mod state {
|
|||||||
|
|
||||||
// ── Test implementation ───────────────────────────────────────────────────────
|
// ── Test implementation ───────────────────────────────────────────────────────
|
||||||
//
|
//
|
||||||
// Each test thread owns its private K and M via thread_local!, so tests may
|
// Process-wide, freely overwritable (no write-once constraint), visible from
|
||||||
// call set_k / set_m with any value without affecting other tests.
|
// any thread — including threads a test doesn't spawn itself (rayon workers,
|
||||||
|
// PartitionRunner workers, ...). `0` (never explicitly set) is returned as-is,
|
||||||
|
// same default as the old thread-local `Cell`.
|
||||||
|
|
||||||
#[cfg(any(test, feature = "test-utils"))]
|
#[cfg(any(test, feature = "test-utils"))]
|
||||||
mod state {
|
mod state {
|
||||||
use std::cell::Cell;
|
use std::sync::atomic::{AtomicUsize, Ordering};
|
||||||
|
|
||||||
thread_local! {
|
static K: AtomicUsize = AtomicUsize::new(0);
|
||||||
static K: Cell<usize> = Cell::new(0);
|
static M: AtomicUsize = AtomicUsize::new(0);
|
||||||
static M: Cell<usize> = Cell::new(0);
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
|
pub fn set_k(k: usize) { K.store(k, Ordering::SeqCst); }
|
||||||
pub fn k() -> usize { K.with(|c| c.get()) }
|
pub fn k() -> usize { K.load(Ordering::SeqCst) }
|
||||||
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
|
pub fn set_m(m: usize) { M.store(m, Ordering::SeqCst); }
|
||||||
pub fn m() -> usize { M.with(|c| c.get()) }
|
pub fn m() -> usize { M.load(Ordering::SeqCst) }
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Public API (identical signature in both configurations) ───────────────────
|
// ── Public API (identical signature in both configurations) ───────────────────
|
||||||
|
|||||||
@@ -102,9 +102,9 @@ fn roundtrip_single() {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn roundtrip_all_lengths() {
|
fn roundtrip_all_lengths() {
|
||||||
obikseq::params::set_k(11);
|
setup();
|
||||||
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
|
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
|
||||||
for len in (11..=19).chain([255, 256, 257]) {
|
for len in (TEST_K..=19).chain([255, 256, 257]) {
|
||||||
let sk = make_sk(&bases[..len]);
|
let sk = make_sk(&bases[..len]);
|
||||||
let mut buf = Vec::new();
|
let mut buf = Vec::new();
|
||||||
sk.write_to_binary(&mut buf).unwrap();
|
sk.write_to_binary(&mut buf).unwrap();
|
||||||
|
|||||||
Reference in New Issue
Block a user