Compare commits
10
Commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
17c9e076bd | ||
|
|
f8cfb493b8 | ||
|
|
cc2ed4bd31 | ||
|
|
e66c4d81ef | ||
|
|
c20a1ed465 | ||
|
|
9a1c0c0ee0 | ||
|
|
b80ab77d66 | ||
|
|
6e2a4c977b | ||
|
|
8c16b79983 | ||
|
|
d0c277d5b6 |
@@ -1,4 +1,28 @@
|
|||||||
## Dans OBILayeredMap
|
## Chose à vérifier suite à la commande index
|
||||||
|
|
||||||
- Est-ce que CachelineEfVec est vraiment justifier dans notre cas. vu les contraintes sur la distribution des valeurs imposées par CachelineEfVec en terme d'ordre, de grandeur et de dispersion ?
|
- partition.meta ne devrait plus exister
|
||||||
- Il semble que le count de kmer soit stocké, ce qui doit-être une possibilité pas une obligation.
|
- les spectrums globaux devrait etre identifier par génome
|
||||||
|
- regrouper dans un sous-dossier spectrums à la racine de l'index avec un nom basé sur le génome
|
||||||
|
- les spectrum patiels ont-ils vocation à être conserver ?
|
||||||
|
- l'étape de déreplication dure quasiment autant de temps que le comptage mais ne laisse aucune trace de progression à l'utilisateur
|
||||||
|
|
||||||
|
## commandes à ajouter
|
||||||
|
|
||||||
|
- merge : pour construire un index à partir d'index existants
|
||||||
|
- deux modes : count et presence/absence. count exige que tous les index mergés soient déjà en mode count. mode presence/absence par defaut. Si passage de mode count à mode presence/absence, par defaut presence = count >= 1. Possibilité de spécifier un seuil personnalisé.
|
||||||
|
|
||||||
|
- filter : produit un nouvel index filtré à partir d'un index existant en verifiant que les kmer présents dans le nouvel index respectent les critères de filtrage spécifiés
|
||||||
|
- quorum de presence en fraction-(min/max) du nombre de génomes, en nombre-(min/max) de génomes, si mode count la présence peut être défini par un seuil personnalisé minimum et maximum
|
||||||
|
|
||||||
|
- aggregate : aggrege toutes les colonnes d'une matrice d'index en une seule colonne.
|
||||||
|
|
||||||
|
- query : scan un fichier de sequences et retourne pour chaque sequence quels kmer sont présents dans l'index et dans quel genomes
|
||||||
|
|
||||||
|
- distance : calcule la matrice de distance entre les genomes
|
||||||
|
- proposer une option pour chaque distance à calculer
|
||||||
|
- un possibité de récuperer la matrice des kmer communs
|
||||||
|
- un possibité de calculer l'arbre nj
|
||||||
|
- les matrices sont sauvegardées en CSV
|
||||||
|
- les arbres NJ sont sauvegardés en Newick avec les longeurs de branche
|
||||||
|
|
||||||
|
- dump : une table csv de l'index avec les kmer et les genomes associés en mode count ou presence/absence avec une option pour forcer le mode presence/absence meme si l'index est en mode count. Par defaut, le mode count est utilisé pour les index en mode count et le mode presence/absence pour les index en mode presence/absence.
|
||||||
|
|||||||
Binary file not shown.
Generated
+115
-649
File diff suppressed because it is too large
Load Diff
+1
-1
@@ -1,5 +1,5 @@
|
|||||||
[workspace]
|
[workspace]
|
||||||
resolver = "3"
|
resolver = "3"
|
||||||
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys"]
|
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex"]
|
||||||
[profile.release]
|
[profile.release]
|
||||||
debug = 1
|
debug = 1
|
||||||
|
|||||||
@@ -1,12 +1,10 @@
|
|||||||
//use ahash::RandomState;
|
//use ahash::RandomState;
|
||||||
use hashbrown::HashMap;
|
use hashbrown::HashMap;
|
||||||
use obifastwrite::write_unitig;
|
|
||||||
use obikseq::k;
|
use obikseq::k;
|
||||||
use obikseq::unitig::Unitig;
|
use obikseq::unitig::Unitig;
|
||||||
use obikseq::{CanonicalKmer, Kmer, Sequence};
|
use obikseq::{CanonicalKmer, Kmer, Sequence};
|
||||||
use std::cell::Cell;
|
use std::cell::Cell;
|
||||||
use std::fmt;
|
use std::fmt;
|
||||||
use std::io;
|
|
||||||
use xxhash_rust::xxh3::Xxh3Builder;
|
use xxhash_rust::xxh3::Xxh3Builder;
|
||||||
|
|
||||||
// ── Types ─────────────────────────────────────────────────────────────────────
|
// ── Types ─────────────────────────────────────────────────────────────────────
|
||||||
@@ -293,59 +291,6 @@ impl GraphDeBruijn {
|
|||||||
Some(oriented)
|
Some(oriented)
|
||||||
}
|
}
|
||||||
|
|
||||||
fn next_longtig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
|
|
||||||
let canonical = kmer.canonical();
|
|
||||||
let node = self.nodes.get(&canonical)?.get();
|
|
||||||
|
|
||||||
let direct = kmer.raw() == canonical.raw();
|
|
||||||
|
|
||||||
if (direct && node.n_right_neighbours() == 0) || (!direct && node.n_left_neighbours() == 0)
|
|
||||||
{
|
|
||||||
return None;
|
|
||||||
}
|
|
||||||
|
|
||||||
let next_c: CanonicalKmer = if direct {
|
|
||||||
if node.can_extend_right() {
|
|
||||||
canonical
|
|
||||||
.into_kmer()
|
|
||||||
.push_right(node.right_nuc())
|
|
||||||
.canonical()
|
|
||||||
} else {
|
|
||||||
self.iter_right_neighbors(canonical)
|
|
||||||
.filter(|n| !self.is_visited(n).unwrap_or(true))
|
|
||||||
.next()?
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
if node.can_extend_left() {
|
|
||||||
canonical.into_kmer().push_left(node.left_nuc()).canonical()
|
|
||||||
} else {
|
|
||||||
self.iter_left_neighbors(canonical)
|
|
||||||
.filter(|n| !self.is_visited(n).unwrap_or(true))
|
|
||||||
.next()?
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
let cell = self.nodes.get(&next_c)?;
|
|
||||||
let next_node = cell.get();
|
|
||||||
if next_node.is_visited() {
|
|
||||||
return None;
|
|
||||||
}
|
|
||||||
|
|
||||||
let oriented = oriented_next(kmer, next_c);
|
|
||||||
let ndirect = oriented.raw() == next_c.raw();
|
|
||||||
|
|
||||||
if (ndirect && next_node.n_right_neighbours() > 1)
|
|
||||||
|| (!ndirect && next_node.n_left_neighbours() > 1)
|
|
||||||
{
|
|
||||||
return None;
|
|
||||||
}
|
|
||||||
|
|
||||||
let mut updated = next_node;
|
|
||||||
updated.set_visited();
|
|
||||||
cell.set(updated);
|
|
||||||
Some(oriented)
|
|
||||||
}
|
|
||||||
|
|
||||||
fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
|
fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
|
||||||
UnitigIter {
|
UnitigIter {
|
||||||
graph: self,
|
graph: self,
|
||||||
@@ -353,13 +298,6 @@ impl GraphDeBruijn {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
fn iter_longtig_kmers(&self, start: Kmer) -> LongtigIter<'_> {
|
|
||||||
LongtigIter {
|
|
||||||
graph: self,
|
|
||||||
current: Some(start),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
|
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
|
||||||
let k = k();
|
let k = k();
|
||||||
self.start_iter().map(move |(start, first_next)| {
|
self.start_iter().map(move |(start, first_next)| {
|
||||||
@@ -373,36 +311,6 @@ impl GraphDeBruijn {
|
|||||||
})
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn iter_longtig(&self) -> impl Iterator<Item = Unitig> + '_ {
|
|
||||||
let k = k();
|
|
||||||
self.start_iter().map(move |(start, first_next)| {
|
|
||||||
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
|
|
||||||
if let Some(next_c) = first_next {
|
|
||||||
for kmer in self.iter_longtig_kmers(next_c) {
|
|
||||||
nucs.push(kmer.nucleotide(k - 1));
|
|
||||||
}
|
|
||||||
}
|
|
||||||
Unitig::from_nucleotides(&nucs)
|
|
||||||
})
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Write all unitigs to `out` in FASTA format.
|
|
||||||
///
|
|
||||||
/// Calls [`obifastwrite::write_unitig`] for each unitig produced by
|
|
||||||
/// [`iter_unitig`]. Stops and returns the first I/O error encountered.
|
|
||||||
pub fn write_fasta<W: io::Write>(&self, out: &mut W, unitig: bool) -> io::Result<()> {
|
|
||||||
if unitig {
|
|
||||||
for unitig in self.iter_unitig() {
|
|
||||||
write_unitig(&unitig, k(), out)?;
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
for unitig in self.iter_longtig() {
|
|
||||||
write_unitig(&unitig, k(), out)?;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
Ok(())
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn len(&self) -> usize {
|
pub fn len(&self) -> usize {
|
||||||
self.nodes.len()
|
self.nodes.len()
|
||||||
}
|
}
|
||||||
@@ -516,23 +424,6 @@ impl Iterator for UnitigIter<'_> {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── UnitigIter ────────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
struct LongtigIter<'a> {
|
|
||||||
graph: &'a GraphDeBruijn,
|
|
||||||
current: Option<Kmer>,
|
|
||||||
}
|
|
||||||
|
|
||||||
impl Iterator for LongtigIter<'_> {
|
|
||||||
type Item = Kmer;
|
|
||||||
|
|
||||||
fn next(&mut self) -> Option<Kmer> {
|
|
||||||
let current = self.current?;
|
|
||||||
self.current = self.graph.next_longtig_kmer(current);
|
|
||||||
Some(current)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
fn oriented_next(from: Kmer, to: CanonicalKmer) -> Kmer {
|
fn oriented_next(from: Kmer, to: CanonicalKmer) -> Kmer {
|
||||||
|
|||||||
@@ -1,9 +1,11 @@
|
|||||||
use std::fmt;
|
use std::fmt;
|
||||||
use std::io::{self, Write};
|
use std::io::{self, Write};
|
||||||
use xxhash_rust::xxh64::xxh64;
|
|
||||||
|
|
||||||
pub(crate) enum JsonVal<'a> {
|
/// A JSON value that is either a number or a quoted string.
|
||||||
|
pub enum JsonVal<'a> {
|
||||||
|
/// Integer value, serialised without quotes.
|
||||||
Num(u64),
|
Num(u64),
|
||||||
|
/// String value, serialised with double quotes.
|
||||||
Str(&'a str),
|
Str(&'a str),
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -16,11 +18,8 @@ impl fmt::Display for JsonVal<'_> {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn seq_id(ascii: &[u8]) -> String {
|
/// Write a JSON object `{"k1":v1,"k2":v2,...}` to `writer`.
|
||||||
format!("{:016X}", xxh64(ascii, 0))
|
pub fn annotation<W: Write>(
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) fn annotation<W: Write>(
|
|
||||||
writer: &mut W,
|
writer: &mut W,
|
||||||
fields: &[(&str, JsonVal<'_>)],
|
fields: &[(&str, JsonVal<'_>)],
|
||||||
) -> io::Result<()> {
|
) -> io::Result<()> {
|
||||||
@@ -34,10 +33,29 @@ pub(crate) fn annotation<W: Write>(
|
|||||||
write!(writer, "}}")
|
write!(writer, "}}")
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn write_sequence<W: Write>(writer: &mut W, seq: &[u8], width: usize) -> io::Result<()> {
|
/// xxHash-64 of `ascii`, formatted as 16 uppercase hex digits.
|
||||||
for chunk in seq.chunks(width) {
|
pub fn seq_id(ascii: &[u8]) -> String {
|
||||||
// SAFETY: seq is valid UTF-8; any contiguous slice of ASCII bytes is too
|
use xxhash_rust::xxh64::xxh64;
|
||||||
writeln!(writer, "{}", unsafe { std::str::from_utf8_unchecked(chunk) })?;
|
format!("{:016X}", xxh64(ascii, 0))
|
||||||
}
|
}
|
||||||
Ok(())
|
|
||||||
|
/// Write `seq` as one line of ASCII DNA, followed by a newline.
|
||||||
|
pub fn write_sequence<W: Write>(writer: &mut W, seq: &[u8]) -> io::Result<()> {
|
||||||
|
// SAFETY: seq is valid ASCII DNA (A/C/G/T).
|
||||||
|
writeln!(writer, "{}", unsafe { std::str::from_utf8_unchecked(seq) })
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Core FASTA record writer.
|
||||||
|
///
|
||||||
|
/// Writes `>{id} {annotation}\n{sequence}\n`.
|
||||||
|
pub fn write_record<W: Write>(
|
||||||
|
seq: &[u8],
|
||||||
|
id: &str,
|
||||||
|
fields: &[(&str, JsonVal<'_>)],
|
||||||
|
out: &mut W,
|
||||||
|
) -> io::Result<()> {
|
||||||
|
write!(out, ">{id} ")?;
|
||||||
|
annotation(out, fields)?;
|
||||||
|
writeln!(out)?;
|
||||||
|
write_sequence(out, seq)
|
||||||
}
|
}
|
||||||
|
|||||||
+89
-116
@@ -1,32 +1,20 @@
|
|||||||
//! FASTA serialisation of [`SuperKmer`] values.
|
//! FASTA serialisation for obikmer sequence types.
|
||||||
//!
|
//!
|
||||||
//! Two functions cover the two phases of the scatter pipeline:
|
//! Three public functions cover the main output cases:
|
||||||
//!
|
//!
|
||||||
//! - [`write_scatter`]: scatter phase (before routing). The header annotation
|
//! - [`write_scatter`]: super-kmers in scatter phase (minimizer annotation)
|
||||||
//! contains the minimizer sequence decoded from [`SuperKmer::minimizer_pos`].
|
//! - [`write_count`]: super-kmers in count phase (occurrence count annotation)
|
||||||
|
//! - [`write_unitig`]: unitigs from the layered index (partition + index annotation)
|
||||||
//!
|
//!
|
||||||
//! - [`write_count`]: count phase (after deduplication). The header annotation
|
//! All produce OBITools-compatible FASTA:
|
||||||
//! contains the occurrence count from [`SuperKmer::count`].
|
|
||||||
//!
|
|
||||||
//! Both functions write standard OBITools-compatible FASTA:
|
|
||||||
//!
|
//!
|
||||||
//! ```text
|
//! ```text
|
||||||
//! >ID {"seq_length":32,"kmer_size":31,"minimizer_size":11,"partition":42,"minimizer":"CGTGCTAGATC"}
|
//! >ID {"key":value,...}
|
||||||
//! GCTAGCATGCTAGCTGTAGCTGTGAGTGCTG
|
//! SEQUENCE
|
||||||
//! ```
|
//! ```
|
||||||
//!
|
//!
|
||||||
//! The record identifier is the xxHash-64 of the ASCII sequence, formatted as
|
//! The lower-level primitive [`write_record`] and the [`JsonVal`] type are also
|
||||||
//! a 16-digit uppercase hexadecimal string. xxHash-64 is collision-resistant
|
//! public for callers that need custom annotations.
|
||||||
//! enough for debugging identifiers (collision probability < 1e-9 for billions
|
|
||||||
//! of distinct super-kmers).
|
|
||||||
//!
|
|
||||||
//! # Phase contract
|
|
||||||
//!
|
|
||||||
//! `write_scatter` reads [`SuperKmer::minimizer_pos`], which is only valid
|
|
||||||
//! **before** [`SuperKmer::init_count`] is called. `write_count` reads
|
|
||||||
//! [`SuperKmer::count`], which is only meaningful **after** `init_count`.
|
|
||||||
//! Mixing the two functions in the wrong phase produces silently wrong output;
|
|
||||||
//! this is enforced by pipeline structure, not by the type system.
|
|
||||||
|
|
||||||
#![deny(missing_docs)]
|
#![deny(missing_docs)]
|
||||||
|
|
||||||
@@ -35,22 +23,15 @@ mod fasta;
|
|||||||
use std::io::{self, Write};
|
use std::io::{self, Write};
|
||||||
|
|
||||||
use obikseq::{Minimizer, SuperKmer, Unitig};
|
use obikseq::{Minimizer, SuperKmer, Unitig};
|
||||||
use xxhash_rust::xxh64::xxh64;
|
|
||||||
|
pub use fasta::{JsonVal, annotation, seq_id, write_record};
|
||||||
|
|
||||||
// ── public API ────────────────────────────────────────────────────────────────
|
// ── public API ────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
/// Write one super-kmer in FASTA format — **scatter phase**.
|
/// Write one super-kmer in FASTA format — **scatter phase**.
|
||||||
///
|
///
|
||||||
/// The `minimizer` field in the JSON annotation contains the ASCII sequence of
|
/// ID is the xxHash-64 of the sequence. JSON annotation includes
|
||||||
/// the minimizer, decoded from [`SuperKmer::minimizer_pos`] (scatter-phase
|
/// `seq_length`, `kmer_size`, `minimizer_size`, `partition`, `minimizer`.
|
||||||
/// value of the payload field).
|
|
||||||
///
|
|
||||||
/// # Parameters
|
|
||||||
/// - `sk`: the super-kmer to serialise (must be in scatter phase)
|
|
||||||
/// - `out`: destination writer
|
|
||||||
/// - `k`: k-mer size used to build `sk`
|
|
||||||
/// - `m`: minimizer size
|
|
||||||
/// - `partition`: partition index computed from the minimizer hash
|
|
||||||
pub fn write_scatter<W: Write>(
|
pub fn write_scatter<W: Write>(
|
||||||
sk: &SuperKmer,
|
sk: &SuperKmer,
|
||||||
out: &mut W,
|
out: &mut W,
|
||||||
@@ -61,37 +42,26 @@ pub fn write_scatter<W: Write>(
|
|||||||
) -> io::Result<()> {
|
) -> io::Result<()> {
|
||||||
let ascii = sk.to_ascii();
|
let ascii = sk.to_ascii();
|
||||||
let id = seq_id(&ascii);
|
let id = seq_id(&ascii);
|
||||||
let seq_len = ascii.len();
|
|
||||||
let min_seq = minimizer.to_ascii();
|
let min_seq = minimizer.to_ascii();
|
||||||
|
let min_str = unsafe { std::str::from_utf8_unchecked(&min_seq) };
|
||||||
writeln!(
|
write_record(
|
||||||
|
&ascii,
|
||||||
|
&id,
|
||||||
|
&[
|
||||||
|
("seq_length", JsonVal::Num(ascii.len() as u64)),
|
||||||
|
("kmer_size", JsonVal::Num(k as u64)),
|
||||||
|
("minimizer_size",JsonVal::Num(m as u64)),
|
||||||
|
("partition", JsonVal::Num(partition as u64)),
|
||||||
|
("minimizer", JsonVal::Str(min_str)),
|
||||||
|
],
|
||||||
out,
|
out,
|
||||||
">{id} {{\"seq_length\":{seq_len},\"kmer_size\":{k},\
|
)
|
||||||
\"minimizer_size\":{m},\"partition\":{partition},\
|
|
||||||
\"minimizer\":\"{min}\"}}",
|
|
||||||
id = id,
|
|
||||||
seq_len = seq_len,
|
|
||||||
k = k,
|
|
||||||
m = m,
|
|
||||||
partition = partition,
|
|
||||||
min = unsafe { std::str::from_utf8_unchecked(&min_seq) },
|
|
||||||
)?;
|
|
||||||
out.write_all(&ascii)?;
|
|
||||||
out.write_all(b"\n")
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Write one super-kmer in FASTA format — **count phase**.
|
/// Write one super-kmer in FASTA format — **count phase**.
|
||||||
///
|
///
|
||||||
/// The `count` field in the JSON annotation contains the occurrence count from
|
/// ID is the xxHash-64 of the sequence. JSON annotation includes
|
||||||
/// [`SuperKmer::count`] (count-phase value of the payload field).
|
/// `seq_length`, `kmer_size`, `minimizer_size`, `partition`, `count`.
|
||||||
///
|
|
||||||
/// # Parameters
|
|
||||||
/// - `sk`: the super-kmer to serialise (must be in count phase, i.e. after
|
|
||||||
/// [`SuperKmer::init_count`] has been called)
|
|
||||||
/// - `out`: destination writer
|
|
||||||
/// - `k`: k-mer size
|
|
||||||
/// - `m`: minimizer size
|
|
||||||
/// - `partition`: partition index
|
|
||||||
pub fn write_count<W: Write>(
|
pub fn write_count<W: Write>(
|
||||||
sk: &SuperKmer,
|
sk: &SuperKmer,
|
||||||
out: &mut W,
|
out: &mut W,
|
||||||
@@ -101,52 +71,47 @@ pub fn write_count<W: Write>(
|
|||||||
) -> io::Result<()> {
|
) -> io::Result<()> {
|
||||||
let ascii = sk.to_ascii();
|
let ascii = sk.to_ascii();
|
||||||
let id = seq_id(&ascii);
|
let id = seq_id(&ascii);
|
||||||
let seq_len = ascii.len();
|
write_record(
|
||||||
let count = sk.count();
|
&ascii,
|
||||||
|
&id,
|
||||||
writeln!(
|
&[
|
||||||
|
("seq_length", JsonVal::Num(ascii.len() as u64)),
|
||||||
|
("kmer_size", JsonVal::Num(k as u64)),
|
||||||
|
("minimizer_size",JsonVal::Num(m as u64)),
|
||||||
|
("partition", JsonVal::Num(partition as u64)),
|
||||||
|
("count", JsonVal::Num(sk.count() as u64)),
|
||||||
|
],
|
||||||
out,
|
out,
|
||||||
">{id} {{\"seq_length\":{seq_len},\"kmer_size\":{k},\
|
)
|
||||||
\"minimizer_size\":{m},\"partition\":{partition},\
|
|
||||||
\"count\":{count}}}",
|
|
||||||
id = id,
|
|
||||||
seq_len = seq_len,
|
|
||||||
k = k,
|
|
||||||
m = m,
|
|
||||||
partition = partition,
|
|
||||||
count = count,
|
|
||||||
)?;
|
|
||||||
out.write_all(&ascii)?;
|
|
||||||
out.write_all(b"\n")
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Write one unitig in FASTA format.
|
/// Write one unitig in FASTA format.
|
||||||
///
|
///
|
||||||
/// Header annotation (JSON):
|
/// ID is `part_PPPPP_unitig_IIIIII` where `P` is the partition index and `I`
|
||||||
/// ```text
|
/// is the unitig index within that partition. JSON annotation includes
|
||||||
/// >HASH {"seq_length":<seql>,"kmer_size":<k>,"n_kmers":<seql-k+1>}
|
/// `seq_length`, `kmer_size`, `n_kmers`, `partition`, `unitig_index`.
|
||||||
/// ```
|
pub fn write_unitig<W: Write>(
|
||||||
///
|
unitig: &Unitig,
|
||||||
/// `HASH` is the xxHash-64 of the ASCII sequence (16 uppercase hex digits).
|
k: usize,
|
||||||
/// `n_kmers` is the number of distinct k-mers covered by this unitig.
|
partition: usize,
|
||||||
pub fn write_unitig<W: Write>(unitig: &Unitig, k: usize, out: &mut W) -> io::Result<()> {
|
index: usize,
|
||||||
|
out: &mut W,
|
||||||
|
) -> io::Result<()> {
|
||||||
let ascii = unitig.to_ascii();
|
let ascii = unitig.to_ascii();
|
||||||
let id = seq_id(&ascii);
|
|
||||||
let seql = unitig.seql();
|
let seql = unitig.seql();
|
||||||
let n_kmers = seql - k + 1;
|
let id = format!("part_{partition:05}_unitig_{index:06}");
|
||||||
writeln!(
|
write_record(
|
||||||
|
&ascii,
|
||||||
|
&id,
|
||||||
|
&[
|
||||||
|
("seq_length", JsonVal::Num(seql as u64)),
|
||||||
|
("kmer_size", JsonVal::Num(k as u64)),
|
||||||
|
("n_kmers", JsonVal::Num((seql - k + 1) as u64)),
|
||||||
|
("partition", JsonVal::Num(partition as u64)),
|
||||||
|
("unitig_index", JsonVal::Num(index as u64)),
|
||||||
|
],
|
||||||
out,
|
out,
|
||||||
">{id} {{\"seq_length\":{seql},\"kmer_size\":{k},\"n_kmers\":{n_kmers}}}",
|
)
|
||||||
)?;
|
|
||||||
out.write_all(&ascii)?;
|
|
||||||
out.write_all(b"\n")
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── internal helpers ──────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
/// xxHash-64 of the ASCII sequence, formatted as 16 uppercase hex digits.
|
|
||||||
fn seq_id(ascii: &[u8]) -> String {
|
|
||||||
format!("{:016X}", xxh64(ascii, 0))
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||||
@@ -178,9 +143,6 @@ mod tests {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn scatter_minimizer_decoded_from_hash() {
|
fn scatter_minimizer_decoded_from_hash() {
|
||||||
// "ACG" right-aligned: A=00, C=01, G=10 → 0b000110 = 6
|
|
||||||
// Left-aligned for m=3: shift by 64 − 2·3 = 58.
|
|
||||||
// set_m(3) so that Minimizer::to_ascii() decodes exactly 3 bases.
|
|
||||||
obikseq::params::set_m(3);
|
obikseq::params::set_m(3);
|
||||||
let sk = make(b"ACGTACGTACGT");
|
let sk = make(b"ACGTACGTACGT");
|
||||||
let minimizer = Minimizer::from_raw_unchecked(6u64 << (64 - 2 * 3));
|
let minimizer = Minimizer::from_raw_unchecked(6u64 << (64 - 2 * 3));
|
||||||
@@ -230,13 +192,34 @@ mod tests {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn count_sequence_line_correct() {
|
fn count_sequence_line_correct() {
|
||||||
// TTTTACGT canonicalises to ACGTAAAA (revcomp is ACGTAAAA < TTTTACGT)
|
|
||||||
let sk = make(b"TTTTACGT");
|
let sk = make(b"TTTTACGT");
|
||||||
let out = capture(|w| write_count(&sk, w, 4, 2, 0));
|
let out = capture(|w| write_count(&sk, w, 4, 2, 0));
|
||||||
let lines: Vec<&str> = out.lines().collect();
|
let lines: Vec<&str> = out.lines().collect();
|
||||||
assert_eq!(lines[1], "ACGTAAAA");
|
assert_eq!(lines[1], "ACGTAAAA");
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── write_unitig ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn unitig_id_format() {
|
||||||
|
obikseq::params::set_k(4);
|
||||||
|
let unitig = obikseq::packed_seq::PackedSeq::from_ascii(b"ACGTACGT");
|
||||||
|
let out = capture(|w| write_unitig(&unitig, 4, 3, 17, w));
|
||||||
|
let id = out.lines().next().unwrap();
|
||||||
|
assert!(id.starts_with(">part_00003_unitig_000017"), "got: {id}");
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn unitig_annotation_fields() {
|
||||||
|
obikseq::params::set_k(4);
|
||||||
|
let unitig = obikseq::packed_seq::PackedSeq::from_ascii(b"ACGTACGT");
|
||||||
|
let out = capture(|w| write_unitig(&unitig, 4, 2, 5, w));
|
||||||
|
assert!(out.contains("\"partition\":2"));
|
||||||
|
assert!(out.contains("\"unitig_index\":5"));
|
||||||
|
assert!(out.contains("\"n_kmers\":5"));
|
||||||
|
assert!(out.contains("\"kmer_size\":4"));
|
||||||
|
}
|
||||||
|
|
||||||
// ── ID stability ──────────────────────────────────────────────────────────
|
// ── ID stability ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
@@ -260,7 +243,7 @@ mod tests {
|
|||||||
.next()
|
.next()
|
||||||
.unwrap()[1..]
|
.unwrap()[1..]
|
||||||
.to_string();
|
.to_string();
|
||||||
assert_eq!(id1, id2, "same sequence must produce same ID");
|
assert_eq!(id1, id2);
|
||||||
}
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
@@ -269,21 +252,11 @@ mod tests {
|
|||||||
let sk2 = make(b"TTTTTTTT");
|
let sk2 = make(b"TTTTTTTT");
|
||||||
|
|
||||||
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
|
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
|
||||||
.lines()
|
.lines().next().unwrap()
|
||||||
.next()
|
.split_whitespace().next().unwrap()[1..].to_string();
|
||||||
.unwrap()
|
|
||||||
.split_whitespace()
|
|
||||||
.next()
|
|
||||||
.unwrap()[1..]
|
|
||||||
.to_string();
|
|
||||||
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
|
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
|
||||||
.lines()
|
.lines().next().unwrap()
|
||||||
.next()
|
.split_whitespace().next().unwrap()[1..].to_string();
|
||||||
.unwrap()
|
|
||||||
.split_whitespace()
|
|
||||||
.next()
|
|
||||||
.unwrap()[1..]
|
|
||||||
.to_string();
|
|
||||||
assert_ne!(id1, id2);
|
assert_ne!(id1, id2);
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -291,7 +264,7 @@ mod tests {
|
|||||||
fn id_is_16_hex_digits() {
|
fn id_is_16_hex_digits() {
|
||||||
let sk = make(b"ACGTACGT");
|
let sk = make(b"ACGTACGT");
|
||||||
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)));
|
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)));
|
||||||
let id = &out.lines().next().unwrap()[1..17]; // skip '>'
|
let id = &out.lines().next().unwrap()[1..17];
|
||||||
assert_eq!(id.len(), 16);
|
assert_eq!(id.len(), 16);
|
||||||
assert!(id.chars().all(|c| c.is_ascii_hexdigit()));
|
assert!(id.chars().all(|c| c.is_ascii_hexdigit()));
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -0,0 +1,21 @@
|
|||||||
|
[package]
|
||||||
|
name = "obikindex"
|
||||||
|
version = "0.1.0"
|
||||||
|
edition = "2024"
|
||||||
|
|
||||||
|
[dependencies]
|
||||||
|
obikpartitionner = { path = "../obikpartitionner" }
|
||||||
|
obikseq = { path = "../obikseq" }
|
||||||
|
obisys = { path = "../obisys" }
|
||||||
|
obiskio = { path = "../obiskio" }
|
||||||
|
obidebruinj = { path = "../obidebruinj" }
|
||||||
|
obilayeredmap = { path = "../obilayeredmap" }
|
||||||
|
obicompactvec = { path = "../obicompactvec" }
|
||||||
|
cacheline-ef = "1.1"
|
||||||
|
epserde = "0.8"
|
||||||
|
ptr_hash = "1.1"
|
||||||
|
rayon = "1"
|
||||||
|
serde = { version = "1", features = ["derive"] }
|
||||||
|
serde_json = "1"
|
||||||
|
indicatif = "0.17"
|
||||||
|
tracing = "0.1.44"
|
||||||
@@ -0,0 +1,53 @@
|
|||||||
|
use std::fmt;
|
||||||
|
use std::io;
|
||||||
|
|
||||||
|
use obiskio::SKError;
|
||||||
|
use obilayeredmap::OLMError;
|
||||||
|
|
||||||
|
#[derive(Debug)]
|
||||||
|
pub enum OKIError {
|
||||||
|
Io(io::Error),
|
||||||
|
Json(serde_json::Error),
|
||||||
|
Partition(SKError),
|
||||||
|
Layer(OLMError),
|
||||||
|
}
|
||||||
|
|
||||||
|
pub type OKIResult<T> = Result<T, OKIError>;
|
||||||
|
|
||||||
|
impl fmt::Display for OKIError {
|
||||||
|
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
||||||
|
match self {
|
||||||
|
OKIError::Io(e) => write!(f, "I/O error: {e}"),
|
||||||
|
OKIError::Json(e) => write!(f, "JSON error: {e}"),
|
||||||
|
OKIError::Partition(e) => write!(f, "partition error: {e}"),
|
||||||
|
OKIError::Layer(e) => write!(f, "layer error: {e}"),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
impl std::error::Error for OKIError {
|
||||||
|
fn source(&self) -> Option<&(dyn std::error::Error + 'static)> {
|
||||||
|
match self {
|
||||||
|
OKIError::Io(e) => Some(e),
|
||||||
|
OKIError::Json(e) => Some(e),
|
||||||
|
OKIError::Partition(e) => Some(e),
|
||||||
|
OKIError::Layer(e) => Some(e),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
impl From<io::Error> for OKIError {
|
||||||
|
fn from(e: io::Error) -> Self { OKIError::Io(e) }
|
||||||
|
}
|
||||||
|
|
||||||
|
impl From<serde_json::Error> for OKIError {
|
||||||
|
fn from(e: serde_json::Error) -> Self { OKIError::Json(e) }
|
||||||
|
}
|
||||||
|
|
||||||
|
impl From<SKError> for OKIError {
|
||||||
|
fn from(e: SKError) -> Self { OKIError::Partition(e) }
|
||||||
|
}
|
||||||
|
|
||||||
|
impl From<OLMError> for OKIError {
|
||||||
|
fn from(e: OLMError) -> Self { OKIError::Layer(e) }
|
||||||
|
}
|
||||||
@@ -0,0 +1,301 @@
|
|||||||
|
use std::fs;
|
||||||
|
use std::path::{Path, PathBuf};
|
||||||
|
use std::sync::atomic::{AtomicUsize, Ordering};
|
||||||
|
use std::sync::{Arc, Mutex};
|
||||||
|
|
||||||
|
use cacheline_ef::{CachelineEf, CachelineEfVec};
|
||||||
|
use epserde::prelude::*;
|
||||||
|
use indicatif::{ProgressBar, ProgressStyle};
|
||||||
|
use obicompactvec::{PersistentCompactIntMatrix, PersistentCompactIntVec};
|
||||||
|
use obidebruinj::GraphDeBruijn;
|
||||||
|
use obikpartitionner::KmerPartition;
|
||||||
|
use obilayeredmap::layer::Layer;
|
||||||
|
use obiskio::{SKFileMeta, SKFileReader};
|
||||||
|
use obisys::{Reporter, Stage};
|
||||||
|
use ptr_hash::{PtrHash, bucket_fn::CubicEps, hash::Xx64};
|
||||||
|
use rayon::prelude::*;
|
||||||
|
use tracing::info;
|
||||||
|
|
||||||
|
use crate::error::{OKIError, OKIResult};
|
||||||
|
use crate::meta::{IndexConfig, IndexMeta};
|
||||||
|
use crate::state::{IndexState, SENTINEL_INDEXED, SENTINEL_SCATTERED};
|
||||||
|
|
||||||
|
type Mphf = PtrHash<u64, CubicEps, CachelineEfVec<Vec<CachelineEf>>, Xx64, Vec<u8>>;
|
||||||
|
|
||||||
|
pub struct KmerIndex {
|
||||||
|
root_path: PathBuf,
|
||||||
|
meta: IndexMeta,
|
||||||
|
partition: KmerPartition,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl KmerIndex {
|
||||||
|
/// Create a new index at `path`.
|
||||||
|
///
|
||||||
|
/// If `genome_label` is `Some`, it is stored immediately.
|
||||||
|
/// If `None`, the label will be derived from the first scatter input path
|
||||||
|
/// when `mark_scattered` is called.
|
||||||
|
pub fn create<P: AsRef<Path>>(
|
||||||
|
path: P,
|
||||||
|
config: IndexConfig,
|
||||||
|
genome_label: Option<String>,
|
||||||
|
force: bool,
|
||||||
|
) -> OKIResult<Self> {
|
||||||
|
let root_path = path.as_ref().to_owned();
|
||||||
|
let partition = KmerPartition::create(
|
||||||
|
&root_path,
|
||||||
|
config.n_bits,
|
||||||
|
config.kmer_size,
|
||||||
|
config.minimizer_size,
|
||||||
|
force,
|
||||||
|
)?;
|
||||||
|
let mut meta = IndexMeta::new(config);
|
||||||
|
if let Some(label) = genome_label {
|
||||||
|
meta.genomes.push(label);
|
||||||
|
}
|
||||||
|
meta.write(&root_path)?;
|
||||||
|
Ok(Self { root_path, meta, partition })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn open<P: AsRef<Path>>(path: P) -> OKIResult<Self> {
|
||||||
|
let root_path = path.as_ref().to_owned();
|
||||||
|
let meta = IndexMeta::read(&root_path).map_err(OKIError::Io)?;
|
||||||
|
let partition = KmerPartition::open(&root_path)?;
|
||||||
|
Ok(Self { root_path, meta, partition })
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Return `true` if `path` contains an `index.meta` file.
|
||||||
|
pub fn exists<P: AsRef<Path>>(path: P) -> bool {
|
||||||
|
IndexMeta::exists(path.as_ref())
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Current construction state, as reported by sentinel files on disk.
|
||||||
|
pub fn state(&self) -> IndexState {
|
||||||
|
IndexState::detect(&self.root_path).unwrap_or(IndexState::Empty)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn meta(&self) -> &IndexMeta { &self.meta }
|
||||||
|
pub fn kmer_size(&self) -> usize { self.meta.config.kmer_size }
|
||||||
|
pub fn minimizer_size(&self) -> usize { self.meta.config.minimizer_size }
|
||||||
|
pub fn n_partitions(&self) -> usize { self.partition.n_partitions() }
|
||||||
|
|
||||||
|
/// Expose the inner partition so the caller can run scatter into it.
|
||||||
|
/// Call `mark_scattered` once scatter is complete.
|
||||||
|
pub fn partition_mut(&mut self) -> &mut KmerPartition {
|
||||||
|
&mut self.partition
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Mark scatter as complete and write `scatter.done`.
|
||||||
|
///
|
||||||
|
/// If no genome label was set at creation time, one is derived from
|
||||||
|
/// `first_scatter_path` (filename stripped of all extensions).
|
||||||
|
/// If `first_scatter_path` is also `None`, the label defaults to `"unknown"`.
|
||||||
|
pub fn mark_scattered(&mut self, first_scatter_path: Option<&Path>) -> OKIResult<()> {
|
||||||
|
if self.meta.genomes.is_empty() {
|
||||||
|
let label = first_scatter_path
|
||||||
|
.map(label_from_path)
|
||||||
|
.unwrap_or_else(|| "unknown".to_string());
|
||||||
|
self.meta.genomes.push(label);
|
||||||
|
self.meta.write(&self.root_path)?;
|
||||||
|
}
|
||||||
|
touch(&self.root_path.join(SENTINEL_SCATTERED))?;
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Dereplicate all partitions then compute kmer counts.
|
||||||
|
///
|
||||||
|
/// Writes `kmer_spectrum_raw.json` at the index root upon completion
|
||||||
|
/// (this file doubles as the `Counted` sentinel).
|
||||||
|
pub fn dereplicate_and_count(&self, rep: &mut Reporter) -> OKIResult<()> {
|
||||||
|
let t = Stage::start("dereplicate");
|
||||||
|
self.partition.dereplicate()?;
|
||||||
|
rep.push(t.stop());
|
||||||
|
|
||||||
|
let t = Stage::start("count_kmer");
|
||||||
|
self.partition.count_kmer()?;
|
||||||
|
rep.push(t.stop());
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Build the layered MPHF index for all partitions.
|
||||||
|
///
|
||||||
|
/// Default mode (`config.with_counts = false`): set membership only.
|
||||||
|
/// With counts: count matrix per kmer.
|
||||||
|
///
|
||||||
|
/// Writes `index.done` upon completion.
|
||||||
|
/// Path to the unitigs file for partition `part`, layer `layer`.
|
||||||
|
pub fn layer_unitigs_path(&self, part: usize, layer: usize) -> PathBuf {
|
||||||
|
self.partition.part_dir(part)
|
||||||
|
.join("index")
|
||||||
|
.join(format!("layer_{layer}"))
|
||||||
|
.join("unitigs.bin")
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn build_layers(
|
||||||
|
&self,
|
||||||
|
min_ab: u32,
|
||||||
|
max_ab: Option<u32>,
|
||||||
|
keep_intermediate: bool,
|
||||||
|
rep: &mut Reporter,
|
||||||
|
) -> OKIResult<()> {
|
||||||
|
let n = self.partition.n_partitions();
|
||||||
|
let t = Stage::start("index");
|
||||||
|
let with_counts = self.meta.config.with_counts;
|
||||||
|
let filter_active = min_ab > 1 || max_ab.is_some();
|
||||||
|
let need_counts = filter_active || with_counts;
|
||||||
|
let total_kmers = AtomicUsize::new(0);
|
||||||
|
|
||||||
|
let partition = &self.partition;
|
||||||
|
|
||||||
|
let pb = Arc::new(Mutex::new(
|
||||||
|
ProgressBar::new(n as u64).with_style(
|
||||||
|
ProgressStyle::with_template("index — [{bar:20}] {pos}/{len} | {msg}").unwrap(),
|
||||||
|
),
|
||||||
|
));
|
||||||
|
|
||||||
|
(0..n).into_par_iter().for_each(|i| {
|
||||||
|
let part_dir = partition.part_dir(i);
|
||||||
|
let dedup_path = part_dir.join("dereplicated.skmer.zst");
|
||||||
|
if !dedup_path.exists() {
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
|
||||||
|
let layer_dir = part_dir.join("index").join("layer_0");
|
||||||
|
if layer_dir.join("mphf.bin").exists() {
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
|
||||||
|
let mphf1_opt: Option<Mphf> = if need_counts {
|
||||||
|
let p = part_dir.join("mphf1.bin");
|
||||||
|
p.exists().then(|| Mphf::load_full(&p).ok()).flatten()
|
||||||
|
} else {
|
||||||
|
None
|
||||||
|
};
|
||||||
|
|
||||||
|
let counts1_opt: Option<PersistentCompactIntVec> = if need_counts {
|
||||||
|
let p = part_dir.join("counts1.bin");
|
||||||
|
p.exists()
|
||||||
|
.then(|| PersistentCompactIntVec::open(&p).ok())
|
||||||
|
.flatten()
|
||||||
|
} else {
|
||||||
|
None
|
||||||
|
};
|
||||||
|
|
||||||
|
let mut g = GraphDeBruijn::new();
|
||||||
|
let mut reader = SKFileReader::open(&dedup_path).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error opening {}: {e}", dedup_path.display());
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
for sk in reader.iter() {
|
||||||
|
for kmer in sk.iter_canonical_kmers() {
|
||||||
|
let accept = if filter_active {
|
||||||
|
match (&mphf1_opt, &counts1_opt) {
|
||||||
|
(Some(mphf), Some(counts)) => {
|
||||||
|
let ab = counts.get(mphf.index(&kmer.raw()));
|
||||||
|
ab >= min_ab && max_ab.map_or(true, |max| ab <= max)
|
||||||
|
}
|
||||||
|
_ => true,
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
true
|
||||||
|
};
|
||||||
|
if accept {
|
||||||
|
g.push(kmer);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
let n_kmers = g.len();
|
||||||
|
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
|
||||||
|
g.compute_degrees();
|
||||||
|
|
||||||
|
fs::create_dir_all(&layer_dir).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating {}: {e}", layer_dir.display());
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
let mut uw = Layer::<()>::unitig_writer(&layer_dir).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating unitig writer (partition {i}): {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
for unitig in g.iter_unitig() {
|
||||||
|
uw.write(&unitig).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error writing unitig (partition {i}): {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
}
|
||||||
|
uw.close().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error closing unitig writer (partition {i}): {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
|
||||||
|
if with_counts {
|
||||||
|
Layer::<PersistentCompactIntMatrix>::build(&layer_dir, |kmer| {
|
||||||
|
match (&mphf1_opt, &counts1_opt) {
|
||||||
|
(Some(mphf), Some(counts)) => counts.get(mphf.index(&kmer.raw())),
|
||||||
|
_ => 1,
|
||||||
|
}
|
||||||
|
})
|
||||||
|
.unwrap_or_else(|e| {
|
||||||
|
eprintln!("error building count layer (partition {i}): {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
} else {
|
||||||
|
Layer::<()>::build(&layer_dir).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error building set layer (partition {i}): {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
}
|
||||||
|
|
||||||
|
let pb = pb.lock().unwrap();
|
||||||
|
pb.inc(1);
|
||||||
|
pb.set_message(format!("{i}: {n_kmers} kmers"));
|
||||||
|
});
|
||||||
|
|
||||||
|
pb.lock().unwrap().finish_and_clear();
|
||||||
|
info!(
|
||||||
|
"done — {} total kmers indexed",
|
||||||
|
total_kmers.load(Ordering::Relaxed)
|
||||||
|
);
|
||||||
|
|
||||||
|
if !keep_intermediate {
|
||||||
|
for i in 0..n {
|
||||||
|
let part_dir = partition.part_dir(i);
|
||||||
|
remove_if_exists(&part_dir.join("dereplicated.skmer.zst"));
|
||||||
|
remove_if_exists(&SKFileMeta::sidecar_path(
|
||||||
|
&part_dir.join("dereplicated.skmer.zst"),
|
||||||
|
));
|
||||||
|
remove_if_exists(&part_dir.join("mphf1.bin"));
|
||||||
|
remove_if_exists(&part_dir.join("counts1.bin"));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
touch(&self.root_path.join(SENTINEL_INDEXED))?;
|
||||||
|
rep.push(t.stop());
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Derive a genome label from a file path: filename stripped of all extensions.
|
||||||
|
fn label_from_path(path: &Path) -> String {
|
||||||
|
let name = path
|
||||||
|
.file_name()
|
||||||
|
.unwrap_or(path.as_os_str())
|
||||||
|
.to_string_lossy()
|
||||||
|
.into_owned();
|
||||||
|
let mut s = name;
|
||||||
|
while let Some(pos) = s.rfind('.') {
|
||||||
|
s.truncate(pos);
|
||||||
|
}
|
||||||
|
if s.is_empty() { "unknown".to_string() } else { s }
|
||||||
|
}
|
||||||
|
|
||||||
|
fn touch(path: &Path) -> Result<(), std::io::Error> {
|
||||||
|
fs::File::create(path).map(|_| ())
|
||||||
|
}
|
||||||
|
|
||||||
|
fn remove_if_exists(path: &Path) {
|
||||||
|
if let Err(e) = fs::remove_file(path) {
|
||||||
|
if e.kind() != std::io::ErrorKind::NotFound {
|
||||||
|
eprintln!("warning: could not remove {}: {e}", path.display());
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,9 @@
|
|||||||
|
pub mod error;
|
||||||
|
pub mod meta;
|
||||||
|
pub mod state;
|
||||||
|
mod index;
|
||||||
|
|
||||||
|
pub use error::{OKIError, OKIResult};
|
||||||
|
pub use index::KmerIndex;
|
||||||
|
pub use meta::{IndexConfig, IndexMeta, META_FILENAME};
|
||||||
|
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
|
||||||
@@ -0,0 +1,45 @@
|
|||||||
|
use std::fs;
|
||||||
|
use std::io;
|
||||||
|
use std::path::Path;
|
||||||
|
|
||||||
|
use serde::{Deserialize, Serialize};
|
||||||
|
|
||||||
|
pub const META_FILENAME: &str = "index.meta";
|
||||||
|
const META_VERSION: u32 = 1;
|
||||||
|
|
||||||
|
#[derive(Debug, Clone, Serialize, Deserialize)]
|
||||||
|
pub struct IndexConfig {
|
||||||
|
pub kmer_size: usize,
|
||||||
|
pub minimizer_size: usize,
|
||||||
|
pub n_bits: usize,
|
||||||
|
pub with_counts: bool,
|
||||||
|
}
|
||||||
|
|
||||||
|
#[derive(Debug, Clone, Serialize, Deserialize)]
|
||||||
|
pub struct IndexMeta {
|
||||||
|
pub version: u32,
|
||||||
|
pub config: IndexConfig,
|
||||||
|
/// Ordered list of genome labels indexed here.
|
||||||
|
/// Element 0 is the initial genome; subsequent entries come from merges.
|
||||||
|
pub genomes: Vec<String>,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl IndexMeta {
|
||||||
|
pub fn new(config: IndexConfig) -> Self {
|
||||||
|
Self { version: META_VERSION, config, genomes: Vec::new() }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn write(&self, root: &Path) -> io::Result<()> {
|
||||||
|
let file = fs::File::create(root.join(META_FILENAME))?;
|
||||||
|
serde_json::to_writer_pretty(file, self).map_err(io::Error::other)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn read(root: &Path) -> io::Result<Self> {
|
||||||
|
let file = fs::File::open(root.join(META_FILENAME))?;
|
||||||
|
serde_json::from_reader(file).map_err(io::Error::other)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn exists(root: &Path) -> bool {
|
||||||
|
root.join(META_FILENAME).exists()
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,45 @@
|
|||||||
|
use std::path::Path;
|
||||||
|
|
||||||
|
use crate::meta::META_FILENAME;
|
||||||
|
|
||||||
|
pub const SENTINEL_SCATTERED: &str = "scatter.done";
|
||||||
|
pub const SENTINEL_COUNTED: &str = "kmer_spectrum_raw.json";
|
||||||
|
pub const SENTINEL_INDEXED: &str = "index.done";
|
||||||
|
|
||||||
|
/// Progression state of a `KmerIndex`.
|
||||||
|
///
|
||||||
|
/// Variants are ordered: `Empty < Scattered < Counted < Indexed`.
|
||||||
|
/// A state is reported only when its sentinel file is fully present —
|
||||||
|
/// partial states (e.g. scatter interrupted mid-way) are not accepted.
|
||||||
|
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord)]
|
||||||
|
pub enum IndexState {
|
||||||
|
/// `index.meta` present; scatter not yet completed.
|
||||||
|
Empty,
|
||||||
|
/// `scatter.done` sentinel present — all super-kmers have been routed.
|
||||||
|
Scattered,
|
||||||
|
/// `kmer_spectrum_raw.json` present — dereplicate + count complete.
|
||||||
|
Counted,
|
||||||
|
/// `index.done` sentinel present — layered MPHF index fully built.
|
||||||
|
Indexed,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl IndexState {
|
||||||
|
/// Detect the state of the index at `root`.
|
||||||
|
///
|
||||||
|
/// Returns `None` if `index.meta` is absent (not an obikindex directory).
|
||||||
|
pub fn detect(root: &Path) -> Option<Self> {
|
||||||
|
if !root.join(META_FILENAME).exists() {
|
||||||
|
return None;
|
||||||
|
}
|
||||||
|
if root.join(SENTINEL_INDEXED).exists() {
|
||||||
|
return Some(Self::Indexed);
|
||||||
|
}
|
||||||
|
if root.join(SENTINEL_COUNTED).exists() {
|
||||||
|
return Some(Self::Counted);
|
||||||
|
}
|
||||||
|
if root.join(SENTINEL_SCATTERED).exists() {
|
||||||
|
return Some(Self::Scattered);
|
||||||
|
}
|
||||||
|
Some(Self::Empty)
|
||||||
|
}
|
||||||
|
}
|
||||||
+14
-15
@@ -8,21 +8,20 @@ name = "obikmer"
|
|||||||
path = "src/main.rs"
|
path = "src/main.rs"
|
||||||
|
|
||||||
[dependencies]
|
[dependencies]
|
||||||
obikseq = { path = "../obikseq" }
|
obikseq = { path = "../obikseq" }
|
||||||
obiread = { path = "../obiread" }
|
obiread = { path = "../obiread" }
|
||||||
obiskbuilder = { path = "../obiskbuilder" }
|
obiskbuilder = { path = "../obiskbuilder" }
|
||||||
obifastwrite = { path = "../obifastwrite" }
|
obifastwrite = { path = "../obifastwrite" }
|
||||||
obipipeline = { path = "../obipipeline" }
|
obipipeline = { path = "../obipipeline" }
|
||||||
obidebruinj = { path = "../obidebruinj" }
|
obikrope = { path = "../obikrope" }
|
||||||
clap = { version = "4", features = ["derive"] }
|
obikpartitionner = { path = "../obikpartitionner" }
|
||||||
obikrope = { path = "../obikrope" }
|
obisys = { path = "../obisys" }
|
||||||
obikpartitionner = { path = "../obikpartitionner" }
|
obiskio = { path = "../obiskio" }
|
||||||
obiskio = { path = "../obiskio" }
|
obikindex = { path = "../obikindex" }
|
||||||
niffler = "3"
|
clap = { version = "4", features = ["derive"] }
|
||||||
rayon = "1"
|
rayon = "1"
|
||||||
ph = "0.11"
|
indicatif = "0.17"
|
||||||
memmap2 = "0.9"
|
tracing = "0.1.44"
|
||||||
tracing = "0.1.44"
|
|
||||||
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
|
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
|
||||||
pprof = { version = "0.13", features = ["prost-codec"], optional = true }
|
pprof = { version = "0.13", features = ["prost-codec"], optional = true }
|
||||||
|
|
||||||
|
|||||||
@@ -1,24 +0,0 @@
|
|||||||
use clap::Args;
|
|
||||||
use obikpartitionner::KmerPartition;
|
|
||||||
use std::path::PathBuf;
|
|
||||||
use tracing::info;
|
|
||||||
|
|
||||||
#[derive(Args)]
|
|
||||||
pub struct CountArgs {
|
|
||||||
/// Partition directory produced by the `partition` command
|
|
||||||
#[arg(short, long)]
|
|
||||||
pub partition: PathBuf,
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn run(args: CountArgs) {
|
|
||||||
let kp = KmerPartition::open(&args.partition).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
|
|
||||||
info!("counting kmers in {}", args.partition.display());
|
|
||||||
kp.count_kmer().unwrap_or_else(|e| {
|
|
||||||
eprintln!("error: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
}
|
|
||||||
@@ -1,84 +0,0 @@
|
|||||||
use std::fs::File;
|
|
||||||
use std::path::PathBuf;
|
|
||||||
use std::sync::atomic::{AtomicUsize, Ordering};
|
|
||||||
|
|
||||||
use clap::Args;
|
|
||||||
use niffler::Level;
|
|
||||||
use niffler::send::compression::Format;
|
|
||||||
use obifastwrite::write_count;
|
|
||||||
use obikpartitionner::KmerPartition;
|
|
||||||
use obiskio::SKFileReader;
|
|
||||||
use rayon::prelude::*;
|
|
||||||
use tracing::info;
|
|
||||||
|
|
||||||
#[derive(Args)]
|
|
||||||
pub struct FastaArgs {
|
|
||||||
/// Root of the k-mer partition directory (produced by the `partition` command)
|
|
||||||
pub partition: PathBuf,
|
|
||||||
|
|
||||||
/// Dump dereplicated super-kmers as FASTA (→ <partition>/dereplicated.skmer.fasta.gz)
|
|
||||||
#[arg(long)]
|
|
||||||
pub super_kmers: bool,
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn run(args: FastaArgs) {
|
|
||||||
if !args.super_kmers {
|
|
||||||
eprintln!("error: specify at least one output mode (--super-kmers)");
|
|
||||||
std::process::exit(1);
|
|
||||||
}
|
|
||||||
|
|
||||||
let kp = KmerPartition::open(&args.partition).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening partition: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
|
|
||||||
if args.super_kmers {
|
|
||||||
dump_super_kmers(&kp, &args.partition);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
fn dump_super_kmers(kp: &KmerPartition, partition_dir: &PathBuf) {
|
|
||||||
let k = kp.kmer_size();
|
|
||||||
let m = kp.minimizer_size();
|
|
||||||
let n = kp.n_partitions();
|
|
||||||
|
|
||||||
info!("writing {n} partition FASTA files (parallel)");
|
|
||||||
|
|
||||||
let total = AtomicUsize::new(0);
|
|
||||||
|
|
||||||
(0..n).into_par_iter().for_each(|i| {
|
|
||||||
let part_dir = partition_dir.join(format!("part_{i:05}"));
|
|
||||||
let in_path = part_dir.join("dereplicated.skmer.zst");
|
|
||||||
if !in_path.exists() {
|
|
||||||
return;
|
|
||||||
}
|
|
||||||
let out_path = part_dir.join("dereplicated.skmer.fasta.gz");
|
|
||||||
|
|
||||||
let file = File::create(&out_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error creating {}: {e}", out_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
let mut writer = niffler::send::get_writer(Box::new(file), Format::Gzip, Level::Six)
|
|
||||||
.unwrap_or_else(|e| {
|
|
||||||
eprintln!("error creating gzip writer: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
|
|
||||||
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening {}: {e}", in_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
let mut count = 0usize;
|
|
||||||
for sk in reader.iter() {
|
|
||||||
write_count(&sk, &mut writer, k, m, i as u32).unwrap_or_else(|e| {
|
|
||||||
eprintln!("write error: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
count += 1;
|
|
||||||
}
|
|
||||||
info!("partition {i}: {count} super-kmers → {}", out_path.display());
|
|
||||||
total.fetch_add(count, Ordering::Relaxed);
|
|
||||||
});
|
|
||||||
|
|
||||||
info!("wrote {} super-kmers total", total.load(Ordering::Relaxed));
|
|
||||||
}
|
|
||||||
@@ -0,0 +1,117 @@
|
|||||||
|
use std::path::PathBuf;
|
||||||
|
|
||||||
|
use clap::Args;
|
||||||
|
use obikindex::{IndexConfig, IndexState, KmerIndex};
|
||||||
|
use obikseq::{set_k, set_m};
|
||||||
|
use obisys::Reporter;
|
||||||
|
use tracing::info;
|
||||||
|
|
||||||
|
use crate::cli::CommonArgs;
|
||||||
|
use crate::steps::scatter;
|
||||||
|
|
||||||
|
#[derive(Args)]
|
||||||
|
pub struct IndexArgs {
|
||||||
|
/// Output index directory
|
||||||
|
#[arg(short, long)]
|
||||||
|
pub output: PathBuf,
|
||||||
|
|
||||||
|
/// Overwrite output directory if it already exists
|
||||||
|
#[arg(long, default_value_t = false)]
|
||||||
|
pub force: bool,
|
||||||
|
|
||||||
|
/// Genome label (default: input filename without path/extension)
|
||||||
|
#[arg(long)]
|
||||||
|
pub label: Option<String>,
|
||||||
|
|
||||||
|
/// Minimum kmer abundance (inclusive)
|
||||||
|
#[arg(long, default_value_t = 1)]
|
||||||
|
pub min_abundance: u32,
|
||||||
|
|
||||||
|
/// Maximum kmer abundance (inclusive)
|
||||||
|
#[arg(long)]
|
||||||
|
pub max_abundance: Option<u32>,
|
||||||
|
|
||||||
|
/// Store kmer counts in the index (default: set membership only)
|
||||||
|
#[arg(long, default_value_t = false)]
|
||||||
|
pub with_counts: bool,
|
||||||
|
|
||||||
|
/// Keep intermediate build files (dereplicated superkmers, mphf1, counts1)
|
||||||
|
#[arg(long, default_value_t = false)]
|
||||||
|
pub keep_intermediate: bool,
|
||||||
|
|
||||||
|
#[command(flatten)]
|
||||||
|
pub common: CommonArgs,
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn run(args: IndexArgs) {
|
||||||
|
let output = args.output.clone();
|
||||||
|
let mut rep = Reporter::new();
|
||||||
|
|
||||||
|
// ── Open or create the index ─────────────────────────────────────────────
|
||||||
|
let mut idx = if KmerIndex::exists(&output) {
|
||||||
|
info!("resuming from existing index at {}", output.display());
|
||||||
|
KmerIndex::open(&output).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error opening index: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
})
|
||||||
|
} else {
|
||||||
|
let config = IndexConfig {
|
||||||
|
kmer_size: args.common.kmer_size,
|
||||||
|
minimizer_size: args.common.minimizer_size,
|
||||||
|
n_bits: args.common.partition_bits,
|
||||||
|
with_counts: args.with_counts,
|
||||||
|
};
|
||||||
|
KmerIndex::create(&output, config, args.label.clone(), args.force).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating index: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
})
|
||||||
|
};
|
||||||
|
|
||||||
|
set_k(idx.kmer_size());
|
||||||
|
set_m(idx.minimizer_size());
|
||||||
|
|
||||||
|
// ── Stage 1: scatter ─────────────────────────────────────────────────────
|
||||||
|
if idx.state() < IndexState::Scattered {
|
||||||
|
let first_path = args.common.inputs.first().map(PathBuf::from);
|
||||||
|
let k = idx.kmer_size();
|
||||||
|
let level_max = args.common.level_max;
|
||||||
|
let theta = args.common.theta;
|
||||||
|
let n_workers = args.common.threads.max(1);
|
||||||
|
|
||||||
|
scatter(idx.partition_mut(), args.common.seqfile_paths(), k, level_max, theta, n_workers, &mut rep);
|
||||||
|
|
||||||
|
idx.mark_scattered(first_path.as_deref()).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error marking scatter done: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
} else {
|
||||||
|
info!("scatter already done, skipping");
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Stage 2: dereplicate + count ─────────────────────────────────────────
|
||||||
|
if idx.state() < IndexState::Counted {
|
||||||
|
idx.dereplicate_and_count(&mut rep).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
} else {
|
||||||
|
info!("dereplicate+count already done, skipping");
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Stage 3: build layered index ─────────────────────────────────────────
|
||||||
|
if idx.state() < IndexState::Indexed {
|
||||||
|
idx.build_layers(
|
||||||
|
args.min_abundance,
|
||||||
|
args.max_abundance,
|
||||||
|
args.keep_intermediate,
|
||||||
|
&mut rep,
|
||||||
|
).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
} else {
|
||||||
|
info!("index already built, skipping");
|
||||||
|
}
|
||||||
|
|
||||||
|
rep.print();
|
||||||
|
}
|
||||||
@@ -1,143 +0,0 @@
|
|||||||
use std::fs::File;
|
|
||||||
use std::path::PathBuf;
|
|
||||||
use std::sync::atomic::{AtomicUsize, Ordering};
|
|
||||||
|
|
||||||
use clap::Args;
|
|
||||||
use niffler::Level;
|
|
||||||
use niffler::send::compression::Format;
|
|
||||||
use obidebruinj::GraphDeBruijn;
|
|
||||||
use obikpartitionner::KmerPartition;
|
|
||||||
use obikseq::set_k;
|
|
||||||
use obiskio::SKFileReader;
|
|
||||||
use ph::fmph::GOFunction;
|
|
||||||
use rayon::prelude::*;
|
|
||||||
use tracing::info;
|
|
||||||
|
|
||||||
#[derive(Args)]
|
|
||||||
pub struct LongtigArgs {
|
|
||||||
/// Root of the k-mer partition directory (produced by the `partition` command)
|
|
||||||
pub partition: PathBuf,
|
|
||||||
|
|
||||||
/// Minimum kmer abundance (inclusive); kmers below this threshold are excluded
|
|
||||||
#[arg(long, default_value_t = 1)]
|
|
||||||
pub min_abundance: u32,
|
|
||||||
|
|
||||||
/// Maximum kmer abundance (inclusive); kmers above this threshold are excluded
|
|
||||||
#[arg(long)]
|
|
||||||
pub max_abundance: Option<u32>,
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn run(args: LongtigArgs) {
|
|
||||||
let kp = KmerPartition::open(&args.partition).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening partition: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
|
|
||||||
let k = kp.kmer_size();
|
|
||||||
set_k(k);
|
|
||||||
let n = kp.n_partitions();
|
|
||||||
info!("building longtigs from {n} partitions (k={k}, parallel)");
|
|
||||||
|
|
||||||
let total_kmers = AtomicUsize::new(0);
|
|
||||||
|
|
||||||
(0..n).into_par_iter().for_each(|i| {
|
|
||||||
let part_dir = args.partition.join(format!("part_{i:05}"));
|
|
||||||
let in_path = part_dir.join("dereplicated.skmer.zst");
|
|
||||||
if !in_path.exists() {
|
|
||||||
return;
|
|
||||||
}
|
|
||||||
let out_path = part_dir.join("longtig.fasta.gz");
|
|
||||||
|
|
||||||
let mut g = GraphDeBruijn::new();
|
|
||||||
|
|
||||||
let mphf_path = part_dir.join("mphf1.bin");
|
|
||||||
let counts_path = part_dir.join("counts1.bin");
|
|
||||||
let filter_active = (args.min_abundance > 1 || args.max_abundance.is_some())
|
|
||||||
&& mphf_path.exists()
|
|
||||||
&& counts_path.exists();
|
|
||||||
|
|
||||||
let mphf_opt: Option<GOFunction> = if filter_active {
|
|
||||||
let mut f = File::open(&mphf_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening {}: {e}", mphf_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
Some(GOFunction::read(&mut f).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error reading MPHF {}: {e}", mphf_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
}))
|
|
||||||
} else {
|
|
||||||
None
|
|
||||||
};
|
|
||||||
|
|
||||||
let counts_mmap_opt = if filter_active {
|
|
||||||
let cf = File::open(&counts_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening {}: {e}", counts_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
Some(unsafe {
|
|
||||||
memmap2::Mmap::map(&cf).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error mmapping {}: {e}", counts_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
})
|
|
||||||
})
|
|
||||||
} else {
|
|
||||||
None
|
|
||||||
};
|
|
||||||
|
|
||||||
let counts_slice: Option<&[u32]> = counts_mmap_opt
|
|
||||||
.as_ref()
|
|
||||||
.map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) });
|
|
||||||
|
|
||||||
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening {}: {e}", in_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
for sk in reader.iter() {
|
|
||||||
for kmer in sk.iter_canonical_kmers() {
|
|
||||||
let accept = match (&mphf_opt, counts_slice) {
|
|
||||||
(Some(mphf), Some(counts)) => {
|
|
||||||
if let Some(slot) = mphf.get(&kmer) {
|
|
||||||
let ab = counts[slot as usize];
|
|
||||||
ab >= args.min_abundance
|
|
||||||
&& args.max_abundance.map_or(true, |max| ab <= max)
|
|
||||||
} else {
|
|
||||||
false
|
|
||||||
}
|
|
||||||
}
|
|
||||||
_ => true,
|
|
||||||
};
|
|
||||||
if accept {
|
|
||||||
g.push(kmer);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
let n_kmers = g.len();
|
|
||||||
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
|
|
||||||
info!(
|
|
||||||
"partition {i}/{n}: {n_kmers} canonical k-mers → {}",
|
|
||||||
out_path.display()
|
|
||||||
);
|
|
||||||
|
|
||||||
g.compute_degrees();
|
|
||||||
|
|
||||||
let file = File::create(&out_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error creating {}: {e}", out_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
let mut writer = niffler::send::get_writer(Box::new(file), Format::Gzip, Level::Six)
|
|
||||||
.unwrap_or_else(|e| {
|
|
||||||
eprintln!("error creating gzip writer: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
g.write_fasta(&mut writer, false).unwrap_or_else(|e| {
|
|
||||||
eprintln!("write error on partition {i}: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
});
|
|
||||||
|
|
||||||
info!(
|
|
||||||
"done — {} total canonical k-mers across all partitions",
|
|
||||||
total_kmers.load(Ordering::Relaxed)
|
|
||||||
);
|
|
||||||
}
|
|
||||||
@@ -1,6 +1,3 @@
|
|||||||
pub mod count;
|
pub mod index;
|
||||||
pub mod fasta;
|
|
||||||
pub mod longtig;
|
|
||||||
pub mod partition;
|
|
||||||
pub mod superkmer;
|
pub mod superkmer;
|
||||||
pub mod unitig;
|
pub mod unitig;
|
||||||
|
|||||||
@@ -1,61 +0,0 @@
|
|||||||
use std::path::PathBuf;
|
|
||||||
|
|
||||||
use clap::Args;
|
|
||||||
use obikpartitionner::KmerPartition;
|
|
||||||
use obikseq::{RoutableSuperKmer, set_k, set_m};
|
|
||||||
use tracing::info;
|
|
||||||
|
|
||||||
use crate::cli::{CommonArgs, PipelineData, open_chunks};
|
|
||||||
|
|
||||||
#[derive(Args)]
|
|
||||||
pub struct PartitionArgs {
|
|
||||||
/// Output partition directory
|
|
||||||
#[arg(short, long)]
|
|
||||||
pub output: PathBuf,
|
|
||||||
|
|
||||||
/// Overwrite output directory if it already exists
|
|
||||||
#[arg(long, default_value_t = false)]
|
|
||||||
pub force: bool,
|
|
||||||
|
|
||||||
#[command(flatten)]
|
|
||||||
pub common: CommonArgs,
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── Entry point ───────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
pub fn run(args: PartitionArgs) {
|
|
||||||
let k = args.common.kmer_size;
|
|
||||||
set_k(k);
|
|
||||||
let m = args.common.minimizer_size;
|
|
||||||
set_m(m);
|
|
||||||
let theta = args.common.theta;
|
|
||||||
let level_max = args.common.level_max;
|
|
||||||
let n_workers = args.common.threads.max(1);
|
|
||||||
|
|
||||||
let mut kp = KmerPartition::create(&args.output, args.common.partition_bits, k, m, args.force)
|
|
||||||
.unwrap_or_else(|e| {
|
|
||||||
eprintln!("error: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
|
|
||||||
let path_source = args.common.seqfile_paths();
|
|
||||||
|
|
||||||
let pipe = obipipeline::make_pipe! {
|
|
||||||
PipelineData : PathBuf => Vec<RoutableSuperKmer>,
|
|
||||||
||? { |path| open_chunks(path) } : Path => RawChunk,
|
|
||||||
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
|
|
||||||
| { move |rope| obiskbuilder::build_superkmers(rope, k, level_max, theta) }: NormChunk => Batch,
|
|
||||||
};
|
|
||||||
|
|
||||||
for batch in pipe.apply(path_source, n_workers, 1) {
|
|
||||||
kp.write_batch(batch).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
}
|
|
||||||
kp.close().expect("close error");
|
|
||||||
|
|
||||||
info!("dereplicating...");
|
|
||||||
kp.dereplicate().expect("dereplicate error");
|
|
||||||
kp.count_kmer().expect("count kmer error");
|
|
||||||
}
|
|
||||||
@@ -3,7 +3,7 @@ use std::path::PathBuf;
|
|||||||
|
|
||||||
use clap::Args;
|
use clap::Args;
|
||||||
use obifastwrite::write_scatter;
|
use obifastwrite::write_scatter;
|
||||||
use obikseq::RoutableSuperKmer;
|
use obikseq::{RoutableSuperKmer, set_k, set_m};
|
||||||
|
|
||||||
use crate::cli::{CommonArgs, PipelineData, open_chunks};
|
use crate::cli::{CommonArgs, PipelineData, open_chunks};
|
||||||
|
|
||||||
@@ -41,6 +41,9 @@ pub fn run(args: SuperkmerArgs) {
|
|||||||
let partition_bits = args.common.partition_bits;
|
let partition_bits = args.common.partition_bits;
|
||||||
let n_workers = args.common.threads.max(1);
|
let n_workers = args.common.threads.max(1);
|
||||||
|
|
||||||
|
set_k(k);
|
||||||
|
set_m(m);
|
||||||
|
|
||||||
let path_source = args.common.seqfile_paths();
|
let path_source = args.common.seqfile_paths();
|
||||||
|
|
||||||
let pipe = obipipeline::make_pipe! {
|
let pipe = obipipeline::make_pipe! {
|
||||||
|
|||||||
+26
-115
@@ -1,143 +1,54 @@
|
|||||||
use std::fs::File;
|
use std::io::{self, BufWriter, Write};
|
||||||
use std::path::PathBuf;
|
use std::path::PathBuf;
|
||||||
use std::sync::atomic::{AtomicUsize, Ordering};
|
use std::sync::Mutex;
|
||||||
|
|
||||||
use clap::Args;
|
use clap::Args;
|
||||||
use niffler::Level;
|
use obifastwrite::write_unitig;
|
||||||
use niffler::send::compression::Format;
|
use obikindex::KmerIndex;
|
||||||
use obidebruinj::GraphDeBruijn;
|
|
||||||
use obikpartitionner::KmerPartition;
|
|
||||||
use obikseq::set_k;
|
use obikseq::set_k;
|
||||||
use obiskio::SKFileReader;
|
use obiskio::UnitigFileReader;
|
||||||
use ph::fmph::GOFunction;
|
|
||||||
use rayon::prelude::*;
|
use rayon::prelude::*;
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
#[derive(Args)]
|
#[derive(Args)]
|
||||||
pub struct UnitigArgs {
|
pub struct UnitigArgs {
|
||||||
/// Root of the k-mer partition directory (produced by the `partition` command)
|
/// Index directory produced by the `index` command
|
||||||
pub partition: PathBuf,
|
pub index: PathBuf,
|
||||||
|
|
||||||
/// Minimum kmer abundance (inclusive); kmers below this threshold are excluded
|
|
||||||
#[arg(long, default_value_t = 1)]
|
|
||||||
pub min_abundance: u32,
|
|
||||||
|
|
||||||
/// Maximum kmer abundance (inclusive); kmers above this threshold are excluded
|
|
||||||
#[arg(long)]
|
|
||||||
pub max_abundance: Option<u32>,
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn run(args: UnitigArgs) {
|
pub fn run(args: UnitigArgs) {
|
||||||
let kp = KmerPartition::open(&args.partition).unwrap_or_else(|e| {
|
let idx = KmerIndex::open(&args.index).unwrap_or_else(|e| {
|
||||||
eprintln!("error opening partition: {e}");
|
eprintln!("error opening index: {e}");
|
||||||
std::process::exit(1)
|
std::process::exit(1)
|
||||||
});
|
});
|
||||||
|
|
||||||
let k = kp.kmer_size();
|
let k = idx.kmer_size();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let n = kp.n_partitions();
|
let n = idx.n_partitions();
|
||||||
info!("building unitigs from {n} partitions (k={k}, parallel)");
|
info!("dumping unitigs from {n} partitions (k={k})");
|
||||||
|
|
||||||
let total_kmers = AtomicUsize::new(0);
|
let stdout = Mutex::new(BufWriter::new(io::stdout()));
|
||||||
|
|
||||||
(0..n).into_par_iter().for_each(|i| {
|
(0..n).into_par_iter().for_each(|i| {
|
||||||
let part_dir = args.partition.join(format!("part_{i:05}"));
|
let path = idx.layer_unitigs_path(i, 0);
|
||||||
let in_path = part_dir.join("dereplicated.skmer.zst");
|
if !path.exists() {
|
||||||
if !in_path.exists() {
|
|
||||||
return;
|
return;
|
||||||
}
|
}
|
||||||
let out_path = part_dir.join("unitig.fasta.gz");
|
|
||||||
|
|
||||||
let mut g = GraphDeBruijn::new();
|
let reader = UnitigFileReader::open(&path).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error opening unitigs (partition {i}): {e}");
|
||||||
let mphf_path = part_dir.join("mphf1.bin");
|
|
||||||
let counts_path = part_dir.join("counts1.bin");
|
|
||||||
let filter_active = (args.min_abundance > 1 || args.max_abundance.is_some())
|
|
||||||
&& mphf_path.exists()
|
|
||||||
&& counts_path.exists();
|
|
||||||
|
|
||||||
let mphf_opt: Option<GOFunction> = if filter_active {
|
|
||||||
let mut f = File::open(&mphf_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening {}: {e}", mphf_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
Some(GOFunction::read(&mut f).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error reading MPHF {}: {e}", mphf_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
}))
|
|
||||||
} else {
|
|
||||||
None
|
|
||||||
};
|
|
||||||
|
|
||||||
let counts_mmap_opt = if filter_active {
|
|
||||||
let cf = File::open(&counts_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening {}: {e}", counts_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
Some(unsafe {
|
|
||||||
memmap2::Mmap::map(&cf).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error mmapping {}: {e}", counts_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
})
|
|
||||||
})
|
|
||||||
} else {
|
|
||||||
None
|
|
||||||
};
|
|
||||||
|
|
||||||
let counts_slice: Option<&[u32]> = counts_mmap_opt
|
|
||||||
.as_ref()
|
|
||||||
.map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) });
|
|
||||||
|
|
||||||
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error opening {}: {e}", in_path.display());
|
|
||||||
std::process::exit(1)
|
std::process::exit(1)
|
||||||
});
|
});
|
||||||
for sk in reader.iter() {
|
|
||||||
for kmer in sk.iter_canonical_kmers() {
|
for j in 0..reader.len() {
|
||||||
let accept = match (&mphf_opt, counts_slice) {
|
let unitig = reader.unitig(j);
|
||||||
(Some(mphf), Some(counts)) => {
|
let mut out = stdout.lock().unwrap();
|
||||||
if let Some(slot) = mphf.get(&kmer) {
|
write_unitig(&unitig, k, i, j, &mut *out).unwrap_or_else(|e| {
|
||||||
let ab = counts[slot as usize];
|
eprintln!("write error: {e}");
|
||||||
ab >= args.min_abundance
|
std::process::exit(1)
|
||||||
&& args.max_abundance.map_or(true, |max| ab <= max)
|
});
|
||||||
} else {
|
|
||||||
false
|
|
||||||
}
|
|
||||||
}
|
|
||||||
_ => true,
|
|
||||||
};
|
|
||||||
if accept {
|
|
||||||
g.push(kmer);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
let n_kmers = g.len();
|
|
||||||
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
|
|
||||||
info!(
|
|
||||||
"partition {i}/{n}: {n_kmers} canonical k-mers → {}",
|
|
||||||
out_path.display()
|
|
||||||
);
|
|
||||||
|
|
||||||
g.compute_degrees();
|
|
||||||
|
|
||||||
let file = File::create(&out_path).unwrap_or_else(|e| {
|
|
||||||
eprintln!("error creating {}: {e}", out_path.display());
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
let mut writer = niffler::send::get_writer(Box::new(file), Format::Gzip, Level::Six)
|
|
||||||
.unwrap_or_else(|e| {
|
|
||||||
eprintln!("error creating gzip writer: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
g.write_fasta(&mut writer, true).unwrap_or_else(|e| {
|
|
||||||
eprintln!("write error on partition {i}: {e}");
|
|
||||||
std::process::exit(1)
|
|
||||||
});
|
|
||||||
});
|
});
|
||||||
|
|
||||||
info!(
|
stdout.into_inner().unwrap().flush().expect("flush error");
|
||||||
"done — {} total canonical k-mers across all partitions",
|
|
||||||
total_kmers.load(Ordering::Relaxed)
|
|
||||||
);
|
|
||||||
}
|
}
|
||||||
|
|||||||
+7
-15
@@ -1,5 +1,6 @@
|
|||||||
mod cli;
|
mod cli;
|
||||||
mod cmd;
|
mod cmd;
|
||||||
|
mod steps;
|
||||||
|
|
||||||
use clap::{Parser, Subcommand};
|
use clap::{Parser, Subcommand};
|
||||||
use tracing_subscriber::{EnvFilter, fmt};
|
use tracing_subscriber::{EnvFilter, fmt};
|
||||||
@@ -13,18 +14,12 @@ struct Cli {
|
|||||||
|
|
||||||
#[derive(Subcommand)]
|
#[derive(Subcommand)]
|
||||||
enum Commands {
|
enum Commands {
|
||||||
/// Extract super-kmers from a sequence file (scatter phase)
|
/// Extract super-kmers from a sequence file and write to stdout
|
||||||
Superkmer(cmd::superkmer::SuperkmerArgs),
|
Superkmer(cmd::superkmer::SuperkmerArgs),
|
||||||
/// Partition super-kmers on disk by minimizer
|
/// Build the complete genome index (scatter → dereplicate → count → layered MPHF)
|
||||||
Partition(cmd::partition::PartitionArgs),
|
Index(cmd::index::IndexArgs),
|
||||||
/// Count kmers from an existing dereplicated partition directory
|
/// Dump unitigs from a built index to stdout (debug)
|
||||||
Count(cmd::count::CountArgs),
|
|
||||||
/// Export partition data to FASTA (--super-kmers: dereplicated super-kmers)
|
|
||||||
Fasta(cmd::fasta::FastaArgs),
|
|
||||||
/// Build de Bruijn unitigs for all partitions and write to unitig.fasta.gz
|
|
||||||
Unitig(cmd::unitig::UnitigArgs),
|
Unitig(cmd::unitig::UnitigArgs),
|
||||||
/// Build de Bruijn longtigs for all partitions and write to longtig.fasta.gz
|
|
||||||
Longtig(cmd::longtig::LongtigArgs),
|
|
||||||
}
|
}
|
||||||
|
|
||||||
fn main() {
|
fn main() {
|
||||||
@@ -47,11 +42,8 @@ fn main() {
|
|||||||
let cli = Cli::parse();
|
let cli = Cli::parse();
|
||||||
match cli.command {
|
match cli.command {
|
||||||
Commands::Superkmer(args) => cmd::superkmer::run(args),
|
Commands::Superkmer(args) => cmd::superkmer::run(args),
|
||||||
Commands::Partition(args) => cmd::partition::run(args),
|
Commands::Index(args) => cmd::index::run(args),
|
||||||
Commands::Count(args) => cmd::count::run(args),
|
Commands::Unitig(args) => cmd::unitig::run(args),
|
||||||
Commands::Fasta(args) => cmd::fasta::run(args),
|
|
||||||
Commands::Unitig(args) => cmd::unitig::run(args),
|
|
||||||
Commands::Longtig(args) => cmd::longtig::run(args),
|
|
||||||
}
|
}
|
||||||
|
|
||||||
#[cfg(feature = "profiling")]
|
#[cfg(feature = "profiling")]
|
||||||
|
|||||||
@@ -0,0 +1,3 @@
|
|||||||
|
mod scatter;
|
||||||
|
|
||||||
|
pub use scatter::scatter;
|
||||||
@@ -0,0 +1,71 @@
|
|||||||
|
use std::path::PathBuf;
|
||||||
|
use std::time::{Duration, Instant};
|
||||||
|
|
||||||
|
use indicatif::{ProgressBar, ProgressStyle};
|
||||||
|
use obikpartitionner::KmerPartition;
|
||||||
|
use obisys::{Reporter, Stage};
|
||||||
|
|
||||||
|
use crate::cli::{PipelineData, open_chunks};
|
||||||
|
|
||||||
|
/// Run scatter: normalise → build superkmers → route to partition → close.
|
||||||
|
/// Reports the "scatter" stage to `rep`.
|
||||||
|
pub fn scatter(
|
||||||
|
kp: &mut KmerPartition,
|
||||||
|
path_source: obiread::PathIter,
|
||||||
|
k: usize,
|
||||||
|
level_max: usize,
|
||||||
|
theta: f64,
|
||||||
|
n_workers: usize,
|
||||||
|
rep: &mut Reporter,
|
||||||
|
) {
|
||||||
|
use obikseq::RoutableSuperKmer;
|
||||||
|
|
||||||
|
let t = Stage::start("scatter");
|
||||||
|
let pipe = obipipeline::make_pipe! {
|
||||||
|
PipelineData : PathBuf => Vec<RoutableSuperKmer>,
|
||||||
|
||? { |path| open_chunks(path) } : Path => RawChunk,
|
||||||
|
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
|
||||||
|
| { move |rope| obiskbuilder::build_superkmers(rope, k, level_max, theta) }: NormChunk => Batch,
|
||||||
|
};
|
||||||
|
|
||||||
|
let pb = ProgressBar::new_spinner();
|
||||||
|
pb.set_style(
|
||||||
|
ProgressStyle::with_template("{spinner} scatter — {msg} {elapsed}")
|
||||||
|
.unwrap()
|
||||||
|
.tick_strings(&["⠋", "⠙", "⠹", "⠸", "⠼", "⠴", "⠦", "⠧", "⠇", "⠏"]),
|
||||||
|
);
|
||||||
|
pb.enable_steady_tick(Duration::from_millis(100));
|
||||||
|
|
||||||
|
let mut total_bases: u64 = 0;
|
||||||
|
let mut ema_rate: f64 = 0.0;
|
||||||
|
let mut last_t = Instant::now();
|
||||||
|
let mut last_bases: u64 = 0;
|
||||||
|
const ALPHA: f64 = 0.15;
|
||||||
|
|
||||||
|
for batch in pipe.apply(path_source, n_workers, 1) {
|
||||||
|
total_bases += batch.iter().map(|sk| sk.seql() as u64).sum::<u64>();
|
||||||
|
let now = Instant::now();
|
||||||
|
let dt = now.duration_since(last_t).as_secs_f64();
|
||||||
|
if dt > 0.1 {
|
||||||
|
let instant = (total_bases - last_bases) as f64 / dt;
|
||||||
|
ema_rate = ALPHA * instant + (1.0 - ALPHA) * ema_rate;
|
||||||
|
last_t = now;
|
||||||
|
last_bases = total_bases;
|
||||||
|
let bp = total_bases as f64;
|
||||||
|
let (count_str, rate_str) = if bp >= 1e9 {
|
||||||
|
(format!("{:.2} Gbp", bp / 1e9), format!("{:.0} Mbp/s", ema_rate / 1e6))
|
||||||
|
} else {
|
||||||
|
(format!("{:.0} Mbp", bp / 1e6), format!("{:.0} Mbp/s", ema_rate / 1e6))
|
||||||
|
};
|
||||||
|
pb.set_message(format!("{count_str} {rate_str}"));
|
||||||
|
}
|
||||||
|
kp.write_batch(batch).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
}
|
||||||
|
pb.finish_and_clear();
|
||||||
|
kp.close().expect("close error");
|
||||||
|
rep.push(t.stop());
|
||||||
|
}
|
||||||
|
|
||||||
@@ -25,3 +25,4 @@ epserde = "0.8"
|
|||||||
memmap2 = "0.9.10"
|
memmap2 = "0.9.10"
|
||||||
obicompactvec = { path = "../obicompactvec" }
|
obicompactvec = { path = "../obicompactvec" }
|
||||||
ptr_hash = "1.1"
|
ptr_hash = "1.1"
|
||||||
|
indicatif = "0.17"
|
||||||
|
|||||||
@@ -1,4 +1,4 @@
|
|||||||
mod kmer_sort;
|
mod kmer_sort;
|
||||||
mod partition;
|
mod partition;
|
||||||
|
|
||||||
pub use partition::KmerPartition;
|
pub use partition::{KmerPartition, PARTITIONS_SUBDIR};
|
||||||
|
|||||||
@@ -2,7 +2,10 @@ use std::collections::{BTreeMap, HashMap};
|
|||||||
use std::fs;
|
use std::fs;
|
||||||
use std::io;
|
use std::io;
|
||||||
use std::path::{Path, PathBuf};
|
use std::path::{Path, PathBuf};
|
||||||
use tracing::{debug, info};
|
use std::time::Instant;
|
||||||
|
use tracing::debug;
|
||||||
|
|
||||||
|
use indicatif::{ProgressBar, ProgressStyle};
|
||||||
|
|
||||||
use cacheline_ef::{CachelineEf, CachelineEfVec};
|
use cacheline_ef::{CachelineEf, CachelineEfVec};
|
||||||
use epserde::ser::Serialize as EpSerialize;
|
use epserde::ser::Serialize as EpSerialize;
|
||||||
@@ -27,6 +30,7 @@ type Mphf = PtrHash<u64, CubicEps, CachelineEfVec<Vec<CachelineEf>>, Xx64, Vec<u
|
|||||||
|
|
||||||
const META_FILENAME: &str = "partition.meta";
|
const META_FILENAME: &str = "partition.meta";
|
||||||
const SK_EXT: &str = "skmer.zst";
|
const SK_EXT: &str = "skmer.zst";
|
||||||
|
pub const PARTITIONS_SUBDIR: &str = "partitions";
|
||||||
|
|
||||||
#[derive(Serialize, Deserialize)]
|
#[derive(Serialize, Deserialize)]
|
||||||
struct PartitionMeta {
|
struct PartitionMeta {
|
||||||
@@ -55,7 +59,7 @@ impl KmerPartition {
|
|||||||
minimizer_size: usize,
|
minimizer_size: usize,
|
||||||
force: bool,
|
force: bool,
|
||||||
) -> SKResult<Self> {
|
) -> SKResult<Self> {
|
||||||
Self::create_with(path, n_bits, kmer_size, minimizer_size, Level::Three, force)
|
Self::create_with(path, n_bits, kmer_size, minimizer_size, Level::One, force)
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn create_with<P: AsRef<Path>>(
|
pub fn create_with<P: AsRef<Path>>(
|
||||||
@@ -81,7 +85,7 @@ impl KmerPartition {
|
|||||||
.into());
|
.into());
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
fs::create_dir_all(&root_path)?;
|
fs::create_dir_all(root_path.join(PARTITIONS_SUBDIR))?;
|
||||||
let n_partitions = 1usize << n_bits;
|
let n_partitions = 1usize << n_bits;
|
||||||
let writers = (0..n_partitions).map(|_| None).collect();
|
let writers = (0..n_partitions).map(|_| None).collect();
|
||||||
let partition = Self {
|
let partition = Self {
|
||||||
@@ -172,6 +176,11 @@ impl KmerPartition {
|
|||||||
&self.root_path
|
&self.root_path
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Path of partition `i` directory.
|
||||||
|
pub fn part_dir(&self, i: usize) -> PathBuf {
|
||||||
|
self.root_path.join(PARTITIONS_SUBDIR).join(format!("part_{i:05}"))
|
||||||
|
}
|
||||||
|
|
||||||
pub fn kmer_size(&self) -> usize {
|
pub fn kmer_size(&self) -> usize {
|
||||||
self.kmer_size
|
self.kmer_size
|
||||||
}
|
}
|
||||||
@@ -205,7 +214,6 @@ impl KmerPartition {
|
|||||||
/// more temporary file descriptors — all managed by the global fd pool.
|
/// more temporary file descriptors — all managed by the global fd pool.
|
||||||
pub fn dereplicate(&self) -> SKResult<()> {
|
pub fn dereplicate(&self) -> SKResult<()> {
|
||||||
let level = self.level;
|
let level = self.level;
|
||||||
let root = &self.root_path;
|
|
||||||
let sys = System::new_all();
|
let sys = System::new_all();
|
||||||
// available_memory() can return 0 on macOS when the compressor page count exceeds
|
// available_memory() can return 0 on macOS when the compressor page count exceeds
|
||||||
// free+inactive+purgeable pages (sysinfo saturating_sub). Fall back to half of total.
|
// free+inactive+purgeable pages (sysinfo saturating_sub). Fall back to half of total.
|
||||||
@@ -219,7 +227,7 @@ impl KmerPartition {
|
|||||||
let results: Vec<SKResult<()>> = (0..self.n_partitions)
|
let results: Vec<SKResult<()>> = (0..self.n_partitions)
|
||||||
.into_par_iter()
|
.into_par_iter()
|
||||||
.map(|i| {
|
.map(|i| {
|
||||||
let dir = root.join(format!("part_{:05}", i));
|
let dir = self.part_dir(i);
|
||||||
if !dir.exists() {
|
if !dir.exists() {
|
||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
@@ -246,8 +254,6 @@ impl KmerPartition {
|
|||||||
/// Partitions are processed in parallel via Rayon (one task per thread).
|
/// Partitions are processed in parallel via Rayon (one task per thread).
|
||||||
/// Peak memory per partition is ~80 MB, so n_threads partitions run simultaneously.
|
/// Peak memory per partition is ~80 MB, so n_threads partitions run simultaneously.
|
||||||
pub fn count_kmer(&self) -> SKResult<()> {
|
pub fn count_kmer(&self) -> SKResult<()> {
|
||||||
let root = &self.root_path;
|
|
||||||
|
|
||||||
let sys = System::new_all();
|
let sys = System::new_all();
|
||||||
let available = match sys.available_memory() {
|
let available = match sys.available_memory() {
|
||||||
0 => sys.total_memory() / 2,
|
0 => sys.total_memory() / 2,
|
||||||
@@ -256,18 +262,33 @@ impl KmerPartition {
|
|||||||
let n_threads = rayon::current_num_threads().max(1) as u64;
|
let n_threads = rayon::current_num_threads().max(1) as u64;
|
||||||
let chunk_kmers = chunk_size_from_ram(available / n_threads);
|
let chunk_kmers = chunk_size_from_ram(available / n_threads);
|
||||||
|
|
||||||
|
let pb = ProgressBar::new(self.n_partitions as u64);
|
||||||
|
pb.set_style(
|
||||||
|
ProgressStyle::with_template(
|
||||||
|
"counting [{bar:40}] {pos}/{len} ({percent}%) {per_sec} eta {eta} {msg}",
|
||||||
|
)
|
||||||
|
.unwrap()
|
||||||
|
.progress_chars("█▌░"),
|
||||||
|
);
|
||||||
|
|
||||||
let results: Vec<SKResult<()>> = (0..self.n_partitions)
|
let results: Vec<SKResult<()>> = (0..self.n_partitions)
|
||||||
.into_par_iter()
|
.into_par_iter()
|
||||||
.map(|i| {
|
.map(|i| {
|
||||||
let dir = root.join(format!("part_{:05}", i));
|
let dir = self.part_dir(i);
|
||||||
let dedup_path = dir.join(format!("dereplicated.{SK_EXT}"));
|
let dedup_path = dir.join(format!("dereplicated.{SK_EXT}"));
|
||||||
if !dedup_path.exists() {
|
if !dedup_path.exists() {
|
||||||
|
pb.inc(1);
|
||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
info!("counting kmers in partition {}/{}", i, self.n_partitions);
|
let t = Instant::now();
|
||||||
count_partition(&dir, &dedup_path, chunk_kmers)
|
let result = count_partition(&dir, &dedup_path, chunk_kmers);
|
||||||
|
pb.set_message(format!("last {:.0}ms", t.elapsed().as_millis()));
|
||||||
|
pb.inc(1);
|
||||||
|
result
|
||||||
})
|
})
|
||||||
.collect();
|
.collect();
|
||||||
|
|
||||||
|
pb.finish_and_clear();
|
||||||
for r in results {
|
for r in results {
|
||||||
r?;
|
r?;
|
||||||
}
|
}
|
||||||
@@ -278,9 +299,7 @@ impl KmerPartition {
|
|||||||
let mut global_f1: u64 = 0;
|
let mut global_f1: u64 = 0;
|
||||||
|
|
||||||
for i in 0..self.n_partitions {
|
for i in 0..self.n_partitions {
|
||||||
let path = root
|
let path = self.part_dir(i).join("kmer_spectrum_raw.json");
|
||||||
.join(format!("part_{:05}", i))
|
|
||||||
.join("kmer_spectrum_raw.json");
|
|
||||||
if !path.exists() {
|
if !path.exists() {
|
||||||
continue;
|
continue;
|
||||||
}
|
}
|
||||||
@@ -302,7 +321,7 @@ impl KmerPartition {
|
|||||||
.map(|(&c, &f)| (format!("{c:010}"), f))
|
.map(|(&c, &f)| (format!("{c:010}"), f))
|
||||||
.collect();
|
.collect();
|
||||||
serde_json::to_writer_pretty(
|
serde_json::to_writer_pretty(
|
||||||
fs::File::create(root.join("kmer_spectrum_raw.json"))?,
|
fs::File::create(self.root_path.join("kmer_spectrum_raw.json"))?,
|
||||||
&serde_json::json!({ "f0": global_f0, "f1": global_f1, "spectrum": &global_spectrum_map }),
|
&serde_json::json!({ "f0": global_f0, "f1": global_f1, "spectrum": &global_spectrum_map }),
|
||||||
)
|
)
|
||||||
.map_err(io::Error::other)?;
|
.map_err(io::Error::other)?;
|
||||||
@@ -334,7 +353,7 @@ impl KmerPartition {
|
|||||||
|
|
||||||
fn ensure_writer(&mut self, partition: usize) -> SKResult<&mut SKFileWriter> {
|
fn ensure_writer(&mut self, partition: usize) -> SKResult<&mut SKFileWriter> {
|
||||||
if self.writers[partition].is_none() {
|
if self.writers[partition].is_none() {
|
||||||
let dir = self.root_path.join(format!("part_{:05}", partition));
|
let dir = self.root_path.join(PARTITIONS_SUBDIR).join(format!("part_{:05}", partition));
|
||||||
fs::create_dir_all(&dir)?;
|
fs::create_dir_all(&dir)?;
|
||||||
let file_path = dir.join(format!("raw.{SK_EXT}"));
|
let file_path = dir.join(format!("raw.{SK_EXT}"));
|
||||||
let writer = SKFileWriter::create_with(file_path, Format::Zstd, self.level)?;
|
let writer = SKFileWriter::create_with(file_path, Format::Zstd, self.level)?;
|
||||||
@@ -509,7 +528,11 @@ fn build_mphf(unique_path: &Path, f0: usize) -> io::Result<Mphf> {
|
|||||||
let kmers: &[u64] = unsafe {
|
let kmers: &[u64] = unsafe {
|
||||||
std::slice::from_raw_parts(mmap.as_ptr() as *const u64, f0)
|
std::slice::from_raw_parts(mmap.as_ptr() as *const u64, f0)
|
||||||
};
|
};
|
||||||
Ok(Mphf::new_from_par_iter(f0, kmers.par_iter().copied(), PtrHashParams::<CubicEps>::default()))
|
// Sequential constructor: the outer par_iter over partitions already saturates
|
||||||
|
// the Rayon pool. new_from_par_iter would get no additional threads and adds
|
||||||
|
// coordination overhead. try_new accesses the same mmap'd pages at zero extra cost.
|
||||||
|
Mphf::try_new(kmers, PtrHashParams::<CubicEps>::default())
|
||||||
|
.ok_or_else(|| io::Error::other("ptr_hash construction failed"))
|
||||||
}
|
}
|
||||||
|
|
||||||
fn count_partition(dir: &Path, dedup_path: &Path, chunk_kmers: usize) -> SKResult<()> {
|
fn count_partition(dir: &Path, dedup_path: &Path, chunk_kmers: usize) -> SKResult<()> {
|
||||||
@@ -623,7 +646,7 @@ mod tests {
|
|||||||
kp.close().unwrap();
|
kp.close().unwrap();
|
||||||
kp.dereplicate().unwrap();
|
kp.dereplicate().unwrap();
|
||||||
|
|
||||||
let part_dir = dir.path().join("part_00000");
|
let part_dir = dir.path().join(PARTITIONS_SUBDIR).join("part_00000");
|
||||||
let dedup_path = part_dir.join("dereplicated.skmer.zst");
|
let dedup_path = part_dir.join("dereplicated.skmer.zst");
|
||||||
if !dedup_path.exists() {
|
if !dedup_path.exists() {
|
||||||
return (0, 0);
|
return (0, 0);
|
||||||
|
|||||||
@@ -118,7 +118,7 @@ pub struct KmerOf<L: KmerLength>(u64, PhantomData<L>);
|
|||||||
impl<L: KmerLength> KmerOf<L> {
|
impl<L: KmerLength> KmerOf<L> {
|
||||||
/// Wrap a raw left-aligned u64 value as a kmer.
|
/// Wrap a raw left-aligned u64 value as a kmer.
|
||||||
#[inline]
|
#[inline]
|
||||||
pub fn from_raw(raw: u64) -> Self {
|
pub const fn from_raw(raw: u64) -> Self {
|
||||||
KmerOf(raw, PhantomData)
|
KmerOf(raw, PhantomData)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -0,0 +1,145 @@
|
|||||||
|
use std::fs;
|
||||||
|
use std::path::PathBuf;
|
||||||
|
|
||||||
|
const K_MAX: usize = 32;
|
||||||
|
const WS_MAX: usize = 6;
|
||||||
|
|
||||||
|
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
|
||||||
|
let mask = (1u64 << (ws * 2)) - 1;
|
||||||
|
let mut canonical = kmer & mask;
|
||||||
|
let mut current = canonical;
|
||||||
|
for _ in 0..ws - 1 {
|
||||||
|
let top = (current >> ((ws - 1) * 2)) & 3;
|
||||||
|
current = ((current << 2) | top) & mask;
|
||||||
|
if current < canonical {
|
||||||
|
canonical = current;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
canonical
|
||||||
|
}
|
||||||
|
|
||||||
|
fn revcomp_raw(x: u64, k: usize) -> u64 {
|
||||||
|
let x = !x;
|
||||||
|
let x = x.swap_bytes();
|
||||||
|
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
|
||||||
|
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
|
||||||
|
x << (64 - 2 * k)
|
||||||
|
}
|
||||||
|
|
||||||
|
fn build_normalized_kmer(k: usize) -> Vec<u64> {
|
||||||
|
let n = 1usize << (k * 2);
|
||||||
|
let shift = 64 - k * 2;
|
||||||
|
let mut result = vec![0u64; n];
|
||||||
|
for i in 0..n {
|
||||||
|
let la = (i as u64) << shift;
|
||||||
|
let ra = i as u64;
|
||||||
|
let rc_ra = revcomp_raw(la, k) >> shift;
|
||||||
|
let circ = normalize_circular(ra, k);
|
||||||
|
let circ_rc = normalize_circular(rc_ra, k);
|
||||||
|
result[i] = if circ < circ_rc { circ } else { circ_rc };
|
||||||
|
}
|
||||||
|
result
|
||||||
|
}
|
||||||
|
|
||||||
|
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
|
||||||
|
let n = norm.len();
|
||||||
|
let mut sizes = vec![0u32; n];
|
||||||
|
for &c in norm {
|
||||||
|
sizes[c as usize] += 1;
|
||||||
|
}
|
||||||
|
norm.iter()
|
||||||
|
.map(|&c| {
|
||||||
|
let s = sizes[c as usize];
|
||||||
|
if s > 0 { (s as f64).ln() } else { 0.0 }
|
||||||
|
})
|
||||||
|
.collect()
|
||||||
|
}
|
||||||
|
|
||||||
|
fn build_n_log_n() -> [f64; K_MAX + 1] {
|
||||||
|
let mut t = [0.0f64; K_MAX + 1];
|
||||||
|
for n in 1..=K_MAX {
|
||||||
|
t[n] = (n as f64) * (n as f64).ln();
|
||||||
|
}
|
||||||
|
t
|
||||||
|
}
|
||||||
|
|
||||||
|
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
|
||||||
|
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
|
||||||
|
for k in 2..=K_MAX {
|
||||||
|
for ws in 1..=WS_MAX.min(k - 1) {
|
||||||
|
let n_raw = 1usize << (ws * 2);
|
||||||
|
let nwords = k - ws + 1;
|
||||||
|
let c = nwords / n_raw;
|
||||||
|
let r = nwords % n_raw;
|
||||||
|
let nf = nwords as f64;
|
||||||
|
let t1 = if c == 0 || n_raw == r {
|
||||||
|
0.0
|
||||||
|
} else {
|
||||||
|
let f1 = c as f64 / nf;
|
||||||
|
(n_raw - r) as f64 * f1 * f1.ln()
|
||||||
|
};
|
||||||
|
let t2 = if r == 0 {
|
||||||
|
0.0
|
||||||
|
} else {
|
||||||
|
let f2 = (c + 1) as f64 / nf;
|
||||||
|
r as f64 * f2 * f2.ln()
|
||||||
|
};
|
||||||
|
t[k][ws] = -(t1 + t2);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
t
|
||||||
|
}
|
||||||
|
|
||||||
|
fn build_log_nwords() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
|
||||||
|
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
|
||||||
|
for k in 2..=K_MAX {
|
||||||
|
for ws in 1..=WS_MAX.min(k - 1) {
|
||||||
|
t[k][ws] = ((k - ws + 1) as f64).ln();
|
||||||
|
}
|
||||||
|
}
|
||||||
|
t
|
||||||
|
}
|
||||||
|
|
||||||
|
fn emit_f64_1d(out: &mut String, name: &str, n: usize, values: &[f64]) {
|
||||||
|
out.push_str(&format!("pub(crate) const {name}: [f64; {n}] = [\n"));
|
||||||
|
for v in values {
|
||||||
|
out.push_str(&format!(" {v:?},\n"));
|
||||||
|
}
|
||||||
|
out.push_str("];\n");
|
||||||
|
}
|
||||||
|
|
||||||
|
fn emit_f64_2d(out: &mut String, name: &str, rows: usize, cols: usize, values: &[[f64; WS_MAX + 1]]) {
|
||||||
|
out.push_str(&format!("pub(crate) const {name}: [[f64; {cols}]; {rows}] = [\n"));
|
||||||
|
for row in values {
|
||||||
|
out.push_str(" [");
|
||||||
|
for (i, v) in row.iter().enumerate() {
|
||||||
|
if i > 0 { out.push_str(", "); }
|
||||||
|
out.push_str(&format!("{v:?}"));
|
||||||
|
}
|
||||||
|
out.push_str("],\n");
|
||||||
|
}
|
||||||
|
out.push_str("];\n");
|
||||||
|
}
|
||||||
|
|
||||||
|
fn main() {
|
||||||
|
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
|
||||||
|
let mut out = String::new();
|
||||||
|
|
||||||
|
for k in 1..=6usize {
|
||||||
|
let n = 1usize << (k * 2);
|
||||||
|
let norm = build_normalized_kmer(k);
|
||||||
|
let ln_class = build_ln_class(&norm);
|
||||||
|
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
|
||||||
|
}
|
||||||
|
|
||||||
|
let n_log_n = build_n_log_n();
|
||||||
|
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
|
||||||
|
|
||||||
|
let emax = build_emax();
|
||||||
|
emit_f64_2d(&mut out, "EMAX", K_MAX + 1, WS_MAX + 1, &emax);
|
||||||
|
|
||||||
|
let log_nwords = build_log_nwords();
|
||||||
|
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
|
||||||
|
|
||||||
|
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap();
|
||||||
|
}
|
||||||
@@ -1,173 +1,108 @@
|
|||||||
use obikseq::kmer::Kmer;
|
pub(crate) const NORMK1: [u64; 4] = build_normalized_kmer::<4>();
|
||||||
use std::sync::LazyLock;
|
pub(crate) const NORMK2: [u64; 16] = build_normalized_kmer::<16>();
|
||||||
|
pub(crate) const NORMK3: [u64; 64] = build_normalized_kmer::<64>();
|
||||||
|
pub(crate) const NORMK4: [u64; 256] = build_normalized_kmer::<256>();
|
||||||
|
pub(crate) const NORMK5: [u64; 1024] = build_normalized_kmer::<1024>();
|
||||||
|
pub(crate) const NORMK6: [u64; 4096] = build_normalized_kmer::<4096>();
|
||||||
|
|
||||||
pub(crate) static NORMK1: LazyLock<[u64; 4]> = LazyLock::new(|| build_normalized_kmer::<4>());
|
include!(concat!(env!("OUT_DIR"), "/ln_class_tables.rs"));
|
||||||
pub(crate) static NORMK2: LazyLock<[u64; 16]> = LazyLock::new(|| build_normalized_kmer::<16>());
|
|
||||||
pub(crate) static NORMK3: LazyLock<[u64; 64]> = LazyLock::new(|| build_normalized_kmer::<64>());
|
|
||||||
pub(crate) static NORMK4: LazyLock<[u64; 256]> = LazyLock::new(|| build_normalized_kmer::<256>());
|
|
||||||
pub(crate) static NORMK5: LazyLock<[u64; 1024]> = LazyLock::new(|| build_normalized_kmer::<1024>());
|
|
||||||
pub(crate) static NORMK6: LazyLock<[u64; 4096]> = LazyLock::new(|| build_normalized_kmer::<4096>());
|
|
||||||
|
|
||||||
pub(crate) static LN_CARD_ROT1: LazyLock<[f64; 4]> =
|
const fn normalize_circular(kmer: u64, ws: usize) -> u64 {
|
||||||
LazyLock::new(|| build_log_class_size::<4>(&NORMK1));
|
|
||||||
pub(crate) static LN_CARD_ROT2: LazyLock<[f64; 16]> =
|
|
||||||
LazyLock::new(|| build_log_class_size::<16>(&NORMK2));
|
|
||||||
pub(crate) static LN_CARD_ROT3: LazyLock<[f64; 64]> =
|
|
||||||
LazyLock::new(|| build_log_class_size::<64>(&NORMK3));
|
|
||||||
pub(crate) static LN_CARD_ROT4: LazyLock<[f64; 256]> =
|
|
||||||
LazyLock::new(|| build_log_class_size::<256>(&NORMK4));
|
|
||||||
pub(crate) static LN_CARD_ROT5: LazyLock<[f64; 1024]> =
|
|
||||||
LazyLock::new(|| build_log_class_size::<1024>(&NORMK5));
|
|
||||||
pub(crate) static LN_CARD_ROT6: LazyLock<[f64; 4096]> =
|
|
||||||
LazyLock::new(|| build_log_class_size::<4096>(&NORMK6));
|
|
||||||
|
|
||||||
fn ln0(x: f64) -> f64 {
|
|
||||||
if x == 0.0 { 0.0 } else { x.ln() }
|
|
||||||
}
|
|
||||||
|
|
||||||
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
|
|
||||||
let mask = (1u64 << (ws * 2)) - 1;
|
let mask = (1u64 << (ws * 2)) - 1;
|
||||||
let mut canonical = kmer & mask;
|
let mut canonical = kmer & mask;
|
||||||
let mut current = canonical;
|
let mut current = canonical;
|
||||||
for _ in 0..ws - 1 {
|
let mut i = 0;
|
||||||
|
while i < (ws - 1) {
|
||||||
let top = (current >> ((ws - 1) * 2)) & 3;
|
let top = (current >> ((ws - 1) * 2)) & 3;
|
||||||
current = ((current << 2) | top) & mask;
|
current = ((current << 2) | top) & mask;
|
||||||
if current < canonical {
|
if current < canonical {
|
||||||
canonical = current;
|
canonical = current;
|
||||||
}
|
}
|
||||||
|
i += 1;
|
||||||
}
|
}
|
||||||
canonical
|
canonical
|
||||||
}
|
}
|
||||||
|
|
||||||
fn build_normalized_kmer<const N: usize>() -> [u64; N] {
|
const fn build_normalized_kmer<const N: usize>() -> [u64; N] {
|
||||||
let mut result = [0u64; N];
|
let mut result = [0u64; N];
|
||||||
let k = N.ilog(4) as usize;
|
let k = k_from_n::<N>();
|
||||||
let shift = 64 - k * 2;
|
let shift = 64 - k * 2;
|
||||||
for i in 0..N {
|
let mut i = 0;
|
||||||
|
while i < N {
|
||||||
let la = (i as u64) << shift;
|
let la = (i as u64) << shift;
|
||||||
let ra = i as u64;
|
let ra = i as u64;
|
||||||
let rc_ra = Kmer::from_raw(la).revcomp().raw() >> shift;
|
let rc_ra = revcomp_raw(la, k) >> shift;
|
||||||
let circ = normalize_circular(ra, k);
|
let circ = normalize_circular(ra, k);
|
||||||
let circ_rc = normalize_circular(rc_ra, k);
|
let circ_rc = normalize_circular(rc_ra, k);
|
||||||
result[i] = circ.min(circ_rc);
|
result[i] = if circ < circ_rc { circ } else { circ_rc };
|
||||||
|
i += 1;
|
||||||
}
|
}
|
||||||
result
|
result
|
||||||
}
|
}
|
||||||
|
|
||||||
fn build_log_class_size<const N: usize>(norm: &[u64; N]) -> [f64; N] {
|
const fn revcomp_raw(x: u64, k: usize) -> u64 {
|
||||||
let mut sizes = [0u32; N];
|
let x = !x;
|
||||||
for &c in norm {
|
let x = x.swap_bytes();
|
||||||
sizes[c as usize] += 1;
|
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
|
||||||
}
|
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
|
||||||
let mut result = [0.0f64; N];
|
x << (64 - 2 * k)
|
||||||
for i in 0..N {
|
|
||||||
if sizes[i] > 0 {
|
|
||||||
result[i] = ln0(sizes[i] as f64);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
result
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn entropy_norm_kmer(kmer: u64, k: usize, left: bool) -> u64 {
|
const fn k_from_n<const N: usize>() -> usize {
|
||||||
let shift = 64 - k * 2;
|
match N {
|
||||||
let ra = if left { kmer >> shift } else { kmer }; // left-aligned → right-aligned index
|
4 => 1,
|
||||||
let canonical_ra = match k {
|
16 => 2,
|
||||||
1 => NORMK1[ra as usize],
|
64 => 3,
|
||||||
2 => NORMK2[ra as usize],
|
256 => 4,
|
||||||
3 => NORMK3[ra as usize],
|
1024 => 5,
|
||||||
4 => NORMK4[ra as usize],
|
4096 => 6,
|
||||||
5 => NORMK5[ra as usize],
|
_ => panic!("N must be a power of 4"),
|
||||||
6 => NORMK6[ra as usize],
|
|
||||||
_ => panic!("k must be 1..=6"),
|
|
||||||
};
|
|
||||||
if left {
|
|
||||||
canonical_ra << shift
|
|
||||||
} else {
|
|
||||||
canonical_ra
|
|
||||||
} // right-aligned → left-aligned
|
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) fn ln_class_size(kmer: u64, k: usize, left: bool) -> f64 {
|
|
||||||
let ra = if left { kmer >> (64 - k * 2) } else { kmer }; // left-aligned → right-aligned index
|
|
||||||
match k {
|
|
||||||
1 => LN_CARD_ROT1[NORMK1[ra as usize] as usize],
|
|
||||||
2 => LN_CARD_ROT2[NORMK2[ra as usize] as usize],
|
|
||||||
3 => LN_CARD_ROT3[NORMK3[ra as usize] as usize],
|
|
||||||
4 => LN_CARD_ROT4[NORMK4[ra as usize] as usize],
|
|
||||||
5 => LN_CARD_ROT5[NORMK5[ra as usize] as usize],
|
|
||||||
6 => LN_CARD_ROT6[NORMK6[ra as usize] as usize],
|
|
||||||
_ => panic!("k must be 1..=6"),
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── k-dependent tables (k ≤ K_MAX, ws ≤ WS_MAX) ──────────────────────────────
|
|
||||||
|
|
||||||
pub(crate) const K_MAX: usize = 32;
|
|
||||||
pub(crate) const WS_MAX: usize = 6;
|
pub(crate) const WS_MAX: usize = 6;
|
||||||
|
|
||||||
/// n·ln(n), with n_log_n[0] = 0. Indexed by n = 0..=K_MAX.
|
#[inline(always)]
|
||||||
pub(crate) static N_LOG_N: LazyLock<[f64; K_MAX + 1]> = LazyLock::new(|| build_n_log_n());
|
pub(crate) const fn n_log_n(n: usize) -> f64 {
|
||||||
|
|
||||||
/// H_max[k][ws]: maximum entropy for kmer length k and word size ws.
|
|
||||||
pub(crate) static EMAX: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> = LazyLock::new(|| build_emax());
|
|
||||||
|
|
||||||
/// ln(k − ws + 1): log of the number of ws-words in a kmer of length k.
|
|
||||||
pub(crate) static LOG_NWORDS: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> =
|
|
||||||
LazyLock::new(|| build_log_nwords());
|
|
||||||
|
|
||||||
pub(crate) fn n_log_n(n: usize) -> f64 {
|
|
||||||
N_LOG_N[n]
|
N_LOG_N[n]
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn emax(k: usize, ws: usize) -> f64 {
|
#[inline(always)]
|
||||||
|
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
|
||||||
EMAX[k][ws]
|
EMAX[k][ws]
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn log_nwords(k: usize, ws: usize) -> f64 {
|
#[inline(always)]
|
||||||
|
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
|
||||||
LOG_NWORDS[k][ws]
|
LOG_NWORDS[k][ws]
|
||||||
}
|
}
|
||||||
|
|
||||||
fn build_n_log_n() -> [f64; K_MAX + 1] {
|
#[inline(always)]
|
||||||
let mut result = [0.0f64; K_MAX + 1];
|
pub(crate) const fn entropy_norm_kmer<const LEFT: bool, const K: usize>(kmer: u64) -> u64 {
|
||||||
for n in 1..=K_MAX {
|
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
|
||||||
result[n] = (n as f64) * (n as f64).ln();
|
const NORM: [&[u64]; 7] = [&[], &NORMK1, &NORMK2, &NORMK3, &NORMK4, &NORMK5, &NORMK6];
|
||||||
|
|
||||||
|
let shift = SHIFT[K];
|
||||||
|
let ra = if LEFT { kmer >> shift } else { kmer };
|
||||||
|
let canonical_ra = NORM[K][ra as usize];
|
||||||
|
if LEFT {
|
||||||
|
canonical_ra << shift
|
||||||
|
} else {
|
||||||
|
canonical_ra
|
||||||
}
|
}
|
||||||
result
|
|
||||||
}
|
}
|
||||||
|
|
||||||
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
|
#[inline(always)]
|
||||||
let mut result = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
|
pub(crate) const fn ln_class_size<const LEFT: bool, const K: usize>(kmer: u64) -> f64 {
|
||||||
for k in 2..=K_MAX {
|
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
|
||||||
for ws in 1..=WS_MAX.min(k - 1) {
|
let ra = if LEFT { kmer >> SHIFT[K] } else { kmer };
|
||||||
let n_raw = 1usize << (ws * 2); // 4^ws
|
match K {
|
||||||
let nwords = k - ws + 1;
|
1 => LN_CLASS1[ra as usize],
|
||||||
let c = nwords / n_raw;
|
2 => LN_CLASS2[ra as usize],
|
||||||
let r = nwords % n_raw;
|
3 => LN_CLASS3[ra as usize],
|
||||||
let nf = nwords as f64;
|
4 => LN_CLASS4[ra as usize],
|
||||||
let t1 = if c == 0 || n_raw == r {
|
5 => LN_CLASS5[ra as usize],
|
||||||
0.0
|
6 => LN_CLASS6[ra as usize],
|
||||||
} else {
|
_ => panic!("k must be 1..=6"),
|
||||||
let f1 = c as f64 / nf;
|
|
||||||
(n_raw - r) as f64 * f1 * f1.ln()
|
|
||||||
};
|
|
||||||
let t2 = if r == 0 {
|
|
||||||
0.0
|
|
||||||
} else {
|
|
||||||
let f2 = (c + 1) as f64 / nf;
|
|
||||||
r as f64 * f2 * f2.ln()
|
|
||||||
};
|
|
||||||
result[k][ws] = -(t1 + t2);
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
result
|
|
||||||
}
|
|
||||||
|
|
||||||
fn build_log_nwords() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
|
|
||||||
let mut result = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
|
|
||||||
for k in 2..=K_MAX {
|
|
||||||
for ws in 1..=WS_MAX.min(k - 1) {
|
|
||||||
result[k][ws] = ((k - ws + 1) as f64).ln();
|
|
||||||
}
|
|
||||||
}
|
|
||||||
result
|
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -26,6 +26,7 @@ use crate::scratch::SuperKmerScratch;
|
|||||||
pub struct SuperKmerIter<'a> {
|
pub struct SuperKmerIter<'a> {
|
||||||
cursor: ForwardCursor<'a>,
|
cursor: ForwardCursor<'a>,
|
||||||
k: usize,
|
k: usize,
|
||||||
|
rope_len: usize,
|
||||||
theta: f64,
|
theta: f64,
|
||||||
scratch: SuperKmerScratch,
|
scratch: SuperKmerScratch,
|
||||||
stat: RollingStat,
|
stat: RollingStat,
|
||||||
@@ -44,6 +45,7 @@ impl<'a> SuperKmerIter<'a> {
|
|||||||
Self {
|
Self {
|
||||||
cursor: rope.fw_cursor(),
|
cursor: rope.fw_cursor(),
|
||||||
k,
|
k,
|
||||||
|
rope_len: rope.len(),
|
||||||
theta,
|
theta,
|
||||||
scratch: SuperKmerScratch::new(),
|
scratch: SuperKmerScratch::new(),
|
||||||
stat: RollingStat::new(level_max),
|
stat: RollingStat::new(level_max),
|
||||||
@@ -71,6 +73,10 @@ impl<'a> SuperKmerIter<'a> {
|
|||||||
impl Iterator for SuperKmerIter<'_> {
|
impl Iterator for SuperKmerIter<'_> {
|
||||||
type Item = RoutableSuperKmer;
|
type Item = RoutableSuperKmer;
|
||||||
|
|
||||||
|
fn size_hint(&self) -> (usize, Option<usize>) {
|
||||||
|
(0, Some(self.rope_len / self.k))
|
||||||
|
}
|
||||||
|
|
||||||
fn next(&mut self) -> Option<RoutableSuperKmer> {
|
fn next(&mut self) -> Option<RoutableSuperKmer> {
|
||||||
loop {
|
loop {
|
||||||
let byte = match self.cursor.read_next().ok() {
|
let byte = match self.cursor.read_next().ok() {
|
||||||
|
|||||||
@@ -4,36 +4,118 @@ use obikseq::params;
|
|||||||
use crate::encoding::encode_nuc;
|
use crate::encoding::encode_nuc;
|
||||||
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
|
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
|
||||||
|
|
||||||
#[derive(Clone, Copy)]
|
// ── Stack-allocated ring buffer ───────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Fixed-capacity ring buffer backed by a stack array.
|
||||||
|
/// N must be a power of two; operations are branchless via `% N`.
|
||||||
|
struct Ring<T: Copy + Default, const N: usize> {
|
||||||
|
buf: [T; N],
|
||||||
|
head: usize,
|
||||||
|
len: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl<T: Copy + Default, const N: usize> Ring<T, N> {
|
||||||
|
#[inline]
|
||||||
|
fn new() -> Self {
|
||||||
|
Self {
|
||||||
|
buf: [T::default(); N],
|
||||||
|
head: 0,
|
||||||
|
len: 0,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
#[inline]
|
||||||
|
fn is_empty(&self) -> bool {
|
||||||
|
self.len == 0
|
||||||
|
}
|
||||||
|
#[inline]
|
||||||
|
fn clear(&mut self) {
|
||||||
|
self.len = 0;
|
||||||
|
self.head = 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
fn push_back(&mut self, val: T) {
|
||||||
|
self.buf[(self.head + self.len) % N] = val;
|
||||||
|
self.len += 1;
|
||||||
|
}
|
||||||
|
#[inline]
|
||||||
|
fn pop_front(&mut self) -> T {
|
||||||
|
let val = self.buf[self.head];
|
||||||
|
self.head = (self.head + 1) % N;
|
||||||
|
self.len -= 1;
|
||||||
|
val
|
||||||
|
}
|
||||||
|
#[inline]
|
||||||
|
fn pop_back(&mut self) -> T {
|
||||||
|
self.len -= 1;
|
||||||
|
self.buf[(self.head + self.len) % N]
|
||||||
|
}
|
||||||
|
#[inline]
|
||||||
|
fn front(&self) -> Option<&T> {
|
||||||
|
if self.len > 0 {
|
||||||
|
Some(&self.buf[self.head])
|
||||||
|
} else {
|
||||||
|
None
|
||||||
|
}
|
||||||
|
}
|
||||||
|
#[inline]
|
||||||
|
fn back(&self) -> Option<&T> {
|
||||||
|
if self.len > 0 {
|
||||||
|
Some(&self.buf[(self.head + self.len - 1) % N])
|
||||||
|
} else {
|
||||||
|
None
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Iterate over elements front-to-back (copies, since T: Copy).
|
||||||
|
fn iter(&self) -> impl Iterator<Item = T> + '_ {
|
||||||
|
(0..self.len).map(move |i| self.buf[(self.head + i) % N])
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── MmerItem ──────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[derive(Clone, Copy, Default)]
|
||||||
struct MmerItem {
|
struct MmerItem {
|
||||||
/// 0-based position of this m-mer's first base within the current segment.
|
/// 0-based position of this m-mer's first base within the current segment.
|
||||||
position: usize,
|
position: usize,
|
||||||
/// Raw canonical m-mer value (right-aligned), used for partition key computation.
|
/// Raw canonical m-mer value (right-aligned).
|
||||||
canonical: u64,
|
canonical: u64,
|
||||||
/// mix64 hash of the canonical m-mer, used as the random ordering key.
|
/// mix64 hash of the canonical m-mer, used as the random ordering key.
|
||||||
hash: u64,
|
hash: u64,
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── RollingStat ───────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
pub struct RollingStat {
|
pub struct RollingStat {
|
||||||
entropy_max_k: usize,
|
entropy_max_k: usize,
|
||||||
|
k: usize,
|
||||||
|
m: usize,
|
||||||
|
steady: bool,
|
||||||
rolling_k: u64,
|
rolling_k: u64,
|
||||||
rolling_rck: u64,
|
rolling_rck: u64,
|
||||||
k_mask: u64,
|
k_mask: u64,
|
||||||
m_mask: u64,
|
m_mask: u64,
|
||||||
received: usize,
|
received: usize,
|
||||||
k1q: std::collections::VecDeque<u64>,
|
|
||||||
k2q: std::collections::VecDeque<u64>,
|
// Sliding-window queues — stack-allocated, capacity ≤ k ≤ 31.
|
||||||
k3q: std::collections::VecDeque<u64>,
|
k1q: Ring<u64, 32>,
|
||||||
k4q: std::collections::VecDeque<u64>,
|
k2q: Ring<u64, 32>,
|
||||||
k5q: std::collections::VecDeque<u64>,
|
k3q: Ring<u64, 32>,
|
||||||
k6q: std::collections::VecDeque<u64>,
|
k4q: Ring<u64, 32>,
|
||||||
minimier: std::collections::VecDeque<MmerItem>,
|
k5q: Ring<u64, 32>,
|
||||||
k1c: Vec<usize>,
|
k6q: Ring<u64, 32>,
|
||||||
k2c: Vec<usize>,
|
minimier: Ring<MmerItem, 32>,
|
||||||
k3c: Vec<usize>,
|
|
||||||
k4c: Vec<usize>,
|
// Frequency count arrays.
|
||||||
k5c: Vec<usize>,
|
// Max count per cell ≤ k ≤ 31 → u8 is sufficient.
|
||||||
k6c: Vec<usize>,
|
k1c: [u8; 4],
|
||||||
|
k2c: [u8; 16],
|
||||||
|
k3c: [u8; 64],
|
||||||
|
k4c: [u8; 256],
|
||||||
|
k5c: [u8; 1024],
|
||||||
|
k6c: [u8; 4096],
|
||||||
|
|
||||||
sum_f_log_f: [f64; WS_MAX + 1],
|
sum_f_log_f: [f64; WS_MAX + 1],
|
||||||
sum_f_log_s: [f64; WS_MAX + 1],
|
sum_f_log_s: [f64; WS_MAX + 1],
|
||||||
}
|
}
|
||||||
@@ -44,24 +126,27 @@ impl RollingStat {
|
|||||||
let m = params::m();
|
let m = params::m();
|
||||||
Self {
|
Self {
|
||||||
entropy_max_k,
|
entropy_max_k,
|
||||||
|
k,
|
||||||
|
m,
|
||||||
|
steady: false,
|
||||||
rolling_k: 0,
|
rolling_k: 0,
|
||||||
rolling_rck: 0,
|
rolling_rck: 0,
|
||||||
k_mask: (!0u64) >> (64 - k * 2),
|
k_mask: (!0u64) >> (64 - k * 2),
|
||||||
m_mask: (!0u64) >> (64 - m * 2),
|
m_mask: (!0u64) >> (64 - m * 2),
|
||||||
received: 0,
|
received: 0,
|
||||||
k1q: std::collections::VecDeque::with_capacity(k),
|
k1q: Ring::new(),
|
||||||
k2q: std::collections::VecDeque::with_capacity(k - 1),
|
k2q: Ring::new(),
|
||||||
k3q: std::collections::VecDeque::with_capacity(k - 2),
|
k3q: Ring::new(),
|
||||||
k4q: std::collections::VecDeque::with_capacity(k - 3),
|
k4q: Ring::new(),
|
||||||
k5q: std::collections::VecDeque::with_capacity(k - 4),
|
k5q: Ring::new(),
|
||||||
k6q: std::collections::VecDeque::with_capacity(k - 5),
|
k6q: Ring::new(),
|
||||||
minimier: std::collections::VecDeque::with_capacity(k - m + 2),
|
minimier: Ring::new(),
|
||||||
k1c: vec![0; 4_usize.pow(1)],
|
k1c: [0; 4],
|
||||||
k2c: vec![0; 4_usize.pow(2)],
|
k2c: [0; 16],
|
||||||
k3c: vec![0; 4_usize.pow(3)],
|
k3c: [0; 64],
|
||||||
k4c: vec![0; 4_usize.pow(4)],
|
k4c: [0; 256],
|
||||||
k5c: vec![0; 4_usize.pow(5)],
|
k5c: [0; 1024],
|
||||||
k6c: vec![0; 4_usize.pow(6)],
|
k6c: [0; 4096],
|
||||||
sum_f_log_f: [0.0; WS_MAX + 1],
|
sum_f_log_f: [0.0; WS_MAX + 1],
|
||||||
sum_f_log_s: [0.0; WS_MAX + 1],
|
sum_f_log_s: [0.0; WS_MAX + 1],
|
||||||
}
|
}
|
||||||
@@ -71,24 +156,22 @@ impl RollingStat {
|
|||||||
self.rolling_k = 0;
|
self.rolling_k = 0;
|
||||||
self.rolling_rck = 0;
|
self.rolling_rck = 0;
|
||||||
self.received = 0;
|
self.received = 0;
|
||||||
for &i in &self.k1q {
|
self.steady = false;
|
||||||
self.k1c[i as usize] = 0;
|
|
||||||
}
|
// for i in self.k1q.iter() { self.k1c[i as usize] = 0; }
|
||||||
for &i in &self.k2q {
|
// for i in self.k2q.iter() { self.k2c[i as usize] = 0; }
|
||||||
self.k2c[i as usize] = 0;
|
// for i in self.k3q.iter() { self.k3c[i as usize] = 0; }
|
||||||
}
|
// for i in self.k4q.iter() { self.k4c[i as usize] = 0; }
|
||||||
for &i in &self.k3q {
|
// for i in self.k5q.iter() { self.k5c[i as usize] = 0; }
|
||||||
self.k3c[i as usize] = 0;
|
// for i in self.k6q.iter() { self.k6c[i as usize] = 0; }
|
||||||
}
|
|
||||||
for &i in &self.k4q {
|
self.k1c.fill(0);
|
||||||
self.k4c[i as usize] = 0;
|
self.k2c.fill(0);
|
||||||
}
|
self.k3c.fill(0);
|
||||||
for &i in &self.k5q {
|
self.k4c.fill(0);
|
||||||
self.k5c[i as usize] = 0;
|
self.k5c.fill(0);
|
||||||
}
|
self.k6c.fill(0);
|
||||||
for &i in &self.k6q {
|
|
||||||
self.k6c[i as usize] = 0;
|
|
||||||
}
|
|
||||||
self.k1q.clear();
|
self.k1q.clear();
|
||||||
self.k2q.clear();
|
self.k2q.clear();
|
||||||
self.k3q.clear();
|
self.k3q.clear();
|
||||||
@@ -96,37 +179,36 @@ impl RollingStat {
|
|||||||
self.k5q.clear();
|
self.k5q.clear();
|
||||||
self.k6q.clear();
|
self.k6q.clear();
|
||||||
self.minimier.clear();
|
self.minimier.clear();
|
||||||
|
|
||||||
self.sum_f_log_f = [0.0; WS_MAX + 1];
|
self.sum_f_log_f = [0.0; WS_MAX + 1];
|
||||||
self.sum_f_log_s = [0.0; WS_MAX + 1];
|
self.sum_f_log_s = [0.0; WS_MAX + 1];
|
||||||
}
|
}
|
||||||
|
|
||||||
#[inline]
|
#[inline]
|
||||||
fn update_sums_decrement(
|
fn update_sums_decrement<const K: usize>(
|
||||||
sum_f_log_f: &mut [f64; WS_MAX + 1],
|
sum_f_log_f: &mut [f64; WS_MAX + 1],
|
||||||
sum_f_log_s: &mut [f64; WS_MAX + 1],
|
sum_f_log_s: &mut [f64; WS_MAX + 1],
|
||||||
ws: usize,
|
|
||||||
canonical: u64,
|
canonical: u64,
|
||||||
f: usize,
|
f: usize,
|
||||||
) {
|
) {
|
||||||
sum_f_log_f[ws] += n_log_n(f - 1) - n_log_n(f);
|
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
|
||||||
sum_f_log_s[ws] -= ln_class_size(canonical, ws, false);
|
sum_f_log_s[K] -= ln_class_size::<false, K>(canonical);
|
||||||
}
|
}
|
||||||
|
|
||||||
#[inline]
|
#[inline]
|
||||||
fn update_sums_increment(
|
fn update_sums_increment<const K: usize>(
|
||||||
sum_f_log_f: &mut [f64; WS_MAX + 1],
|
sum_f_log_f: &mut [f64; WS_MAX + 1],
|
||||||
sum_f_log_s: &mut [f64; WS_MAX + 1],
|
sum_f_log_s: &mut [f64; WS_MAX + 1],
|
||||||
ws: usize,
|
|
||||||
canonical: u64,
|
canonical: u64,
|
||||||
g: usize,
|
g: usize,
|
||||||
) {
|
) {
|
||||||
sum_f_log_f[ws] += n_log_n(g + 1) - n_log_n(g);
|
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
|
||||||
sum_f_log_s[ws] += ln_class_size(canonical, ws, false);
|
sum_f_log_s[K] += ln_class_size::<false, K>(canonical);
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn push(&mut self, nuc: u8) {
|
pub fn push(&mut self, nuc: u8) {
|
||||||
let k = params::k();
|
let k = self.k;
|
||||||
let m = params::m();
|
let m = self.m;
|
||||||
|
|
||||||
let bnuc = encode_nuc(nuc);
|
let bnuc = encode_nuc(nuc);
|
||||||
let cnuc = bnuc ^ 3;
|
let cnuc = bnuc ^ 3;
|
||||||
@@ -135,12 +217,12 @@ impl RollingStat {
|
|||||||
self.rolling_rck =
|
self.rolling_rck =
|
||||||
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
|
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
|
||||||
|
|
||||||
let canonical_k1 = entropy_norm_kmer(self.rolling_k & 3, 1, false);
|
let canonical_k1 = entropy_norm_kmer::<false, 1>(self.rolling_k & 3);
|
||||||
let canonical_k2 = entropy_norm_kmer(self.rolling_k & 15, 2, false);
|
let canonical_k2 = entropy_norm_kmer::<false, 2>(self.rolling_k & 15);
|
||||||
let canonical_k3 = entropy_norm_kmer(self.rolling_k & 63, 3, false);
|
let canonical_k3 = entropy_norm_kmer::<false, 3>(self.rolling_k & 63);
|
||||||
let canonical_k4 = entropy_norm_kmer(self.rolling_k & 255, 4, false);
|
let canonical_k4 = entropy_norm_kmer::<false, 4>(self.rolling_k & 255);
|
||||||
let canonical_k5 = entropy_norm_kmer(self.rolling_k & 1023, 5, false);
|
let canonical_k5 = entropy_norm_kmer::<false, 5>(self.rolling_k & 1023);
|
||||||
let canonical_k6 = entropy_norm_kmer(self.rolling_k & 4095, 6, false);
|
let canonical_k6 = entropy_norm_kmer::<false, 6>(self.rolling_k & 4095);
|
||||||
|
|
||||||
self.received += 1;
|
self.received += 1;
|
||||||
|
|
||||||
@@ -175,107 +257,147 @@ impl RollingStat {
|
|||||||
}
|
}
|
||||||
|
|
||||||
if self.received > k {
|
if self.received > k {
|
||||||
let old1 = self.k1q.pop_front().unwrap();
|
let old1 = self.k1q.pop_front();
|
||||||
let f1 = self.k1c[old1 as usize];
|
let f1 = self.k1c[old1 as usize] as usize;
|
||||||
Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 1, old1, f1);
|
Self::update_sums_decrement::<1>(
|
||||||
|
&mut self.sum_f_log_f,
|
||||||
|
&mut self.sum_f_log_s,
|
||||||
|
old1,
|
||||||
|
f1,
|
||||||
|
);
|
||||||
self.k1c[old1 as usize] -= 1;
|
self.k1c[old1 as usize] -= 1;
|
||||||
|
|
||||||
let old2 = self.k2q.pop_front().unwrap();
|
let old2 = self.k2q.pop_front();
|
||||||
let f2 = self.k2c[old2 as usize];
|
let f2 = self.k2c[old2 as usize] as usize;
|
||||||
Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 2, old2, f2);
|
Self::update_sums_decrement::<2>(
|
||||||
|
&mut self.sum_f_log_f,
|
||||||
|
&mut self.sum_f_log_s,
|
||||||
|
old2,
|
||||||
|
f2,
|
||||||
|
);
|
||||||
self.k2c[old2 as usize] -= 1;
|
self.k2c[old2 as usize] -= 1;
|
||||||
|
|
||||||
let old3 = self.k3q.pop_front().unwrap();
|
let old3 = self.k3q.pop_front();
|
||||||
let f3 = self.k3c[old3 as usize];
|
let f3 = self.k3c[old3 as usize] as usize;
|
||||||
Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 3, old3, f3);
|
Self::update_sums_decrement::<3>(
|
||||||
|
&mut self.sum_f_log_f,
|
||||||
|
&mut self.sum_f_log_s,
|
||||||
|
old3,
|
||||||
|
f3,
|
||||||
|
);
|
||||||
self.k3c[old3 as usize] -= 1;
|
self.k3c[old3 as usize] -= 1;
|
||||||
|
|
||||||
let old4 = self.k4q.pop_front().unwrap();
|
let old4 = self.k4q.pop_front();
|
||||||
let f4 = self.k4c[old4 as usize];
|
let f4 = self.k4c[old4 as usize] as usize;
|
||||||
Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 4, old4, f4);
|
Self::update_sums_decrement::<4>(
|
||||||
|
&mut self.sum_f_log_f,
|
||||||
|
&mut self.sum_f_log_s,
|
||||||
|
old4,
|
||||||
|
f4,
|
||||||
|
);
|
||||||
self.k4c[old4 as usize] -= 1;
|
self.k4c[old4 as usize] -= 1;
|
||||||
|
|
||||||
let old5 = self.k5q.pop_front().unwrap();
|
let old5 = self.k5q.pop_front();
|
||||||
let f5 = self.k5c[old5 as usize];
|
let f5 = self.k5c[old5 as usize] as usize;
|
||||||
Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 5, old5, f5);
|
Self::update_sums_decrement::<5>(
|
||||||
|
&mut self.sum_f_log_f,
|
||||||
|
&mut self.sum_f_log_s,
|
||||||
|
old5,
|
||||||
|
f5,
|
||||||
|
);
|
||||||
self.k5c[old5 as usize] -= 1;
|
self.k5c[old5 as usize] -= 1;
|
||||||
|
|
||||||
let old6 = self.k6q.pop_front().unwrap();
|
let old6 = self.k6q.pop_front();
|
||||||
let f6 = self.k6c[old6 as usize];
|
let f6 = self.k6c[old6 as usize] as usize;
|
||||||
Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 6, old6, f6);
|
Self::update_sums_decrement::<6>(
|
||||||
|
&mut self.sum_f_log_f,
|
||||||
|
&mut self.sum_f_log_s,
|
||||||
|
old6,
|
||||||
|
f6,
|
||||||
|
);
|
||||||
self.k6c[old6 as usize] -= 1;
|
self.k6c[old6 as usize] -= 1;
|
||||||
}
|
}
|
||||||
|
|
||||||
let g1 = self.k1c[canonical_k1 as usize];
|
if self.steady {
|
||||||
Self::update_sums_increment(
|
let g1 = self.k1c[canonical_k1 as usize] as usize;
|
||||||
&mut self.sum_f_log_f,
|
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
|
||||||
&mut self.sum_f_log_s,
|
self.k1c[canonical_k1 as usize] += 1;
|
||||||
1,
|
self.k1q.push_back(canonical_k1);
|
||||||
canonical_k1,
|
|
||||||
g1,
|
let g2 = self.k2c[canonical_k2 as usize] as usize;
|
||||||
);
|
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
|
||||||
|
self.k2c[canonical_k2 as usize] += 1;
|
||||||
|
self.k2q.push_back(canonical_k2);
|
||||||
|
|
||||||
|
let g3 = self.k3c[canonical_k3 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
|
||||||
|
self.k3c[canonical_k3 as usize] += 1;
|
||||||
|
self.k3q.push_back(canonical_k3);
|
||||||
|
|
||||||
|
let g4 = self.k4c[canonical_k4 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
|
||||||
|
self.k4c[canonical_k4 as usize] += 1;
|
||||||
|
self.k4q.push_back(canonical_k4);
|
||||||
|
|
||||||
|
let g5 = self.k5c[canonical_k5 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
|
||||||
|
self.k5c[canonical_k5 as usize] += 1;
|
||||||
|
self.k5q.push_back(canonical_k5);
|
||||||
|
|
||||||
|
let g6 = self.k6c[canonical_k6 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
|
||||||
|
self.k6c[canonical_k6 as usize] += 1;
|
||||||
|
self.k6q.push_back(canonical_k6);
|
||||||
|
} else {
|
||||||
|
self.push_warmup_increments(
|
||||||
|
canonical_k1, canonical_k2, canonical_k3,
|
||||||
|
canonical_k4, canonical_k5, canonical_k6,
|
||||||
|
);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cold]
|
||||||
|
#[inline(never)]
|
||||||
|
fn push_warmup_increments(
|
||||||
|
&mut self,
|
||||||
|
canonical_k1: u64, canonical_k2: u64, canonical_k3: u64,
|
||||||
|
canonical_k4: u64, canonical_k5: u64, canonical_k6: u64,
|
||||||
|
) {
|
||||||
|
let g1 = self.k1c[canonical_k1 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
|
||||||
self.k1c[canonical_k1 as usize] += 1;
|
self.k1c[canonical_k1 as usize] += 1;
|
||||||
self.k1q.push_back(canonical_k1);
|
self.k1q.push_back(canonical_k1);
|
||||||
|
|
||||||
if self.received >= 2 {
|
if self.received >= 2 {
|
||||||
let g2 = self.k2c[canonical_k2 as usize];
|
let g2 = self.k2c[canonical_k2 as usize] as usize;
|
||||||
Self::update_sums_increment(
|
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
2,
|
|
||||||
canonical_k2,
|
|
||||||
g2,
|
|
||||||
);
|
|
||||||
self.k2c[canonical_k2 as usize] += 1;
|
self.k2c[canonical_k2 as usize] += 1;
|
||||||
self.k2q.push_back(canonical_k2);
|
self.k2q.push_back(canonical_k2);
|
||||||
|
|
||||||
if self.received >= 3 {
|
if self.received >= 3 {
|
||||||
let g3 = self.k3c[canonical_k3 as usize];
|
let g3 = self.k3c[canonical_k3 as usize] as usize;
|
||||||
Self::update_sums_increment(
|
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
3,
|
|
||||||
canonical_k3,
|
|
||||||
g3,
|
|
||||||
);
|
|
||||||
self.k3c[canonical_k3 as usize] += 1;
|
self.k3c[canonical_k3 as usize] += 1;
|
||||||
self.k3q.push_back(canonical_k3);
|
self.k3q.push_back(canonical_k3);
|
||||||
|
|
||||||
if self.received >= 4 {
|
if self.received >= 4 {
|
||||||
let g4 = self.k4c[canonical_k4 as usize];
|
let g4 = self.k4c[canonical_k4 as usize] as usize;
|
||||||
Self::update_sums_increment(
|
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
4,
|
|
||||||
canonical_k4,
|
|
||||||
g4,
|
|
||||||
);
|
|
||||||
self.k4c[canonical_k4 as usize] += 1;
|
self.k4c[canonical_k4 as usize] += 1;
|
||||||
self.k4q.push_back(canonical_k4);
|
self.k4q.push_back(canonical_k4);
|
||||||
|
|
||||||
if self.received >= 5 {
|
if self.received >= 5 {
|
||||||
let g5 = self.k5c[canonical_k5 as usize];
|
let g5 = self.k5c[canonical_k5 as usize] as usize;
|
||||||
Self::update_sums_increment(
|
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
5,
|
|
||||||
canonical_k5,
|
|
||||||
g5,
|
|
||||||
);
|
|
||||||
self.k5c[canonical_k5 as usize] += 1;
|
self.k5c[canonical_k5 as usize] += 1;
|
||||||
self.k5q.push_back(canonical_k5);
|
self.k5q.push_back(canonical_k5);
|
||||||
|
|
||||||
if self.received >= 6 {
|
if self.received >= 6 {
|
||||||
let g6 = self.k6c[canonical_k6 as usize];
|
let g6 = self.k6c[canonical_k6 as usize] as usize;
|
||||||
Self::update_sums_increment(
|
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
6,
|
|
||||||
canonical_k6,
|
|
||||||
g6,
|
|
||||||
);
|
|
||||||
self.k6c[canonical_k6 as usize] += 1;
|
self.k6c[canonical_k6 as usize] += 1;
|
||||||
self.k6q.push_back(canonical_k6);
|
self.k6q.push_back(canonical_k6);
|
||||||
|
self.steady = true;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -284,7 +406,7 @@ impl RollingStat {
|
|||||||
}
|
}
|
||||||
|
|
||||||
pub fn ready(&self) -> bool {
|
pub fn ready(&self) -> bool {
|
||||||
self.received >= params::k()
|
self.received >= self.k
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn minimizer_position(&self) -> Option<usize> {
|
pub fn minimizer_position(&self) -> Option<usize> {
|
||||||
@@ -305,14 +427,14 @@ impl RollingStat {
|
|||||||
|
|
||||||
pub fn canonical_minimizer(&self) -> Option<Minimizer> {
|
pub fn canonical_minimizer(&self) -> Option<Minimizer> {
|
||||||
self.canonical_minimizer_raw()
|
self.canonical_minimizer_raw()
|
||||||
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - params::m() * 2)))
|
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn entropy(&self, order: usize) -> Option<f64> {
|
pub fn entropy(&self, order: usize) -> Option<f64> {
|
||||||
if !self.ready() {
|
if !self.ready() {
|
||||||
return None;
|
return None;
|
||||||
}
|
}
|
||||||
let k = params::k();
|
let k = self.k;
|
||||||
let em = emax(k, order);
|
let em = emax(k, order);
|
||||||
if em <= 0.0 {
|
if em <= 0.0 {
|
||||||
return Some(1.0);
|
return Some(1.0);
|
||||||
|
|||||||
@@ -15,7 +15,7 @@ use std::sync::{Arc, Mutex, OnceLock};
|
|||||||
pub const MAX_POOL_SIZE: usize = 512;
|
pub const MAX_POOL_SIZE: usize = 512;
|
||||||
|
|
||||||
/// Default pending buffer threshold (bytes) before draining to the physical fd.
|
/// Default pending buffer threshold (bytes) before draining to the physical fd.
|
||||||
pub const DEFAULT_FLUSH_THRESHOLD: usize = 8 * 1024;
|
pub const DEFAULT_FLUSH_THRESHOLD: usize = 64 * 1024;
|
||||||
|
|
||||||
// Convenient alias for the per-entry physical writer slot.
|
// Convenient alias for the per-entry physical writer slot.
|
||||||
type PhysWriter = Option<Box<dyn Write + Send>>;
|
type PhysWriter = Option<Box<dyn Write + Send>>;
|
||||||
|
|||||||
@@ -0,0 +1,7 @@
|
|||||||
|
[package]
|
||||||
|
name = "obisys"
|
||||||
|
version = "0.1.0"
|
||||||
|
edition = "2024"
|
||||||
|
|
||||||
|
[dependencies]
|
||||||
|
libc = "0.2"
|
||||||
@@ -0,0 +1,243 @@
|
|||||||
|
use std::fmt;
|
||||||
|
use std::time::Instant;
|
||||||
|
|
||||||
|
use libc::{RUSAGE_SELF, getrusage, rusage, timeval};
|
||||||
|
|
||||||
|
// ── raw helpers ───────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
fn get_rusage() -> rusage {
|
||||||
|
let mut ru = unsafe { std::mem::zeroed::<rusage>() };
|
||||||
|
unsafe { getrusage(RUSAGE_SELF, &mut ru) };
|
||||||
|
ru
|
||||||
|
}
|
||||||
|
|
||||||
|
fn tv_to_secs(tv: timeval) -> f64 {
|
||||||
|
tv.tv_sec as f64 + tv.tv_usec as f64 * 1e-6
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cfg(target_os = "macos")]
|
||||||
|
fn rss_to_bytes(ru: &rusage) -> u64 { ru.ru_maxrss as u64 }
|
||||||
|
|
||||||
|
#[cfg(not(target_os = "macos"))]
|
||||||
|
fn rss_to_bytes(ru: &rusage) -> u64 { ru.ru_maxrss as u64 * 1024 }
|
||||||
|
|
||||||
|
// Monotonically increasing counters — negative delta would be a kernel bug.
|
||||||
|
fn delta(end: i64, start: i64) -> u64 { (end - start).max(0) as u64 }
|
||||||
|
|
||||||
|
// ── public API ────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Snapshot taken at the start of a pipeline stage.
|
||||||
|
#[must_use = "call .stop() to record the stage"]
|
||||||
|
pub struct Stage {
|
||||||
|
label: String,
|
||||||
|
wall: Instant,
|
||||||
|
ru: rusage,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl Stage {
|
||||||
|
pub fn start(label: impl Into<String>) -> Self {
|
||||||
|
Self { label: label.into(), wall: Instant::now(), ru: get_rusage() }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn stop(self) -> StageStats {
|
||||||
|
let wall_secs = self.wall.elapsed().as_secs_f64();
|
||||||
|
let end = get_rusage();
|
||||||
|
StageStats {
|
||||||
|
label: self.label,
|
||||||
|
wall_secs,
|
||||||
|
user_secs: tv_to_secs(end.ru_utime) - tv_to_secs(self.ru.ru_utime),
|
||||||
|
sys_secs: tv_to_secs(end.ru_stime) - tv_to_secs(self.ru.ru_stime),
|
||||||
|
max_rss_bytes: rss_to_bytes(&end),
|
||||||
|
minor_faults: delta(end.ru_minflt as i64, self.ru.ru_minflt as i64),
|
||||||
|
major_faults: delta(end.ru_majflt as i64, self.ru.ru_majflt as i64),
|
||||||
|
vol_ctx: delta(end.ru_nvcsw as i64, self.ru.ru_nvcsw as i64),
|
||||||
|
invol_ctx: delta(end.ru_nivcsw as i64, self.ru.ru_nivcsw as i64),
|
||||||
|
in_blocks: delta(end.ru_inblock as i64, self.ru.ru_inblock as i64),
|
||||||
|
out_blocks: delta(end.ru_oublock as i64, self.ru.ru_oublock as i64),
|
||||||
|
swaps: delta(end.ru_nswap as i64, self.ru.ru_nswap as i64),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Per-stage efficiency metrics collected from `getrusage(RUSAGE_SELF)` deltas.
|
||||||
|
pub struct StageStats {
|
||||||
|
pub label: String,
|
||||||
|
pub wall_secs: f64,
|
||||||
|
pub user_secs: f64,
|
||||||
|
pub sys_secs: f64,
|
||||||
|
/// Peak RSS at end of stage (bytes). ru_maxrss is a process-lifetime maximum,
|
||||||
|
/// so this reflects the high-water mark up to and including this stage.
|
||||||
|
pub max_rss_bytes: u64,
|
||||||
|
pub minor_faults: u64,
|
||||||
|
pub major_faults: u64,
|
||||||
|
pub vol_ctx: u64, // voluntary context switches
|
||||||
|
pub invol_ctx: u64, // involuntary context switches
|
||||||
|
pub in_blocks: u64, // filesystem block reads (after page cache)
|
||||||
|
pub out_blocks: u64, // filesystem block writes
|
||||||
|
pub swaps: u64,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl StageStats {
|
||||||
|
/// (user + sys) / wall — effective thread count utilisation.
|
||||||
|
pub fn parallelism(&self) -> f64 {
|
||||||
|
if self.wall_secs > 1e-9 { (self.user_secs + self.sys_secs) / self.wall_secs }
|
||||||
|
else { 0.0 }
|
||||||
|
}
|
||||||
|
|
||||||
|
/// parallelism / n_cores — fraction of available CPU power used (0..1+).
|
||||||
|
pub fn efficiency(&self, n_cores: usize) -> f64 {
|
||||||
|
self.parallelism() / n_cores as f64
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Accumulates stage stats and prints a human-readable summary table.
|
||||||
|
#[derive(Default)]
|
||||||
|
pub struct Reporter {
|
||||||
|
stages: Vec<StageStats>,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl Reporter {
|
||||||
|
pub fn new() -> Self { Self::default() }
|
||||||
|
pub fn push(&mut self, stats: StageStats) { self.stages.push(stats); }
|
||||||
|
pub fn stages(&self) -> &[StageStats] { &self.stages }
|
||||||
|
/// Print the summary to stderr.
|
||||||
|
pub fn print(&self) { eprint!("{self}"); }
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── diagnosis ─────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
struct Diagnosis {
|
||||||
|
tag: &'static str,
|
||||||
|
detail: Option<String>,
|
||||||
|
}
|
||||||
|
|
||||||
|
// Thresholds are intentionally conservative to avoid false positives.
|
||||||
|
fn diagnose(s: &StageStats, n_cores: usize) -> Diagnosis {
|
||||||
|
let eff = s.efficiency(n_cores);
|
||||||
|
let cpu_pct = eff * 100.0;
|
||||||
|
let io_ops = s.in_blocks + s.out_blocks;
|
||||||
|
|
||||||
|
// swaps > 0 is the only reliable cross-platform indicator of true RAM exhaustion.
|
||||||
|
// ru_majflt is intentionally excluded: on macOS it counts all file-backed mmap
|
||||||
|
// page-ins (even from page cache), making it useless as a memory-pressure signal
|
||||||
|
// for mmap-heavy code. On Linux it is more meaningful, but swaps covers the
|
||||||
|
// severe case on both platforms.
|
||||||
|
if s.swaps > 0 {
|
||||||
|
return Diagnosis {
|
||||||
|
tag: "swapping",
|
||||||
|
detail: Some(format!(
|
||||||
|
"swapped {} time(s) — working set exceeds available RAM",
|
||||||
|
s.swaps,
|
||||||
|
)),
|
||||||
|
};
|
||||||
|
}
|
||||||
|
if eff < 0.3 && io_ops > 100 {
|
||||||
|
return Diagnosis {
|
||||||
|
tag: "disk I/O",
|
||||||
|
detail: Some(format!(
|
||||||
|
"{} block reads + {} writes — CPU at {:.0}%, stage is I/O-bound",
|
||||||
|
s.in_blocks, s.out_blocks, cpu_pct,
|
||||||
|
)),
|
||||||
|
};
|
||||||
|
}
|
||||||
|
if eff < 0.3 && s.vol_ctx > 200 {
|
||||||
|
return Diagnosis {
|
||||||
|
tag: "contention",
|
||||||
|
detail: Some(format!(
|
||||||
|
"{} voluntary context switches — CPU at {:.0}%, possible lock contention or I/O wait",
|
||||||
|
s.vol_ctx, cpu_pct,
|
||||||
|
)),
|
||||||
|
};
|
||||||
|
}
|
||||||
|
Diagnosis { tag: "—", detail: None }
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── display helpers ───────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
fn fmt_secs(s: f64) -> String {
|
||||||
|
if s >= 100.0 { format!("{:.0}s", s) }
|
||||||
|
else if s >= 10.0 { format!("{:.1}s", s) }
|
||||||
|
else if s >= 1.0 { format!("{:.2}s", s) }
|
||||||
|
else { format!("{:.0}ms", s * 1000.0) }
|
||||||
|
}
|
||||||
|
|
||||||
|
fn fmt_bytes(b: u64) -> String {
|
||||||
|
if b >= 1 << 30 { format!("{:.1} GB", b as f64 / (1u64 << 30) as f64) }
|
||||||
|
else if b >= 1 << 20 { format!("{:.0} MB", b as f64 / (1u64 << 20) as f64) }
|
||||||
|
else { format!("{:.0} KB", b as f64 / 1024.0) }
|
||||||
|
}
|
||||||
|
|
||||||
|
fn fmt_efficiency(par: f64, n_cores: usize) -> String {
|
||||||
|
format!("{:.1}×/{} ({:.0}%)", par, n_cores, par / n_cores as f64 * 100.0)
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Display ───────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
impl fmt::Display for Reporter {
|
||||||
|
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
||||||
|
if self.stages.is_empty() { return Ok(()); }
|
||||||
|
|
||||||
|
let n_cores = std::thread::available_parallelism()
|
||||||
|
.map(|n| n.get())
|
||||||
|
.unwrap_or(1);
|
||||||
|
|
||||||
|
// column widths
|
||||||
|
let nw = self.stages.iter().map(|s| s.label.len()).max().unwrap_or(5).max(5);
|
||||||
|
// efficiency col: worst-case width for this run's n_cores value
|
||||||
|
let ew = format!("{:.1}×/{} (100%)", 99.9f64, n_cores).len();
|
||||||
|
|
||||||
|
let sep_w = nw + 2 + 7 + 2 + ew + 2 + 8 + 2 + 12;
|
||||||
|
let sep = "─".repeat(sep_w);
|
||||||
|
|
||||||
|
// header
|
||||||
|
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8} status",
|
||||||
|
"stage", "wall", "efficiency", "peak RSS")?;
|
||||||
|
writeln!(f, "{sep}")?;
|
||||||
|
|
||||||
|
// compute all diagnoses up front (needed for both table and footnotes)
|
||||||
|
let diagnoses: Vec<Diagnosis> = self.stages.iter()
|
||||||
|
.map(|s| diagnose(s, n_cores))
|
||||||
|
.collect();
|
||||||
|
|
||||||
|
// per-stage rows
|
||||||
|
for (s, d) in self.stages.iter().zip(diagnoses.iter()) {
|
||||||
|
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8} {}",
|
||||||
|
s.label,
|
||||||
|
fmt_secs(s.wall_secs),
|
||||||
|
fmt_efficiency(s.parallelism(), n_cores),
|
||||||
|
fmt_bytes(s.max_rss_bytes),
|
||||||
|
d.tag,
|
||||||
|
)?;
|
||||||
|
}
|
||||||
|
|
||||||
|
// totals
|
||||||
|
let tw = self.stages.iter().map(|s| s.wall_secs).sum::<f64>();
|
||||||
|
let tu = self.stages.iter().map(|s| s.user_secs).sum::<f64>();
|
||||||
|
let ts = self.stages.iter().map(|s| s.sys_secs).sum::<f64>();
|
||||||
|
let trss = self.stages.iter().map(|s| s.max_rss_bytes).max().unwrap_or(0);
|
||||||
|
let tpar = if tw > 1e-9 { (tu + ts) / tw } else { 0.0 };
|
||||||
|
|
||||||
|
writeln!(f, "{sep}")?;
|
||||||
|
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8}",
|
||||||
|
"TOTAL",
|
||||||
|
fmt_secs(tw),
|
||||||
|
fmt_efficiency(tpar, n_cores),
|
||||||
|
fmt_bytes(trss),
|
||||||
|
)?;
|
||||||
|
|
||||||
|
// bottleneck footnotes (only if at least one anomaly detected)
|
||||||
|
let bottlenecks: Vec<(&str, &str)> = self.stages.iter()
|
||||||
|
.zip(diagnoses.iter())
|
||||||
|
.filter_map(|(s, d)| d.detail.as_deref().map(|det| (s.label.as_str(), det)))
|
||||||
|
.collect();
|
||||||
|
|
||||||
|
if !bottlenecks.is_empty() {
|
||||||
|
writeln!(f, "\nBottlenecks:")?;
|
||||||
|
for (label, detail) in &bottlenecks {
|
||||||
|
writeln!(f, " {label} — {detail}")?;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
}
|
||||||
Reference in New Issue
Block a user