Compare commits
61 Commits
fb4962c4fe
...
v1.1.34
| Author | SHA1 | Date | |
|---|---|---|---|
| 2b37e8aac4 | |||
| 67b4e4da53 | |||
| 66ab4c6db1 | |||
| f84dd539bf | |||
| 6378734e1c | |||
| b3a617cce1 | |||
| 2080e5e8a9 | |||
| 45ed2bc9b8 | |||
| aa126fd89d | |||
| c612132763 | |||
| 19660f8cd0 | |||
| 7b07540a69 | |||
| 89c43e28f5 | |||
| b9b2e42ad2 | |||
| ca42fdff2f | |||
| 136cd89efb | |||
| a4bbf607b7 | |||
| 9927100a1c | |||
| 527258f822 | |||
| ef62f1947e | |||
| d02316dcf6 | |||
| c323b3eaef | |||
| b77d8e9ca0 | |||
| 7c5bab3694 | |||
| fab4e0d6de | |||
| 973a3f3d6e | |||
| 1a839a295a | |||
| 2ea58703c7 | |||
| ac3ef106e7 | |||
| 469e53b6f5 | |||
| 9f1df96ea7 | |||
| 4e4cce2879 | |||
| 68b05b93c4 | |||
| 0a668cf8a6 | |||
| e6d6942e2f | |||
| bf9c9aeacb | |||
| 22a65857a1 | |||
| d16a867640 | |||
| 616050075f | |||
| e22afe9621 | |||
| bdfac71e65 | |||
| a00bb37478 | |||
| d30a4efd9b | |||
| 6baf2e64ca | |||
| c0a71a2d49 | |||
| a609c1af95 | |||
| 3d32be8a83 | |||
| c4c71dc892 | |||
| 4e625afaba | |||
| a522c0907e | |||
| c1d6f277ce | |||
| 9356be4ec0 | |||
| c694e1f2b0 | |||
| 280ca1f5a3 | |||
| 9abb2db92f | |||
| 7c1efa9cbb | |||
| 4c4524766c | |||
| 7eea71fdcd | |||
| f91c5a3f79 | |||
| 9578f991f4 | |||
| 1cd7916e06 |
@@ -0,0 +1,35 @@
|
|||||||
|
name: CI
|
||||||
|
|
||||||
|
on:
|
||||||
|
pull_request:
|
||||||
|
branches: ['main']
|
||||||
|
|
||||||
|
jobs:
|
||||||
|
build:
|
||||||
|
runs-on: ubuntu-latest
|
||||||
|
defaults:
|
||||||
|
run:
|
||||||
|
working-directory: src
|
||||||
|
steps:
|
||||||
|
- uses: actions/checkout@v4
|
||||||
|
|
||||||
|
- name: Install Rust
|
||||||
|
run: |
|
||||||
|
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
|
||||||
|
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
|
||||||
|
|
||||||
|
- name: Cache cargo registry
|
||||||
|
uses: actions/cache@v4
|
||||||
|
with:
|
||||||
|
path: |
|
||||||
|
~/.cargo/registry
|
||||||
|
~/.cargo/git
|
||||||
|
src/target
|
||||||
|
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
|
||||||
|
restore-keys: ${{ runner.os }}-cargo-
|
||||||
|
|
||||||
|
- name: Build
|
||||||
|
run: cargo build --release
|
||||||
|
|
||||||
|
- name: Test
|
||||||
|
run: cargo test --release
|
||||||
@@ -0,0 +1,123 @@
|
|||||||
|
name: Release
|
||||||
|
|
||||||
|
on:
|
||||||
|
push:
|
||||||
|
tags:
|
||||||
|
- "v*"
|
||||||
|
|
||||||
|
jobs:
|
||||||
|
create-release:
|
||||||
|
runs-on: ubuntu-latest
|
||||||
|
outputs:
|
||||||
|
release_id: ${{ steps.create.outputs.release_id }}
|
||||||
|
steps:
|
||||||
|
- uses: actions/checkout@v4
|
||||||
|
with:
|
||||||
|
fetch-depth: 0
|
||||||
|
|
||||||
|
- name: Create Gitea release
|
||||||
|
id: create
|
||||||
|
env:
|
||||||
|
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
|
||||||
|
TAG: ${{ github.ref_name }}
|
||||||
|
run: |
|
||||||
|
sudo apt-get update -qq && sudo apt-get install -y -qq jq
|
||||||
|
body=$(git for-each-ref --format='%(contents)' "refs/tags/$TAG")
|
||||||
|
release_id=$(curl -s -X POST \
|
||||||
|
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases" \
|
||||||
|
-H "Authorization: token $GITEA_TOKEN" \
|
||||||
|
-H "Content-Type: application/json" \
|
||||||
|
-d "{\"tag_name\":\"$TAG\",\"name\":\"$TAG\",\"body\":$(echo "$body" | jq -Rs .)}" | jq -r '.id')
|
||||||
|
echo "release_id=$release_id" >> $GITHUB_OUTPUT
|
||||||
|
|
||||||
|
build-linux-x86_64:
|
||||||
|
needs: create-release
|
||||||
|
runs-on: ubuntu-latest
|
||||||
|
defaults:
|
||||||
|
run:
|
||||||
|
working-directory: src
|
||||||
|
steps:
|
||||||
|
- uses: actions/checkout@v4
|
||||||
|
|
||||||
|
- name: Install Rust + zigbuild
|
||||||
|
run: |
|
||||||
|
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
|
||||||
|
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
|
||||||
|
sudo apt-get update -qq && sudo apt-get install -y -qq jq
|
||||||
|
pip install ziglang --quiet --break-system-packages
|
||||||
|
$HOME/.cargo/bin/cargo install cargo-zigbuild
|
||||||
|
$HOME/.cargo/bin/rustup target add x86_64-unknown-linux-musl
|
||||||
|
|
||||||
|
- name: Create musl C/C++ wrappers
|
||||||
|
run: |
|
||||||
|
ZIG=$(python3 -c "import ziglang, os; print(os.path.join(os.path.dirname(ziglang.__file__), 'zig'))")
|
||||||
|
printf '#!/bin/sh\nexec "%s" cc -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-gcc > /dev/null
|
||||||
|
printf '#!/bin/sh\nexec "%s" c++ -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-g++ > /dev/null
|
||||||
|
sudo chmod +x /usr/local/bin/x86_64-linux-musl-gcc /usr/local/bin/x86_64-linux-musl-g++
|
||||||
|
|
||||||
|
- name: Cache cargo registry
|
||||||
|
uses: actions/cache@v4
|
||||||
|
with:
|
||||||
|
path: |
|
||||||
|
~/.cargo/registry
|
||||||
|
~/.cargo/git
|
||||||
|
src/target
|
||||||
|
key: linux-musl-cargo-${{ hashFiles('src/Cargo.lock') }}
|
||||||
|
restore-keys: linux-musl-cargo-
|
||||||
|
|
||||||
|
- name: Build static binary
|
||||||
|
env:
|
||||||
|
PKG_CONFIG_ALLOW_CROSS: "1"
|
||||||
|
run: cargo zigbuild --release --target x86_64-unknown-linux-musl
|
||||||
|
|
||||||
|
- name: Prepare and upload artifact
|
||||||
|
env:
|
||||||
|
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
|
||||||
|
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
|
||||||
|
run: |
|
||||||
|
mkdir -p /tmp/dist
|
||||||
|
cp target/x86_64-unknown-linux-musl/release/obikmer /tmp/dist/obikmer-linux-x86_64
|
||||||
|
strip /tmp/dist/obikmer-linux-x86_64
|
||||||
|
curl -s -X POST \
|
||||||
|
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
|
||||||
|
-H "Authorization: token $GITEA_TOKEN" \
|
||||||
|
-F "attachment=@/tmp/dist/obikmer-linux-x86_64"
|
||||||
|
|
||||||
|
build-macos-arm64:
|
||||||
|
needs: create-release
|
||||||
|
runs-on: ubuntu-latest
|
||||||
|
steps:
|
||||||
|
- uses: actions/checkout@v4
|
||||||
|
|
||||||
|
- name: Login to registry
|
||||||
|
run: echo "${{ secrets.REGISTRYTOKEN }}" | docker login registry.metabarcoding.org -u ${{ secrets.REGISTRYUSER }} --password-stdin
|
||||||
|
|
||||||
|
- name: Cache cargo registry
|
||||||
|
uses: actions/cache@v4
|
||||||
|
with:
|
||||||
|
path: |
|
||||||
|
~/.cargo/registry
|
||||||
|
~/.cargo/git
|
||||||
|
src/target
|
||||||
|
key: macos-arm64-cargo-${{ hashFiles('src/Cargo.lock') }}
|
||||||
|
restore-keys: macos-arm64-cargo-
|
||||||
|
|
||||||
|
- name: Build macOS binary
|
||||||
|
run: |
|
||||||
|
docker run --rm \
|
||||||
|
-v "${{ github.workspace }}:/src" \
|
||||||
|
-w /src/src \
|
||||||
|
registry.metabarcoding.org/cibuilder/rustcrossosx:latest \
|
||||||
|
cargo build --release --target aarch64-apple-darwin --no-default-features
|
||||||
|
|
||||||
|
- name: Prepare and upload artifact
|
||||||
|
env:
|
||||||
|
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
|
||||||
|
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
|
||||||
|
run: |
|
||||||
|
mkdir -p /tmp/dist
|
||||||
|
cp src/target/aarch64-apple-darwin/release/obikmer /tmp/dist/obikmer-macos-arm64
|
||||||
|
curl -s -X POST \
|
||||||
|
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
|
||||||
|
-H "Authorization: token $GITEA_TOKEN" \
|
||||||
|
-F "attachment=@/tmp/dist/obikmer-macos-arm64"
|
||||||
+13
@@ -8,4 +8,17 @@ data-stress
|
|||||||
*.pb
|
*.pb
|
||||||
./**/*.json
|
./**/*.json
|
||||||
*.bin
|
*.bin
|
||||||
|
*.log
|
||||||
Betula_exilis--IGA-24-33
|
Betula_exilis--IGA-24-33
|
||||||
|
benchmark/genomes
|
||||||
|
benchmark/simulated_data
|
||||||
|
benchmark/specimen_index_presence
|
||||||
|
benchmark/specimen_index_count
|
||||||
|
benchmark/global_index_presence
|
||||||
|
benchmark/global_index_count
|
||||||
|
benchmark/stats
|
||||||
|
benchmark/reference_index
|
||||||
|
benchmark/reference_dist
|
||||||
|
benchmark/obikmer_dist
|
||||||
|
benchmark/specific_index_count
|
||||||
|
benchmark/specific_index_presence
|
||||||
|
|||||||
@@ -0,0 +1,2 @@
|
|||||||
|
/cache
|
||||||
|
/project.local.yml
|
||||||
@@ -0,0 +1,133 @@
|
|||||||
|
# the name by which the project can be referenced within Serena
|
||||||
|
project_name: "obikmer"
|
||||||
|
|
||||||
|
|
||||||
|
# list of languages for which language servers are started; choose from:
|
||||||
|
# al angular ansible bash clojure
|
||||||
|
# cpp cpp_ccls crystal csharp csharp_omnisharp
|
||||||
|
# dart elixir elm erlang fortran
|
||||||
|
# fsharp go groovy haskell haxe
|
||||||
|
# hlsl html java json julia
|
||||||
|
# kotlin lean4 lua luau markdown
|
||||||
|
# matlab msl nix ocaml pascal
|
||||||
|
# perl php php_phpactor powershell python
|
||||||
|
# python_jedi python_ty r rego ruby
|
||||||
|
# ruby_solargraph rust scala scss solidity
|
||||||
|
# svelte swift systemverilog terraform toml
|
||||||
|
# typescript typescript_vts vue yaml zig
|
||||||
|
# (This list may be outdated. For the current list, see values of Language enum here:
|
||||||
|
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
|
||||||
|
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
|
||||||
|
# Note:
|
||||||
|
# - For C, use cpp
|
||||||
|
# - For JavaScript, use typescript
|
||||||
|
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
|
||||||
|
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
|
||||||
|
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
|
||||||
|
# - For Free Pascal/Lazarus, use pascal
|
||||||
|
# Special requirements:
|
||||||
|
# Some languages require additional setup/installations.
|
||||||
|
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
|
||||||
|
# When using multiple languages, the first language server that supports a given file will be used for that file.
|
||||||
|
# The first language is the default language and the respective language server will be used as a fallback.
|
||||||
|
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
|
||||||
|
languages:
|
||||||
|
- rust
|
||||||
|
|
||||||
|
# the encoding used by text files in the project
|
||||||
|
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
|
||||||
|
encoding: "utf-8"
|
||||||
|
|
||||||
|
# line ending convention to use when writing source files.
|
||||||
|
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
|
||||||
|
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
|
||||||
|
line_ending:
|
||||||
|
|
||||||
|
# The language backend to use for this project.
|
||||||
|
# If not set, the global setting from serena_config.yml is used.
|
||||||
|
# Valid values: LSP, JetBrains
|
||||||
|
# Note: the backend is fixed at startup. If a project with a different backend
|
||||||
|
# is activated post-init, an error will be returned.
|
||||||
|
language_backend:
|
||||||
|
|
||||||
|
# whether to use project's .gitignore files to ignore files
|
||||||
|
ignore_all_files_in_gitignore: true
|
||||||
|
|
||||||
|
# advanced configuration option allowing to configure language server-specific options.
|
||||||
|
# Maps the language key to the options.
|
||||||
|
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
|
||||||
|
# No documentation on options means no options are available.
|
||||||
|
ls_specific_settings: {}
|
||||||
|
|
||||||
|
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
|
||||||
|
# Paths can be absolute or relative to the project root.
|
||||||
|
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
|
||||||
|
# symbols and references across package boundaries.
|
||||||
|
# Currently supported for: TypeScript.
|
||||||
|
# Example:
|
||||||
|
# additional_workspace_folders:
|
||||||
|
# - ../sibling-package
|
||||||
|
# - ../shared-lib
|
||||||
|
additional_workspace_folders: []
|
||||||
|
|
||||||
|
# list of additional paths to ignore in this project.
|
||||||
|
# Same syntax as gitignore, so you can use * and **.
|
||||||
|
# Note: global ignored_paths from serena_config.yml are also applied additively.
|
||||||
|
ignored_paths: []
|
||||||
|
|
||||||
|
# whether the project is in read-only mode
|
||||||
|
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
|
||||||
|
# Added on 2025-04-18
|
||||||
|
read_only: false
|
||||||
|
|
||||||
|
# list of tool names to exclude.
|
||||||
|
# This extends the existing exclusions (e.g. from the global configuration)
|
||||||
|
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||||
|
excluded_tools: []
|
||||||
|
|
||||||
|
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
|
||||||
|
# This extends the existing inclusions (e.g. from the global configuration).
|
||||||
|
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||||
|
included_optional_tools: []
|
||||||
|
|
||||||
|
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
|
||||||
|
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
|
||||||
|
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||||
|
fixed_tools: []
|
||||||
|
|
||||||
|
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
|
||||||
|
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
|
||||||
|
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
|
||||||
|
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
|
||||||
|
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
|
||||||
|
# for this project.
|
||||||
|
# This setting can, in turn, be overridden by CLI parameters (--mode).
|
||||||
|
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
|
||||||
|
default_modes:
|
||||||
|
|
||||||
|
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
|
||||||
|
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
|
||||||
|
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
|
||||||
|
added_modes:
|
||||||
|
|
||||||
|
# initial prompt for the project. It will always be given to the LLM upon activating the project
|
||||||
|
# (contrary to the memories, which are loaded on demand).
|
||||||
|
initial_prompt: ""
|
||||||
|
|
||||||
|
# time budget (seconds) per tool call for the retrieval of additional symbol information
|
||||||
|
# such as docstrings or parameter information.
|
||||||
|
# This overrides the corresponding setting in the global configuration; see the documentation there.
|
||||||
|
# If null or missing, use the setting from the global configuration.
|
||||||
|
symbol_info_budget:
|
||||||
|
|
||||||
|
# list of regex patterns which, when matched, mark a memory entry as read‑only.
|
||||||
|
# Extends the list from the global configuration, merging the two lists.
|
||||||
|
read_only_memory_patterns: []
|
||||||
|
|
||||||
|
# list of regex patterns for memories to completely ignore.
|
||||||
|
# Matching memories will not appear in list_memories or activate_project output
|
||||||
|
# and cannot be accessed via read_memory or write_memory.
|
||||||
|
# To access ignored memory files, use the read_file tool on the raw file path.
|
||||||
|
# Extends the list from the global configuration, merging the two lists.
|
||||||
|
# Example: ["_archive/.*", "_episodes/.*"]
|
||||||
|
ignored_memory_patterns: []
|
||||||
@@ -73,3 +73,29 @@ Lors de l'ajout de nouveaux fichiers Markdown dans `docmd/`, mettre à jour la s
|
|||||||
---
|
---
|
||||||
|
|
||||||
Je continue à poser mes questions et à guider la discussion.
|
Je continue à poser mes questions et à guider la discussion.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## MCP Tools
|
||||||
|
|
||||||
|
**Règle absolue : avant tout travail de code, appeler `mcp__serena__initial_instructions` pour charger les instructions Serena.**
|
||||||
|
|
||||||
|
### Hiérarchie des outils pour ce projet Rust
|
||||||
|
|
||||||
|
**Navigation et édition de code → serena en priorité**
|
||||||
|
- Trouver un symbole, une déclaration, les implémentations d'un trait : `mcp__serena__find_symbol`, `mcp__serena__find_declaration`, `mcp__serena__find_implementations`
|
||||||
|
- Trouver les usages d'un symbole : `mcp__serena__find_referencing_symbols`
|
||||||
|
- Diagnostics LSP (erreurs de compilation) : `mcp__serena__get_diagnostics_for_file`
|
||||||
|
- Vue d'ensemble d'un fichier : `mcp__serena__get_symbols_overview`
|
||||||
|
- Modifier le corps d'une fonction/impl : `mcp__serena__replace_symbol_body`
|
||||||
|
- Ne pas utiliser `cclsp` quand serena couvre le besoin
|
||||||
|
|
||||||
|
**Analyse architecturale → jcodemunch**
|
||||||
|
- Hotspots, couplage, dead code, dépendances entre modules
|
||||||
|
- Utiliser avant de refactorer une zone critique
|
||||||
|
|
||||||
|
**Raisonnement complexe → sequential-thinking**
|
||||||
|
- Décisions d'architecture, choix d'algorithme, trade-offs non triviaux
|
||||||
|
|
||||||
|
**Documentation de crates → context7**
|
||||||
|
- Toujours consulter avant d'utiliser une API de bibliothèque externe
|
||||||
|
|||||||
@@ -22,6 +22,7 @@ $(MKDOCS): $(VENV)/bin/activate
|
|||||||
mkdocs mkdocs-material \
|
mkdocs mkdocs-material \
|
||||||
mkdocs-mermaid2-plugin \
|
mkdocs-mermaid2-plugin \
|
||||||
mkdocs-bibtex
|
mkdocs-bibtex
|
||||||
|
$(PIP) install --quiet --upgrade InSilicoSeq
|
||||||
|
|
||||||
# ── obikmer binary ───────────────────────────────────────────────────────────
|
# ── obikmer binary ───────────────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -62,3 +63,36 @@ clean-doc:
|
|||||||
.PHONY: clean
|
.PHONY: clean
|
||||||
clean: clean-doc
|
clean: clean-doc
|
||||||
rm -rf $(VENV)
|
rm -rf $(VENV)
|
||||||
|
|
||||||
|
# ── release ───────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
CARGO_TOML := $(CARGO_DIR)/obikmer/Cargo.toml
|
||||||
|
|
||||||
|
.PHONY: bump-version
|
||||||
|
bump-version:
|
||||||
|
@current=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
|
||||||
|
if [ -n "$(RELEASE)" ]; then \
|
||||||
|
new_version="$(RELEASE)"; \
|
||||||
|
else \
|
||||||
|
major=$$(echo $$current | cut -d. -f1); \
|
||||||
|
minor=$$(echo $$current | cut -d. -f2); \
|
||||||
|
patch=$$(echo $$current | cut -d. -f3); \
|
||||||
|
new_patch=$$((patch + 1)); \
|
||||||
|
new_version="$$major.$$minor.$$new_patch"; \
|
||||||
|
fi; \
|
||||||
|
echo "Version: $$current -> $$new_version"; \
|
||||||
|
sed -i.bak "s/^version = \"$$current\"/version = \"$$new_version\"/" $(CARGO_TOML) && \
|
||||||
|
rm $(CARGO_TOML).bak
|
||||||
|
|
||||||
|
.PHONY: release
|
||||||
|
release: bump-version
|
||||||
|
@jj auto-describe
|
||||||
|
@jj git push --change @
|
||||||
|
@new_version=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
|
||||||
|
git_hash=$$(jj log -r @ --no-graph -T 'commit_id'); \
|
||||||
|
commits=$$(jj log -r 'latest(tags())..@' --no-graph -T 'description ++ "\n"' 2>/dev/null || \
|
||||||
|
jj log --no-graph -T 'description ++ "\n"' --limit 30); \
|
||||||
|
notes=$$(printf 'Write concise markdown release notes for obikmer (a Rust kmer genomics tool). Be technical and direct. Base them strictly on these commit messages:\n\n%s' "$$commits" | aichat 2>/dev/null); \
|
||||||
|
tag_msg="$${notes:-Release v$$new_version}"; \
|
||||||
|
git tag -a "v$$new_version" -m "$$tag_msg" "$$git_hash" && \
|
||||||
|
git push origin "v$$new_version"
|
||||||
|
|||||||
@@ -0,0 +1,230 @@
|
|||||||
|
# Requires GNU Make >= 4.3 (grouped targets &:) — use gmake on macOS
|
||||||
|
BINARY := ../src/target/release/obikmer
|
||||||
|
VENV_PY := ../.venv/bin/python3
|
||||||
|
|
||||||
|
GENOMES := $(wildcard genomes/*.fna.gz)
|
||||||
|
|
||||||
|
# SPECIMENS, SPECIES, and the full dependency graph are generated by
|
||||||
|
# make_deps.py from the genome FASTA headers — like .d files in C.
|
||||||
|
# Make rebuilds deps.mk whenever genomes/ changes and restarts.
|
||||||
|
-include deps.mk
|
||||||
|
|
||||||
|
REF_NPZS := $(SPECIMENS:%=reference_index/%.npz)
|
||||||
|
REF_DIST_CSVS := $(addprefix reference_dist/, \
|
||||||
|
shared_kmers.csv hamming_dist.csv jaccard_dist.csv \
|
||||||
|
bray_curtis_dist.csv relfreq_bray_curtis_dist.csv \
|
||||||
|
euclidean_dist.csv relfreq_euclidean_dist.csv \
|
||||||
|
hellinger_dist.csv hellinger_euclidean_dist.csv)
|
||||||
|
OBIKMER_PRESENCE_DIST := $(addprefix obikmer_dist/presence/, \
|
||||||
|
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
|
||||||
|
hamming_dist.csv hamming_nj.nwk)
|
||||||
|
OBIKMER_COUNT_DIST := $(addprefix obikmer_dist/count/, \
|
||||||
|
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
|
||||||
|
bray_curtis_dist.csv bray_curtis_nj.nwk \
|
||||||
|
relfreq_bray_curtis_dist.csv relfreq_bray_curtis_nj.nwk \
|
||||||
|
euclidean_dist.csv euclidean_nj.nwk \
|
||||||
|
relfreq_euclidean_dist.csv relfreq_euclidean_nj.nwk \
|
||||||
|
hellinger_dist.csv hellinger_nj.nwk \
|
||||||
|
hellinger_euclidean_dist.csv hellinger_euclidean_nj.nwk)
|
||||||
|
DIST_COMPARISON := stats/dist_comparison/summary.csv
|
||||||
|
PRESENCE_DONE := $(SPECIMENS:%=specimen_index_presence/%/index.done)
|
||||||
|
PRESENCE_STATS := $(SPECIMENS:%=stats/indexing_presence/%.stats)
|
||||||
|
COUNT_DONE := $(SPECIMENS:%=specimen_index_count/%/index.done)
|
||||||
|
COUNT_STATS := $(SPECIMENS:%=stats/indexing_count/%.stats)
|
||||||
|
VERIFY_PRESENCE_STATS := $(SPECIMENS:%=stats/verify_presence/%.stats)
|
||||||
|
VERIFY_COUNT_STATS := $(SPECIMENS:%=stats/verify_count/%.stats)
|
||||||
|
SPECIFIC_PRESENCE_DONE := $(SPECIES:%=specific_index_presence/%/index.done)
|
||||||
|
SPECIFIC_PRESENCE_STATS := $(SPECIES:%=stats/specific_kmer_presence/%.stats)
|
||||||
|
SPECIFIC_COUNT_DONE := $(SPECIES:%=specific_index_count/%/index.done)
|
||||||
|
SPECIFIC_COUNT_STATS := $(SPECIES:%=stats/specific_kmer_count/%.stats)
|
||||||
|
SIMULATED_READS := $(foreach s,$(SPECIMENS),simulated_data/$(subst --,/,$s)/reads_R1.fastq.gz)
|
||||||
|
|
||||||
|
.NOTPARALLEL:
|
||||||
|
|
||||||
|
.PHONY: all simulate reference reference_dist \
|
||||||
|
obikmer_dist obikmer_dist_presence obikmer_dist_count \
|
||||||
|
dist_comparison \
|
||||||
|
index_presence index_count \
|
||||||
|
aggregate_index_presence aggregate_index_count \
|
||||||
|
merge_presence merge_count \
|
||||||
|
verify_presence verify_count \
|
||||||
|
aggregate_verify_presence aggregate_verify_count \
|
||||||
|
verify_merge_presence verify_merge_count \
|
||||||
|
filter_presence filter_count \
|
||||||
|
aggregate_filter_presence aggregate_filter_count
|
||||||
|
|
||||||
|
verify_merge_presence: stats/verify_merge_presence/current.csv
|
||||||
|
verify_merge_count: stats/verify_merge_count/current.csv
|
||||||
|
|
||||||
|
all: aggregate_verify_presence aggregate_verify_count \
|
||||||
|
verify_merge_presence verify_merge_count \
|
||||||
|
aggregate_filter_presence aggregate_filter_count \
|
||||||
|
dist_comparison
|
||||||
|
|
||||||
|
# ── dependency file ───────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
deps.mk: $(GENOMES)
|
||||||
|
$(VENV_PY) make_deps.py $^ > $@
|
||||||
|
|
||||||
|
# ── simulation ────────────────────────────────────────────────────────────────
|
||||||
|
# Prerequisites (genome → reads) are in deps.mk; $< is the genome file.
|
||||||
|
|
||||||
|
$(SIMULATED_READS):
|
||||||
|
bash simulate_one.sh $< $(dir $@)
|
||||||
|
|
||||||
|
simulate: $(SIMULATED_READS)
|
||||||
|
|
||||||
|
# ── reference kmer sets ───────────────────────────────────────────────────────
|
||||||
|
# Prerequisites (reads → npz) are in deps.mk.
|
||||||
|
|
||||||
|
reference_index/%.npz:
|
||||||
|
bash build_reference.sh $*
|
||||||
|
|
||||||
|
reference: $(REF_NPZS)
|
||||||
|
|
||||||
|
# ── reference distance matrices ───────────────────────────────────────────────
|
||||||
|
|
||||||
|
$(REF_DIST_CSVS) &: $(REF_NPZS) build_reference_dist.py
|
||||||
|
$(VENV_PY) build_reference_dist.py
|
||||||
|
|
||||||
|
reference_dist: $(REF_DIST_CSVS)
|
||||||
|
|
||||||
|
# ── obikmer distance (presence index) ────────────────────────────────────────
|
||||||
|
|
||||||
|
$(OBIKMER_PRESENCE_DIST) &: global_index_presence/index.done $(BINARY)
|
||||||
|
mkdir -p obikmer_dist/presence
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/presence/jaccard \
|
||||||
|
--metric jaccard --shared-kmers --nj \
|
||||||
|
global_index_presence
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/presence/hamming \
|
||||||
|
--metric hamming --nj \
|
||||||
|
global_index_presence
|
||||||
|
|
||||||
|
obikmer_dist_presence: $(OBIKMER_PRESENCE_DIST)
|
||||||
|
|
||||||
|
# ── obikmer distance (count index) ───────────────────────────────────────────
|
||||||
|
|
||||||
|
$(OBIKMER_COUNT_DIST) &: global_index_count/index.done $(BINARY)
|
||||||
|
mkdir -p obikmer_dist/count
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/count/jaccard \
|
||||||
|
--metric jaccard --shared-kmers --nj \
|
||||||
|
global_index_count
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/count/bray_curtis \
|
||||||
|
--metric bray-curtis --nj \
|
||||||
|
global_index_count
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/count/relfreq_bray_curtis \
|
||||||
|
--metric relfreq-bray-curtis --nj \
|
||||||
|
global_index_count
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/count/euclidean \
|
||||||
|
--metric euclidean --nj \
|
||||||
|
global_index_count
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/count/relfreq_euclidean \
|
||||||
|
--metric relfreq-euclidean --nj \
|
||||||
|
global_index_count
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/count/hellinger \
|
||||||
|
--metric hellinger --nj \
|
||||||
|
global_index_count
|
||||||
|
$(BINARY) distance \
|
||||||
|
--output obikmer_dist/count/hellinger_euclidean \
|
||||||
|
--metric hellinger-euclidean --nj \
|
||||||
|
global_index_count
|
||||||
|
|
||||||
|
obikmer_dist_count: $(OBIKMER_COUNT_DIST)
|
||||||
|
|
||||||
|
obikmer_dist: obikmer_dist_presence obikmer_dist_count
|
||||||
|
|
||||||
|
# ── distance comparison ───────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
$(DIST_COMPARISON): $(REF_DIST_CSVS) $(OBIKMER_PRESENCE_DIST) $(OBIKMER_COUNT_DIST) compare_all_dist.py
|
||||||
|
$(VENV_PY) compare_all_dist.py --out $(DIST_COMPARISON)
|
||||||
|
|
||||||
|
dist_comparison: $(DIST_COMPARISON)
|
||||||
|
|
||||||
|
# ── per-specimen indexing ─────────────────────────────────────────────────────
|
||||||
|
# Prerequisites (reads → index.done + .stats) are in deps.mk.
|
||||||
|
|
||||||
|
specimen_index_presence/%/index.done \
|
||||||
|
stats/indexing_presence/%.stats &: $(BINARY)
|
||||||
|
bash index_one_presence.sh $*
|
||||||
|
|
||||||
|
specimen_index_count/%/index.done \
|
||||||
|
stats/indexing_count/%.stats &: $(BINARY)
|
||||||
|
bash index_one_count.sh $*
|
||||||
|
|
||||||
|
index_presence: $(PRESENCE_DONE)
|
||||||
|
index_count: $(COUNT_DONE)
|
||||||
|
|
||||||
|
# ── indexing stats aggregation ────────────────────────────────────────────────
|
||||||
|
|
||||||
|
aggregate_index_presence: $(PRESENCE_STATS)
|
||||||
|
bash aggregate_stats.sh indexing_presence
|
||||||
|
|
||||||
|
aggregate_index_count: $(COUNT_STATS)
|
||||||
|
bash aggregate_stats.sh indexing_count
|
||||||
|
|
||||||
|
# ── global merge ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
global_index_presence/index.done: $(PRESENCE_DONE) $(BINARY)
|
||||||
|
bash merge_presence.sh
|
||||||
|
|
||||||
|
global_index_count/index.done: $(COUNT_DONE) $(BINARY)
|
||||||
|
bash merge_count.sh
|
||||||
|
|
||||||
|
merge_presence: global_index_presence/index.done
|
||||||
|
merge_count: global_index_count/index.done
|
||||||
|
|
||||||
|
# ── per-specimen verification ─────────────────────────────────────────────────
|
||||||
|
# Prerequisites (index.done + npz → .stats) are in deps.mk.
|
||||||
|
|
||||||
|
stats/verify_presence/%.stats:
|
||||||
|
bash verify_one_presence.sh $*
|
||||||
|
|
||||||
|
stats/verify_count/%.stats:
|
||||||
|
bash verify_one_count.sh $*
|
||||||
|
|
||||||
|
verify_presence: $(VERIFY_PRESENCE_STATS)
|
||||||
|
verify_count: $(VERIFY_COUNT_STATS)
|
||||||
|
|
||||||
|
# ── verification stats aggregation ───────────────────────────────────────────
|
||||||
|
|
||||||
|
aggregate_verify_presence: $(VERIFY_PRESENCE_STATS)
|
||||||
|
bash aggregate_stats.sh verify_presence
|
||||||
|
|
||||||
|
aggregate_verify_count: $(VERIFY_COUNT_STATS)
|
||||||
|
bash aggregate_stats.sh verify_count
|
||||||
|
|
||||||
|
# ── species-specific indexes ──────────────────────────────────────────────────
|
||||||
|
# Prerequisites (global index → specific index) are in deps.mk.
|
||||||
|
|
||||||
|
specific_index_presence/%/index.done \
|
||||||
|
stats/specific_kmer_presence/%.stats &: $(BINARY)
|
||||||
|
bash filter_one_presence.sh $*
|
||||||
|
|
||||||
|
specific_index_count/%/index.done \
|
||||||
|
stats/specific_kmer_count/%.stats &: $(BINARY)
|
||||||
|
bash filter_one_count.sh $*
|
||||||
|
|
||||||
|
filter_presence: $(SPECIFIC_PRESENCE_DONE)
|
||||||
|
filter_count: $(SPECIFIC_COUNT_DONE)
|
||||||
|
|
||||||
|
aggregate_filter_presence: $(SPECIFIC_PRESENCE_STATS)
|
||||||
|
bash aggregate_stats.sh specific_kmer_presence
|
||||||
|
|
||||||
|
aggregate_filter_count: $(SPECIFIC_COUNT_STATS)
|
||||||
|
bash aggregate_stats.sh specific_kmer_count
|
||||||
|
|
||||||
|
# ── merged index verification ─────────────────────────────────────────────────
|
||||||
|
|
||||||
|
stats/verify_merge_presence/current.csv: $(REF_NPZS) global_index_presence/index.done
|
||||||
|
bash verify_merge_presence.sh
|
||||||
|
|
||||||
|
stats/verify_merge_count/current.csv: $(REF_NPZS) global_index_count/index.done
|
||||||
|
bash verify_merge_count.sh
|
||||||
@@ -0,0 +1,132 @@
|
|||||||
|
# Benchmark pipeline
|
||||||
|
|
||||||
|
Requires **GNU Make ≥ 4.3** (grouped targets `&:`). On macOS use `gmake`.
|
||||||
|
|
||||||
|
```
|
||||||
|
gmake all # full pipeline
|
||||||
|
gmake simulate # simulation only
|
||||||
|
gmake reference # reference kmer sets only
|
||||||
|
```
|
||||||
|
|
||||||
|
## Pipeline overview
|
||||||
|
|
||||||
|
```mermaid
|
||||||
|
flowchart TD
|
||||||
|
GENOMES["genomes/*.fna.gz"]
|
||||||
|
BIN["obikmer binary"]
|
||||||
|
|
||||||
|
GENOMES --> simulate
|
||||||
|
simulate --> simdata[("simulated_data/")]
|
||||||
|
|
||||||
|
simdata --> reference
|
||||||
|
reference --> refnpz[("reference_index/*.npz")]
|
||||||
|
|
||||||
|
subgraph presence ["Presence track"]
|
||||||
|
simdata --> index_presence
|
||||||
|
BIN --> index_presence
|
||||||
|
index_presence --> pres_done[("specimen_index_presence/")]
|
||||||
|
index_presence --> pres_istats[("stats/indexing_presence/")]
|
||||||
|
pres_istats --> aggregate_index_presence
|
||||||
|
|
||||||
|
pres_done --> merge_presence
|
||||||
|
BIN --> merge_presence
|
||||||
|
merge_presence --> gpres[("global_index_presence/")]
|
||||||
|
|
||||||
|
refnpz --> verify_presence
|
||||||
|
pres_done --> verify_presence
|
||||||
|
verify_presence --> vpres_stats[("stats/verify_presence/")]
|
||||||
|
vpres_stats --> aggregate_verify_presence
|
||||||
|
|
||||||
|
gpres --> filter_presence
|
||||||
|
BIN --> filter_presence
|
||||||
|
filter_presence --> spec_pres[("specific_index_presence/")]
|
||||||
|
filter_presence --> spec_pres_stats[("stats/specific_kmer_presence/")]
|
||||||
|
spec_pres_stats --> aggregate_filter_presence
|
||||||
|
|
||||||
|
refnpz --> verify_merge_presence
|
||||||
|
gpres --> verify_merge_presence
|
||||||
|
verify_merge_presence --> vmp[("stats/verify_merge_presence/")]
|
||||||
|
end
|
||||||
|
|
||||||
|
subgraph count ["Count track"]
|
||||||
|
simdata --> index_count
|
||||||
|
BIN --> index_count
|
||||||
|
index_count --> count_done[("specimen_index_count/")]
|
||||||
|
index_count --> count_istats[("stats/indexing_count/")]
|
||||||
|
count_istats --> aggregate_index_count
|
||||||
|
|
||||||
|
count_done --> merge_count
|
||||||
|
BIN --> merge_count
|
||||||
|
merge_count --> gcount[("global_index_count/")]
|
||||||
|
|
||||||
|
refnpz --> verify_count
|
||||||
|
count_done --> verify_count
|
||||||
|
verify_count --> vcount_stats[("stats/verify_count/")]
|
||||||
|
vcount_stats --> aggregate_verify_count
|
||||||
|
|
||||||
|
gcount --> filter_count
|
||||||
|
BIN --> filter_count
|
||||||
|
filter_count --> spec_count[("specific_index_count/")]
|
||||||
|
filter_count --> spec_count_stats[("stats/specific_kmer_count/")]
|
||||||
|
spec_count_stats --> aggregate_filter_count
|
||||||
|
|
||||||
|
refnpz --> verify_merge_count
|
||||||
|
gcount --> verify_merge_count
|
||||||
|
verify_merge_count --> vmc[("stats/verify_merge_count/")]
|
||||||
|
end
|
||||||
|
|
||||||
|
aggregate_verify_presence --> all
|
||||||
|
aggregate_verify_count --> all
|
||||||
|
vmp --> all
|
||||||
|
vmc --> all
|
||||||
|
all -. "$(MAKE) re-eval" .-> aggregate_filter_presence
|
||||||
|
all -. "$(MAKE) re-eval" .-> aggregate_filter_count
|
||||||
|
```
|
||||||
|
|
||||||
|
## Steps
|
||||||
|
|
||||||
|
| Target | Script | Description |
|
||||||
|
|---|---|---|
|
||||||
|
| `simulate` | `simulate.sh` | Simulate sequencing reads from the reference genomes |
|
||||||
|
| `reference` | `build_reference.sh` | Build reference kmer sets (`.npz`) from simulation truth |
|
||||||
|
| `index_presence` | `index_one_presence.sh` | Index each specimen (presence mode) |
|
||||||
|
| `index_count` | `index_one_count.sh` | Index each specimen (count mode) |
|
||||||
|
| `aggregate_index_presence` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (presence) |
|
||||||
|
| `aggregate_index_count` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (count) |
|
||||||
|
| `merge_presence` | `merge_presence.sh` | Merge all specimen presence indexes into a global index |
|
||||||
|
| `merge_count` | `merge_count.sh` | Merge all specimen count indexes into a global index |
|
||||||
|
| `verify_presence` | `verify_one_presence.sh` | Verify each specimen presence index against reference |
|
||||||
|
| `verify_count` | `verify_one_count.sh` | Verify each specimen count index against reference |
|
||||||
|
| `aggregate_verify_presence` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (presence) |
|
||||||
|
| `aggregate_verify_count` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (count) |
|
||||||
|
| `filter_presence` | `filter_one_presence.sh` | Extract species-specific presence indexes from global index |
|
||||||
|
| `filter_count` | `filter_one_count.sh` | Extract species-specific count indexes from global index |
|
||||||
|
| `aggregate_filter_presence` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (presence) |
|
||||||
|
| `aggregate_filter_count` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (count) |
|
||||||
|
| `verify_merge_presence` | `verify_merge_presence.sh` | Verify global presence index against all reference sets |
|
||||||
|
| `verify_merge_count` | `verify_merge_count.sh` | Verify global count index against all reference sets |
|
||||||
|
|
||||||
|
## Directory layout
|
||||||
|
|
||||||
|
```
|
||||||
|
benchmark/
|
||||||
|
├── genomes/ # input reference genomes (.fna.gz)
|
||||||
|
├── simulated_data/ # generated by simulate
|
||||||
|
│ └── <species>/<specimen>/
|
||||||
|
├── reference_index/ # reference kmer sets (.npz)
|
||||||
|
├── specimen_index_presence/ # per-specimen presence indexes
|
||||||
|
├── specimen_index_count/ # per-specimen count indexes
|
||||||
|
├── global_index_presence/ # merged global presence index
|
||||||
|
├── global_index_count/ # merged global count index
|
||||||
|
├── specific_index_presence/ # species-specific presence indexes
|
||||||
|
├── specific_index_count/ # species-specific count indexes
|
||||||
|
└── stats/ # all benchmark statistics
|
||||||
|
├── indexing_presence/
|
||||||
|
├── indexing_count/
|
||||||
|
├── verify_presence/
|
||||||
|
├── verify_count/
|
||||||
|
├── specific_kmer_presence/
|
||||||
|
├── specific_kmer_count/
|
||||||
|
├── verify_merge_presence/
|
||||||
|
└── verify_merge_count/
|
||||||
|
```
|
||||||
Executable
+53
@@ -0,0 +1,53 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Usage: aggregate_stats.sh TYPE
|
||||||
|
# TYPE = indexing_presence | indexing_count | verify_presence | verify_count
|
||||||
|
#
|
||||||
|
# Reads all stats/TYPE/*.stats files (one CSV data row each, no header).
|
||||||
|
# Creates a new stats/TYPE/run_NNN.csv only if any .stats file is newer than
|
||||||
|
# the most recent run CSV (idempotent when nothing changed).
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
TYPE="$1"
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/${TYPE}"
|
||||||
|
|
||||||
|
case "${TYPE}" in
|
||||||
|
indexing_presence|indexing_count)
|
||||||
|
HEADER="run,species,strain,scatter_wall_s,scatter_rss_b,dereplicate_wall_s,dereplicate_rss_b,count_kmer_wall_s,count_kmer_rss_b,index_wall_s,index_rss_b,total_wall_s,total_rss_b"
|
||||||
|
;;
|
||||||
|
verify_presence)
|
||||||
|
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct"
|
||||||
|
;;
|
||||||
|
verify_count)
|
||||||
|
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,fn_pct,fp_pct,cm_pct"
|
||||||
|
;;
|
||||||
|
specific_kmer_presence|specific_kmer_count)
|
||||||
|
HEADER="run,species,rebuild_wall_s,rebuild_rss_b,pack_wall_s,pack_rss_b,filter_total_wall_s,filter_total_rss_b,select_wall_s,select_rss_b,select_total_wall_s,select_total_rss_b"
|
||||||
|
;;
|
||||||
|
*)
|
||||||
|
echo "ERROR: unknown stats type '${TYPE}'" >&2
|
||||||
|
exit 1
|
||||||
|
;;
|
||||||
|
esac
|
||||||
|
|
||||||
|
# Find most recent existing run CSV (empty string if none).
|
||||||
|
latest_csv=$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | sort | tail -1)
|
||||||
|
|
||||||
|
# Check if any .stats file is newer than the latest run CSV.
|
||||||
|
if [[ -n "${latest_csv}" ]] && \
|
||||||
|
[[ -z "$(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' -newer "${latest_csv}" 2>/dev/null)" ]]; then
|
||||||
|
echo "[${TYPE}] stats up to date (${latest_csv})"
|
||||||
|
exit 0
|
||||||
|
fi
|
||||||
|
|
||||||
|
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | wc -l | tr -d ' ')")
|
||||||
|
CSV="${STATS_DIR}/run_${run_n}.csv"
|
||||||
|
|
||||||
|
echo "${HEADER}" >"${CSV}"
|
||||||
|
|
||||||
|
# Sort .stats files by name for reproducible row order.
|
||||||
|
while IFS= read -r stats_file; do
|
||||||
|
sed "s/^/${run_n},/" "${stats_file}"
|
||||||
|
done < <(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' | sort) >>"${CSV}"
|
||||||
|
|
||||||
|
echo "[${TYPE}] run ${run_n} → ${CSV}"
|
||||||
Executable
+137
@@ -0,0 +1,137 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""Build a reference kmer index from paired-end FASTQ reads.
|
||||||
|
|
||||||
|
Extracts canonical kmers — min(kmer, revcomp(kmer)) encoded as uint64 —
|
||||||
|
counts their abundances, and saves a sorted numpy pair (kmers, counts).
|
||||||
|
|
||||||
|
Output .npz arrays
|
||||||
|
kmers : uint64, sorted ascending — canonical kmer integers
|
||||||
|
counts : uint32, same order — raw read abundances
|
||||||
|
"""
|
||||||
|
import argparse
|
||||||
|
import gzip
|
||||||
|
import sys
|
||||||
|
from collections import defaultdict
|
||||||
|
|
||||||
|
import numpy as np
|
||||||
|
|
||||||
|
|
||||||
|
# ── encoding ────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
|
||||||
|
'a': 0, 'c': 1, 'g': 2, 't': 3}
|
||||||
|
|
||||||
|
# Lookup table: revcomp of one byte (4 bases, 8 bits).
|
||||||
|
# Precomputed once at import time.
|
||||||
|
_REVCOMP8 = [0] * 256
|
||||||
|
for _i in range(256):
|
||||||
|
_rc, _x = 0, _i
|
||||||
|
for _ in range(4):
|
||||||
|
_rc = (_rc << 2) | (3 - (_x & 3))
|
||||||
|
_x >>= 2
|
||||||
|
_REVCOMP8[_i] = _rc
|
||||||
|
del _i, _rc, _x
|
||||||
|
|
||||||
|
|
||||||
|
def revcomp_int(kmer: int, k: int) -> int:
|
||||||
|
"""Reverse-complement of a kmer encoded as an integer (2 bits/base).
|
||||||
|
|
||||||
|
Uses byte-level lookup (4 bases at a time) for speed.
|
||||||
|
"""
|
||||||
|
rc = 0
|
||||||
|
bits_left = 2 * k
|
||||||
|
while bits_left > 0:
|
||||||
|
chunk = min(8, bits_left)
|
||||||
|
rc_byte = _REVCOMP8[kmer & 0xFF] >> (8 - chunk)
|
||||||
|
rc = (rc << chunk) | rc_byte
|
||||||
|
kmer >>= chunk
|
||||||
|
bits_left -= chunk
|
||||||
|
return rc
|
||||||
|
|
||||||
|
|
||||||
|
# ── FASTQ parsing ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def iter_sequences(path: str):
|
||||||
|
"""Yield raw sequences from a (gzipped) FASTQ file."""
|
||||||
|
opener = gzip.open if path.endswith('.gz') else open
|
||||||
|
with opener(path, 'rt') as fh:
|
||||||
|
while True:
|
||||||
|
if not fh.readline(): # '@' header
|
||||||
|
break
|
||||||
|
seq = fh.readline().rstrip('\n')
|
||||||
|
fh.readline() # '+'
|
||||||
|
fh.readline() # quality
|
||||||
|
yield seq
|
||||||
|
|
||||||
|
|
||||||
|
# ── kmer counting ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def count_kmers(paths: list[str], k: int) -> dict[int, int]:
|
||||||
|
mask = (1 << (2 * k)) - 1
|
||||||
|
counts: dict[int, int] = defaultdict(int)
|
||||||
|
n_reads = 0
|
||||||
|
|
||||||
|
for path in paths:
|
||||||
|
for seq in iter_sequences(path):
|
||||||
|
n_reads += 1
|
||||||
|
kmer = 0
|
||||||
|
run = 0 # consecutive valid bases
|
||||||
|
|
||||||
|
for c in seq:
|
||||||
|
b = _ENCODE.get(c)
|
||||||
|
if b is None: # N or unexpected character → reset
|
||||||
|
kmer = 0
|
||||||
|
run = 0
|
||||||
|
continue
|
||||||
|
kmer = ((kmer << 2) | b) & mask
|
||||||
|
run += 1
|
||||||
|
if run >= k:
|
||||||
|
rc = revcomp_int(kmer, k)
|
||||||
|
counts[kmer if kmer <= rc else rc] += 1
|
||||||
|
|
||||||
|
if n_reads % 100_000 == 0:
|
||||||
|
print(f' {n_reads:,} reads processed, '
|
||||||
|
f'{len(counts):,} distinct kmers so far',
|
||||||
|
file=sys.stderr)
|
||||||
|
|
||||||
|
print(f' {n_reads:,} reads total, {len(counts):,} distinct kmers',
|
||||||
|
file=sys.stderr)
|
||||||
|
return counts
|
||||||
|
|
||||||
|
|
||||||
|
# ── main ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def main() -> None:
|
||||||
|
ap = argparse.ArgumentParser(description=__doc__,
|
||||||
|
formatter_class=argparse.RawDescriptionHelpFormatter)
|
||||||
|
ap.add_argument('reads', nargs='+', metavar='FASTQ',
|
||||||
|
help='Input reads (FASTQ, gzip OK)')
|
||||||
|
ap.add_argument('-k', '--kmer-size', type=int, default=31,
|
||||||
|
metavar='K')
|
||||||
|
ap.add_argument('--min-abundance', type=int, default=1,
|
||||||
|
metavar='N', help='Drop kmers with count < N (default 1)')
|
||||||
|
ap.add_argument('-o', '--output', required=True,
|
||||||
|
metavar='FILE', help='Output .npz path')
|
||||||
|
args = ap.parse_args()
|
||||||
|
|
||||||
|
print(f'k={args.kmer_size} files={len(args.reads)}', file=sys.stderr)
|
||||||
|
counts = count_kmers(args.reads, args.kmer_size)
|
||||||
|
|
||||||
|
if args.min_abundance > 1:
|
||||||
|
before = len(counts)
|
||||||
|
counts = {k: v for k, v in counts.items() if v >= args.min_abundance}
|
||||||
|
print(f' min-abundance={args.min_abundance}: '
|
||||||
|
f'{before - len(counts):,} kmers dropped, '
|
||||||
|
f'{len(counts):,} retained',
|
||||||
|
file=sys.stderr)
|
||||||
|
|
||||||
|
print(f'Sorting and saving → {args.output}', file=sys.stderr)
|
||||||
|
kmers_arr = np.fromiter(sorted(counts), dtype=np.uint64, count=len(counts))
|
||||||
|
counts_arr = np.array([counts[int(k)] for k in kmers_arr], dtype=np.uint32)
|
||||||
|
|
||||||
|
np.savez_compressed(args.output, kmers=kmers_arr, counts=counts_arr)
|
||||||
|
print(f'Done {len(kmers_arr):,} kmers → {args.output}', file=sys.stderr)
|
||||||
|
|
||||||
|
|
||||||
|
if __name__ == '__main__':
|
||||||
|
main()
|
||||||
Executable
+39
@@ -0,0 +1,39 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
SIMDATA_DIR="${SCRIPT_DIR}/simulated_data"
|
||||||
|
REF_DIR="${SCRIPT_DIR}/reference_index"
|
||||||
|
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
|
||||||
|
BUILD_PY="${SCRIPT_DIR}/build_reference.py"
|
||||||
|
|
||||||
|
KMER_SIZE="${KMER_SIZE:-31}"
|
||||||
|
MIN_ABUNDANCE="${MIN_ABUNDANCE:-1}"
|
||||||
|
|
||||||
|
mkdir -p "${REF_DIR}"
|
||||||
|
|
||||||
|
for species_dir in "${SIMDATA_DIR}"/*/; do
|
||||||
|
[[ -d "${species_dir}" ]] || continue
|
||||||
|
species=$(basename "${species_dir}")
|
||||||
|
|
||||||
|
for strain_dir in "${species_dir}"*/; do
|
||||||
|
[[ -d "${strain_dir}" ]] || continue
|
||||||
|
strain=$(basename "${strain_dir}")
|
||||||
|
|
||||||
|
r1="${strain_dir}/reads_R1.fastq.gz"
|
||||||
|
r2="${strain_dir}/reads_R2.fastq.gz"
|
||||||
|
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
|
||||||
|
echo "SKIP ${species}--${strain}: reads not found" >&2
|
||||||
|
continue
|
||||||
|
fi
|
||||||
|
|
||||||
|
out="${REF_DIR}/${species}--${strain}.npz"
|
||||||
|
echo "[${species}--${strain}] → ${out}"
|
||||||
|
|
||||||
|
"${PYTHON}" "${BUILD_PY}" \
|
||||||
|
--kmer-size "${KMER_SIZE}" \
|
||||||
|
--min-abundance "${MIN_ABUNDANCE}" \
|
||||||
|
--output "${out}" \
|
||||||
|
"${r1}" "${r2}"
|
||||||
|
done
|
||||||
|
done
|
||||||
Executable
+226
@@ -0,0 +1,226 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""Compute reference pairwise distance matrices from per-specimen .npz kmer indexes.
|
||||||
|
|
||||||
|
Reads all .npz files in reference_index/ (each containing sorted uint64 `kmers`
|
||||||
|
and uint32 `counts`), computes all distance metrics supported by `obikmer distance`,
|
||||||
|
and writes one CSV per metric to reference_dist/.
|
||||||
|
|
||||||
|
Output CSV format matches `obikmer distance --output`:
|
||||||
|
- first row: "genome", then specimen names
|
||||||
|
- subsequent rows: specimen name, then float or int values
|
||||||
|
|
||||||
|
Metrics written
|
||||||
|
jaccard_dist.csv Jaccard distance (presence/absence)
|
||||||
|
shared_kmers.csv Shared-kmer count matrix (intersection size)
|
||||||
|
bray_curtis_dist.csv Bray-Curtis dissimilarity (raw counts)
|
||||||
|
relfreq_bray_curtis_dist.csv Bray-Curtis on relative frequencies
|
||||||
|
euclidean_dist.csv Euclidean distance (raw counts)
|
||||||
|
relfreq_euclidean_dist.csv Euclidean distance on relative frequencies
|
||||||
|
hellinger_dist.csv Hellinger distance
|
||||||
|
hellinger_euclidean_dist.csv Euclidean distance in Hellinger space
|
||||||
|
"""
|
||||||
|
import argparse
|
||||||
|
import sys
|
||||||
|
from pathlib import Path
|
||||||
|
|
||||||
|
import numpy as np
|
||||||
|
|
||||||
|
|
||||||
|
# ── pairwise helpers ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def shared_indices(a_kmers: np.ndarray, b_kmers: np.ndarray):
|
||||||
|
"""Return index arrays (idx_a, idx_b) for kmers present in both sets.
|
||||||
|
|
||||||
|
Both arrays must be sorted uint64. Uses searchsorted: O(|B| log |A|).
|
||||||
|
"""
|
||||||
|
pos = np.searchsorted(a_kmers, b_kmers)
|
||||||
|
pos = np.clip(pos, 0, len(a_kmers) - 1)
|
||||||
|
mask = a_kmers[pos] == b_kmers
|
||||||
|
idx_b = np.where(mask)[0]
|
||||||
|
idx_a = pos[idx_b]
|
||||||
|
return idx_a, idx_b
|
||||||
|
|
||||||
|
|
||||||
|
def pairwise_stats(specimens: list[dict]) -> dict[str, np.ndarray]:
|
||||||
|
"""Compute all pairwise distance matrices at once.
|
||||||
|
|
||||||
|
Returns a dict metric_name → ndarray (n×n float64 or int64).
|
||||||
|
Each specimen dict has keys: name, kmers, counts.
|
||||||
|
"""
|
||||||
|
n = len(specimens)
|
||||||
|
|
||||||
|
# Pre-compute per-specimen scalars
|
||||||
|
kmer_counts = np.array([len(s['kmers']) for s in specimens], dtype=np.uint64)
|
||||||
|
count_sums = np.array([s['counts'].sum() for s in specimens], dtype=np.uint64)
|
||||||
|
|
||||||
|
# Per-specimen sum-of-squares (for Euclidean decomposition)
|
||||||
|
sq_sums = np.array([(s['counts'].astype(np.float64) ** 2).sum() for s in specimens])
|
||||||
|
|
||||||
|
# Allocate output matrices
|
||||||
|
shared_mat = np.zeros((n, n), dtype=np.uint64)
|
||||||
|
hamming_mat = np.zeros((n, n), dtype=np.float64)
|
||||||
|
jaccard_mat = np.zeros((n, n), dtype=np.float64)
|
||||||
|
bray_mat = np.zeros((n, n), dtype=np.float64)
|
||||||
|
relfreq_bray = np.zeros((n, n), dtype=np.float64)
|
||||||
|
euclidean_mat = np.zeros((n, n), dtype=np.float64)
|
||||||
|
relfreq_eucl = np.zeros((n, n), dtype=np.float64)
|
||||||
|
hellinger_mat = np.zeros((n, n), dtype=np.float64)
|
||||||
|
hell_eucl_mat = np.zeros((n, n), dtype=np.float64)
|
||||||
|
|
||||||
|
for i in range(n):
|
||||||
|
a_km = specimens[i]['kmers']
|
||||||
|
a_ct = specimens[i]['counts'].astype(np.float64)
|
||||||
|
sa = float(count_sums[i])
|
||||||
|
na = int(kmer_counts[i])
|
||||||
|
|
||||||
|
for j in range(i + 1, n):
|
||||||
|
b_km = specimens[j]['kmers']
|
||||||
|
b_ct = specimens[j]['counts'].astype(np.float64)
|
||||||
|
sb = float(count_sums[j])
|
||||||
|
nb = int(kmer_counts[j])
|
||||||
|
|
||||||
|
idx_a, idx_b = shared_indices(a_km, b_km)
|
||||||
|
inter = len(idx_a)
|
||||||
|
|
||||||
|
ca_sh = a_ct[idx_a]
|
||||||
|
cb_sh = b_ct[idx_b]
|
||||||
|
|
||||||
|
# ── Presence metrics ──────────────────────────────────────────────
|
||||||
|
|
||||||
|
union = na + nb - inter
|
||||||
|
jac = (1.0 - inter / union) if union else 0.0
|
||||||
|
hamming = float(na + nb - 2 * inter) # |A Δ B|
|
||||||
|
|
||||||
|
# ── Count metrics ─────────────────────────────────────────────────
|
||||||
|
|
||||||
|
# Bray-Curtis: 1 - 2*Σmin(a,b) / (Σa + Σb)
|
||||||
|
sum_min = np.minimum(ca_sh, cb_sh).sum()
|
||||||
|
denom_bc = sa + sb
|
||||||
|
bc = (1.0 - 2.0 * sum_min / denom_bc) if denom_bc else 0.0
|
||||||
|
|
||||||
|
# RelfreqBray: 1 - Σmin(a/sa, b/sb) [only shared contribute]
|
||||||
|
if sa and sb:
|
||||||
|
rfb = 1.0 - np.minimum(ca_sh / sa, cb_sh / sb).sum()
|
||||||
|
else:
|
||||||
|
rfb = 0.0
|
||||||
|
|
||||||
|
# Euclidean: √(Σa² + Σb² - 2·Σ(a·b)_shared)
|
||||||
|
cross = (ca_sh * cb_sh).sum()
|
||||||
|
eucl_partial = sq_sums[i] + sq_sums[j] - 2.0 * cross
|
||||||
|
eucl = np.sqrt(max(eucl_partial, 0.0))
|
||||||
|
|
||||||
|
# RelfreqEuclidean: √(Σ(a/sa - b/sb)²)
|
||||||
|
# = √(Σa²/sa² + Σb²/sb² - 2·Σ(a·b)_shared/(sa·sb))
|
||||||
|
if sa and sb:
|
||||||
|
rf_cross = (ca_sh / sa * (cb_sh / sb)).sum()
|
||||||
|
rfe_partial = (sq_sums[i] / sa**2
|
||||||
|
+ sq_sums[j] / sb**2
|
||||||
|
- 2.0 * rf_cross)
|
||||||
|
rfe = np.sqrt(max(rfe_partial, 0.0))
|
||||||
|
else:
|
||||||
|
rfe = 0.0
|
||||||
|
|
||||||
|
# Hellinger partial: Σ(√(a/sa) - √(b/sb))² over global universe
|
||||||
|
# = 2 - 2·Σ√(a·b)_shared / √(sa·sb)
|
||||||
|
if sa and sb:
|
||||||
|
bc_coeff = np.sqrt(ca_sh * cb_sh).sum() / np.sqrt(sa * sb)
|
||||||
|
hell_partial = max(2.0 - 2.0 * bc_coeff, 0.0)
|
||||||
|
else:
|
||||||
|
hell_partial = 0.0
|
||||||
|
|
||||||
|
sq2 = np.sqrt(2.0)
|
||||||
|
hell = np.sqrt(hell_partial) / sq2
|
||||||
|
hell_euc = np.sqrt(hell_partial)
|
||||||
|
|
||||||
|
# ── Fill symmetric matrices ───────────────────────────────────────
|
||||||
|
for mat, val in [
|
||||||
|
(shared_mat, inter),
|
||||||
|
(hamming_mat, hamming),
|
||||||
|
(jaccard_mat, jac),
|
||||||
|
(bray_mat, bc),
|
||||||
|
(relfreq_bray, rfb),
|
||||||
|
(euclidean_mat, eucl),
|
||||||
|
(relfreq_eucl, rfe),
|
||||||
|
(hellinger_mat, hell),
|
||||||
|
(hell_eucl_mat, hell_euc),
|
||||||
|
]:
|
||||||
|
mat[i, j] = val
|
||||||
|
mat[j, i] = val
|
||||||
|
|
||||||
|
return {
|
||||||
|
'shared_kmers': shared_mat,
|
||||||
|
'hamming_dist': hamming_mat,
|
||||||
|
'jaccard_dist': jaccard_mat,
|
||||||
|
'bray_curtis_dist': bray_mat,
|
||||||
|
'relfreq_bray_curtis_dist': relfreq_bray,
|
||||||
|
'euclidean_dist': euclidean_mat,
|
||||||
|
'relfreq_euclidean_dist': relfreq_eucl,
|
||||||
|
'hellinger_dist': hellinger_mat,
|
||||||
|
'hellinger_euclidean_dist': hell_eucl_mat,
|
||||||
|
}
|
||||||
|
|
||||||
|
|
||||||
|
# ── I/O ───────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def write_csv(path: Path, labels: list[str], mat: np.ndarray, fmt: str) -> None:
|
||||||
|
with path.open('w') as fh:
|
||||||
|
fh.write('genome,' + ','.join(labels) + '\n')
|
||||||
|
for i, label in enumerate(labels):
|
||||||
|
row = ','.join(format(mat[i, j], fmt) for j in range(len(labels)))
|
||||||
|
fh.write(f'{label},{row}\n')
|
||||||
|
print(f' → {path}', file=sys.stderr)
|
||||||
|
|
||||||
|
|
||||||
|
# ── main ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def main() -> None:
|
||||||
|
ap = argparse.ArgumentParser(description=__doc__,
|
||||||
|
formatter_class=argparse.RawDescriptionHelpFormatter)
|
||||||
|
ap.add_argument('--ref-dir', default='reference_index',
|
||||||
|
help='Directory with per-specimen .npz files (default: reference_index)')
|
||||||
|
ap.add_argument('--out-dir', default='reference_dist',
|
||||||
|
help='Output directory for CSV files (default: reference_dist)')
|
||||||
|
args = ap.parse_args()
|
||||||
|
|
||||||
|
ref_dir = Path(args.ref_dir)
|
||||||
|
out_dir = Path(args.out_dir)
|
||||||
|
out_dir.mkdir(exist_ok=True)
|
||||||
|
|
||||||
|
npz_files = sorted(ref_dir.glob('*.npz'))
|
||||||
|
if not npz_files:
|
||||||
|
print(f'ERROR: no .npz files found in {ref_dir}', file=sys.stderr)
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
print(f'Loading {len(npz_files)} specimen(s) from {ref_dir}/', file=sys.stderr)
|
||||||
|
specimens = []
|
||||||
|
for f in npz_files:
|
||||||
|
data = np.load(f)
|
||||||
|
specimens.append({
|
||||||
|
'name': f.stem,
|
||||||
|
'kmers': data['kmers'],
|
||||||
|
'counts': data['counts'],
|
||||||
|
})
|
||||||
|
print(f' {f.stem}: {len(data["kmers"]):,} kmers', file=sys.stderr)
|
||||||
|
|
||||||
|
labels = [s['name'] for s in specimens]
|
||||||
|
n = len(labels)
|
||||||
|
print(f'\nComputing pairwise distances for {n} specimens…', file=sys.stderr)
|
||||||
|
|
||||||
|
matrices = pairwise_stats(specimens)
|
||||||
|
|
||||||
|
print(f'\nWriting CSVs to {out_dir}/', file=sys.stderr)
|
||||||
|
write_csv(out_dir / 'shared_kmers.csv', labels, matrices['shared_kmers'], 'd')
|
||||||
|
write_csv(out_dir / 'hamming_dist.csv', labels, matrices['hamming_dist'], '.6f')
|
||||||
|
write_csv(out_dir / 'jaccard_dist.csv', labels, matrices['jaccard_dist'], '.6f')
|
||||||
|
write_csv(out_dir / 'bray_curtis_dist.csv', labels, matrices['bray_curtis_dist'], '.6f')
|
||||||
|
write_csv(out_dir / 'relfreq_bray_curtis_dist.csv', labels, matrices['relfreq_bray_curtis_dist'], '.6f')
|
||||||
|
write_csv(out_dir / 'euclidean_dist.csv', labels, matrices['euclidean_dist'], '.6f')
|
||||||
|
write_csv(out_dir / 'relfreq_euclidean_dist.csv', labels, matrices['relfreq_euclidean_dist'], '.6f')
|
||||||
|
write_csv(out_dir / 'hellinger_dist.csv', labels, matrices['hellinger_dist'], '.6f')
|
||||||
|
write_csv(out_dir / 'hellinger_euclidean_dist.csv', labels, matrices['hellinger_euclidean_dist'], '.6f')
|
||||||
|
|
||||||
|
print('\nDone.', file=sys.stderr)
|
||||||
|
|
||||||
|
|
||||||
|
if __name__ == '__main__':
|
||||||
|
main()
|
||||||
Executable
+182
@@ -0,0 +1,182 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""Compare all reference distance matrices against obikmer distance outputs.
|
||||||
|
|
||||||
|
Reads from:
|
||||||
|
reference_dist/ — ground-truth matrices computed by build_reference_dist.py
|
||||||
|
obikmer_dist/ — matrices produced by `obikmer distance`
|
||||||
|
|
||||||
|
Handles label reordering: both matrices are sorted by genome label before
|
||||||
|
element-wise comparison, so column/row order differences are irrelevant.
|
||||||
|
|
||||||
|
Output: stats/dist_comparison/summary.csv
|
||||||
|
comparison,max_abs,mean_abs,rmse,n_pairs,status
|
||||||
|
"""
|
||||||
|
import csv
|
||||||
|
import sys
|
||||||
|
from pathlib import Path
|
||||||
|
|
||||||
|
import numpy as np
|
||||||
|
|
||||||
|
|
||||||
|
# ── CSV loading ───────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def load_matrix(path: Path) -> tuple[list[str], np.ndarray]:
|
||||||
|
"""Load a distance-matrix CSV; return (sorted_labels, matrix_float64)."""
|
||||||
|
with path.open() as fh:
|
||||||
|
reader = csv.reader(fh)
|
||||||
|
header = next(reader)[1:] # skip 'genome' column
|
||||||
|
raw: dict[str, list[float]] = {}
|
||||||
|
for row in reader:
|
||||||
|
raw[row[0]] = [float(x) for x in row[1:]]
|
||||||
|
|
||||||
|
label_to_col = {h: i for i, h in enumerate(header)}
|
||||||
|
labels = sorted(raw.keys())
|
||||||
|
n = len(labels)
|
||||||
|
mat = np.zeros((n, n), dtype=np.float64)
|
||||||
|
for i, ri in enumerate(labels):
|
||||||
|
for j, cj in enumerate(labels):
|
||||||
|
mat[i, j] = raw[ri][label_to_col[cj]]
|
||||||
|
return labels, mat
|
||||||
|
|
||||||
|
|
||||||
|
# ── comparison ────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def compare(label: str,
|
||||||
|
ref_path: Path,
|
||||||
|
obi_path: Path,
|
||||||
|
tol: float = 1e-4) -> dict:
|
||||||
|
if not ref_path.exists():
|
||||||
|
return {'comparison': label, 'status': 'REF_MISSING',
|
||||||
|
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
|
||||||
|
if not obi_path.exists():
|
||||||
|
return {'comparison': label, 'status': 'OBI_MISSING',
|
||||||
|
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
|
||||||
|
|
||||||
|
ref_labels, ref_mat = load_matrix(ref_path)
|
||||||
|
obi_labels, obi_mat = load_matrix(obi_path)
|
||||||
|
|
||||||
|
if ref_labels != obi_labels:
|
||||||
|
only_ref = sorted(set(ref_labels) - set(obi_labels))
|
||||||
|
only_obi = sorted(set(obi_labels) - set(ref_labels))
|
||||||
|
print(f' [{label}] label mismatch — '
|
||||||
|
f'only_ref={only_ref} only_obi={only_obi}', file=sys.stderr)
|
||||||
|
return {'comparison': label, 'status': 'LABEL_MISMATCH',
|
||||||
|
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
|
||||||
|
|
||||||
|
n = len(ref_labels)
|
||||||
|
# Off-diagonal mask
|
||||||
|
mask = ~np.eye(n, dtype=bool)
|
||||||
|
diff = np.abs(ref_mat[mask] - obi_mat[mask])
|
||||||
|
n_pairs = diff.size
|
||||||
|
|
||||||
|
max_abs = float(diff.max())
|
||||||
|
mean_abs = float(diff.mean())
|
||||||
|
rmse = float(np.sqrt((diff ** 2).mean()))
|
||||||
|
status = 'PASS' if max_abs <= tol else 'FAIL'
|
||||||
|
|
||||||
|
print(f' [{label}] n={n_pairs} '
|
||||||
|
f'max={max_abs:.3e} mean={mean_abs:.3e} rmse={rmse:.3e} {status}',
|
||||||
|
file=sys.stderr)
|
||||||
|
return {
|
||||||
|
'comparison': label,
|
||||||
|
'max_abs': f'{max_abs:.6e}',
|
||||||
|
'mean_abs': f'{mean_abs:.6e}',
|
||||||
|
'rmse': f'{rmse:.6e}',
|
||||||
|
'n_pairs': str(n_pairs),
|
||||||
|
'status': status,
|
||||||
|
}
|
||||||
|
|
||||||
|
|
||||||
|
# ── comparison table ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
# (label, ref_csv, obikmer_csv)
|
||||||
|
# The reference jaccard/shared is presence-based, which should match both
|
||||||
|
# presence/jaccard and count/jaccard (threshold=1).
|
||||||
|
COMPARISONS = [
|
||||||
|
# ── presence index ────────────────────────────────────────────────────────
|
||||||
|
('presence/jaccard_dist',
|
||||||
|
'reference_dist/jaccard_dist.csv',
|
||||||
|
'obikmer_dist/presence/jaccard_dist.csv'),
|
||||||
|
|
||||||
|
('presence/jaccard_shared',
|
||||||
|
'reference_dist/shared_kmers.csv',
|
||||||
|
'obikmer_dist/presence/jaccard_shared.csv'),
|
||||||
|
|
||||||
|
('presence/hamming_dist',
|
||||||
|
'reference_dist/hamming_dist.csv',
|
||||||
|
'obikmer_dist/presence/hamming_dist.csv'),
|
||||||
|
|
||||||
|
# ── count index (jaccard cross-check) ─────────────────────────────────────
|
||||||
|
('count/jaccard_dist',
|
||||||
|
'reference_dist/jaccard_dist.csv',
|
||||||
|
'obikmer_dist/count/jaccard_dist.csv'),
|
||||||
|
|
||||||
|
('count/jaccard_shared',
|
||||||
|
'reference_dist/shared_kmers.csv',
|
||||||
|
'obikmer_dist/count/jaccard_shared.csv'),
|
||||||
|
|
||||||
|
# ── count index (count-based metrics) ────────────────────────────────────
|
||||||
|
('count/bray_curtis_dist',
|
||||||
|
'reference_dist/bray_curtis_dist.csv',
|
||||||
|
'obikmer_dist/count/bray_curtis_dist.csv'),
|
||||||
|
|
||||||
|
('count/relfreq_bray_curtis_dist',
|
||||||
|
'reference_dist/relfreq_bray_curtis_dist.csv',
|
||||||
|
'obikmer_dist/count/relfreq_bray_curtis_dist.csv'),
|
||||||
|
|
||||||
|
('count/euclidean_dist',
|
||||||
|
'reference_dist/euclidean_dist.csv',
|
||||||
|
'obikmer_dist/count/euclidean_dist.csv'),
|
||||||
|
|
||||||
|
('count/relfreq_euclidean_dist',
|
||||||
|
'reference_dist/relfreq_euclidean_dist.csv',
|
||||||
|
'obikmer_dist/count/relfreq_euclidean_dist.csv'),
|
||||||
|
|
||||||
|
('count/hellinger_dist',
|
||||||
|
'reference_dist/hellinger_dist.csv',
|
||||||
|
'obikmer_dist/count/hellinger_dist.csv'),
|
||||||
|
|
||||||
|
('count/hellinger_euclidean_dist',
|
||||||
|
'reference_dist/hellinger_euclidean_dist.csv',
|
||||||
|
'obikmer_dist/count/hellinger_euclidean_dist.csv'),
|
||||||
|
]
|
||||||
|
|
||||||
|
|
||||||
|
# ── main ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def main() -> None:
|
||||||
|
import argparse
|
||||||
|
ap = argparse.ArgumentParser(description=__doc__,
|
||||||
|
formatter_class=argparse.RawDescriptionHelpFormatter)
|
||||||
|
ap.add_argument('--tol', type=float, default=1e-4,
|
||||||
|
help='Max abs diff threshold for PASS/FAIL (default 1e-4)')
|
||||||
|
ap.add_argument('--out', default='stats/dist_comparison/summary.csv',
|
||||||
|
help='Output summary CSV path')
|
||||||
|
args = ap.parse_args()
|
||||||
|
|
||||||
|
out_path = Path(args.out)
|
||||||
|
out_path.parent.mkdir(parents=True, exist_ok=True)
|
||||||
|
|
||||||
|
print(f'Comparing {len(COMPARISONS)} matrix pairs…', file=sys.stderr)
|
||||||
|
rows = []
|
||||||
|
for label, ref, obi in COMPARISONS:
|
||||||
|
rows.append(compare(label, Path(ref), Path(obi), tol=args.tol))
|
||||||
|
|
||||||
|
fields = ['comparison', 'max_abs', 'mean_abs', 'rmse', 'n_pairs', 'status']
|
||||||
|
with out_path.open('w', newline='') as fh:
|
||||||
|
w = csv.DictWriter(fh, fieldnames=fields)
|
||||||
|
w.writeheader()
|
||||||
|
w.writerows(rows)
|
||||||
|
|
||||||
|
print(f'\n→ {out_path}', file=sys.stderr)
|
||||||
|
|
||||||
|
n_fail = sum(1 for r in rows if r.get('status') == 'FAIL')
|
||||||
|
n_pass = sum(1 for r in rows if r.get('status') == 'PASS')
|
||||||
|
print(f'Summary: {n_pass} PASS {n_fail} FAIL '
|
||||||
|
f'{len(rows) - n_pass - n_fail} SKIP', file=sys.stderr)
|
||||||
|
if n_fail:
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
|
||||||
|
if __name__ == '__main__':
|
||||||
|
main()
|
||||||
@@ -0,0 +1,199 @@
|
|||||||
|
SPECIMENS := Escherichia_coli--K-12_MG1655 Escherichia_coli--EDL933 Salmonella_enterica--LT2 Escherichia_coli--CFT073 Bacillus_subtilis--168 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Saccharolobus_islandicus--M.16.4 Acidobacterium_capsulatum--ATCC_51196 Salmonella_enterica--AKU_12601 Proteus_mirabilis--HI4320 Salmonella_enterica--CT18 Klebsiella_pneumoniae--HS11286 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Klebsiella_pneumoniae--ATCC_13883 Yersinia_ruckeri--YRB Candidozyma_auris--GCF_003013715.1_ASM301371v2
|
||||||
|
SPECIES := Escherichia_coli Salmonella_enterica Bacillus_subtilis Shouchella_clausii Klebsiella_pneumoniae Opitutus_terrae Saccharolobus_islandicus Acidobacterium_capsulatum Proteus_mirabilis Wolbachia_endosymbiont Yersinia_ruckeri Candidozyma_auris
|
||||||
|
|
||||||
|
# Escherichia_coli--K-12_MG1655
|
||||||
|
simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz: genomes/GCF_000005845.2_ASM584v2_genomic.fna.gz
|
||||||
|
reference_index/Escherichia_coli--K-12_MG1655.npz: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done stats/indexing_presence/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Escherichia_coli--K-12_MG1655/index.done stats/indexing_count/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done
|
||||||
|
stats/verify_count/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_count/Escherichia_coli--K-12_MG1655/index.done
|
||||||
|
|
||||||
|
# Escherichia_coli--EDL933
|
||||||
|
simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz: genomes/GCF_000006665.1_ASM666v1_genomic.fna.gz
|
||||||
|
reference_index/Escherichia_coli--EDL933.npz: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Escherichia_coli--EDL933/index.done stats/indexing_presence/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Escherichia_coli--EDL933/index.done stats/indexing_count/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_presence/Escherichia_coli--EDL933/index.done
|
||||||
|
stats/verify_count/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_count/Escherichia_coli--EDL933/index.done
|
||||||
|
|
||||||
|
# Salmonella_enterica--LT2
|
||||||
|
simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz: genomes/GCF_000006945.2_ASM694v2_genomic.fna.gz
|
||||||
|
reference_index/Salmonella_enterica--LT2.npz: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Salmonella_enterica--LT2/index.done stats/indexing_presence/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Salmonella_enterica--LT2/index.done stats/indexing_count/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_presence/Salmonella_enterica--LT2/index.done
|
||||||
|
stats/verify_count/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_count/Salmonella_enterica--LT2/index.done
|
||||||
|
|
||||||
|
# Escherichia_coli--CFT073
|
||||||
|
simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz: genomes/GCF_000007445.1_ASM744v1_genomic.fna.gz
|
||||||
|
reference_index/Escherichia_coli--CFT073.npz: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Escherichia_coli--CFT073/index.done stats/indexing_presence/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Escherichia_coli--CFT073/index.done stats/indexing_count/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_presence/Escherichia_coli--CFT073/index.done
|
||||||
|
stats/verify_count/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_count/Escherichia_coli--CFT073/index.done
|
||||||
|
|
||||||
|
# Bacillus_subtilis--168
|
||||||
|
simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz: genomes/GCF_000009045.1_ASM904v1_genomic.fna.gz
|
||||||
|
reference_index/Bacillus_subtilis--168.npz: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Bacillus_subtilis--168/index.done stats/indexing_presence/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Bacillus_subtilis--168/index.done stats/indexing_count/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_presence/Bacillus_subtilis--168/index.done
|
||||||
|
stats/verify_count/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_count/Bacillus_subtilis--168/index.done
|
||||||
|
|
||||||
|
# Salmonella_enterica--P125109
|
||||||
|
simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz: genomes/GCF_000009505.1_ASM950v1_genomic.fna.gz
|
||||||
|
reference_index/Salmonella_enterica--P125109.npz: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Salmonella_enterica--P125109/index.done stats/indexing_presence/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Salmonella_enterica--P125109/index.done stats/indexing_count/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_presence/Salmonella_enterica--P125109/index.done
|
||||||
|
stats/verify_count/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_count/Salmonella_enterica--P125109/index.done
|
||||||
|
|
||||||
|
# Shouchella_clausii--KSM-K16
|
||||||
|
simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz: genomes/GCF_000009825.1_ASM982v1_genomic.fna.gz
|
||||||
|
reference_index/Shouchella_clausii--KSM-K16.npz: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Shouchella_clausii--KSM-K16/index.done stats/indexing_presence/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Shouchella_clausii--KSM-K16/index.done stats/indexing_count/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_presence/Shouchella_clausii--KSM-K16/index.done
|
||||||
|
stats/verify_count/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_count/Shouchella_clausii--KSM-K16/index.done
|
||||||
|
|
||||||
|
# Escherichia_coli--K-12_W3110
|
||||||
|
simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz: genomes/GCF_000010245.2_ASM1024v1_genomic.fna.gz
|
||||||
|
reference_index/Escherichia_coli--K-12_W3110.npz: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Escherichia_coli--K-12_W3110/index.done stats/indexing_presence/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Escherichia_coli--K-12_W3110/index.done stats/indexing_count/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_presence/Escherichia_coli--K-12_W3110/index.done
|
||||||
|
stats/verify_count/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_count/Escherichia_coli--K-12_W3110/index.done
|
||||||
|
|
||||||
|
# Klebsiella_pneumoniae--MGH_78578
|
||||||
|
simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz: genomes/GCF_000016305.1_ASM1630v1_genomic.fna.gz
|
||||||
|
reference_index/Klebsiella_pneumoniae--MGH_78578.npz: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_presence/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_count/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done
|
||||||
|
stats/verify_count/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done
|
||||||
|
|
||||||
|
# Opitutus_terrae--PB90-1
|
||||||
|
simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz: genomes/GCF_000019965.1_ASM1996v1_genomic.fna.gz
|
||||||
|
reference_index/Opitutus_terrae--PB90-1.npz: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Opitutus_terrae--PB90-1/index.done stats/indexing_presence/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Opitutus_terrae--PB90-1/index.done stats/indexing_count/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_presence/Opitutus_terrae--PB90-1/index.done
|
||||||
|
stats/verify_count/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_count/Opitutus_terrae--PB90-1/index.done
|
||||||
|
|
||||||
|
# Saccharolobus_islandicus--M.16.4
|
||||||
|
simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz: genomes/GCF_000022445.1_ASM2244v1_genomic.fna.gz
|
||||||
|
reference_index/Saccharolobus_islandicus--M.16.4.npz: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_presence/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_count/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done
|
||||||
|
stats/verify_count/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done
|
||||||
|
|
||||||
|
# Acidobacterium_capsulatum--ATCC_51196
|
||||||
|
simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz: genomes/GCF_000022565.1_ASM2256v1_genomic.fna.gz
|
||||||
|
reference_index/Acidobacterium_capsulatum--ATCC_51196.npz: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_presence/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_count/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done
|
||||||
|
stats/verify_count/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done
|
||||||
|
|
||||||
|
# Salmonella_enterica--AKU_12601
|
||||||
|
simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz: genomes/GCF_000026565.1_ASM2656v1_genomic.fna.gz
|
||||||
|
reference_index/Salmonella_enterica--AKU_12601.npz: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Salmonella_enterica--AKU_12601/index.done stats/indexing_presence/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Salmonella_enterica--AKU_12601/index.done stats/indexing_count/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_presence/Salmonella_enterica--AKU_12601/index.done
|
||||||
|
stats/verify_count/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_count/Salmonella_enterica--AKU_12601/index.done
|
||||||
|
|
||||||
|
# Proteus_mirabilis--HI4320
|
||||||
|
simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz: genomes/GCF_000069965.1_ASM6996v1_genomic.fna.gz
|
||||||
|
reference_index/Proteus_mirabilis--HI4320.npz: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Proteus_mirabilis--HI4320/index.done stats/indexing_presence/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Proteus_mirabilis--HI4320/index.done stats/indexing_count/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_presence/Proteus_mirabilis--HI4320/index.done
|
||||||
|
stats/verify_count/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_count/Proteus_mirabilis--HI4320/index.done
|
||||||
|
|
||||||
|
# Salmonella_enterica--CT18
|
||||||
|
simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz: genomes/GCF_000195995.1_ASM19599v1_genomic.fna.gz
|
||||||
|
reference_index/Salmonella_enterica--CT18.npz: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Salmonella_enterica--CT18/index.done stats/indexing_presence/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Salmonella_enterica--CT18/index.done stats/indexing_count/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_presence/Salmonella_enterica--CT18/index.done
|
||||||
|
stats/verify_count/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_count/Salmonella_enterica--CT18/index.done
|
||||||
|
|
||||||
|
# Klebsiella_pneumoniae--HS11286
|
||||||
|
simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz: genomes/GCF_000240185.1_ASM24018v2_genomic.fna.gz
|
||||||
|
reference_index/Klebsiella_pneumoniae--HS11286.npz: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_presence/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_count/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done
|
||||||
|
stats/verify_count/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done
|
||||||
|
|
||||||
|
# Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1
|
||||||
|
simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz: genomes/GCF_000306885.1_ASM30688v1_genomic.fna.gz
|
||||||
|
reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
|
||||||
|
stats/verify_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
|
||||||
|
|
||||||
|
# Klebsiella_pneumoniae--ATCC_13883
|
||||||
|
simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz: genomes/GCF_000742135.1_ASM74213v1_genomic.fna.gz
|
||||||
|
reference_index/Klebsiella_pneumoniae--ATCC_13883.npz: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_presence/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_count/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done
|
||||||
|
stats/verify_count/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done
|
||||||
|
|
||||||
|
# Yersinia_ruckeri--YRB
|
||||||
|
simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz: genomes/GCF_000834255.1_ASM83425v1_genomic.fna.gz
|
||||||
|
reference_index/Yersinia_ruckeri--YRB.npz: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Yersinia_ruckeri--YRB/index.done stats/indexing_presence/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Yersinia_ruckeri--YRB/index.done stats/indexing_count/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_presence/Yersinia_ruckeri--YRB/index.done
|
||||||
|
stats/verify_count/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_count/Yersinia_ruckeri--YRB/index.done
|
||||||
|
|
||||||
|
# Candidozyma_auris--GCF_003013715.1_ASM301371v2
|
||||||
|
simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz: genomes/GCF_003013715.1_ASM301371v2_genomic.fna.gz
|
||||||
|
reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
|
||||||
|
specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
|
||||||
|
specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
|
||||||
|
stats/verify_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
|
||||||
|
stats/verify_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
|
||||||
|
|
||||||
|
# Escherichia_coli
|
||||||
|
specific_index_presence/Escherichia_coli/index.done stats/specific_kmer_presence/Escherichia_coli.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Escherichia_coli/index.done stats/specific_kmer_count/Escherichia_coli.stats: global_index_count/index.done
|
||||||
|
# Salmonella_enterica
|
||||||
|
specific_index_presence/Salmonella_enterica/index.done stats/specific_kmer_presence/Salmonella_enterica.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Salmonella_enterica/index.done stats/specific_kmer_count/Salmonella_enterica.stats: global_index_count/index.done
|
||||||
|
# Bacillus_subtilis
|
||||||
|
specific_index_presence/Bacillus_subtilis/index.done stats/specific_kmer_presence/Bacillus_subtilis.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Bacillus_subtilis/index.done stats/specific_kmer_count/Bacillus_subtilis.stats: global_index_count/index.done
|
||||||
|
# Shouchella_clausii
|
||||||
|
specific_index_presence/Shouchella_clausii/index.done stats/specific_kmer_presence/Shouchella_clausii.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Shouchella_clausii/index.done stats/specific_kmer_count/Shouchella_clausii.stats: global_index_count/index.done
|
||||||
|
# Klebsiella_pneumoniae
|
||||||
|
specific_index_presence/Klebsiella_pneumoniae/index.done stats/specific_kmer_presence/Klebsiella_pneumoniae.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Klebsiella_pneumoniae/index.done stats/specific_kmer_count/Klebsiella_pneumoniae.stats: global_index_count/index.done
|
||||||
|
# Opitutus_terrae
|
||||||
|
specific_index_presence/Opitutus_terrae/index.done stats/specific_kmer_presence/Opitutus_terrae.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Opitutus_terrae/index.done stats/specific_kmer_count/Opitutus_terrae.stats: global_index_count/index.done
|
||||||
|
# Saccharolobus_islandicus
|
||||||
|
specific_index_presence/Saccharolobus_islandicus/index.done stats/specific_kmer_presence/Saccharolobus_islandicus.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Saccharolobus_islandicus/index.done stats/specific_kmer_count/Saccharolobus_islandicus.stats: global_index_count/index.done
|
||||||
|
# Acidobacterium_capsulatum
|
||||||
|
specific_index_presence/Acidobacterium_capsulatum/index.done stats/specific_kmer_presence/Acidobacterium_capsulatum.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Acidobacterium_capsulatum/index.done stats/specific_kmer_count/Acidobacterium_capsulatum.stats: global_index_count/index.done
|
||||||
|
# Proteus_mirabilis
|
||||||
|
specific_index_presence/Proteus_mirabilis/index.done stats/specific_kmer_presence/Proteus_mirabilis.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Proteus_mirabilis/index.done stats/specific_kmer_count/Proteus_mirabilis.stats: global_index_count/index.done
|
||||||
|
# Wolbachia_endosymbiont
|
||||||
|
specific_index_presence/Wolbachia_endosymbiont/index.done stats/specific_kmer_presence/Wolbachia_endosymbiont.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Wolbachia_endosymbiont/index.done stats/specific_kmer_count/Wolbachia_endosymbiont.stats: global_index_count/index.done
|
||||||
|
# Yersinia_ruckeri
|
||||||
|
specific_index_presence/Yersinia_ruckeri/index.done stats/specific_kmer_presence/Yersinia_ruckeri.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Yersinia_ruckeri/index.done stats/specific_kmer_count/Yersinia_ruckeri.stats: global_index_count/index.done
|
||||||
|
# Candidozyma_auris
|
||||||
|
specific_index_presence/Candidozyma_auris/index.done stats/specific_kmer_presence/Candidozyma_auris.stats: global_index_presence/index.done
|
||||||
|
specific_index_count/Candidozyma_auris/index.done stats/specific_kmer_count/Candidozyma_auris.stats: global_index_count/index.done
|
||||||
Executable
+48
@@ -0,0 +1,48 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
assemblies=(
|
||||||
|
GCF_000005845.2
|
||||||
|
GCF_000010245.2
|
||||||
|
GCF_000007445.1
|
||||||
|
GCF_000006665.1
|
||||||
|
|
||||||
|
GCF_000006945.2
|
||||||
|
GCF_000195995.1
|
||||||
|
GCF_000009505.1
|
||||||
|
GCF_000026565.1
|
||||||
|
|
||||||
|
GCF_000016305.1
|
||||||
|
GCF_000019965.1
|
||||||
|
GCF_000240185.1
|
||||||
|
GCF_000742135.1
|
||||||
|
|
||||||
|
GCF_000069965.1
|
||||||
|
GCF_000022565.1
|
||||||
|
GCF_000306885.1
|
||||||
|
GCF_003013715.1
|
||||||
|
|
||||||
|
GCF_000009045.1
|
||||||
|
GCF_000009825.1
|
||||||
|
GCF_000022445.1
|
||||||
|
GCF_000834255.1
|
||||||
|
)
|
||||||
|
|
||||||
|
mkdir -p genomes
|
||||||
|
|
||||||
|
for acc in "${assemblies[@]}"; do
|
||||||
|
echo "Downloading ${acc}"
|
||||||
|
|
||||||
|
datasets download genome accession "${acc}" \
|
||||||
|
--include genome \
|
||||||
|
--filename "${acc}.zip"
|
||||||
|
|
||||||
|
unzip -q "${acc}.zip" -d "${acc}"
|
||||||
|
find "${acc}" -name "*.fna" |
|
||||||
|
while read file; do
|
||||||
|
obiconvert -Z ${file} >genomes/$(basename ${file}).gz
|
||||||
|
done
|
||||||
|
|
||||||
|
rm -rf "${acc}" "${acc}.zip"
|
||||||
|
done
|
||||||
Executable
+108
@@ -0,0 +1,108 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Usage: filter_one_count.sh SPECIES
|
||||||
|
# Filters global_index_count to keep only kmers specific to SPECIES,
|
||||||
|
# then selects the SPECIES column in-place.
|
||||||
|
# Outputs:
|
||||||
|
# specific_index_count/SPECIES/index.done (written by obikmer select)
|
||||||
|
# stats/specific_kmer_count/SPECIES.stats (one CSV data row, no header)
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SPECIES="$1"
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
|
||||||
|
SOURCE="${SCRIPT_DIR}/global_index_count"
|
||||||
|
OUTPUT="${SCRIPT_DIR}/specific_index_count/${SPECIES}"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_count"
|
||||||
|
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
echo "[${SPECIES}] filter (count) → ${OUTPUT}"
|
||||||
|
|
||||||
|
LOG_FILTER=$(mktemp)
|
||||||
|
LOG_SELECT=$(mktemp)
|
||||||
|
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
|
||||||
|
|
||||||
|
"${BINARY}" filter \
|
||||||
|
--output "${OUTPUT}" \
|
||||||
|
--force \
|
||||||
|
--ingroup "species=${SPECIES}" \
|
||||||
|
--outgroup all \
|
||||||
|
--min-frac 0.5 \
|
||||||
|
--max-frac 1.0 \
|
||||||
|
--max-outgroup-count 0 \
|
||||||
|
"${SOURCE}" \
|
||||||
|
2>"${LOG_FILTER}"
|
||||||
|
|
||||||
|
cat "${LOG_FILTER}" >&2
|
||||||
|
|
||||||
|
"${BINARY}" select \
|
||||||
|
--in-place \
|
||||||
|
--group "${SPECIES}:species=${SPECIES}" \
|
||||||
|
--group-op "${SPECIES}:any" \
|
||||||
|
--select "${SPECIES}" \
|
||||||
|
"${OUTPUT}" \
|
||||||
|
2>"${LOG_SELECT}"
|
||||||
|
|
||||||
|
cat "${LOG_SELECT}" >&2
|
||||||
|
|
||||||
|
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
|
||||||
|
import sys, re
|
||||||
|
|
||||||
|
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
|
||||||
|
|
||||||
|
def strip_ansi(s):
|
||||||
|
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
|
||||||
|
|
||||||
|
def parse_wall(s):
|
||||||
|
s = s.strip()
|
||||||
|
if s.endswith('ms'): return float(s[:-2]) / 1000.0
|
||||||
|
if s.endswith('s'): return float(s[:-1])
|
||||||
|
return 0.0
|
||||||
|
|
||||||
|
def parse_rss(s):
|
||||||
|
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
|
||||||
|
if not m: return 0
|
||||||
|
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
|
||||||
|
|
||||||
|
def is_sep(s):
|
||||||
|
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
|
||||||
|
|
||||||
|
def parse_reporter(logfile):
|
||||||
|
stats = {}
|
||||||
|
state = 'scan'
|
||||||
|
with open(logfile, errors='replace') as fh:
|
||||||
|
for raw in fh:
|
||||||
|
line = strip_ansi(raw.rstrip('\n'))
|
||||||
|
s = line.strip()
|
||||||
|
if state == 'scan':
|
||||||
|
if re.search(r'\bstage\b.*\bwall\b', line):
|
||||||
|
state = 'in_header'
|
||||||
|
elif state == 'in_header':
|
||||||
|
if is_sep(s): state = 'rows'
|
||||||
|
elif state == 'rows':
|
||||||
|
if is_sep(s): state = 'total'
|
||||||
|
elif s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 4:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
|
||||||
|
elif state == 'total':
|
||||||
|
if s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 3:
|
||||||
|
stats['TOTAL'] = (parse_wall(parts[1]),
|
||||||
|
parse_rss(parts[3]) if len(parts) > 3 else 0)
|
||||||
|
break
|
||||||
|
return stats
|
||||||
|
|
||||||
|
f = parse_reporter(log_filter)
|
||||||
|
s = parse_reporter(log_select)
|
||||||
|
|
||||||
|
row = [species]
|
||||||
|
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
|
||||||
|
key = 'TOTAL' if stage.endswith('_total') else stage
|
||||||
|
w, r = d.get(key, ('', ''))
|
||||||
|
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
|
||||||
|
print(','.join(row))
|
||||||
|
PYEOF
|
||||||
Executable
+108
@@ -0,0 +1,108 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Usage: filter_one_presence.sh SPECIES
|
||||||
|
# Filters global_index_presence to keep only kmers specific to SPECIES,
|
||||||
|
# then selects the SPECIES column in-place.
|
||||||
|
# Outputs:
|
||||||
|
# specific_index_presence/SPECIES/index.done (written by obikmer select)
|
||||||
|
# stats/specific_kmer_presence/SPECIES.stats (one CSV data row, no header)
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SPECIES="$1"
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
|
||||||
|
SOURCE="${SCRIPT_DIR}/global_index_presence"
|
||||||
|
OUTPUT="${SCRIPT_DIR}/specific_index_presence/${SPECIES}"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_presence"
|
||||||
|
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
echo "[${SPECIES}] filter (presence) → ${OUTPUT}"
|
||||||
|
|
||||||
|
LOG_FILTER=$(mktemp)
|
||||||
|
LOG_SELECT=$(mktemp)
|
||||||
|
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
|
||||||
|
|
||||||
|
"${BINARY}" filter \
|
||||||
|
--output "${OUTPUT}" \
|
||||||
|
--force \
|
||||||
|
--ingroup "species=${SPECIES}" \
|
||||||
|
--outgroup all \
|
||||||
|
--min-frac 0.5 \
|
||||||
|
--max-frac 1.0 \
|
||||||
|
--max-outgroup-count 0 \
|
||||||
|
"${SOURCE}" \
|
||||||
|
2>"${LOG_FILTER}"
|
||||||
|
|
||||||
|
cat "${LOG_FILTER}" >&2
|
||||||
|
|
||||||
|
"${BINARY}" select \
|
||||||
|
--in-place \
|
||||||
|
--group "${SPECIES}:species=${SPECIES}" \
|
||||||
|
--group-op "${SPECIES}:any" \
|
||||||
|
--select "${SPECIES}" \
|
||||||
|
"${OUTPUT}" \
|
||||||
|
2>"${LOG_SELECT}"
|
||||||
|
|
||||||
|
cat "${LOG_SELECT}" >&2
|
||||||
|
|
||||||
|
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
|
||||||
|
import sys, re
|
||||||
|
|
||||||
|
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
|
||||||
|
|
||||||
|
def strip_ansi(s):
|
||||||
|
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
|
||||||
|
|
||||||
|
def parse_wall(s):
|
||||||
|
s = s.strip()
|
||||||
|
if s.endswith('ms'): return float(s[:-2]) / 1000.0
|
||||||
|
if s.endswith('s'): return float(s[:-1])
|
||||||
|
return 0.0
|
||||||
|
|
||||||
|
def parse_rss(s):
|
||||||
|
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
|
||||||
|
if not m: return 0
|
||||||
|
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
|
||||||
|
|
||||||
|
def is_sep(s):
|
||||||
|
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
|
||||||
|
|
||||||
|
def parse_reporter(logfile):
|
||||||
|
stats = {}
|
||||||
|
state = 'scan'
|
||||||
|
with open(logfile, errors='replace') as fh:
|
||||||
|
for raw in fh:
|
||||||
|
line = strip_ansi(raw.rstrip('\n'))
|
||||||
|
s = line.strip()
|
||||||
|
if state == 'scan':
|
||||||
|
if re.search(r'\bstage\b.*\bwall\b', line):
|
||||||
|
state = 'in_header'
|
||||||
|
elif state == 'in_header':
|
||||||
|
if is_sep(s): state = 'rows'
|
||||||
|
elif state == 'rows':
|
||||||
|
if is_sep(s): state = 'total'
|
||||||
|
elif s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 4:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
|
||||||
|
elif state == 'total':
|
||||||
|
if s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 3:
|
||||||
|
stats['TOTAL'] = (parse_wall(parts[1]),
|
||||||
|
parse_rss(parts[3]) if len(parts) > 3 else 0)
|
||||||
|
break
|
||||||
|
return stats
|
||||||
|
|
||||||
|
f = parse_reporter(log_filter)
|
||||||
|
s = parse_reporter(log_select)
|
||||||
|
|
||||||
|
row = [species]
|
||||||
|
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
|
||||||
|
key = 'TOTAL' if stage.endswith('_total') else stage
|
||||||
|
w, r = d.get(key, ('', ''))
|
||||||
|
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
|
||||||
|
print(','.join(row))
|
||||||
|
PYEOF
|
||||||
Executable
+103
@@ -0,0 +1,103 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Usage: index_one_count.sh SPECIMEN
|
||||||
|
# SPECIMEN = "species--strain" (Make pattern stem)
|
||||||
|
# Outputs:
|
||||||
|
# specimen_index_count/SPECIMEN/index.done (written by obikmer)
|
||||||
|
# stats/indexing_count/SPECIMEN.stats (one CSV data row, no header)
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SPECIMEN="$1"
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
|
||||||
|
species="${SPECIMEN%%--*}"
|
||||||
|
strain="${SPECIMEN#*--}"
|
||||||
|
|
||||||
|
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
|
||||||
|
INDEX_PATH="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/indexing_count"
|
||||||
|
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
r1="${READS_DIR}/reads_R1.fastq.gz"
|
||||||
|
r2="${READS_DIR}/reads_R2.fastq.gz"
|
||||||
|
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
|
||||||
|
echo "ERROR: reads not found in ${READS_DIR}" >&2
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
|
||||||
|
echo "[${SPECIMEN}] indexing (count) → ${INDEX_PATH}"
|
||||||
|
|
||||||
|
STDERR_LOG=$(mktemp)
|
||||||
|
trap 'rm -f "${STDERR_LOG}"' EXIT
|
||||||
|
|
||||||
|
"${BINARY}" index \
|
||||||
|
--output "${INDEX_PATH}" \
|
||||||
|
--force \
|
||||||
|
--theta 0 \
|
||||||
|
--with-counts \
|
||||||
|
--label "${SPECIMEN}" \
|
||||||
|
--meta "species=${species}" \
|
||||||
|
"${r1}" "${r2}" \
|
||||||
|
2>"${STDERR_LOG}"
|
||||||
|
|
||||||
|
cat "${STDERR_LOG}" >&2
|
||||||
|
|
||||||
|
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
|
||||||
|
import sys, re
|
||||||
|
|
||||||
|
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
|
||||||
|
|
||||||
|
def strip_ansi(s):
|
||||||
|
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
|
||||||
|
|
||||||
|
def parse_wall(s):
|
||||||
|
s = s.strip()
|
||||||
|
if s.endswith('ms'): return float(s[:-2]) / 1000.0
|
||||||
|
if s.endswith('s'): return float(s[:-1])
|
||||||
|
return 0.0
|
||||||
|
|
||||||
|
def parse_rss(s):
|
||||||
|
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
|
||||||
|
if not m: return 0
|
||||||
|
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
|
||||||
|
|
||||||
|
def is_sep(s):
|
||||||
|
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
|
||||||
|
|
||||||
|
stats = {}
|
||||||
|
state = 'scan'
|
||||||
|
|
||||||
|
with open(logfile, errors='replace') as fh:
|
||||||
|
for raw in fh:
|
||||||
|
line = strip_ansi(raw.rstrip('\n'))
|
||||||
|
s = line.strip()
|
||||||
|
if state == 'scan':
|
||||||
|
if re.search(r'\bstage\b.*\bwall\b', line):
|
||||||
|
state = 'in_header'
|
||||||
|
elif state == 'in_header':
|
||||||
|
if is_sep(s): state = 'rows'
|
||||||
|
elif state == 'rows':
|
||||||
|
if is_sep(s): state = 'total'
|
||||||
|
elif s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 4:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
|
||||||
|
elif state == 'total':
|
||||||
|
if s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 3:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]),
|
||||||
|
parse_rss(parts[3]) if len(parts) > 3 else 0)
|
||||||
|
break
|
||||||
|
|
||||||
|
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
|
||||||
|
row = [species, strain]
|
||||||
|
for stage in STAGE_ORDER:
|
||||||
|
w, r = stats.get(stage, ('', ''))
|
||||||
|
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
|
||||||
|
tw, tr = stats.get('TOTAL', ('', ''))
|
||||||
|
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
|
||||||
|
print(','.join(row))
|
||||||
|
PYEOF
|
||||||
Executable
+102
@@ -0,0 +1,102 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Usage: index_one_presence.sh SPECIMEN
|
||||||
|
# SPECIMEN = "species--strain" (Make pattern stem)
|
||||||
|
# Outputs:
|
||||||
|
# specimen_index_presence/SPECIMEN/index.done (written by obikmer)
|
||||||
|
# stats/indexing_presence/SPECIMEN.stats (one CSV data row, no header)
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SPECIMEN="$1"
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
|
||||||
|
species="${SPECIMEN%%--*}"
|
||||||
|
strain="${SPECIMEN#*--}"
|
||||||
|
|
||||||
|
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
|
||||||
|
INDEX_PATH="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/indexing_presence"
|
||||||
|
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
r1="${READS_DIR}/reads_R1.fastq.gz"
|
||||||
|
r2="${READS_DIR}/reads_R2.fastq.gz"
|
||||||
|
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
|
||||||
|
echo "ERROR: reads not found in ${READS_DIR}" >&2
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
|
||||||
|
echo "[${SPECIMEN}] indexing (presence) → ${INDEX_PATH}"
|
||||||
|
|
||||||
|
STDERR_LOG=$(mktemp)
|
||||||
|
trap 'rm -f "${STDERR_LOG}"' EXIT
|
||||||
|
|
||||||
|
"${BINARY}" index \
|
||||||
|
--output "${INDEX_PATH}" \
|
||||||
|
--force \
|
||||||
|
--theta 0 \
|
||||||
|
--label "${SPECIMEN}" \
|
||||||
|
--meta "species=${species}" \
|
||||||
|
"${r1}" "${r2}" \
|
||||||
|
2>"${STDERR_LOG}"
|
||||||
|
|
||||||
|
cat "${STDERR_LOG}" >&2
|
||||||
|
|
||||||
|
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
|
||||||
|
import sys, re
|
||||||
|
|
||||||
|
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
|
||||||
|
|
||||||
|
def strip_ansi(s):
|
||||||
|
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
|
||||||
|
|
||||||
|
def parse_wall(s):
|
||||||
|
s = s.strip()
|
||||||
|
if s.endswith('ms'): return float(s[:-2]) / 1000.0
|
||||||
|
if s.endswith('s'): return float(s[:-1])
|
||||||
|
return 0.0
|
||||||
|
|
||||||
|
def parse_rss(s):
|
||||||
|
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
|
||||||
|
if not m: return 0
|
||||||
|
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
|
||||||
|
|
||||||
|
def is_sep(s):
|
||||||
|
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
|
||||||
|
|
||||||
|
stats = {}
|
||||||
|
state = 'scan'
|
||||||
|
|
||||||
|
with open(logfile, errors='replace') as fh:
|
||||||
|
for raw in fh:
|
||||||
|
line = strip_ansi(raw.rstrip('\n'))
|
||||||
|
s = line.strip()
|
||||||
|
if state == 'scan':
|
||||||
|
if re.search(r'\bstage\b.*\bwall\b', line):
|
||||||
|
state = 'in_header'
|
||||||
|
elif state == 'in_header':
|
||||||
|
if is_sep(s): state = 'rows'
|
||||||
|
elif state == 'rows':
|
||||||
|
if is_sep(s): state = 'total'
|
||||||
|
elif s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 4:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
|
||||||
|
elif state == 'total':
|
||||||
|
if s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 3:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]),
|
||||||
|
parse_rss(parts[3]) if len(parts) > 3 else 0)
|
||||||
|
break
|
||||||
|
|
||||||
|
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
|
||||||
|
row = [species, strain]
|
||||||
|
for stage in STAGE_ORDER:
|
||||||
|
w, r = stats.get(stage, ('', ''))
|
||||||
|
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
|
||||||
|
tw, tr = stats.get('TOTAL', ('', ''))
|
||||||
|
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
|
||||||
|
print(','.join(row))
|
||||||
|
PYEOF
|
||||||
@@ -0,0 +1,118 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""Generate deps.mk — pure dependency declarations for the benchmark pipeline.
|
||||||
|
|
||||||
|
Like C .d files: only target: prerequisites lines, no recipes.
|
||||||
|
Recipes stay in the Makefile as generic rules.
|
||||||
|
"""
|
||||||
|
import gzip
|
||||||
|
import re
|
||||||
|
import sys
|
||||||
|
from pathlib import Path
|
||||||
|
|
||||||
|
STOP_WORDS = {'complete', 'chromosome', 'whole', 'sequence', 'genome',
|
||||||
|
'endosymbiont', 'of'}
|
||||||
|
STOP_PREFIXES = ('scaffold', 'contig', 'plasmid')
|
||||||
|
|
||||||
|
|
||||||
|
def is_stop(tok):
|
||||||
|
t = tok.lower()
|
||||||
|
return t in STOP_WORDS or any(t.startswith(p) for p in STOP_PREFIXES)
|
||||||
|
|
||||||
|
|
||||||
|
def sanitize(s):
|
||||||
|
return re.sub(r'[^A-Za-z0-9._-]', '_', s).strip('_')
|
||||||
|
|
||||||
|
|
||||||
|
def collect_tokens(text):
|
||||||
|
parts = []
|
||||||
|
for tok in text.split():
|
||||||
|
tok = tok.rstrip(',.')
|
||||||
|
if is_stop(tok):
|
||||||
|
break
|
||||||
|
parts.append(sanitize(tok))
|
||||||
|
return '_'.join(filter(None, parts))
|
||||||
|
|
||||||
|
|
||||||
|
def parse_organism(defn, gcf_id):
|
||||||
|
words = defn.split()
|
||||||
|
species = sanitize(words[0] + '_' + words[1])
|
||||||
|
|
||||||
|
m = re.search(r'\bstr\.\s+(\S+)(?:\s+substr\.\s+(\S+))?', defn)
|
||||||
|
if m:
|
||||||
|
strain = sanitize(m.group(1))
|
||||||
|
if m.group(2):
|
||||||
|
strain += '_' + sanitize(m.group(2))
|
||||||
|
return species, strain
|
||||||
|
|
||||||
|
m = re.search(r'\bstrain\b\s+(.*)', defn)
|
||||||
|
if m:
|
||||||
|
strain = collect_tokens(m.group(1))
|
||||||
|
if strain:
|
||||||
|
return species, strain
|
||||||
|
|
||||||
|
remainder = re.sub(r'^\S+ \S+\s*', '', defn)
|
||||||
|
remainder = re.sub(r'^subsp\.\s+\S+\s*', '', remainder)
|
||||||
|
remainder = re.sub(r'^serovar\s+\S+\s*', '', remainder)
|
||||||
|
strain = collect_tokens(remainder)
|
||||||
|
return species, strain if strain else gcf_id
|
||||||
|
|
||||||
|
|
||||||
|
def first_definition(path):
|
||||||
|
with gzip.open(path, 'rt') as fh:
|
||||||
|
for line in fh:
|
||||||
|
if line.startswith('>'):
|
||||||
|
m = re.search(r'"definition":"([^"]*)"', line)
|
||||||
|
return m.group(1) if m else line[1:].split()[0]
|
||||||
|
return Path(path).stem
|
||||||
|
|
||||||
|
|
||||||
|
def main():
|
||||||
|
entries = [] # (specimen, species, sim_dir, genome_path)
|
||||||
|
species_seen = []
|
||||||
|
|
||||||
|
for path in sorted(sys.argv[1:]):
|
||||||
|
gcf_id = Path(path).name.replace('_genomic.fna.gz', '')
|
||||||
|
defn = first_definition(path)
|
||||||
|
sp, st = parse_organism(defn, gcf_id)
|
||||||
|
specimen = f'{sp}--{st}'
|
||||||
|
sim_dir = f'simulated_data/{sp}/{st}'
|
||||||
|
entries.append((specimen, sp, sim_dir, path))
|
||||||
|
if sp not in species_seen:
|
||||||
|
species_seen.append(sp)
|
||||||
|
|
||||||
|
specimens = [e[0] for e in entries]
|
||||||
|
print('SPECIMENS :=', ' '.join(specimens))
|
||||||
|
print('SPECIES :=', ' '.join(species_seen))
|
||||||
|
|
||||||
|
for specimen, species, sim_dir, genome in entries:
|
||||||
|
reads = f'{sim_dir}/reads_R1.fastq.gz'
|
||||||
|
p_done = f'specimen_index_presence/{specimen}/index.done'
|
||||||
|
p_stats = f'stats/indexing_presence/{specimen}.stats'
|
||||||
|
c_done = f'specimen_index_count/{specimen}/index.done'
|
||||||
|
c_stats = f'stats/indexing_count/{specimen}.stats'
|
||||||
|
ref = f'reference_index/{specimen}.npz'
|
||||||
|
vp = f'stats/verify_presence/{specimen}.stats'
|
||||||
|
vc = f'stats/verify_count/{specimen}.stats'
|
||||||
|
|
||||||
|
print()
|
||||||
|
print(f'# {specimen}')
|
||||||
|
print(f'{reads}: {genome}')
|
||||||
|
print(f'{ref}: {reads}')
|
||||||
|
print(f'{p_done} {p_stats}: {reads}')
|
||||||
|
print(f'{c_done} {c_stats}: {reads}')
|
||||||
|
print(f'{vp}: {ref} {p_done}')
|
||||||
|
print(f'{vc}: {ref} {c_done}')
|
||||||
|
|
||||||
|
print()
|
||||||
|
for sp in species_seen:
|
||||||
|
sp_done = f'specific_index_presence/{sp}/index.done'
|
||||||
|
sp_stats = f'stats/specific_kmer_presence/{sp}.stats'
|
||||||
|
sc_done = f'specific_index_count/{sp}/index.done'
|
||||||
|
sc_stats = f'stats/specific_kmer_count/{sp}.stats'
|
||||||
|
print(f'# {sp}')
|
||||||
|
print(f'{sp_done} {sp_stats}: global_index_presence/index.done')
|
||||||
|
print(f'{sc_done} {sc_stats}: global_index_count/index.done')
|
||||||
|
|
||||||
|
|
||||||
|
if __name__ == '__main__':
|
||||||
|
main()
|
||||||
Executable
+103
@@ -0,0 +1,103 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
IDX_DIR="${SCRIPT_DIR}/specimen_index_count"
|
||||||
|
OUTPUT="${SCRIPT_DIR}/global_index_count"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/merge_count"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
|
||||||
|
CSV="${STATS_DIR}/run_${run_n}.csv"
|
||||||
|
|
||||||
|
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
|
||||||
|
|
||||||
|
parse_reporter() {
|
||||||
|
local run="$1" n_sources="$2" logfile="$3"
|
||||||
|
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
|
||||||
|
import sys, re
|
||||||
|
|
||||||
|
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
|
||||||
|
|
||||||
|
def strip_ansi(s):
|
||||||
|
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
|
||||||
|
|
||||||
|
def parse_wall(s):
|
||||||
|
s = s.strip()
|
||||||
|
if s.endswith('ms'): return float(s[:-2]) / 1000.0
|
||||||
|
if s.endswith('s'): return float(s[:-1])
|
||||||
|
return 0.0
|
||||||
|
|
||||||
|
def parse_rss(s):
|
||||||
|
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
|
||||||
|
if not m: return 0
|
||||||
|
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
|
||||||
|
|
||||||
|
def is_sep(s):
|
||||||
|
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
|
||||||
|
|
||||||
|
stats = {}
|
||||||
|
state = 'scan'
|
||||||
|
|
||||||
|
with open(logfile, errors='replace') as fh:
|
||||||
|
for raw in fh:
|
||||||
|
line = strip_ansi(raw.rstrip('\n'))
|
||||||
|
s = line.strip()
|
||||||
|
|
||||||
|
if state == 'scan':
|
||||||
|
if re.search(r'\bstage\b.*\bwall\b', line):
|
||||||
|
state = 'in_header'
|
||||||
|
elif state == 'in_header':
|
||||||
|
if is_sep(s):
|
||||||
|
state = 'rows'
|
||||||
|
elif state == 'rows':
|
||||||
|
if is_sep(s):
|
||||||
|
state = 'total'
|
||||||
|
elif s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 4:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
|
||||||
|
elif state == 'total':
|
||||||
|
if s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 3:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]),
|
||||||
|
parse_rss(parts[3]) if len(parts) > 3 else 0)
|
||||||
|
break
|
||||||
|
|
||||||
|
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
|
||||||
|
row = [run, n_sources]
|
||||||
|
for stage in STAGE_ORDER:
|
||||||
|
w, r = stats.get(stage, ('', ''))
|
||||||
|
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
|
||||||
|
tw, tr = stats.get('TOTAL', ('', ''))
|
||||||
|
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
|
||||||
|
print(','.join(row))
|
||||||
|
PYEOF
|
||||||
|
}
|
||||||
|
|
||||||
|
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
|
||||||
|
|
||||||
|
if [[ ${#sources[@]} -eq 0 ]]; then
|
||||||
|
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
|
||||||
|
echo "Merging ${#sources[@]} count indexes → ${OUTPUT}"
|
||||||
|
printf ' %s\n' "${sources[@]}"
|
||||||
|
|
||||||
|
STDERR_LOG=$(mktemp)
|
||||||
|
trap 'rm -f "${STDERR_LOG}"' EXIT
|
||||||
|
|
||||||
|
"${BINARY}" merge \
|
||||||
|
--output "${OUTPUT}" \
|
||||||
|
--force \
|
||||||
|
"${sources[@]}" \
|
||||||
|
2>"${STDERR_LOG}"
|
||||||
|
|
||||||
|
cat "${STDERR_LOG}" >&2
|
||||||
|
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
|
||||||
|
|
||||||
|
echo "Done. Run ${run_n} → ${CSV}"
|
||||||
Executable
+104
@@ -0,0 +1,104 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
IDX_DIR="${SCRIPT_DIR}/specimen_index_presence"
|
||||||
|
OUTPUT="${SCRIPT_DIR}/global_index_presence"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/merge_presence"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
|
||||||
|
CSV="${STATS_DIR}/run_${run_n}.csv"
|
||||||
|
|
||||||
|
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
|
||||||
|
|
||||||
|
parse_reporter() {
|
||||||
|
local run="$1" n_sources="$2" logfile="$3"
|
||||||
|
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
|
||||||
|
import sys, re
|
||||||
|
|
||||||
|
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
|
||||||
|
|
||||||
|
def strip_ansi(s):
|
||||||
|
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
|
||||||
|
|
||||||
|
def parse_wall(s):
|
||||||
|
s = s.strip()
|
||||||
|
if s.endswith('ms'): return float(s[:-2]) / 1000.0
|
||||||
|
if s.endswith('s'): return float(s[:-1])
|
||||||
|
return 0.0
|
||||||
|
|
||||||
|
def parse_rss(s):
|
||||||
|
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
|
||||||
|
if not m: return 0
|
||||||
|
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
|
||||||
|
|
||||||
|
def is_sep(s):
|
||||||
|
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
|
||||||
|
|
||||||
|
stats = {}
|
||||||
|
state = 'scan'
|
||||||
|
|
||||||
|
with open(logfile, errors='replace') as fh:
|
||||||
|
for raw in fh:
|
||||||
|
line = strip_ansi(raw.rstrip('\n'))
|
||||||
|
s = line.strip()
|
||||||
|
|
||||||
|
if state == 'scan':
|
||||||
|
if re.search(r'\bstage\b.*\bwall\b', line):
|
||||||
|
state = 'in_header'
|
||||||
|
elif state == 'in_header':
|
||||||
|
if is_sep(s):
|
||||||
|
state = 'rows'
|
||||||
|
elif state == 'rows':
|
||||||
|
if is_sep(s):
|
||||||
|
state = 'total'
|
||||||
|
elif s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 4:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
|
||||||
|
elif state == 'total':
|
||||||
|
if s:
|
||||||
|
parts = re.split(r' +', s)
|
||||||
|
if len(parts) >= 3:
|
||||||
|
stats[parts[0]] = (parse_wall(parts[1]),
|
||||||
|
parse_rss(parts[3]) if len(parts) > 3 else 0)
|
||||||
|
break
|
||||||
|
|
||||||
|
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
|
||||||
|
row = [run, n_sources]
|
||||||
|
for stage in STAGE_ORDER:
|
||||||
|
w, r = stats.get(stage, ('', ''))
|
||||||
|
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
|
||||||
|
tw, tr = stats.get('TOTAL', ('', ''))
|
||||||
|
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
|
||||||
|
print(','.join(row))
|
||||||
|
PYEOF
|
||||||
|
}
|
||||||
|
|
||||||
|
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
|
||||||
|
|
||||||
|
if [[ ${#sources[@]} -eq 0 ]]; then
|
||||||
|
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
|
||||||
|
echo "Merging ${#sources[@]} presence indexes → ${OUTPUT}"
|
||||||
|
printf ' %s\n' "${sources[@]}"
|
||||||
|
|
||||||
|
STDERR_LOG=$(mktemp)
|
||||||
|
trap 'rm -f "${STDERR_LOG}"' EXIT
|
||||||
|
|
||||||
|
"${BINARY}" merge \
|
||||||
|
--output "${OUTPUT}" \
|
||||||
|
--force \
|
||||||
|
--force-presence \
|
||||||
|
"${sources[@]}" \
|
||||||
|
2>"${STDERR_LOG}"
|
||||||
|
|
||||||
|
cat "${STDERR_LOG}" >&2
|
||||||
|
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
|
||||||
|
|
||||||
|
echo "Done. Run ${run_n} → ${CSV}"
|
||||||
Executable
+12
@@ -0,0 +1,12 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Simulate all genomes. Delegates to simulate_one.sh per genome.
|
||||||
|
# Prefer running via `gmake simulate` which handles individual dependencies.
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
|
||||||
|
for genome_file in "${SCRIPT_DIR}"/genomes/*.fna.gz; do
|
||||||
|
out_dir=$("${SCRIPT_DIR}/../.venv/bin/python3" "${SCRIPT_DIR}/make_deps.py" \
|
||||||
|
--dir-for "${genome_file}")
|
||||||
|
bash "${SCRIPT_DIR}/simulate_one.sh" "${genome_file}" "${out_dir}"
|
||||||
|
done
|
||||||
@@ -0,0 +1,33 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Usage: simulate_one.sh genome.fna.gz output_dir
|
||||||
|
# Simulates paired-end HiSeq reads for a single genome.
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
ISS="${SCRIPT_DIR}/../.venv/bin/iss"
|
||||||
|
COVERAGE=15
|
||||||
|
READ_LENGTH=150
|
||||||
|
CPUS="${CPUS:-$(sysctl -n hw.logicalcpu 2>/dev/null || nproc 2>/dev/null || echo 2)}"
|
||||||
|
|
||||||
|
genome_file="$1"
|
||||||
|
out_dir="$2"
|
||||||
|
|
||||||
|
mkdir -p "${out_dir}"
|
||||||
|
|
||||||
|
tmp_fasta=$(mktemp "${TMPDIR:-/tmp}/obikmer_XXXXXX.fna")
|
||||||
|
trap 'rm -f "${tmp_fasta}"' EXIT
|
||||||
|
|
||||||
|
gzip -dc "${genome_file}" > "${tmp_fasta}"
|
||||||
|
|
||||||
|
genome_size=$(grep -v "^>" "${tmp_fasta}" | tr -d '[:space:]' | wc -c | tr -d ' ')
|
||||||
|
n_reads=$(python3 -c "import math; print(math.ceil(${COVERAGE} * ${genome_size} / (2 * ${READ_LENGTH})))")
|
||||||
|
|
||||||
|
echo "[${out_dir}] genome=${genome_size} bp → ${n_reads} read pairs (${COVERAGE}x HiSeq)"
|
||||||
|
|
||||||
|
"${ISS}" generate \
|
||||||
|
--genomes "${tmp_fasta}" \
|
||||||
|
--model HiSeq \
|
||||||
|
--n_reads "${n_reads}" \
|
||||||
|
--cpus "${CPUS}" \
|
||||||
|
--compress \
|
||||||
|
--output "${out_dir}/reads"
|
||||||
@@ -0,0 +1,21 @@
|
|||||||
|
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
|
||||||
|
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
|
||||||
|
Acidobacterium_capsulatum--ATCC_51196,1.000000,0.000000,0.999981,0.999990,0.999989,0.999987,0.999987,0.999990,0.999988,0.999988,0.999994,0.999989,1.000000,0.999988,0.999987,0.999987,0.999988,0.999989,0.999991,0.999987
|
||||||
|
Bacillus_subtilis--168,1.000000,0.999981,0.000000,0.999990,0.999989,0.999989,0.999989,0.999989,0.999988,0.999986,0.999995,0.999985,0.999999,0.999988,0.999987,0.999989,0.999988,0.999778,0.999993,0.999987
|
||||||
|
Escherichia_coli--CFT073,1.000000,0.999990,0.999990,0.000000,0.825741,0.807495,0.807218,0.991156,0.996855,0.997849,0.999996,0.999633,1.000000,0.993885,0.996736,0.994148,0.993821,0.999991,0.999984,0.999291
|
||||||
|
Escherichia_coli--EDL933,1.000000,0.999989,0.999989,0.825741,0.000000,0.735107,0.734775,0.996126,0.998058,0.997908,0.999997,0.999640,1.000000,0.993993,0.997126,0.994390,0.994059,0.999991,0.999986,0.999292
|
||||||
|
Escherichia_coli--K-12_MG1655,1.000000,0.999987,0.999989,0.807495,0.735107,0.000000,0.382567,0.996190,0.997747,0.997455,0.999996,0.999604,1.000000,0.993444,0.996645,0.993773,0.993431,0.999989,0.999984,0.999174
|
||||||
|
Escherichia_coli--K-12_W3110,1.000000,0.999987,0.999989,0.807218,0.734775,0.382567,0.000000,0.996220,0.997761,0.997467,0.999995,0.999604,1.000000,0.993445,0.996669,0.993769,0.993443,0.999990,0.999985,0.999165
|
||||||
|
Klebsiella_pneumoniae--ATCC_13883,1.000000,0.999990,0.999989,0.991156,0.996126,0.996190,0.996220,0.000000,0.845220,0.840545,0.999997,0.999648,1.000000,0.996177,0.998128,0.996268,0.996052,0.999990,0.999987,0.999325
|
||||||
|
Klebsiella_pneumoniae--HS11286,1.000000,0.999988,0.999988,0.996855,0.998058,0.997747,0.997761,0.845220,0.000000,0.906475,0.999996,0.999683,1.000000,0.997724,0.995697,0.997776,0.997769,0.999989,0.999979,0.999463
|
||||||
|
Klebsiella_pneumoniae--MGH_78578,1.000000,0.999988,0.999986,0.997849,0.997908,0.997455,0.997467,0.840545,0.906475,0.000000,0.999996,0.999704,1.000000,0.997928,0.995054,0.997844,0.997868,0.999990,0.999980,0.999479
|
||||||
|
Opitutus_terrae--PB90-1,1.000000,0.999994,0.999995,0.999996,0.999997,0.999996,0.999995,0.999997,0.999996,0.999996,0.000000,0.999997,0.999998,0.999996,0.999996,0.999996,0.999995,0.999997,0.999993,0.999996
|
||||||
|
Proteus_mirabilis--HI4320,1.000000,0.999989,0.999985,0.999633,0.999640,0.999604,0.999604,0.999648,0.999683,0.999704,0.999997,0.000000,1.000000,0.999604,0.999699,0.999622,0.999613,0.999987,0.999983,0.999505
|
||||||
|
Saccharolobus_islandicus--M.16.4,1.000000,1.000000,0.999999,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,0.999998,1.000000,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
|
||||||
|
Salmonella_enterica--AKU_12601,1.000000,0.999988,0.999988,0.993885,0.993993,0.993444,0.993445,0.996177,0.997724,0.997928,0.999996,0.999604,1.000000,0.000000,0.869238,0.682277,0.663383,0.999990,0.999985,0.999260
|
||||||
|
Salmonella_enterica--CT18,1.000000,0.999987,0.999987,0.996736,0.997126,0.996645,0.996669,0.998128,0.995697,0.995054,0.999996,0.999699,1.000000,0.869238,0.000000,0.890872,0.886148,0.999988,0.999976,0.999524
|
||||||
|
Salmonella_enterica--LT2,1.000000,0.999987,0.999989,0.994148,0.994390,0.993773,0.993769,0.996268,0.997776,0.997844,0.999996,0.999622,1.000000,0.682277,0.890872,0.000000,0.622606,0.999989,0.999985,0.999296
|
||||||
|
Salmonella_enterica--P125109,1.000000,0.999988,0.999988,0.993821,0.994059,0.993431,0.993443,0.996052,0.997769,0.997868,0.999995,0.999613,1.000000,0.663383,0.886148,0.622606,0.000000,0.999988,0.999983,0.999270
|
||||||
|
Shouchella_clausii--KSM-K16,1.000000,0.999989,0.999778,0.999991,0.999991,0.999989,0.999990,0.999990,0.999989,0.999990,0.999997,0.999987,1.000000,0.999990,0.999988,0.999989,0.999988,0.000000,0.999991,0.999988
|
||||||
|
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,1.000000,0.999991,0.999993,0.999984,0.999986,0.999984,0.999985,0.999987,0.999979,0.999980,0.999993,0.999983,1.000000,0.999985,0.999976,0.999985,0.999983,0.999991,0.000000,0.999983
|
||||||
|
Yersinia_ruckeri--YRB,1.000000,0.999987,0.999987,0.999291,0.999292,0.999174,0.999165,0.999325,0.999463,0.999479,0.999996,0.999505,1.000000,0.999260,0.999524,0.999296,0.999270,0.999988,0.999983,0.000000
|
||||||
|
@@ -0,0 +1 @@
|
|||||||
|
(((((((((((Candidozyma_auris--GCF_003013715.1_ASM301371v2:0.5000001881725941,Saccharolobus_islandicus--M.16.4:0.4999993211600824):0.0000023411501775538747,Opitutus_terrae--PB90-1:0.499997075187947):0.0000029791191795691675,(Acidobacterium_capsulatum--ATCC_51196:0.49999227771334689,(Bacillus_subtilis--168:0.49988797935621456,Shouchella_clausii--KSM-K16:0.49988984146059159):0.0001037210285571577):0.0000023959836053522034):0.0000034093646568700288,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1:0.4999920159222422):0.000199555100890203,Proteus_mirabilis--HI4320:0.49979129185300427):0.00010103619067070024,Yersinia_ruckeri--YRB:0.4996806650749249):0.0013719139155004,(Klebsiella_pneumoniae--HS11286:0.43798845051648258,(Klebsiella_pneumoniae--ATCC_13883:0.41780293826821265,Klebsiella_pneumoniae--MGH_78578:0.42274184870836559):0.017586732339732737):0.0604124197073832):0.0006482538063555254,(Salmonella_enterica--CT18:0.43952894448143017,(Salmonella_enterica--AKU_12601:0.3357977326267918,(Salmonella_enterica--LT2:0.31203395843666389,Salmonella_enterica--P125109:0.31057217324861216):0.025729515856701136):0.10292985918524672):0.05825411485542886):0.08937928015651564,Escherichia_coli--CFT073:0.40806501650701029):0.0410131211869626,Escherichia_coli--EDL933:0.3681464750911808):0.1755112579711463,Escherichia_coli--K-12_MG1655:0.19129818036662728,Escherichia_coli--K-12_W3110:0.19126872019906239);
|
||||||
@@ -0,0 +1,21 @@
|
|||||||
|
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
|
||||||
|
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0,0,0,0,0,0,0,0,0,0,0,0,8,0,1,0,0,0,0,3
|
||||||
|
Acidobacterium_capsulatum--ATCC_51196,0,0,203,119,128,141,140,116,109,111,78,112,0,136,109,147,134,117,55,129
|
||||||
|
Bacillus_subtilis--168,0,203,0,124,132,128,123,133,109,130,66,158,6,131,112,124,135,2393,46,124
|
||||||
|
Escherichia_coli--CFT073,0,119,124,0,1966777,1998059,1999094,117743,32029,22312,63,4225,0,74946,31918,73311,76585,113,128,7854
|
||||||
|
Escherichia_coli--EDL933,0,128,132,1966777,0,2627885,2628700,52488,20134,22064,48,4202,0,74655,28602,71244,74665,112,108,7963
|
||||||
|
Escherichia_coli--K-12_MG1655,0,141,128,1998059,2627885,0,4452541,48302,21382,24602,47,4277,0,75729,30449,73622,76778,119,111,8566
|
||||||
|
Escherichia_coli--K-12_W3110,0,140,123,1999094,2628700,4452541,0,47894,21226,24470,68,4278,0,75658,30207,73614,76583,112,108,8660
|
||||||
|
Klebsiella_pneumoniae--ATCC_13883,0,116,133,117743,52488,48302,47894,0,1416091,1477759,42,4172,0,48296,18988,48144,50416,120,106,7712
|
||||||
|
Klebsiella_pneumoniae--HS11286,0,109,109,32029,20134,21382,21226,1416091,0,644063,42,2738,0,21498,29758,21606,21376,99,102,4417
|
||||||
|
Klebsiella_pneumoniae--MGH_78578,0,111,130,22312,22064,24602,24470,1477759,644063,0,42,2614,0,19948,35067,21330,20813,97,102,4374
|
||||||
|
Opitutus_terrae--PB90-1,0,78,66,63,48,47,68,42,42,42,0,43,18,57,42,53,66,39,58,43
|
||||||
|
Proteus_mirabilis--HI4320,0,112,158,4225,4202,4277,4278,4172,2738,2614,43,0,0,4254,2481,4166,4215,131,103,4704
|
||||||
|
Saccharolobus_islandicus--M.16.4,8,0,6,0,0,0,0,0,0,0,18,0,0,0,0,0,0,0,0,0
|
||||||
|
Salmonella_enterica--AKU_12601,0,136,131,74946,74655,75729,75658,48296,21498,19948,57,4254,0,0,1047731,2857146,2951421,117,108,7643
|
||||||
|
Salmonella_enterica--CT18,1,109,112,31918,28602,30449,30207,18988,29758,35067,42,2481,0,1047731,0,917948,940297,106,106,3716
|
||||||
|
Salmonella_enterica--LT2,0,147,124,73311,71244,73622,73614,48144,21606,21330,53,4166,0,2857146,917948,0,3284800,122,108,7460
|
||||||
|
Salmonella_enterica--P125109,0,134,135,76585,74665,76778,76583,50416,21376,20813,66,4215,0,2951421,940297,3284800,0,134,124,7645
|
||||||
|
Shouchella_clausii--KSM-K16,0,117,2393,113,112,119,112,120,99,97,39,131,0,117,106,122,134,0,58,124
|
||||||
|
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,0,55,46,128,108,111,108,106,102,102,58,103,0,108,106,108,124,58,0,96
|
||||||
|
Yersinia_ruckeri--YRB,3,129,124,7854,7963,8566,8660,7712,4417,4374,43,4704,0,7643,3716,7460,7645,124,96,0
|
||||||
|
Executable
+181
@@ -0,0 +1,181 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""Compare an obikmer count index against a reference kmer set (presence + counts).
|
||||||
|
|
||||||
|
Loads the reference .npz (sorted uint64 kmers + uint32 counts from build_reference.py),
|
||||||
|
streams `obikmer dump` from a --with-counts index, then reports:
|
||||||
|
- false negatives : kmers in reference absent from the index
|
||||||
|
- false positives : kmers in the index absent from the reference
|
||||||
|
- count mismatches: kmers present in both but with differing counts
|
||||||
|
|
||||||
|
Output to stdout: one CSV row
|
||||||
|
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
|
||||||
|
fn_pct,fp_pct,cm_pct
|
||||||
|
"""
|
||||||
|
import argparse
|
||||||
|
import subprocess
|
||||||
|
import sys
|
||||||
|
|
||||||
|
import numpy as np
|
||||||
|
|
||||||
|
|
||||||
|
# ── encoding ──────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
|
||||||
|
'a': 0, 'c': 1, 'g': 2, 't': 3}
|
||||||
|
|
||||||
|
_DECODE = ['A', 'C', 'G', 'T']
|
||||||
|
|
||||||
|
|
||||||
|
def encode_kmer(s: str) -> int:
|
||||||
|
kmer = 0
|
||||||
|
for c in s:
|
||||||
|
kmer = (kmer << 2) | _ENCODE[c]
|
||||||
|
return kmer
|
||||||
|
|
||||||
|
|
||||||
|
def decode_kmer(val: int, k: int) -> str:
|
||||||
|
bases = []
|
||||||
|
for _ in range(k):
|
||||||
|
bases.append(_DECODE[val & 3])
|
||||||
|
val >>= 2
|
||||||
|
return ''.join(reversed(bases))
|
||||||
|
|
||||||
|
|
||||||
|
# ── dump parsing ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def load_index(obikmer_bin: str, index_dir: str) -> tuple[np.ndarray, np.ndarray]:
|
||||||
|
"""Stream `obikmer dump` and return (kmers_sorted_uint64, counts_uint32)."""
|
||||||
|
cmd = [obikmer_bin, 'dump', index_dir]
|
||||||
|
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
|
||||||
|
text=True)
|
||||||
|
kmers, counts = [], []
|
||||||
|
header = True
|
||||||
|
for line in proc.stdout:
|
||||||
|
if header:
|
||||||
|
header = False
|
||||||
|
continue
|
||||||
|
parts = line.rstrip('\n').split(',')
|
||||||
|
kmers.append(encode_kmer(parts[0]))
|
||||||
|
counts.append(int(parts[1]))
|
||||||
|
proc.wait()
|
||||||
|
if proc.returncode != 0:
|
||||||
|
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
|
||||||
|
sys.exit(1)
|
||||||
|
order = np.argsort(np.array(kmers, dtype=np.uint64), kind='stable')
|
||||||
|
return (np.array(kmers, dtype=np.uint64)[order],
|
||||||
|
np.array(counts, dtype=np.uint32)[order])
|
||||||
|
|
||||||
|
|
||||||
|
# ── comparison ────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def compare(ref_kmers: np.ndarray, ref_counts: np.ndarray,
|
||||||
|
idx_kmers: np.ndarray, idx_counts: np.ndarray,
|
||||||
|
) -> tuple[np.ndarray, np.ndarray, np.ndarray, np.ndarray, np.ndarray]:
|
||||||
|
"""Return (false_neg, false_pos, cm_ref_kmers, cm_ref_counts, cm_idx_counts).
|
||||||
|
|
||||||
|
All arrays sorted; cm_* cover kmers present in both arrays but with
|
||||||
|
differing counts.
|
||||||
|
"""
|
||||||
|
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
|
||||||
|
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
|
||||||
|
|
||||||
|
# Count mismatches among shared kmers.
|
||||||
|
# Both arrays are sorted so we can use searchsorted.
|
||||||
|
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
|
||||||
|
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
|
||||||
|
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
|
||||||
|
|
||||||
|
shared_ref_counts = ref_counts[shared_mask]
|
||||||
|
shared_idx_counts = idx_counts[pos_in_idx[shared_mask]]
|
||||||
|
mismatch_mask = shared_ref_counts != shared_idx_counts
|
||||||
|
|
||||||
|
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
|
||||||
|
cm_ref_counts = shared_ref_counts[mismatch_mask]
|
||||||
|
cm_idx_counts = shared_idx_counts[mismatch_mask]
|
||||||
|
|
||||||
|
return false_neg, false_pos, cm_kmers, cm_ref_counts, cm_idx_counts
|
||||||
|
|
||||||
|
|
||||||
|
# ── main ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def main() -> None:
|
||||||
|
ap = argparse.ArgumentParser(description=__doc__,
|
||||||
|
formatter_class=argparse.RawDescriptionHelpFormatter)
|
||||||
|
ap.add_argument('reference', metavar='REF_NPZ', nargs='?',
|
||||||
|
help='Reference .npz file')
|
||||||
|
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
|
||||||
|
help='obikmer index directory (built with --with-counts)')
|
||||||
|
ap.add_argument('--obikmer', default='obikmer',
|
||||||
|
help='Path to obikmer binary')
|
||||||
|
ap.add_argument('--species', default='')
|
||||||
|
ap.add_argument('--strain', default='')
|
||||||
|
ap.add_argument('--header', action='store_true',
|
||||||
|
help='Print CSV header and exit')
|
||||||
|
ap.add_argument('--save-fp', metavar='FILE',
|
||||||
|
help='Save false-positive kmer strings to FILE')
|
||||||
|
ap.add_argument('--save-fn', metavar='FILE',
|
||||||
|
help='Save false-negative kmer strings to FILE')
|
||||||
|
ap.add_argument('--save-cm', metavar='FILE',
|
||||||
|
help='Save count-mismatch rows (kmer,ref_count,idx_count) to FILE')
|
||||||
|
args = ap.parse_args()
|
||||||
|
|
||||||
|
if args.header:
|
||||||
|
print('species,strain,ref_kmers,idx_kmers,'
|
||||||
|
'false_neg,false_pos,count_mismatch,'
|
||||||
|
'fn_pct,fp_pct,cm_pct')
|
||||||
|
return
|
||||||
|
|
||||||
|
# Detect k
|
||||||
|
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
|
||||||
|
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
|
||||||
|
k = len(out1.splitlines()[1].split(',')[0])
|
||||||
|
|
||||||
|
# Load reference
|
||||||
|
print(f'Loading reference: {args.reference}', file=sys.stderr)
|
||||||
|
npz = np.load(args.reference)
|
||||||
|
ref_kmers = npz['kmers'] # sorted uint64
|
||||||
|
ref_counts = npz['counts'] # uint32
|
||||||
|
|
||||||
|
# Load index
|
||||||
|
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
|
||||||
|
idx_kmers, idx_counts = load_index(args.obikmer, args.index)
|
||||||
|
|
||||||
|
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
|
||||||
|
|
||||||
|
false_neg, false_pos, cm_kmers, cm_ref, cm_idx = compare(
|
||||||
|
ref_kmers, ref_counts, idx_kmers, idx_counts)
|
||||||
|
|
||||||
|
n_shared = len(ref_kmers) - len(false_neg)
|
||||||
|
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
|
||||||
|
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
|
||||||
|
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
|
||||||
|
|
||||||
|
print(f'false negatives : {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
|
||||||
|
print(f'false positives : {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
|
||||||
|
print(f'count mismatches: {len(cm_kmers):,} ({cm_pct:.4f}% of shared)',
|
||||||
|
file=sys.stderr)
|
||||||
|
|
||||||
|
if args.save_fn and len(false_neg):
|
||||||
|
with open(args.save_fn, 'w') as fh:
|
||||||
|
for v in false_neg:
|
||||||
|
fh.write(decode_kmer(int(v), k) + '\n')
|
||||||
|
|
||||||
|
if args.save_fp and len(false_pos):
|
||||||
|
with open(args.save_fp, 'w') as fh:
|
||||||
|
for v in false_pos:
|
||||||
|
fh.write(decode_kmer(int(v), k) + '\n')
|
||||||
|
|
||||||
|
if args.save_cm and len(cm_kmers):
|
||||||
|
with open(args.save_cm, 'w') as fh:
|
||||||
|
fh.write('kmer,ref_count,idx_count\n')
|
||||||
|
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
|
||||||
|
fh.write(f'{decode_kmer(int(v), k)},{rc},{ic}\n')
|
||||||
|
|
||||||
|
print(f'{args.species},{args.strain},'
|
||||||
|
f'{len(ref_kmers)},{len(idx_kmers)},'
|
||||||
|
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
|
||||||
|
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
|
||||||
|
|
||||||
|
|
||||||
|
if __name__ == '__main__':
|
||||||
|
main()
|
||||||
Executable
+201
@@ -0,0 +1,201 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""Verify the merged count index against all per-specimen reference sets.
|
||||||
|
|
||||||
|
Streams `obikmer dump` once on the merged index, accumulates per-specimen
|
||||||
|
kmer+count pairs from each column, then compares each against its reference .npz.
|
||||||
|
|
||||||
|
Output to stdout: one CSV row per specimen (same columns as verify_count.py)
|
||||||
|
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
|
||||||
|
fn_pct,fp_pct,cm_pct
|
||||||
|
"""
|
||||||
|
import argparse
|
||||||
|
import subprocess
|
||||||
|
import sys
|
||||||
|
from pathlib import Path
|
||||||
|
|
||||||
|
import numpy as np
|
||||||
|
|
||||||
|
|
||||||
|
# ── encoding ──────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
|
||||||
|
'a': 0, 'c': 1, 'g': 2, 't': 3}
|
||||||
|
|
||||||
|
_DECODE = ['A', 'C', 'G', 'T']
|
||||||
|
|
||||||
|
|
||||||
|
def encode_kmer(s: str) -> int:
|
||||||
|
kmer = 0
|
||||||
|
for c in s:
|
||||||
|
kmer = (kmer << 2) | _ENCODE[c]
|
||||||
|
return kmer
|
||||||
|
|
||||||
|
|
||||||
|
def decode_kmer(val: int, k: int) -> str:
|
||||||
|
bases = []
|
||||||
|
for _ in range(k):
|
||||||
|
bases.append(_DECODE[val & 3])
|
||||||
|
val >>= 2
|
||||||
|
return ''.join(reversed(bases))
|
||||||
|
|
||||||
|
|
||||||
|
# ── single-pass dump ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def stream_merged_dump(obikmer_bin: str, index_dir: str,
|
||||||
|
) -> tuple[list[str], dict[str, tuple[list[int], list[int]]]]:
|
||||||
|
"""Stream the merged dump once.
|
||||||
|
|
||||||
|
Returns:
|
||||||
|
specimen_names : column labels in dump order
|
||||||
|
per_specimen : mapping label → (kmer_ints, counts) for entries > 0
|
||||||
|
"""
|
||||||
|
cmd = [obikmer_bin, 'dump', index_dir]
|
||||||
|
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
|
||||||
|
text=True)
|
||||||
|
|
||||||
|
header_line = proc.stdout.readline().rstrip('\n')
|
||||||
|
cols = header_line.split(',')
|
||||||
|
specimen_names = cols[1:]
|
||||||
|
per_specimen: dict[str, tuple[list[int], list[int]]] = {
|
||||||
|
name: ([], []) for name in specimen_names}
|
||||||
|
|
||||||
|
for line in proc.stdout:
|
||||||
|
parts = line.rstrip('\n').split(',')
|
||||||
|
kmer_int = encode_kmer(parts[0])
|
||||||
|
for i, name in enumerate(specimen_names):
|
||||||
|
count = int(parts[i + 1])
|
||||||
|
if count > 0:
|
||||||
|
per_specimen[name][0].append(kmer_int)
|
||||||
|
per_specimen[name][1].append(count)
|
||||||
|
|
||||||
|
proc.wait()
|
||||||
|
if proc.returncode != 0:
|
||||||
|
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
return specimen_names, per_specimen
|
||||||
|
|
||||||
|
|
||||||
|
# ── per-specimen comparison ───────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def compare_specimen(name: str,
|
||||||
|
kmer_list: list[int],
|
||||||
|
count_list: list[int],
|
||||||
|
ref_dir: Path,
|
||||||
|
k: int,
|
||||||
|
save_fn: Path | None,
|
||||||
|
save_fp: Path | None,
|
||||||
|
save_cm: Path | None,
|
||||||
|
) -> str:
|
||||||
|
ref_path = ref_dir / f'{name}.npz'
|
||||||
|
if not ref_path.exists():
|
||||||
|
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
|
||||||
|
return ''
|
||||||
|
|
||||||
|
species = name.split('--')[0]
|
||||||
|
strain = name[len(species) + 2:]
|
||||||
|
|
||||||
|
npz = np.load(ref_path)
|
||||||
|
ref_kmers = npz['kmers'] # sorted uint64
|
||||||
|
ref_counts = npz['counts'] # uint32
|
||||||
|
|
||||||
|
order = np.argsort(np.array(kmer_list, dtype=np.uint64), kind='stable')
|
||||||
|
idx_kmers = np.array(kmer_list, dtype=np.uint64)[order]
|
||||||
|
idx_counts = np.array(count_list, dtype=np.uint32)[order]
|
||||||
|
|
||||||
|
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
|
||||||
|
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
|
||||||
|
|
||||||
|
# Count mismatches among shared kmers
|
||||||
|
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
|
||||||
|
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
|
||||||
|
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
|
||||||
|
mismatch_mask = ref_counts[shared_mask] != idx_counts[pos_in_idx[shared_mask]]
|
||||||
|
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
|
||||||
|
cm_ref = ref_counts[shared_mask][mismatch_mask]
|
||||||
|
cm_idx = idx_counts[pos_in_idx[shared_mask]][mismatch_mask]
|
||||||
|
|
||||||
|
n_shared = int(shared_mask.sum())
|
||||||
|
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
|
||||||
|
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
|
||||||
|
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
|
||||||
|
|
||||||
|
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
|
||||||
|
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
|
||||||
|
f'fp={len(false_pos):,} ({fp_pct:.4f}%) '
|
||||||
|
f'cm={len(cm_kmers):,} ({cm_pct:.4f}%)',
|
||||||
|
file=sys.stderr)
|
||||||
|
|
||||||
|
if save_fn and len(false_neg):
|
||||||
|
fn_file = save_fn / f'{name}_fn.txt'
|
||||||
|
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
|
||||||
|
|
||||||
|
if save_fp and len(false_pos):
|
||||||
|
fp_file = save_fp / f'{name}_fp.txt'
|
||||||
|
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
|
||||||
|
|
||||||
|
if save_cm and len(cm_kmers):
|
||||||
|
cm_file = save_cm / f'{name}_cm.csv'
|
||||||
|
lines = ['kmer,ref_count,idx_count']
|
||||||
|
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
|
||||||
|
lines.append(f'{decode_kmer(int(v), k)},{rc},{ic}')
|
||||||
|
cm_file.write_text('\n'.join(lines) + '\n')
|
||||||
|
|
||||||
|
return (f'{species},{strain},'
|
||||||
|
f'{len(ref_kmers)},{len(idx_kmers)},'
|
||||||
|
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
|
||||||
|
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
|
||||||
|
|
||||||
|
|
||||||
|
# ── main ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def main() -> None:
|
||||||
|
ap = argparse.ArgumentParser(description=__doc__,
|
||||||
|
formatter_class=argparse.RawDescriptionHelpFormatter)
|
||||||
|
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
|
||||||
|
help='Merged count index directory')
|
||||||
|
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
|
||||||
|
help='Directory containing per-specimen .npz reference files')
|
||||||
|
ap.add_argument('--obikmer', default='obikmer')
|
||||||
|
ap.add_argument('--header', action='store_true',
|
||||||
|
help='Print CSV header and exit')
|
||||||
|
ap.add_argument('--save-fn', metavar='DIR',
|
||||||
|
help='Directory for false-negative kmer lists')
|
||||||
|
ap.add_argument('--save-fp', metavar='DIR',
|
||||||
|
help='Directory for false-positive kmer lists')
|
||||||
|
ap.add_argument('--save-cm', metavar='DIR',
|
||||||
|
help='Directory for count-mismatch CSV files')
|
||||||
|
args = ap.parse_args()
|
||||||
|
|
||||||
|
if args.header:
|
||||||
|
print('species,strain,ref_kmers,idx_kmers,'
|
||||||
|
'false_neg,false_pos,count_mismatch,'
|
||||||
|
'fn_pct,fp_pct,cm_pct')
|
||||||
|
return
|
||||||
|
|
||||||
|
ref_dir = Path(args.ref_dir)
|
||||||
|
save_fn = Path(args.save_fn) if args.save_fn else None
|
||||||
|
save_fp = Path(args.save_fp) if args.save_fp else None
|
||||||
|
save_cm = Path(args.save_cm) if args.save_cm else None
|
||||||
|
for d in (save_fn, save_fp, save_cm):
|
||||||
|
if d: d.mkdir(parents=True, exist_ok=True)
|
||||||
|
|
||||||
|
out1 = subprocess.check_output(
|
||||||
|
[args.obikmer, 'dump', '--head', '1', args.index],
|
||||||
|
stderr=subprocess.DEVNULL, text=True)
|
||||||
|
k = len(out1.splitlines()[1].split(',')[0])
|
||||||
|
|
||||||
|
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
|
||||||
|
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
|
||||||
|
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
|
||||||
|
|
||||||
|
for name in specimen_names:
|
||||||
|
kmers, counts = per_specimen[name]
|
||||||
|
row = compare_specimen(name, kmers, counts, ref_dir, k,
|
||||||
|
save_fn, save_fp, save_cm)
|
||||||
|
if row:
|
||||||
|
print(row)
|
||||||
|
|
||||||
|
|
||||||
|
if __name__ == '__main__':
|
||||||
|
main()
|
||||||
Executable
+27
@@ -0,0 +1,27 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
INDEX="${SCRIPT_DIR}/global_index_count"
|
||||||
|
REF_DIR="${SCRIPT_DIR}/reference_index"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_count"
|
||||||
|
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
|
||||||
|
VERIFY_PY="${SCRIPT_DIR}/verify_merge_count.py"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
CURRENT="${STATS_DIR}/current.csv"
|
||||||
|
|
||||||
|
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
|
||||||
|
|
||||||
|
"${PYTHON}" "${VERIFY_PY}" \
|
||||||
|
--obikmer "${BINARY}" \
|
||||||
|
"${INDEX}" "${REF_DIR}" \
|
||||||
|
>>"${CURRENT}"
|
||||||
|
|
||||||
|
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'count_*.csv' | wc -l | tr -d ' ')")
|
||||||
|
ARCHIVE="${STATS_DIR}/count_${run_n}.csv"
|
||||||
|
cp "${CURRENT}" "${ARCHIVE}"
|
||||||
|
|
||||||
|
echo "Done. Results → ${ARCHIVE}"
|
||||||
Executable
+170
@@ -0,0 +1,170 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""Verify the merged presence index against all per-specimen reference sets.
|
||||||
|
|
||||||
|
Streams `obikmer dump` once on the merged index, accumulates per-specimen
|
||||||
|
kmer sets from each column, then compares each against its reference .npz.
|
||||||
|
|
||||||
|
Output to stdout: one CSV row per specimen (same columns as verify_presence.py)
|
||||||
|
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct
|
||||||
|
"""
|
||||||
|
import argparse
|
||||||
|
import subprocess
|
||||||
|
import sys
|
||||||
|
from pathlib import Path
|
||||||
|
|
||||||
|
import numpy as np
|
||||||
|
|
||||||
|
|
||||||
|
# ── encoding ──────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
|
||||||
|
'a': 0, 'c': 1, 'g': 2, 't': 3}
|
||||||
|
|
||||||
|
_DECODE = ['A', 'C', 'G', 'T']
|
||||||
|
|
||||||
|
|
||||||
|
def encode_kmer(s: str) -> int:
|
||||||
|
kmer = 0
|
||||||
|
for c in s:
|
||||||
|
kmer = (kmer << 2) | _ENCODE[c]
|
||||||
|
return kmer
|
||||||
|
|
||||||
|
|
||||||
|
def decode_kmer(val: int, k: int) -> str:
|
||||||
|
bases = []
|
||||||
|
for _ in range(k):
|
||||||
|
bases.append(_DECODE[val & 3])
|
||||||
|
val >>= 2
|
||||||
|
return ''.join(reversed(bases))
|
||||||
|
|
||||||
|
|
||||||
|
# ── single-pass dump ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def stream_merged_dump(obikmer_bin: str, index_dir: str,
|
||||||
|
) -> tuple[list[str], dict[str, list[int]]]:
|
||||||
|
"""Stream the merged dump once.
|
||||||
|
|
||||||
|
Returns:
|
||||||
|
specimen_names : column labels in dump order (excluding 'kmer')
|
||||||
|
per_specimen : mapping label → list of kmer ints where presence > 0
|
||||||
|
"""
|
||||||
|
cmd = [obikmer_bin, 'dump', index_dir]
|
||||||
|
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
|
||||||
|
text=True)
|
||||||
|
|
||||||
|
header_line = proc.stdout.readline().rstrip('\n')
|
||||||
|
cols = header_line.split(',')
|
||||||
|
specimen_names = cols[1:] # first col is 'kmer'
|
||||||
|
per_specimen: dict[str, list[int]] = {name: [] for name in specimen_names}
|
||||||
|
|
||||||
|
for line in proc.stdout:
|
||||||
|
parts = line.rstrip('\n').split(',')
|
||||||
|
kmer_int = encode_kmer(parts[0])
|
||||||
|
for i, name in enumerate(specimen_names):
|
||||||
|
if int(parts[i + 1]) > 0:
|
||||||
|
per_specimen[name].append(kmer_int)
|
||||||
|
|
||||||
|
proc.wait()
|
||||||
|
if proc.returncode != 0:
|
||||||
|
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
return specimen_names, per_specimen
|
||||||
|
|
||||||
|
|
||||||
|
# ── per-specimen comparison ───────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def compare_specimen(name: str,
|
||||||
|
kmer_list: list[int],
|
||||||
|
ref_dir: Path,
|
||||||
|
k: int,
|
||||||
|
save_fn: Path | None,
|
||||||
|
save_fp: Path | None,
|
||||||
|
) -> str:
|
||||||
|
"""Compare one specimen column against its reference .npz.
|
||||||
|
|
||||||
|
Returns a CSV row string.
|
||||||
|
"""
|
||||||
|
ref_path = ref_dir / f'{name}.npz'
|
||||||
|
if not ref_path.exists():
|
||||||
|
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
|
||||||
|
return ''
|
||||||
|
|
||||||
|
species = name.split('--')[0]
|
||||||
|
strain = name[len(species) + 2:]
|
||||||
|
|
||||||
|
ref_kmers = np.load(ref_path)['kmers'] # sorted uint64
|
||||||
|
idx_kmers = np.array(sorted(kmer_list), dtype=np.uint64)
|
||||||
|
|
||||||
|
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
|
||||||
|
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
|
||||||
|
|
||||||
|
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
|
||||||
|
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
|
||||||
|
|
||||||
|
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
|
||||||
|
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
|
||||||
|
f'fp={len(false_pos):,} ({fp_pct:.4f}%)',
|
||||||
|
file=sys.stderr)
|
||||||
|
|
||||||
|
if save_fn and len(false_neg):
|
||||||
|
fn_file = save_fn / f'{name}_fn.txt'
|
||||||
|
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
|
||||||
|
|
||||||
|
if save_fp and len(false_pos):
|
||||||
|
fp_file = save_fp / f'{name}_fp.txt'
|
||||||
|
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
|
||||||
|
|
||||||
|
return (f'{species},{strain},'
|
||||||
|
f'{len(ref_kmers)},{len(idx_kmers)},'
|
||||||
|
f'{len(false_neg)},{len(false_pos)},'
|
||||||
|
f'{fn_pct:.4f},{fp_pct:.4f}')
|
||||||
|
|
||||||
|
|
||||||
|
# ── main ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def main() -> None:
|
||||||
|
ap = argparse.ArgumentParser(description=__doc__,
|
||||||
|
formatter_class=argparse.RawDescriptionHelpFormatter)
|
||||||
|
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
|
||||||
|
help='Merged presence index directory')
|
||||||
|
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
|
||||||
|
help='Directory containing per-specimen .npz reference files')
|
||||||
|
ap.add_argument('--obikmer', default='obikmer')
|
||||||
|
ap.add_argument('--header', action='store_true',
|
||||||
|
help='Print CSV header and exit')
|
||||||
|
ap.add_argument('--save-fn', metavar='DIR',
|
||||||
|
help='Directory to save false-negative kmer lists')
|
||||||
|
ap.add_argument('--save-fp', metavar='DIR',
|
||||||
|
help='Directory to save false-positive kmer lists')
|
||||||
|
args = ap.parse_args()
|
||||||
|
|
||||||
|
if args.header:
|
||||||
|
print('species,strain,ref_kmers,idx_kmers,'
|
||||||
|
'false_neg,false_pos,fn_pct,fp_pct')
|
||||||
|
return
|
||||||
|
|
||||||
|
ref_dir = Path(args.ref_dir)
|
||||||
|
save_fn = Path(args.save_fn) if args.save_fn else None
|
||||||
|
save_fp = Path(args.save_fp) if args.save_fp else None
|
||||||
|
if save_fn: save_fn.mkdir(parents=True, exist_ok=True)
|
||||||
|
if save_fp: save_fp.mkdir(parents=True, exist_ok=True)
|
||||||
|
|
||||||
|
# Detect k
|
||||||
|
out1 = subprocess.check_output(
|
||||||
|
[args.obikmer, 'dump', '--head', '1', args.index],
|
||||||
|
stderr=subprocess.DEVNULL, text=True)
|
||||||
|
k = len(out1.splitlines()[1].split(',')[0])
|
||||||
|
|
||||||
|
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
|
||||||
|
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
|
||||||
|
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
|
||||||
|
|
||||||
|
for name in specimen_names:
|
||||||
|
row = compare_specimen(name, per_specimen[name], ref_dir, k, save_fn, save_fp)
|
||||||
|
if row:
|
||||||
|
print(row)
|
||||||
|
|
||||||
|
|
||||||
|
if __name__ == '__main__':
|
||||||
|
main()
|
||||||
Executable
+27
@@ -0,0 +1,27 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
INDEX="${SCRIPT_DIR}/global_index_presence"
|
||||||
|
REF_DIR="${SCRIPT_DIR}/reference_index"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_presence"
|
||||||
|
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
|
||||||
|
VERIFY_PY="${SCRIPT_DIR}/verify_merge_presence.py"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
CURRENT="${STATS_DIR}/current.csv"
|
||||||
|
|
||||||
|
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
|
||||||
|
|
||||||
|
"${PYTHON}" "${VERIFY_PY}" \
|
||||||
|
--obikmer "${BINARY}" \
|
||||||
|
"${INDEX}" "${REF_DIR}" \
|
||||||
|
>>"${CURRENT}"
|
||||||
|
|
||||||
|
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'presence_*.csv' | wc -l | tr -d ' ')")
|
||||||
|
ARCHIVE="${STATS_DIR}/presence_${run_n}.csv"
|
||||||
|
cp "${CURRENT}" "${ARCHIVE}"
|
||||||
|
|
||||||
|
echo "Done. Results → ${ARCHIVE}"
|
||||||
Executable
+30
@@ -0,0 +1,30 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Usage: verify_one_count.sh SPECIMEN
|
||||||
|
# SPECIMEN = "species--strain" (Make pattern stem)
|
||||||
|
# Output: stats/verify_count/SPECIMEN.stats (one CSV data row, no header)
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SPECIMEN="$1"
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
|
||||||
|
VERIFY_PY="${SCRIPT_DIR}/verify_count.py"
|
||||||
|
|
||||||
|
species="${SPECIMEN%%--*}"
|
||||||
|
strain="${SPECIMEN#*--}"
|
||||||
|
|
||||||
|
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
|
||||||
|
INDEX_DIR="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/verify_count"
|
||||||
|
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
echo "[${SPECIMEN}] verifying count"
|
||||||
|
|
||||||
|
"${PYTHON}" "${VERIFY_PY}" \
|
||||||
|
--obikmer "${BINARY}" \
|
||||||
|
--species "${species}" \
|
||||||
|
--strain "${strain}" \
|
||||||
|
"${REF_NPZ}" "${INDEX_DIR}" \
|
||||||
|
>"${STATS_FILE}"
|
||||||
Executable
+30
@@ -0,0 +1,30 @@
|
|||||||
|
#!/usr/bin/env bash
|
||||||
|
# Usage: verify_one_presence.sh SPECIMEN
|
||||||
|
# SPECIMEN = "species--strain" (Make pattern stem)
|
||||||
|
# Output: stats/verify_presence/SPECIMEN.stats (one CSV data row, no header)
|
||||||
|
set -euo pipefail
|
||||||
|
|
||||||
|
SPECIMEN="$1"
|
||||||
|
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
|
||||||
|
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
|
||||||
|
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
|
||||||
|
VERIFY_PY="${SCRIPT_DIR}/verify_presence.py"
|
||||||
|
|
||||||
|
species="${SPECIMEN%%--*}"
|
||||||
|
strain="${SPECIMEN#*--}"
|
||||||
|
|
||||||
|
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
|
||||||
|
INDEX_DIR="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
|
||||||
|
STATS_DIR="${SCRIPT_DIR}/stats/verify_presence"
|
||||||
|
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
|
||||||
|
|
||||||
|
mkdir -p "${STATS_DIR}"
|
||||||
|
|
||||||
|
echo "[${SPECIMEN}] verifying presence"
|
||||||
|
|
||||||
|
"${PYTHON}" "${VERIFY_PY}" \
|
||||||
|
--obikmer "${BINARY}" \
|
||||||
|
--species "${species}" \
|
||||||
|
--strain "${strain}" \
|
||||||
|
"${REF_NPZ}" "${INDEX_DIR}" \
|
||||||
|
>"${STATS_FILE}"
|
||||||
Executable
+139
@@ -0,0 +1,139 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""Compare an obikmer index against a reference kmer set (presence/absence).
|
||||||
|
|
||||||
|
Loads the reference .npz (sorted uint64 kmers built by build_reference.py),
|
||||||
|
streams the output of `obikmer dump`, encodes each kmer string to uint64,
|
||||||
|
then reports false negatives and false positives using numpy set operations.
|
||||||
|
|
||||||
|
Output to stdout: one CSV row
|
||||||
|
species, strain, ref_kmers, idx_kmers, false_neg, false_pos, fn_pct, fp_pct
|
||||||
|
"""
|
||||||
|
import argparse
|
||||||
|
import subprocess
|
||||||
|
import sys
|
||||||
|
|
||||||
|
import numpy as np
|
||||||
|
|
||||||
|
|
||||||
|
# ── encoding ──────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
|
||||||
|
'a': 0, 'c': 1, 'g': 2, 't': 3}
|
||||||
|
|
||||||
|
_DECODE = ['A', 'C', 'G', 'T']
|
||||||
|
|
||||||
|
|
||||||
|
def encode_kmer(s: str) -> int:
|
||||||
|
kmer = 0
|
||||||
|
for c in s:
|
||||||
|
kmer = (kmer << 2) | _ENCODE[c]
|
||||||
|
return kmer
|
||||||
|
|
||||||
|
|
||||||
|
def decode_kmer(val: int, k: int) -> str:
|
||||||
|
bases = []
|
||||||
|
for _ in range(k):
|
||||||
|
bases.append(_DECODE[val & 3])
|
||||||
|
val >>= 2
|
||||||
|
return ''.join(reversed(bases))
|
||||||
|
|
||||||
|
|
||||||
|
# ── dump parsing ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def load_index_kmers(obikmer_bin: str, index_dir: str) -> np.ndarray:
|
||||||
|
"""Stream `obikmer dump` and return a sorted uint64 array of kmer integers."""
|
||||||
|
cmd = [obikmer_bin, 'dump', index_dir]
|
||||||
|
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
|
||||||
|
text=True)
|
||||||
|
kmers = []
|
||||||
|
header = True
|
||||||
|
for line in proc.stdout:
|
||||||
|
if header:
|
||||||
|
header = False
|
||||||
|
continue
|
||||||
|
kmer_str = line.split(',', 1)[0]
|
||||||
|
kmers.append(encode_kmer(kmer_str))
|
||||||
|
proc.wait()
|
||||||
|
if proc.returncode != 0:
|
||||||
|
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
|
||||||
|
sys.exit(1)
|
||||||
|
arr = np.array(kmers, dtype=np.uint64)
|
||||||
|
arr.sort()
|
||||||
|
return arr
|
||||||
|
|
||||||
|
|
||||||
|
# ── comparison ────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def compare(ref: np.ndarray, idx: np.ndarray) -> tuple[np.ndarray, np.ndarray]:
|
||||||
|
"""Return (false_negatives, false_positives) as uint64 arrays."""
|
||||||
|
false_neg = np.setdiff1d(ref, idx, assume_unique=True)
|
||||||
|
false_pos = np.setdiff1d(idx, ref, assume_unique=True)
|
||||||
|
return false_neg, false_pos
|
||||||
|
|
||||||
|
|
||||||
|
# ── main ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
def main() -> None:
|
||||||
|
ap = argparse.ArgumentParser(description=__doc__,
|
||||||
|
formatter_class=argparse.RawDescriptionHelpFormatter)
|
||||||
|
ap.add_argument('reference', metavar='REF_NPZ', nargs='?', help='Reference .npz file')
|
||||||
|
ap.add_argument('index', metavar='INDEX_DIR', nargs='?', help='obikmer index directory')
|
||||||
|
ap.add_argument('--obikmer', default='obikmer', help='Path to obikmer binary')
|
||||||
|
ap.add_argument('--species', default='', help='Species label for CSV row')
|
||||||
|
ap.add_argument('--strain', default='', help='Strain label for CSV row')
|
||||||
|
ap.add_argument('--header', action='store_true', help='Print CSV header and exit')
|
||||||
|
ap.add_argument('--save-fp', metavar='FILE',
|
||||||
|
help='Save false-positive kmer strings to FILE')
|
||||||
|
ap.add_argument('--save-fn', metavar='FILE',
|
||||||
|
help='Save false-negative kmer strings to FILE')
|
||||||
|
args = ap.parse_args()
|
||||||
|
|
||||||
|
if args.header:
|
||||||
|
print('species,strain,ref_kmers,idx_kmers,'
|
||||||
|
'false_neg,false_pos,fn_pct,fp_pct')
|
||||||
|
return
|
||||||
|
|
||||||
|
# Detect k from the index (one cheap call before the full dump).
|
||||||
|
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
|
||||||
|
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
|
||||||
|
k = len(out1.splitlines()[1].split(',')[0])
|
||||||
|
|
||||||
|
# Load reference
|
||||||
|
print(f'Loading reference: {args.reference}', file=sys.stderr)
|
||||||
|
npz = np.load(args.reference)
|
||||||
|
ref_kmers = npz['kmers'] # already sorted uint64
|
||||||
|
|
||||||
|
# Load index
|
||||||
|
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
|
||||||
|
idx_kmers = load_index_kmers(args.obikmer, args.index)
|
||||||
|
|
||||||
|
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
|
||||||
|
|
||||||
|
false_neg, false_pos = compare(ref_kmers, idx_kmers)
|
||||||
|
|
||||||
|
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
|
||||||
|
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
|
||||||
|
|
||||||
|
print(f'false negatives: {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
|
||||||
|
print(f'false positives: {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
|
||||||
|
|
||||||
|
if args.save_fn and len(false_neg):
|
||||||
|
with open(args.save_fn, 'w') as fh:
|
||||||
|
for v in false_neg:
|
||||||
|
fh.write(decode_kmer(int(v), k) + '\n')
|
||||||
|
print(f'False negatives saved → {args.save_fn}', file=sys.stderr)
|
||||||
|
|
||||||
|
if args.save_fp and len(false_pos):
|
||||||
|
with open(args.save_fp, 'w') as fh:
|
||||||
|
for v in false_pos:
|
||||||
|
fh.write(decode_kmer(int(v), k) + '\n')
|
||||||
|
print(f'False positives saved → {args.save_fp}', file=sys.stderr)
|
||||||
|
|
||||||
|
print(f'{args.species},{args.strain},'
|
||||||
|
f'{len(ref_kmers)},{len(idx_kmers)},'
|
||||||
|
f'{len(false_neg)},{len(false_pos)},'
|
||||||
|
f'{fn_pct:.4f},{fp_pct:.4f}')
|
||||||
|
|
||||||
|
|
||||||
|
if __name__ == '__main__':
|
||||||
|
main()
|
||||||
@@ -162,14 +162,158 @@ A single `PartitionRunner` instance can be built once per command invocation
|
|||||||
and reused across multiple `run()` calls (e.g. `merge` runs
|
and reused across multiple `run()` calls (e.g. `merge` runs
|
||||||
`merge_partitions` then `pack_matrices`).
|
`merge_partitions` then `pack_matrices`).
|
||||||
|
|
||||||
|
## Known issue: CPU-only activation signal stalls on I/O-bound stages
|
||||||
|
|
||||||
|
Observed on a real `filter` run (109 genomes, 256 partitions, 8×24-core NUMA):
|
||||||
|
`rebuild` (CPU-bound — k-mer construction) scales cleanly from 9 to 43 active
|
||||||
|
workers as `CpuSample::do_i_activate` (`obisys::lib.rs`) sees efficiency climb.
|
||||||
|
`pack_matrices` (I/O-bound — reopens and recomposes per-genome column files
|
||||||
|
into `.pbmx`/`.pcmx`) activates one extra worker then flatlines at 10/192 for
|
||||||
|
the rest of the stage, even though 256 partitions keep completing over several
|
||||||
|
minutes. This matches the documented intent (§ Adaptive mechanism — "avoids
|
||||||
|
over-provisioning ... I/O-bound ... workloads") but conflates two different
|
||||||
|
things: *"CPU is not the bottleneck"* and *"more workers would not help"*. On
|
||||||
|
storage with real queue depth (NVMe, RAID, parallel FS) the second stage could
|
||||||
|
still benefit from more concurrent workers even with flat CPU usage — a signal
|
||||||
|
the current mechanism cannot see.
|
||||||
|
|
||||||
|
A one-off artefact was also found in the same log: right after a stage
|
||||||
|
transition, `do_i_activate` produced a physically impossible spike (efficiency
|
||||||
|
~94 cores on a 192-core box) because it has no minimum-window guard — unlike
|
||||||
|
its sibling `cpu_efficiency`, which returns `0.0` if `wall < 0.1s`
|
||||||
|
(`obisys::lib.rs:260`). `do_i_activate` unconditionally overwrites
|
||||||
|
`self.wall`/`self.user_secs`/`self.sys_secs` even when the elapsed window is
|
||||||
|
too short to be meaningful, so a burst of rapid completions right after
|
||||||
|
activating a worker can divide a real CPU delta by a near-zero wall delta.
|
||||||
|
|
||||||
|
### Implemented: I/O signal + shared debounce guard
|
||||||
|
|
||||||
|
`IoSample` (`obisys::lib.rs`, alongside `CpuSample`) is fed by
|
||||||
|
`read_bytes`/`write_bytes` from `/proc/self/io` on Linux (actual bytes
|
||||||
|
submitted to the block layer — not `rchar`/`wchar`, which also count
|
||||||
|
page-cache hits, and not `ru_inblock`/`ru_oublock`, unreliable on macOS), with
|
||||||
|
a `proc_pid_rusage(RUSAGE_INFO_V4)` fallback on macOS
|
||||||
|
(`ri_diskio_bytesread`/`ri_diskio_byteswritten`, FFI only via `libc`, no new
|
||||||
|
dependency — same pattern as the existing `getrusage` bindings). Any other
|
||||||
|
target degrades gracefully to a signal that never triggers (falls back to
|
||||||
|
CPU-only activation), same pattern as `cgroup_v2_available`.
|
||||||
|
|
||||||
|
`maybe_activate` (`numa.rs`) activates a worker if *either* signal still shows
|
||||||
|
headroom, making `PartitionRunner` adapt to whichever resource is actually the
|
||||||
|
bottleneck without per-call configuration. Both samplers are called
|
||||||
|
unconditionally — no `||` short-circuit — so neither window starves behind
|
||||||
|
whichever signal fires first:
|
||||||
|
|
||||||
|
```rust
|
||||||
|
let cpu_threshold = CPU_SPAWN_THRESHOLD * activation.last_step() as f64;
|
||||||
|
let cpu_wants_more = cpu_sample.do_i_activate(cpu_threshold);
|
||||||
|
let io_wants_more = io_sample.do_i_activate(IO_SPAWN_THRESHOLD);
|
||||||
|
if cpu_wants_more || io_wants_more {
|
||||||
|
activation.grow(GROWTH_DIVISOR, n_total);
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
The CPU threshold is *not* the flat absolute delta it started as: it scales
|
||||||
|
with `activation.last_step()` — the number of workers activated in the last
|
||||||
|
growth step, tracked by `NodeActivation` (`numa.rs`) and updated every time
|
||||||
|
`grow()` actually grows something. Growing by 8 workers should add ~8 cores of
|
||||||
|
efficiency if the workload is truly CPU-bound; requiring only
|
||||||
|
`CPU_SPAWN_THRESHOLD` (20 %) of that expected gain confirms the growth was
|
||||||
|
useful without demanding perfect linear scaling. Scaling by the *last step's
|
||||||
|
size* rather than the cumulative total keeps the bar equally meaningful
|
||||||
|
whether it's the 2nd growth step or the 20th — a flat absolute threshold
|
||||||
|
(0.2 core) is a strong signal at 8 active workers but pure noise at 150; a
|
||||||
|
threshold scaled by the *cumulative* total instead (considered and rejected)
|
||||||
|
would have made the bar essentially impossible to clear late in the ramp,
|
||||||
|
strangling exactly the CPU-bound saturation the mechanism exists to allow.
|
||||||
|
|
||||||
|
Unlike the CPU signal (an absolute delta in cores — a bounded, portable unit),
|
||||||
|
raw I/O throughput has no natural scale across devices, so `IoSample` uses a
|
||||||
|
**relative** growth threshold instead of an absolute one:
|
||||||
|
|
||||||
|
```rust
|
||||||
|
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
|
||||||
|
let elapsed = self.wall.elapsed().as_secs_f64();
|
||||||
|
if elapsed < 0.1 { return false; } // state untouched — window keeps accumulating
|
||||||
|
|
||||||
|
let n = Self::read_bytes();
|
||||||
|
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
|
||||||
|
let activate = if self.previous_rate == 0.0 {
|
||||||
|
rate > 0.0 // bootstrap: any measured throughput is signal
|
||||||
|
} else {
|
||||||
|
(rate - self.previous_rate) / self.previous_rate >= threshold
|
||||||
|
};
|
||||||
|
|
||||||
|
self.bytes = n;
|
||||||
|
self.wall = Instant::now(); // reset only on a real sample
|
||||||
|
activate
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
The `elapsed < 0.1s → return false without mutating state` guard was also
|
||||||
|
back-ported into `CpuSample::do_i_activate` (previously missing — source of
|
||||||
|
the ~94-core artefact above) — one fix for both problems, and it removes the
|
||||||
|
need for any arbitrary I/O-rate floor: a short/noisy window is rejected
|
||||||
|
outright rather than papered over with a hardware-dependent constant.
|
||||||
|
|
||||||
|
Both spawn thresholds (`CPU_SPAWN_THRESHOLD`, `IO_SPAWN_THRESHOLD`, module-level
|
||||||
|
`const` in `numa.rs`, both `0.2`) are a starting point, not a derived value:
|
||||||
|
`0.2` (20 % relative growth) for `IoSample` was chosen to match the CPU
|
||||||
|
threshold's *implicit* relative sensitivity (in the observed log, an 8→9
|
||||||
|
worker step raised efficiency by ~12 %) — but I/O throughput is lumpier than
|
||||||
|
CPU time (buffered writes flush in bursts), so it needs empirical validation
|
||||||
|
against a real `pack` run before being considered final.
|
||||||
|
|
||||||
|
## Known issue: ramp-up too slow, and confused with node count
|
||||||
|
|
||||||
|
The original design started `n_nodes` workers (one per node) and grew one
|
||||||
|
worker at a time. On a real `filter` run this took ~10 minutes to climb from
|
||||||
|
9 to ~40 active workers even on the CPU-bound `rebuild` stage — most of a
|
||||||
|
35-minute stage spent under-provisioned while waiting for evidence to
|
||||||
|
accumulate one worker at a time. There is no scale-down mechanism (`n_active`
|
||||||
|
only grows), so the original caution was deliberate — but a quarter of
|
||||||
|
available cores is still far from saturation, and the real risk zone (over-provisioning
|
||||||
|
a memory-bandwidth-bound stage) only shows up much later in the ramp, near
|
||||||
|
full occupancy — not at 25 %.
|
||||||
|
|
||||||
|
The fix decouples ramp speed from node *count*: both the initial size and the
|
||||||
|
growth step are a fraction of `workers_per_node` (node *size*), applied
|
||||||
|
identically on every node. A single-NUMA-node (UMA) machine ramps exactly as
|
||||||
|
fast as an 8-node one — growing by `n_nodes` per step, as first considered,
|
||||||
|
would have degenerated to "grow by 1" on UMA, reproducing the original
|
||||||
|
problem for exactly the machines that need the fix most.
|
||||||
|
|
||||||
|
```rust
|
||||||
|
// NodeActivation::grow — called both at startup (activate_initial) and on
|
||||||
|
// every CPU/IO-triggered growth step, with a different divisor each time.
|
||||||
|
let wanted = (self.caps[idx] / divisor).max(1); // INITIAL_DIVISOR=4 at startup, GROWTH_DIVISOR=8 per step
|
||||||
|
let room = self.caps[idx].saturating_sub(self.active[idx]);
|
||||||
|
let grow = wanted.min(room).min(n_total.saturating_sub(self.total));
|
||||||
|
```
|
||||||
|
|
||||||
|
This also fixed a latent correctness gap: the original single shared
|
||||||
|
`activate_tx`/`activate_rx` pair had *no* per-node addressing — sending one
|
||||||
|
activation signal woke up whichever dormant worker (from any node) happened
|
||||||
|
to win the race on that channel. `crossbeam_channel` gives no fairness
|
||||||
|
guarantee across competing receivers, so "round-robin across nodes" was an
|
||||||
|
assumption the code never actually enforced. `PartitionRunner::run` now opens
|
||||||
|
one activation channel per node (`activate_txs`/`activate_rxs`, one pair per
|
||||||
|
`NodeConfig`); `NodeActivation` (`numa.rs`) tracks how many of each node's
|
||||||
|
dormant workers have been woken and grows every node by the same amount per
|
||||||
|
step, capped by that node's remaining dormant workers and by the run's total
|
||||||
|
budget (`n_total`) — balance across nodes is now guaranteed by construction,
|
||||||
|
not incidental to channel implementation details.
|
||||||
|
|
||||||
## Open questions
|
## Open questions
|
||||||
|
|
||||||
- **Error handling**: `run` currently returns the first error; remaining errors
|
- **Error handling**: `run` currently returns the first error; remaining errors
|
||||||
are dropped. A `Vec<E>` return would give complete diagnostics.
|
are dropped. A `Vec<E>` return would give complete diagnostics.
|
||||||
|
|
||||||
- **`workers_per_node` tuning**: currently `(cpus / 8).max(3).min(8)`, calibrated
|
- **`INITIAL_DIVISOR` / `GROWTH_DIVISOR` tuning**: currently `4` and `8`
|
||||||
for merge on BeeGFS. I/O-bound commands (`dump`, `select`) may benefit from
|
(start at 1/4 of a node's cores, grow by 1/8 per step), chosen to fix an
|
||||||
a higher value. A per-call override could be added to the API.
|
observed too-slow ramp — not yet validated against a real `pack` (I/O-bound)
|
||||||
|
run, where over-provisioning risk is different from the CPU-bound `rebuild`
|
||||||
|
case this was tuned against.
|
||||||
|
|
||||||
- **`on_done` ordering**: the runner serialises calls to `on_done` via an
|
- **`on_done` ordering**: the runner serialises calls to `on_done` via an
|
||||||
internal `Arc<Mutex<C>>`. `Send` is required (the Arc clone crosses thread
|
internal `Arc<Mutex<C>>`. `Send` is required (the Arc clone crosses thread
|
||||||
|
|||||||
@@ -29,16 +29,23 @@ Multiple values separated by `|` are always OR-ed within the predicate.
|
|||||||
|
|
||||||
### Path matching (`~` and `!~`)
|
### Path matching (`~` and `!~`)
|
||||||
|
|
||||||
Metadata values can represent hierarchical taxonomic paths such as
|
Metadata values can represent hierarchical concept paths such as
|
||||||
`/Eukaryota/Viridiplantae/Streptophyta/Betulaceae/Betula/nana`.
|
`/Eukaryota/Viridiplantae/Streptophyta/Betulaceae/Betula/nana`.
|
||||||
|
|
||||||
- **Absolute pattern** (starts with `/`): the value must start with the pattern
|
Stored taxonomy values always start with `/` (the root of the path).
|
||||||
at a segment boundary.
|
Query patterns do **not** need to start with `/` — a leading `/` is an optional
|
||||||
`taxon~/Betulaceae/Betula` matches `/Betulaceae/Betula/nana` and
|
start anchor, not a requirement.
|
||||||
`/Betulaceae/Betula` but not `/Betulaceae/Betuloides/…`.
|
|
||||||
- **Bare segment** (no leading `/`): the value must contain the pattern as an
|
| Pattern form | Semantics |
|
||||||
exact path component anywhere.
|
|---|---|
|
||||||
`taxon~Betula` matches any path that has `Betula` as one of its segments.
|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
|
||||||
|
| `/A/B` | value starts with A then B |
|
||||||
|
| `A/B$` | value ends with A then B |
|
||||||
|
| `/A/B$` | value is exactly A then B |
|
||||||
|
| `A@x/B` | A with class `x` followed by B with any class |
|
||||||
|
|
||||||
|
- `taxon~/Betulaceae/Betula` matches any path that starts with `Betulaceae` then `Betula`.
|
||||||
|
- `taxon~Betula` matches any path containing `Betula` as a segment, anywhere.
|
||||||
|
|
||||||
### Missing metadata key → NA
|
### Missing metadata key → NA
|
||||||
|
|
||||||
|
|||||||
@@ -5,12 +5,11 @@
|
|||||||
```
|
```
|
||||||
src/obicompactvec/src/
|
src/obicompactvec/src/
|
||||||
lib.rs public re-exports
|
lib.rs public re-exports
|
||||||
traits.rs BitSlice, BitSliceMut, IntSlice, IntSliceMut + conversion traits
|
views.rs BitSliceView<'a>, IntSliceView<'a> — zero-copy read views
|
||||||
|
traits.rs ColumnWeights, CountPartials, BitPartials (matrix aggregation)
|
||||||
bitvec.rs PersistentBitVec, PersistentBitVecBuilder, BitIter
|
bitvec.rs PersistentBitVec, PersistentBitVecBuilder, BitIter
|
||||||
memoryvec.rs MemoryBitVec
|
|
||||||
reader.rs PersistentCompactIntVec (read-only)
|
reader.rs PersistentCompactIntVec (read-only)
|
||||||
builder.rs PersistentCompactIntVecBuilder (read-write)
|
builder.rs PersistentCompactIntVecBuilder (read-write)
|
||||||
memoryintvec.rs MemoryIntVec
|
|
||||||
tempintvec.rs TempCompactIntVec, TempCompactIntVecBuilder (temp-file-backed)
|
tempintvec.rs TempCompactIntVec, TempCompactIntVecBuilder (temp-file-backed)
|
||||||
tempbitvec.rs TempBitVec, TempBitVecBuilder (temp-file-backed)
|
tempbitvec.rs TempBitVec, TempBitVecBuilder (temp-file-backed)
|
||||||
bitmatrix.rs PersistentBitMatrix, PersistentBitMatrixBuilder
|
bitmatrix.rs PersistentBitMatrix, PersistentBitMatrixBuilder
|
||||||
@@ -23,20 +22,20 @@ src/obicompactvec/src/
|
|||||||
|
|
||||||
```mermaid
|
```mermaid
|
||||||
graph TD
|
graph TD
|
||||||
traits --> memoryvec
|
views --> bitvec
|
||||||
traits --> memoryintvec
|
views --> builder
|
||||||
bitvec --> memoryvec
|
views --> tempbitvec
|
||||||
bitvec --> bitmatrix
|
views --> tempintvec
|
||||||
bitvec --> tempbitvec
|
views --> bitmatrix
|
||||||
|
views --> intmatrix
|
||||||
format --> reader
|
format --> reader
|
||||||
format --> builder
|
format --> builder
|
||||||
reader --> intmatrix
|
reader --> intmatrix
|
||||||
reader --> tempintvec
|
reader --> tempintvec
|
||||||
builder --> intmatrix
|
builder --> intmatrix
|
||||||
builder --> memoryintvec
|
|
||||||
builder --> tempintvec
|
builder --> tempintvec
|
||||||
memoryvec --> traits
|
bitvec --> tempbitvec
|
||||||
memoryintvec --> traits
|
bitvec --> bitmatrix
|
||||||
tempintvec --> intmatrix
|
tempintvec --> intmatrix
|
||||||
tempintvec --> bitmatrix
|
tempintvec --> bitmatrix
|
||||||
tempbitvec --> intmatrix
|
tempbitvec --> intmatrix
|
||||||
@@ -62,7 +61,7 @@ All integer vectors use the same two-tier encoding regardless of storage backend
|
|||||||
|
|
||||||
**Overflow store** — maps slot index to a `u32` value ≥ 255:
|
**Overflow store** — maps slot index to a `u32` value ≥ 255:
|
||||||
|
|
||||||
- In `MemoryIntVec` and `PersistentCompactIntVecBuilder`: a `HashMap<usize, u32>` in RAM.
|
- In `PersistentCompactIntVecBuilder`: a `HashMap<usize, u32>` in RAM.
|
||||||
- In `PersistentCompactIntVec` (reader): a sorted `[(slot: u64, value: u32)]` array in the mmap, with a sparse L1-resident index for binary search.
|
- In `PersistentCompactIntVec` (reader): a sorted `[(slot: u64, value: u32)]` array in the mmap, with a sparse L1-resident index for binary search.
|
||||||
|
|
||||||
```mermaid
|
```mermaid
|
||||||
@@ -70,13 +69,12 @@ flowchart LR
|
|||||||
slot --> P["primary[slot]: u8"]
|
slot --> P["primary[slot]: u8"]
|
||||||
P -->|"< 255"| V["value = byte (0–254)"]
|
P -->|"< 255"| V["value = byte (0–254)"]
|
||||||
P -->|"= 255 sentinel"| OV["overflow store"]
|
P -->|"= 255 sentinel"| OV["overflow store"]
|
||||||
OV -->|"MemoryIntVec / Builder"| HM["HashMap<usize, u32>\nin RAM"]
|
OV -->|"Builder"| HM["HashMap<usize, u32>\nin RAM"]
|
||||||
OV -->|"PersistentCompactIntVec"| SA["sorted [(slot,value)] in mmap\n+ sparse L1 index"]
|
OV -->|"PersistentCompactIntVec"| SA["sorted [(slot,value)] in mmap\n+ sparse L1 index"]
|
||||||
```
|
```
|
||||||
|
|
||||||
**Key property — sentinel 255 = +∞ on `u8`:**
|
**Key property — sentinel 255 = +∞ on `u8`:**
|
||||||
|
|
||||||
This is exploited throughout the binary operations. On a `u8` comparison, 255 behaves as positive infinity:
|
|
||||||
- `min(a, 255) = a` for all `a ≤ 254` → correct when only one side is overflow
|
- `min(a, 255) = a` for all `a ≤ 254` → correct when only one side is overflow
|
||||||
- `max(a, 255) = 255` → correct sentinel when either side is overflow
|
- `max(a, 255) = 255` → correct sentinel when either side is overflow
|
||||||
- Only the **both-overflow** case requires reading actual values from the overflow store.
|
- Only the **both-overflow** case requires reading actual values from the overflow store.
|
||||||
@@ -85,274 +83,60 @@ In practice, k (overflow count) ≪ n (total slots). Observed genomic data: ~0.0
|
|||||||
|
|
||||||
---
|
---
|
||||||
|
|
||||||
## Trait hierarchy
|
## View types
|
||||||
|
|
||||||
```mermaid
|
The previous trait hierarchy (`BitSlice`, `BitSliceMut`, `IntSlice`, `IntSliceMut`) has been replaced by two concrete zero-copy view structs with inherent methods. Views are **`Copy`** — passing them is free. All read operations live on these two types.
|
||||||
classDiagram
|
|
||||||
class BitSlice {
|
### `BitSliceView<'a>`
|
||||||
<<trait>>
|
|
||||||
+len() usize
|
```rust
|
||||||
+words() &[u64]
|
#[derive(Clone, Copy)]
|
||||||
+get(slot) bool
|
pub struct BitSliceView<'a> { pub(crate) words: &'a [u64], pub(crate) n: usize }
|
||||||
+count_ones() u64
|
|
||||||
+count_zeros() u64
|
|
||||||
+partial_jaccard_dist(other) (u64,u64)
|
|
||||||
+jaccard_dist(other) f64
|
|
||||||
+hamming_dist(other) u64
|
|
||||||
}
|
|
||||||
class BitSliceMut {
|
|
||||||
<<trait>>
|
|
||||||
+words_mut() &mut [u64]
|
|
||||||
+set(slot, value)
|
|
||||||
+copy_from(src)
|
|
||||||
+and(other)
|
|
||||||
+or(other)
|
|
||||||
+xor(other)
|
|
||||||
+not()
|
|
||||||
}
|
|
||||||
class IntSlice {
|
|
||||||
<<trait>>
|
|
||||||
+len() usize
|
|
||||||
+get(slot) u32
|
|
||||||
+primary_bytes() &[u8]
|
|
||||||
+overflow_entries() Iterator
|
|
||||||
+iter() Iterator
|
|
||||||
+sum() u64
|
|
||||||
+count_nonzero() u64
|
|
||||||
+cmp_scalar(pred) MemoryBitVec
|
|
||||||
+lt/leq/gt/geq(t) MemoryBitVec
|
|
||||||
}
|
|
||||||
class IntSliceMut {
|
|
||||||
<<trait>>
|
|
||||||
+set(slot, value)
|
|
||||||
+primary_bytes_mut() &mut [u8]
|
|
||||||
+clear_overflow()
|
|
||||||
+inc/dec/add_at(slot)
|
|
||||||
+copy_from(src)
|
|
||||||
+min/max/add/diff(other)
|
|
||||||
+count_bits(bits)
|
|
||||||
}
|
|
||||||
class IntToBit {
|
|
||||||
<<trait blanket>>
|
|
||||||
+to_bitvec(threshold) MemoryBitVec
|
|
||||||
+to_presence() MemoryBitVec
|
|
||||||
}
|
|
||||||
class BitToInt {
|
|
||||||
<<trait blanket>>
|
|
||||||
+to_intvec() MemoryIntVec
|
|
||||||
}
|
|
||||||
BitSliceMut --|> BitSlice : extends
|
|
||||||
IntSliceMut --|> IntSlice : extends
|
|
||||||
IntToBit --|> IntSlice : blanket T:IntSlice
|
|
||||||
BitToInt --|> BitSlice : blanket T:BitSlice
|
|
||||||
```
|
```
|
||||||
|
|
||||||
### BitSlice (read-only)
|
Bit `i` is at `words[i >> 6]` bit `i & 63` (LSB-first). Padding bits in the last word are zero.
|
||||||
|
|
||||||
Required: `len()`, `words() -> &[u64]`.
|
| Method | Cost |
|
||||||
|
|---|---|
|
||||||
|
| `len()`, `is_empty()` | O(1) |
|
||||||
|
| `get(slot)` | O(1) |
|
||||||
|
| `count_ones()` | POPCNT per word, O(n/64) |
|
||||||
|
| `count_zeros()` | `n − count_ones()`, O(n/64) |
|
||||||
|
| `iter() -> BitSliceIter<'a>` | O(1) setup, O(n) iteration |
|
||||||
|
| `partial_jaccard_dist(other: BitSliceView)` | `(a&b).popcount`, `(a\|b).popcount` per word, O(n/64) |
|
||||||
|
| `jaccard_dist(other: BitSliceView)` | from partial, O(n/64) |
|
||||||
|
| `hamming_dist(other: BitSliceView)` | `(a^b).popcount` per word, O(n/64) |
|
||||||
|
|
||||||
Bit `i` is at `words()[i >> 6]` bit `i & 63` (LSB-first). Padding bits in the last word are always zero — this invariant must be maintained by all implementors.
|
`BitSliceIter<'a>`: word-level scan; one word per 64 iterations.
|
||||||
|
|
||||||
| Provided method | Implementation | Cost |
|
### `IntSliceView<'a>`
|
||||||
|---|---|---|
|
|
||||||
| `is_empty()` | `len() == 0` | O(1) |
|
|
||||||
| `get(slot)` | word extract | O(1) |
|
|
||||||
| `count_ones()` | POPCNT per word | O(n/64) |
|
|
||||||
| `count_zeros()` | `n − count_ones()` | O(n/64) |
|
|
||||||
| `partial_jaccard_dist(other)` | `(a&b).popcount`, `(a\|b).popcount` per word | O(n/64) |
|
|
||||||
| `jaccard_dist(other)` | from partial | O(n/64) |
|
|
||||||
| `hamming_dist(other)` | `(a^b).popcount` per word | O(n/64) |
|
|
||||||
|
|
||||||
### BitSliceMut: BitSlice (mutable)
|
```rust
|
||||||
|
#[derive(Clone, Copy)]
|
||||||
Required: `words_mut() -> &mut [u64]`.
|
pub struct IntSliceView<'a> {
|
||||||
|
pub(crate) primary: &'a [u8],
|
||||||
All bulk operations work at the word level (64 bits/iteration). The compiler auto-vectorizes these loops to AVX2/AVX-512. The zero-padding invariant is maintained: `not()` re-masks the last word after flipping.
|
pub(crate) overflow_raw: &'a [u8], // sorted [(slot:u64, value:u32)] entries
|
||||||
|
pub(crate) n_overflow: usize,
|
||||||
| Provided method | Implementation | Cost |
|
pub(crate) n: usize,
|
||||||
|---|---|---|
|
}
|
||||||
| `set(slot, value)` | OR / AND-NOT on one word | O(1) |
|
|
||||||
| `copy_from(src)` | `copy_from_slice` = memcpy | O(n/64) |
|
|
||||||
| `and(other)` | `w &= o` per word | O(n/64) |
|
|
||||||
| `or(other)` | `w \|= o` per word | O(n/64) |
|
|
||||||
| `xor(other)` | `w ^= o` per word | O(n/64) |
|
|
||||||
| `not()` | `w ^= u64::MAX` per word, then mask last | O(n/64) |
|
|
||||||
|
|
||||||
**No overflow complexity here.** The packed `u64` representation is already the natural unit for SIMD operations. No sentinel, no HashMap — just bitwise word ops.
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
### IntSlice (read-only)
|
|
||||||
|
|
||||||
Required:
|
|
||||||
- `len() -> usize`
|
|
||||||
- `get(slot) -> u32` — handles sentinel transparently (binary search into overflow for persistent, HashMap for memory)
|
|
||||||
- `primary_bytes() -> &[u8]` — raw primary array including 255 sentinels
|
|
||||||
- `overflow_entries() -> impl Iterator<Item = (usize, u32)>` — (slot, true_value) pairs for all overflow slots
|
|
||||||
|
|
||||||
| Provided method | Default implementation | Note |
|
|
||||||
|---|---|---|
|
|
||||||
| `is_empty()` | `len() == 0` | |
|
|
||||||
| `iter()` | `(0..n).map(\|i\| self.get(i))` | Overridden in all concrete types |
|
|
||||||
| `sum()` | `iter().map(\|v\| v as u64).sum()` | Overridden in concrete types |
|
|
||||||
| `count_nonzero()` | `iter().filter(\|v\| *v > 0).count()` | Overridden in concrete types |
|
|
||||||
| `lt(t)` | `cmp_scalar(\|v\| v < t)` | |
|
|
||||||
| `leq(t)` | `cmp_scalar(\|v\| v <= t)` | |
|
|
||||||
| `gt(t)` | `cmp_scalar(\|v\| v > t)` | |
|
|
||||||
| `geq(t)` | `cmp_scalar(\|v\| v >= t)` | |
|
|
||||||
| `cmp_scalar(pred)` | two-pass (see below) | |
|
|
||||||
|
|
||||||
**`cmp_scalar` algorithm — two passes:**
|
|
||||||
|
|
||||||
```
|
|
||||||
Pass 1 — byte scan, O(n):
|
|
||||||
for s in 0..n:
|
|
||||||
b = primary[s]
|
|
||||||
if b < 255 AND pred(b as u32):
|
|
||||||
set bit s in result word
|
|
||||||
|
|
||||||
Pass 2 — overflow fixup, O(k):
|
|
||||||
for (s, val) in overflow_entries():
|
|
||||||
if pred(val): set bit s in result word
|
|
||||||
```
|
```
|
||||||
|
|
||||||
Pass 1 reads only the primary byte array — no HashMap access. For simple predicates (`geq`, `lt`, etc.) the compiler inlines `pred` and can auto-vectorize the byte comparison loop. Pass 2 handles the O(k) overflow slots that were left as 0 in pass 1.
|
`overflow_raw` contains `n_overflow` entries of `OVERFLOW_ENTRY_SIZE` bytes each, sorted by slot. The sort invariant is established at `close()`/`freeze()` time.
|
||||||
|
|
||||||
Previous implementation: `pred(self.get(s))` for every slot → O(n log k) due to binary search in overflow. New: O(n) + O(k).
|
| Method | Cost |
|
||||||
|
|---|---|
|
||||||
|
| `len()`, `is_empty()` | O(1) |
|
||||||
|
| `primary_bytes()` | O(1) |
|
||||||
|
| `overflow_entries() -> impl Iterator<(usize,u32)>` | O(n_overflow) iteration |
|
||||||
|
| `get(slot)` | O(1) primary; binary search O(log k) for overflow slots |
|
||||||
|
| `iter() -> IntSliceViewIter<'a>` | merge scan, O(n + k) |
|
||||||
|
| `sum()` | byte scan + overflow, O(n + k) |
|
||||||
|
| `count_nonzero()` | byte scan, O(n) |
|
||||||
|
| Distance methods (`bray_dist`, `euclidean_dist`, `jaccard_dist`, …) | O(n + k) |
|
||||||
|
|
||||||
---
|
`IntSliceViewIter<'a>`: merge scan using `overflow_pos` index. Requires sorted overflow — guaranteed by the construction lifecycle.
|
||||||
|
|
||||||
### IntSliceMut: IntSlice (mutable)
|
**Builder `view()` vs reader `view()`:** `PersistentCompactIntVecBuilder` stores overflow as an unsorted `HashMap`, not raw bytes. Its `view()` returns an `IntSliceView` with `overflow_raw = &[]` and `n_overflow = 0`. This is intentional — the view is primarily useful after `freeze()`. During building, callers that need overflow use `overflow_entries()` directly.
|
||||||
|
|
||||||
Required:
|
|
||||||
- `set(slot, value: u32)` — writes primary byte (or 255 + overflow entry if value ≥ 255); removes stale overflow entry if value drops below 255
|
|
||||||
- `primary_bytes_mut() -> &mut [u8]` — direct mutable access to the primary array
|
|
||||||
- `clear_overflow()` — empties the entire overflow store
|
|
||||||
|
|
||||||
The required methods expose the encoding internals. All provided methods are implemented in terms of these three + the `IntSlice` required methods.
|
|
||||||
|
|
||||||
| Provided method | Hot path | Overflow case | Cost |
|
|
||||||
|---|---|---|---|
|
|
||||||
| `inc(slot)` | `get` + `set` | — | O(1) or O(log k) |
|
|
||||||
| `dec(slot)` | `get` + `set` (saturating) | — | O(1) or O(log k) |
|
|
||||||
| `add_at(slot, delta)` | `get` + `set` (saturating) | — | O(1) or O(log k) |
|
|
||||||
| `copy_from(src)` | `copy_from_slice` + `clear_overflow` + replay overflows | — | O(n) + O(k) |
|
|
||||||
| `min(other)` | byte-level min, O(n) | both-overflow fixup, O(k) | O(n) |
|
|
||||||
| `max(other)` | byte-level max, O(n) | pre-pass on other's overflows, O(k) | O(n) |
|
|
||||||
| `add(other)` | byte add when both < 255, O(n) | `get` + `+` when either = 255 | O(n) |
|
|
||||||
| `diff(other)` | byte saturating_sub when self < 255, O(n) | `get` + `saturating_sub` when self = 255 | O(n) |
|
|
||||||
| `count_bits(bits)` | iterate set bits via word scan | — | O(n_ones) |
|
|
||||||
| `cmp_scalar` | inherited from IntSlice | — | O(n) + O(k) |
|
|
||||||
|
|
||||||
**`min` algorithm:**
|
|
||||||
|
|
||||||
Exploits 255 = +∞: `u8::min(a, 255) = a` and `u8::min(255, b) = b`. Only the case where both sides are ≥ 255 needs actual overflow values.
|
|
||||||
|
|
||||||
```mermaid
|
|
||||||
flowchart TD
|
|
||||||
A["min(self, other)"] --> B["snapshot self_ov: Vec<(slot,val)>\nsnapshot other_ov: HashMap<slot,val>"]
|
|
||||||
B --> C["clear_overflow()"]
|
|
||||||
C --> D["Pass 1 — byte min, SIMD-vectorizable\nprimary[s] = min(self[s], other[s]) ∀s"]
|
|
||||||
D --> E["Pass 2 — both-overflow fixup\nfor (slot, self_val) in self_ov"]
|
|
||||||
E --> F{"slot ∈ other_ov?"}
|
|
||||||
F -->|yes| G["set(slot, min(self_val, other_ov[slot]))"]
|
|
||||||
F -->|no| H["byte pass wrote other.primary < 255\nclear_overflow removed stale entry\nno action"]
|
|
||||||
G --> I[done]
|
|
||||||
H --> I
|
|
||||||
```
|
|
||||||
|
|
||||||
Overflow entries where only self was overflow are correctly handled: after `clear_overflow` + byte pass, `self.primary[slot] = min(255, other.primary[slot]) = other.primary[slot]` (which is < 255). No overflow entry — correct.
|
|
||||||
|
|
||||||
**`max` algorithm:**
|
|
||||||
|
|
||||||
Exploits 255 = +∞: `u8::max(a, 255) = 255` → any slot where either side is overflow will have sentinel 255 in the primary after the byte pass. The byte pass cannot distinguish "self had overflow and other did not" from "self was just written to 255 by the byte pass".
|
|
||||||
|
|
||||||
Solution: read and update self's original value at other's overflow slots *before* the byte pass overwrites them.
|
|
||||||
|
|
||||||
```mermaid
|
|
||||||
flowchart TD
|
|
||||||
A["max(self, other)"] --> B["Pre-pass O(k_other)\nfor (slot, other_val) in other.overflow_entries()"]
|
|
||||||
B --> C["self_val = self.get(slot)\nself.set(slot, max(self_val, other_val))"]
|
|
||||||
C --> D["Pass 1 — byte max, SIMD-vectorizable\nprimary[s] = max(self[s], other[s]) ∀s"]
|
|
||||||
D --> E["Overflow slots: max(255,255)=255\nprimary unchanged\noverflow entry from pre-pass preserved"]
|
|
||||||
E --> F[done]
|
|
||||||
```
|
|
||||||
|
|
||||||
After the pre-pass, self.primary[slot] = 255 for all slots in other's overflow. The byte pass leaves those 255s intact. Self's own overflow slots not in other's overflow are also 255 in primary — byte max(255, b < 255) = 255, unchanged. Correct in all cases.
|
|
||||||
|
|
||||||
**`add` algorithm:**
|
|
||||||
|
|
||||||
No sentinel property useful for add: any pair (sb, ob) with sb + ob ≥ 255 creates a new overflow entry, even when neither input was overflow. Cannot simplify via byte arithmetic.
|
|
||||||
|
|
||||||
```
|
|
||||||
for s in 0..n:
|
|
||||||
sb = self.primary[s]
|
|
||||||
ob = other.primary[s]
|
|
||||||
if sb < 255 AND ob < 255: // hot path: no HashMap
|
|
||||||
sum = sb as u32 + ob as u32
|
|
||||||
if sum < 255: self.primary[s] = sum as u8 // direct byte write
|
|
||||||
else: self.set(s, sum) // creates overflow if needed
|
|
||||||
else: // at least one is overflow
|
|
||||||
self.set(s, self.get(s) + other.get(s))
|
|
||||||
```
|
|
||||||
|
|
||||||
```mermaid
|
|
||||||
flowchart TD
|
|
||||||
A["add(self, other)"] --> B{"sb < 255\nAND ob < 255"}
|
|
||||||
B -->|"yes — hot path\nno HashMap"| C{"sb + ob < 255"}
|
|
||||||
C -->|yes| D["primary[s] = sum as u8\nsingle byte write"]
|
|
||||||
C -->|no| E["set(s, sum)\ncreates overflow entry"]
|
|
||||||
B -->|"no — ≥1 side is overflow"| F["self_val = self.get(s)\nother_val = other.get(s)\nset(s, self_val + other_val)"]
|
|
||||||
D --> Z[next slot]
|
|
||||||
E --> Z
|
|
||||||
F --> Z
|
|
||||||
```
|
|
||||||
|
|
||||||
The `+` on `u32` values is exact (no `saturating_add`). Overflow at u32 level panics in debug — not a real risk for kmer counts. The hot path (both < 255, sum < 255) is a single byte write with no HashMap access.
|
|
||||||
|
|
||||||
**`diff` (saturating sub) algorithm:**
|
|
||||||
|
|
||||||
`saturating_sub(a, b) = a − min(a, b) = max(0, a − b)`. Key insight: if self's primary byte < 255, the result is always < 255 (result ≤ a), so no new overflow entries are created and no overflow lookup is needed for self. Only self's overflow slots (primary = 255) need `get()`.
|
|
||||||
|
|
||||||
| sb | ob | result | get() needed |
|
|
||||||
|----|----|--------|-------------|
|
|
||||||
| < 255 | < 255 | `sb.saturating_sub(ob)` < 255 | none |
|
|
||||||
| < 255 | 255 | 0 (b ≥ 255 > a) | none |
|
|
||||||
| 255 | < 255 | `self.get(s) − ob` | self only |
|
|
||||||
| 255 | 255 | `self.get(s) − other.get(s)` | both |
|
|
||||||
|
|
||||||
```mermaid
|
|
||||||
flowchart TD
|
|
||||||
A["diff(self, other)"] --> B{"sb < 255\nself not overflow"}
|
|
||||||
B -->|"yes — hot path O(n)"| C{"ob < 255"}
|
|
||||||
C -->|yes| D["primary[s] = sb.saturating_sub(ob)\nbyte write, no HashMap"]
|
|
||||||
C -->|"no: b ≥ 255 > a"| E["primary[s] = 0"]
|
|
||||||
B -->|"no — cold path O(k_self)"| F["self_val = self.get(s)"]
|
|
||||||
F --> G{"ob < 255"}
|
|
||||||
G -->|yes| H["other_val = ob as u32"]
|
|
||||||
G -->|no| I["other_val = other.get(s)"]
|
|
||||||
H --> J["set(s, self_val.saturating_sub(other_val))"]
|
|
||||||
I --> J
|
|
||||||
D --> Z[next slot]
|
|
||||||
E --> Z
|
|
||||||
J --> Z
|
|
||||||
```
|
|
||||||
|
|
||||||
Overflow entries that drop below 255 (case sb=255, result < 255) are removed by `set()`. Overflow entries that remain ≥ 255 are updated. Correct in all four cases.
|
|
||||||
|
|
||||||
**`count_bits` algorithm:**
|
|
||||||
|
|
||||||
Increments self at each slot where the corresponding bit in `bits` is set. Iterates `bits.words()` and skips zero words entirely — O(n_ones) rather than O(n).
|
|
||||||
|
|
||||||
```
|
|
||||||
for (w_idx, word) in bits.words():
|
|
||||||
if word == 0: continue
|
|
||||||
base = w_idx * 64
|
|
||||||
while word != 0:
|
|
||||||
bit = trailing_zeros(word)
|
|
||||||
self.inc(base + bit)
|
|
||||||
word &= word − 1 // clear lowest set bit
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
---
|
||||||
|
|
||||||
@@ -360,142 +144,149 @@ for (w_idx, word) in bits.words():
|
|||||||
|
|
||||||
```mermaid
|
```mermaid
|
||||||
classDiagram
|
classDiagram
|
||||||
class MemoryBitVec {
|
class BitSliceView {
|
||||||
-words: Vec~u64~
|
+words: &[u64]
|
||||||
-n: usize
|
+n: usize
|
||||||
+iter() BitIter
|
+get(slot) bool
|
||||||
+ones(n) Self
|
+count_ones() u64
|
||||||
+persist(path) Builder
|
+iter() BitSliceIter
|
||||||
|
+jaccard_dist/hamming_dist(other: BitSliceView)
|
||||||
}
|
}
|
||||||
class MemoryIntVec {
|
class IntSliceView {
|
||||||
-primary: Vec~u8~
|
+primary: &[u8]
|
||||||
-overflow: HashMap~usize,u32~
|
+overflow_raw: &[u8]
|
||||||
-n: usize
|
+n_overflow: usize
|
||||||
+iter() MemoryIntIter
|
+n: usize
|
||||||
+filled(n, value) Self
|
+get(slot) u32
|
||||||
+persist(path) Builder
|
+iter() IntSliceViewIter
|
||||||
|
+overflow_entries() Iterator
|
||||||
|
+bray_dist/euclidean_dist/…(other: IntSliceView)
|
||||||
}
|
}
|
||||||
class PersistentBitVec {
|
class PersistentBitVec {
|
||||||
-mmap: Mmap
|
-mmap: Mmap
|
||||||
-n: usize
|
-n: usize
|
||||||
|
+view() BitSliceView
|
||||||
|
+get(slot) bool
|
||||||
|
+count_ones/zeros() u64
|
||||||
+iter() BitIter
|
+iter() BitIter
|
||||||
+count_ones() u64
|
+partial_jaccard_dist(&Self) (u64,u64)
|
||||||
|
+jaccard_dist/hamming_dist(&Self) …
|
||||||
}
|
}
|
||||||
class PersistentBitVecBuilder {
|
class PersistentBitVecBuilder {
|
||||||
-mmap: MmapMut
|
-mmap: MmapMut
|
||||||
-n: usize
|
-n: usize
|
||||||
+close()
|
+view() BitSliceView
|
||||||
+build_from(src, path)
|
+set(slot, bool)
|
||||||
+build_from_counts(src, t, path)
|
+or/and/xor/not(BitSliceView)
|
||||||
|
+copy_from(BitSliceView)
|
||||||
|
+close() / finish() → PersistentBitVec
|
||||||
}
|
}
|
||||||
class PersistentCompactIntVec {
|
class PersistentCompactIntVec {
|
||||||
-mmap: Mmap
|
-mmap: Mmap
|
||||||
-n usize
|
-n: usize
|
||||||
-n_overflow usize
|
-n_overflow: usize
|
||||||
-step usize
|
-step: usize
|
||||||
-index: Vec~(usize,usize)~
|
-index: Vec~(usize,usize)~
|
||||||
+iter() Iter
|
+view() IntSliceView
|
||||||
+get(slot) u32
|
+get(slot) u32
|
||||||
+sum() u64
|
+iter() Iter
|
||||||
|
+sum/count_nonzero() u64
|
||||||
|
+bray_dist/euclidean_dist/… (&Self)
|
||||||
}
|
}
|
||||||
class PersistentCompactIntVecBuilder {
|
class PersistentCompactIntVecBuilder {
|
||||||
-mmap: MmapMut
|
-mmap: MmapMut
|
||||||
-n: usize
|
-n: usize
|
||||||
-overflow: HashMap~usize,u32~
|
-overflow: HashMap~usize,u32~
|
||||||
+set(slot, value)
|
+view() IntSliceView
|
||||||
+close()
|
+set(slot, u32) / get(slot) u32
|
||||||
+build_from(src, path)
|
+inc / inc_present / inc_present_fast
|
||||||
|
+inc_predicate / inc_predicate_fast
|
||||||
|
+add/min/max/diff/mask_with(…View)
|
||||||
|
+primary_bytes/primary_bytes_mut()
|
||||||
|
+close() / finish() → PersistentCompactIntVec
|
||||||
}
|
}
|
||||||
|
|
||||||
MemoryBitVec ..|> BitSlice
|
PersistentBitVec --> BitSliceView : view()
|
||||||
MemoryBitVec ..|> BitSliceMut
|
PersistentBitVecBuilder --> BitSliceView : view()
|
||||||
PersistentBitVec ..|> BitSlice
|
PersistentCompactIntVec --> IntSliceView : view()
|
||||||
PersistentBitVecBuilder ..|> BitSlice
|
PersistentCompactIntVecBuilder --> IntSliceView : view() (primary only)
|
||||||
PersistentBitVecBuilder ..|> BitSliceMut
|
|
||||||
MemoryIntVec ..|> IntSlice
|
|
||||||
MemoryIntVec ..|> IntSliceMut
|
|
||||||
PersistentCompactIntVec ..|> IntSlice
|
|
||||||
PersistentCompactIntVecBuilder ..|> IntSlice
|
|
||||||
PersistentCompactIntVecBuilder ..|> IntSliceMut
|
|
||||||
|
|
||||||
PersistentBitVecBuilder --> PersistentBitVec : close() then open()
|
PersistentBitVecBuilder --> PersistentBitVec : close() then open()
|
||||||
PersistentCompactIntVecBuilder --> PersistentCompactIntVec : close() then open()
|
PersistentCompactIntVecBuilder --> PersistentCompactIntVec : close() then open()
|
||||||
```
|
```
|
||||||
|
|
||||||
### Memory types
|
### `PersistentBitVec` / `PersistentBitVecBuilder`
|
||||||
|
|
||||||
**`MemoryBitVec`**
|
`PersistentBitVec` is the read-only type. `view()` returns a `BitSliceView<'_>` over the mmap word array. Direct inherent methods delegate to the view: `count_ones()`, `count_zeros()`, `partial_jaccard_dist(&Self)`, `jaccard_dist(&Self)`, `hamming_dist(&Self)`.
|
||||||
|
|
||||||
```rust
|
`BitIter<'a>` — exported iterator for `PersistentBitVec::iter()`:
|
||||||
struct MemoryBitVec { words: Vec<u64>, n: usize }
|
|
||||||
```
|
|
||||||
|
|
||||||
Implements `BitSlice` + `BitSliceMut`. Owns its word array. Used as the result type of `cmp_scalar` / filter operations and as an intermediate for bit-level computations.
|
|
||||||
|
|
||||||
Std ops: `BitAnd`, `BitOr`, `BitXor`, `Not` (owned and borrowed), `BitAndAssign`, `BitOrAssign`, `BitXorAssign` — all delegate to `BitSliceMut` methods.
|
|
||||||
|
|
||||||
`iter()` returns a `BitIter<'_>` (word-level, see below).
|
|
||||||
|
|
||||||
**`MemoryIntVec`**
|
|
||||||
|
|
||||||
```rust
|
|
||||||
struct MemoryIntVec {
|
|
||||||
primary: Vec<u8>,
|
|
||||||
overflow: HashMap<usize, u32>,
|
|
||||||
n: usize,
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
Implements `IntSlice` + `IntSliceMut`. Overrides: `iter()` → inherent `iter()` (merge-scan), `sum()`, `count_nonzero()`.
|
|
||||||
|
|
||||||
`IntSlice` required impls: `primary_bytes()` → `&self.primary`; `overflow_entries()` → `self.overflow.iter().map(...)`.
|
|
||||||
|
|
||||||
`IntSliceMut` required impls: `set()` writes to `self.primary[slot]` and inserts/removes from `self.overflow`; `primary_bytes_mut()` → `&mut self.primary`; `clear_overflow()` → `self.overflow.clear()`.
|
|
||||||
|
|
||||||
Std ops: `Add<&B>`, `Sub<&B>` (owned and borrowed), `AddAssign<&B>`, `SubAssign<&B>` — delegate to `IntSliceMut::add` / `diff`.
|
|
||||||
|
|
||||||
`From<&S: IntSlice>`: copies primary bytes + overflow entries. O(n) + O(k).
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
### Persistent types
|
|
||||||
|
|
||||||
**`PersistentBitVec` / `PersistentBitVecBuilder`**
|
|
||||||
|
|
||||||
See `persistent_bit_vec.md`. `PersistentBitVec` is read-only (implements `BitSlice`). `PersistentBitVecBuilder` is read-write (implements `BitSlice` + `BitSliceMut`).
|
|
||||||
|
|
||||||
`BitIter<'a>` — shared iterator type for both `MemoryBitVec` and `PersistentBitVec`:
|
|
||||||
|
|
||||||
```rust
|
```rust
|
||||||
pub struct BitIter<'a> { pub(crate) words: &'a [u64], pub(crate) slot: usize, pub(crate) n: usize }
|
pub struct BitIter<'a> { pub(crate) words: &'a [u64], pub(crate) slot: usize, pub(crate) n: usize }
|
||||||
```
|
```
|
||||||
|
|
||||||
Word-level scan: `(words[slot >> 6] >> (slot & 63)) & 1 != 0`. One word serves 64 iterations. `pub type MemoryBitIter<'a> = BitIter<'a>` preserves the public API name.
|
`PersistentBitVecBuilder` is the read-write type. Mutation operations accept `BitSliceView<'_>`:
|
||||||
|
|
||||||
**`PersistentCompactIntVec` / `PersistentCompactIntVecBuilder`**
|
| Method | Cost |
|
||||||
|
|---|---|
|
||||||
|
| `set(slot, bool)` | O(1) |
|
||||||
|
| `view() -> BitSliceView<'_>` | O(1) |
|
||||||
|
| `or/and/xor(BitSliceView)` | word-level, O(n/64), SIMD-friendly |
|
||||||
|
| `not()` | `w ^= u64::MAX` per word, re-masks last word | O(n/64) |
|
||||||
|
| `copy_from(BitSliceView)` | `copy_from_slice` | O(n/64) |
|
||||||
|
|
||||||
See `persistent_compact_int_vec.md` for file format and lifecycle.
|
### `PersistentCompactIntVec` / `PersistentCompactIntVecBuilder`
|
||||||
|
|
||||||
`PersistentCompactIntVec` implements `IntSlice`. Overrides: `iter()` → inherent merge-scan `Iter`; `sum()`; `count_nonzero()`. `overflow_entries()` returns a sequential scan `(0..n_overflow).map(|i| (data_slot(i), data_value(i)))` — no binary search since entries are stored sorted.
|
`PersistentCompactIntVec` is the read-only type. `view()` returns an `IntSliceView<'_>` over the mmap primary and overflow arrays. Inherent `iter()` is a merge scan (`Iter` struct). Inherent `sum()` and `count_nonzero()` use fast byte-scan helpers.
|
||||||
|
|
||||||
`PersistentCompactIntVecBuilder` implements `IntSlice` + `IntSliceMut`. `iter()` is NOT overridden (default `get`-per-slot) because the overflow `HashMap` is unsorted. `sum()` and `count_nonzero()` are overridden using `byte_sum` / `byte_count_nonzero` on the mmap primary slice — avoids per-slot overhead.
|
`PersistentCompactIntVecBuilder` is the read-write type. Mutation methods on the builder fall into two categories:
|
||||||
|
|
||||||
**Override rationale:** the default `iter()`, `sum()`, `count_nonzero()` on `IntSlice` call `self.get(s)` per slot, which is O(log k) binary search for `PersistentCompactIntVec`. Overrides provide O(n + k) merge-scan or O(n) byte scan instead.
|
**Point mutations:**
|
||||||
|
|
||||||
---
|
| Method | Note |
|
||||||
|
|---|---|
|
||||||
|
| `set(slot, u32)` | writes primary[slot] or 255+overflow |
|
||||||
|
| `get(slot) -> u32` | reads primary byte or HashMap |
|
||||||
|
| `inc(slot)` | `get` + `set`, O(1) |
|
||||||
|
|
||||||
### IntSlice implementors — override summary
|
**Bulk computation methods** — accept view arguments:
|
||||||
|
|
||||||
| Type | `iter()` | `sum()` | `count_nonzero()` |
|
| Method | Semantics | Overflow |
|
||||||
|------|----------|---------|-------------------|
|
|---|---|---|
|
||||||
| `MemoryIntVec` | inherent merge-scan ✓ | `byte_sum` ✓ | `byte_count_nonzero` ✓ |
|
| `inc_present(BitSliceView)` | `+= 1` at each 1-bit | via `inc`, safe for any group size |
|
||||||
| `PersistentCompactIntVecBuilder` | default (get-per-slot) | `byte_sum` on mmap ✓ | `byte_count_nonzero` on mmap ✓ |
|
| `inc_present_fast(BitSliceView)` | same, raw u8 `+= 1` | `debug_assert` no 255 reached |
|
||||||
| `PersistentCompactIntVec` | inherent merge-scan Iter ✓ | inherent `sum()` ✓ | inherent `count_nonzero()` ✓ |
|
| `inc_predicate(IntSliceView, pred)` | `+= 1` where `pred(col[s])` | two-pass, safe |
|
||||||
| `TempCompactIntVec` | delegates to inner `PersistentCompactIntVec` | delegates | delegates |
|
| `inc_predicate_fast(IntSliceView, pred)` | same, raw u8 | `debug_assert` no 255 reached |
|
||||||
| `TempCompactIntVecBuilder` | default (get-per-slot) | delegates to builder | delegates to builder |
|
| `add(IntSliceView)` | `self[s] += other[s]` | primary fast path + overflow fallback |
|
||||||
| `PackedIntCol<'a>` | inherent PackedIntColIter ✓ | byte_sum ✓ | byte_count_nonzero ✓ |
|
| `min(IntSliceView)` | byte min + both-overflow fixup | see algorithm below |
|
||||||
|
| `max(IntSliceView)` | pre-pass + byte max | see algorithm below |
|
||||||
|
| `diff(IntSliceView)` | saturating sub | self<255 hot path |
|
||||||
|
| `mask_with(BitSliceView)` | zeros slots where mask bit = 0 | O(n_zeros) |
|
||||||
|
|
||||||
`PackedIntCol` is used internally by `PersistentCompactIntMatrix` (packed format) for column views.
|
**`inc_present_fast` / `inc_predicate_fast` invariant:** caller guarantees no counter reaches 255 during the operation (group size < 255 for `inc_present_fast`, or chunk size < 255 for `inc_predicate_fast`). Violation is caught by `debug_assert` in dev builds.
|
||||||
|
|
||||||
|
**`min` algorithm:**
|
||||||
|
|
||||||
|
Exploits 255 = +∞: byte-level min is correct unless both sides are overflow.
|
||||||
|
|
||||||
|
```
|
||||||
|
snapshot self_ov: Vec<(slot,val)>
|
||||||
|
snapshot other_ov: HashMap<slot,val>
|
||||||
|
clear_overflow()
|
||||||
|
Pass 1 — byte min, SIMD-vectorizable, O(n)
|
||||||
|
Pass 2 — both-overflow fixup, O(k_self):
|
||||||
|
for (slot, self_val) in self_ov:
|
||||||
|
if slot ∈ other_ov: set(slot, min(self_val, other_ov[slot]))
|
||||||
|
```
|
||||||
|
|
||||||
|
**`max` algorithm:**
|
||||||
|
|
||||||
|
Cannot do byte max first — `max(255, b<255)=255` overwrites self's original overflow value. Pre-pass reads self's value at other's overflow slots before the byte pass.
|
||||||
|
|
||||||
|
```
|
||||||
|
Pre-pass O(k_other): for (slot, other_val) in other.overflow_entries():
|
||||||
|
set(slot, max(self.get(slot), other_val))
|
||||||
|
Pass 1 — byte max, SIMD-vectorizable, O(n)
|
||||||
|
```
|
||||||
|
|
||||||
---
|
---
|
||||||
|
|
||||||
@@ -505,30 +296,22 @@ Four matrix types, two encodings × two formats:
|
|||||||
|
|
||||||
| | Columnar format | Packed format |
|
| | Columnar format | Packed format |
|
||||||
|---|---|---|
|
|---|---|---|
|
||||||
| **Bit** | `PersistentBitMatrix` | — |
|
| **Bit** | `PersistentBitMatrix` (Columnar variant) | `PersistentBitMatrix` (Packed variant) |
|
||||||
| **Int** | `PersistentCompactIntMatrix` (columnar) | `PersistentCompactIntMatrix` (packed) |
|
| **Int** | `PersistentCompactIntMatrix` (Columnar variant) | `PersistentCompactIntMatrix` (Packed variant) |
|
||||||
|
|
||||||
`PersistentCompactIntMatrix` is an enum behind a transparent API — the caller does not see whether the on-disk format is columnar (one `.pciv` per column) or packed (one `.pcmx` file interleaving all columns). `col(c)` and `col_slice(c)` return column views that implement `IntSlice`.
|
Both matrix types are enums (`Columnar` / `Packed` / `Implicit` for bit) behind a transparent API. `col_view(c)` returns the appropriate view directly:
|
||||||
|
|
||||||
`pack_compact_int_matrix` and `pack_bit_matrix` convert a columnar matrix to packed format.
|
```rust
|
||||||
|
// PersistentBitMatrix
|
||||||
|
pub fn col_view(&self, c: usize) -> BitSliceView<'_>
|
||||||
|
|
||||||
For details see `persistent_compact_int_vec.md` and `persistent_bit_vec.md`.
|
// PersistentCompactIntMatrix
|
||||||
|
pub fn col_view(&self, c: usize) -> IntSliceView<'_>
|
||||||
|
```
|
||||||
|
|
||||||
---
|
No wrapper enums (`BitColView`, `IntColView`): the caller receives a `Copy` view struct immediately usable with any view method or bulk builder method.
|
||||||
|
|
||||||
## Conversion traits
|
`pack_compact_int_matrix` and `pack_bit_matrix` convert columnar → packed format.
|
||||||
|
|
||||||
Four blanket-impl traits on top of `BitSlice` / `IntSlice`:
|
|
||||||
|
|
||||||
**`IntToBit: IntSlice`**
|
|
||||||
- `to_bitvec(threshold: u32) -> MemoryBitVec` — bit set iff value ≥ threshold (delegates to `geq`)
|
|
||||||
- `to_presence() -> MemoryBitVec` — bit set iff value ≥ 1 (delegates to `geq(1)`)
|
|
||||||
|
|
||||||
**`BitToInt: BitSlice`**
|
|
||||||
- `to_intvec() -> MemoryIntVec` — expands each bit to a `u8` (0 or 1) in a new primary array
|
|
||||||
- Uses a `static EXPAND_BYTE: [[u8; 8]; 256]` lookup table — 8 bits expanded per byte, word-level outer loop
|
|
||||||
|
|
||||||
Both `IntToBit` and `BitToInt` are implemented for all `T: IntSlice` / `T: BitSlice` via blanket impls.
|
|
||||||
|
|
||||||
---
|
---
|
||||||
|
|
||||||
@@ -549,37 +332,37 @@ trait ColumnWeights: Send + Sync {
|
|||||||
|
|
||||||
Abstract required methods: `partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`, `partial_relfreq_bray`, `partial_relfreq_euclidean`, `partial_hellinger`.
|
Abstract required methods: `partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`, `partial_relfreq_bray`, `partial_relfreq_euclidean`, `partial_hellinger`.
|
||||||
|
|
||||||
**Additivity rule:** self-contained partials (`partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`) can be element-wise summed across all `(partition, layer)` pairs before applying the finalisation. Normalised partials (`partial_relfreq_*`, `partial_hellinger`) require the **global** `col_weights` (accumulated across all layers and all partitions) as parameter — not per-layer or per-partition weights.
|
**Additivity rule:** self-contained partials (`partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`) can be element-wise summed across all `(partition, layer)` pairs. Normalised partials (`partial_relfreq_*`, `partial_hellinger`) require the **global** `col_weights` (accumulated across all layers and all partitions) as parameter.
|
||||||
|
|
||||||
**`partial_threshold_jaccard` returns `(inter, union)`**, not a single matrix, because `union[i,j]` depends on both columns simultaneously and cannot be reconstructed from per-column statistics.
|
**`partial_threshold_jaccard` returns `(inter, union)`** because `union[i,j]` depends on both columns simultaneously.
|
||||||
|
|
||||||
Provided finalisations (default implementations):
|
Provided finalisations:
|
||||||
|
|
||||||
| Finalisation | Formula |
|
| Finalisation | Formula |
|
||||||
|---|---|
|
|---|---|
|
||||||
| `bray_dist_matrix()` | `1 − 2·partial_bray[i,j] / (w[i] + w[j])` |
|
| `bray_dist_matrix()` | `1 − 2·partial_bray[i,j] / (w[i] + w[j])` |
|
||||||
| `euclidean_dist_matrix()` | `√partial_euclidean[i,j]` |
|
| `euclidean_dist_matrix()` | `√partial_euclidean[i,j]` |
|
||||||
| `threshold_jaccard_dist_matrix(t)` | `1 − inter[i,j] / union[i,j]` |
|
| `threshold_jaccard_dist_matrix(t)` | `1 − inter[i,j] / union[i,j]` |
|
||||||
| `relfreq_bray_dist_matrix()` | `1 − partial_relfreq_bray[i,j]` (two-pass: col_weights then partial) |
|
| `relfreq_bray_dist_matrix()` | `1 − partial_relfreq_bray[i,j]` |
|
||||||
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
|
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
|
||||||
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
|
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
|
||||||
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
|
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
|
||||||
|
|
||||||
### BitPartials
|
### BitPartials
|
||||||
|
|
||||||
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)` (inter, union), `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
|
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
|
||||||
|
|
||||||
---
|
---
|
||||||
|
|
||||||
## Temp-file-backed types
|
## Temp-file-backed types
|
||||||
|
|
||||||
`MemoryBitVec` and `MemoryIntVec` are reserved for truly transient intra-method intermediates (e.g. a single `cmp_scalar` result that lives for one loop iteration). **All inter-function results use temp-file-backed types** so the OS can page them out under memory pressure. This matters in practice: processing dozens of layers × hundreds of partitions in parallel would otherwise accumulate gigabytes of live anonymous memory.
|
**All inter-function results use temp-file-backed types** so the OS can page them out under memory pressure. This matters in practice: processing dozens of layers × hundreds of partitions in parallel would otherwise accumulate gigabytes of live anonymous memory.
|
||||||
|
|
||||||
### Lifecycle
|
### Lifecycle
|
||||||
|
|
||||||
```
|
```
|
||||||
TempCompactIntVecBuilder::new(n) → writable mmap in TempDir
|
TempCompactIntVecBuilder::new(n) → writable mmap in TempDir
|
||||||
↓ (set / add / count_bits / mask_with / …)
|
↓ (inc_present_fast / inc_predicate_fast / add / mask_with / …)
|
||||||
.freeze() → TempCompactIntVec (read-only mmap + TempDir)
|
.freeze() → TempCompactIntVec (read-only mmap + TempDir)
|
||||||
↓ (optional)
|
↓ (optional)
|
||||||
.make_persistent(path) → PersistentCompactIntVec (permanent file)
|
.make_persistent(path) → PersistentCompactIntVec (permanent file)
|
||||||
@@ -587,7 +370,7 @@ TempCompactIntVecBuilder::new(n) → writable mmap in TempDir
|
|||||||
|
|
||||||
Same pattern for `TempBitVecBuilder` → `TempBitVec` → `PersistentBitVec`.
|
Same pattern for `TempBitVecBuilder` → `TempBitVec` → `PersistentBitVec`.
|
||||||
|
|
||||||
**Drop order**: in `TempCompactIntVec { vec: PersistentCompactIntVec, _temp: TempDir }`, Rust drops fields in declaration order — `vec` (mmap) is released before `_temp` (directory) is deleted. No explicit `drop()` needed.
|
**Drop order**: `TempCompactIntVec { vec: PersistentCompactIntVec, _temp: TempDir }` — Rust drops fields in declaration order. `vec` (mmap) released before `_temp` (directory deleted). No explicit `drop()` needed.
|
||||||
|
|
||||||
### TempCompactIntVec / TempCompactIntVecBuilder
|
### TempCompactIntVec / TempCompactIntVecBuilder
|
||||||
|
|
||||||
@@ -603,9 +386,9 @@ pub(crate) struct TempCompactIntVecBuilder {
|
|||||||
}
|
}
|
||||||
```
|
```
|
||||||
|
|
||||||
`TempCompactIntVec` implements `IntSlice` (full delegation to inner `PersistentCompactIntVec`).
|
`TempCompactIntVec`: read access via `get(slot)`, `sum()`, `iter()`, `view() -> IntSliceView<'_>`.
|
||||||
`TempCompactIntVecBuilder` implements `IntSlice` + `IntSliceMut` (delegation to inner builder).
|
|
||||||
`make_persistent(path)` copies the temp file to `path` and opens it as `PersistentCompactIntVec`.
|
`TempCompactIntVecBuilder`: full delegation to inner `PersistentCompactIntVecBuilder` — all bulk computation methods (`inc_present_fast`, `inc_predicate_fast`, `add`, `min`, `max`, `diff`, `mask_with`) are exposed as `pub(crate)`.
|
||||||
|
|
||||||
### TempBitVec / TempBitVecBuilder
|
### TempBitVec / TempBitVecBuilder
|
||||||
|
|
||||||
@@ -621,9 +404,26 @@ pub(crate) struct TempBitVecBuilder {
|
|||||||
}
|
}
|
||||||
```
|
```
|
||||||
|
|
||||||
`TempBitVec` implements `BitSlice`.
|
`TempBitVec`: read access via `get(slot)`, `count_ones()`, `view() -> BitSliceView<'_>`, `iter()`.
|
||||||
`TempBitVecBuilder` implements `BitSlice` + `BitSliceMut`.
|
|
||||||
`make_persistent(path)` copies the temp file and opens as `PersistentBitVec`.
|
`TempBitVecBuilder`: exposes `set(slot, bool)`, `or(BitSliceView)`, and:
|
||||||
|
|
||||||
|
```rust
|
||||||
|
pub(crate) fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool)
|
||||||
|
```
|
||||||
|
|
||||||
|
`or_where` — two passes, no intermediate allocation:
|
||||||
|
|
||||||
|
```
|
||||||
|
Pass 1 — primary bytes, O(n):
|
||||||
|
for slot in 0..n:
|
||||||
|
b = col.primary_bytes()[slot]
|
||||||
|
if b < 255 AND pred(b as u32): self.set(slot, true)
|
||||||
|
|
||||||
|
Pass 2 — overflow, O(k):
|
||||||
|
for (slot, val) in col.overflow_entries():
|
||||||
|
if pred(val): self.set(slot, true)
|
||||||
|
```
|
||||||
|
|
||||||
---
|
---
|
||||||
|
|
||||||
@@ -635,74 +435,76 @@ pub(crate) struct TempBitVecBuilder {
|
|||||||
pub struct ColGroup { pub name: String, pub indices: Vec<usize> }
|
pub struct ColGroup { pub name: String, pub indices: Vec<usize> }
|
||||||
```
|
```
|
||||||
|
|
||||||
Defined **once at the index level** from column metadata. Valid in all matrices of all layers and partitions because column structure is identical across the entire hierarchy (same samples/genomes everywhere; only rows = kmer slots are partitioned).
|
Defined **once at the index level** from column metadata. Valid in all matrices of all layers and partitions — column structure is identical across the entire hierarchy; only rows (kmer slots) are partitioned.
|
||||||
|
|
||||||
`ColGroup` is passed by reference unchanged to any matrix — no index translation.
|
|
||||||
|
|
||||||
### Composition axis
|
### Composition axis
|
||||||
|
|
||||||
- **Across partitions**: kmer space is partitioned → partial results are **concatenated** (disjoint kmer ranges).
|
- **Across partitions**: kmer space is partitioned → partial results **concatenated** (disjoint kmer ranges).
|
||||||
- **Across layers**: same kmer space, different counts → partial results are **aggregated** (add, OR, etc.).
|
- **Across layers**: same kmer space, different counts → partial results **aggregated** (add, OR, etc.).
|
||||||
|
|
||||||
### MatrixGroupOps
|
### MatrixGroupOps
|
||||||
|
|
||||||
Group operations live on the matrix and expose only **additive intermediates** backed by temp files. Predicates (final thresholds → `MemoryBitVec`) are applied at the index level after accumulation.
|
Five required primitives + two default methods derived from them. All return temp-file-backed types.
|
||||||
|
|
||||||
```rust
|
```rust
|
||||||
pub trait MatrixGroupOps {
|
pub trait MatrixGroupOps {
|
||||||
|
// required
|
||||||
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32)
|
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32)
|
||||||
-> io::Result<TempCompactIntVec>;
|
-> io::Result<TempCompactIntVec>;
|
||||||
|
|
||||||
fn partial_group_sum(&self, g: &ColGroup)
|
fn partial_group_sum(&self, g: &ColGroup)
|
||||||
-> io::Result<TempCompactIntVec>;
|
-> io::Result<TempCompactIntVec>;
|
||||||
|
|
||||||
fn partial_group_any(&self, g: &ColGroup, threshold: u32)
|
fn partial_group_any(&self, g: &ColGroup, threshold: u32)
|
||||||
-> io::Result<TempBitVec>;
|
-> io::Result<TempBitVec>;
|
||||||
|
fn partial_group_min(&self, g: &ColGroup)
|
||||||
|
-> io::Result<TempCompactIntVec>;
|
||||||
|
fn partial_group_max(&self, g: &ColGroup)
|
||||||
|
-> io::Result<TempCompactIntVec>;
|
||||||
|
|
||||||
|
// defaults derived from partial_group_presence_count
|
||||||
|
fn partial_group_all(&self, g: &ColGroup, threshold: u32)
|
||||||
|
-> io::Result<TempBitVec>; // slot=1 iff count == g.indices.len()
|
||||||
|
fn partial_group_none(&self, g: &ColGroup, threshold: u32)
|
||||||
|
-> io::Result<TempBitVec>; // slot=1 iff count == 0
|
||||||
}
|
}
|
||||||
```
|
```
|
||||||
|
|
||||||
Implemented for both `PersistentCompactIntMatrix` and `PersistentBitMatrix`. For bit matrices, `partial_group_sum` delegates to `partial_group_presence_count(g, 1)` since values are 0/1.
|
Implemented for both `PersistentCompactIntMatrix` and `PersistentBitMatrix`.
|
||||||
|
|
||||||
|
For **bit matrices**: values are 0/1, so `partial_group_sum` = `partial_group_presence_count(g, 1)`; `partial_group_min` is AND (set first column then mask-with remaining); `partial_group_max` is OR via `partial_group_any` + `inc_present`.
|
||||||
|
|
||||||
**`partial_group_presence_count` — chunking for large groups:**
|
**`partial_group_presence_count` — chunking for large groups:**
|
||||||
|
|
||||||
When `g.indices.len() < 255`, per-slot counts fit in a raw `u8` — fast path: accumulate directly into `primary_bytes_mut()` using `inc_primary_bits`, then `freeze()`. No overflow map needed.
|
When `g.indices.len() < 255`: per-slot counts stay within `u8` range. Use `inc_present_fast` (bit) or `inc_predicate_fast(col_view(c), |v| v >= threshold)` (int) — raw u8 increment, no overflow entry written.
|
||||||
|
|
||||||
When `g.indices.len() ≥ 255`, process in chunks of 254 columns — each chunk stays within `u8` range — then add chunks into a running `TempCompactIntVecBuilder` accumulator via `IntSliceMut::add`. This keeps peak memory proportional to one partition, not the number of columns × partitions.
|
When `g.indices.len() ≥ 255`: process in chunks of 254 columns, accumulate via `.add(chunk_frozen.view())`.
|
||||||
|
|
||||||
```
|
**`partial_group_min` (int matrix)**: copy first column via `.add(col_view(first))` (start from 0 ⇒ copy), then `.min(col_view(c))` for remaining.
|
||||||
fast path (< 255 cols):
|
|
||||||
builder = TempCompactIntVecBuilder::new(n)
|
|
||||||
for c in group:
|
|
||||||
mask = col_view(c).cmp_scalar(|v| v >= threshold) // MemoryBitVec
|
|
||||||
inc_primary_bits(primary_bytes_mut, mask) // u8 safe
|
|
||||||
builder.freeze()
|
|
||||||
|
|
||||||
slow path (≥ 255 cols):
|
**`partial_group_max` (int matrix)**: `.max(col_view(c))` for all columns (start from 0 ⇒ first column acts as copy).
|
||||||
result = TempCompactIntVecBuilder::new(n)
|
|
||||||
for chunk in group.chunks(254):
|
**`partial_group_any`** uses `or_where` on `TempBitVecBuilder` (two-pass: primary bytes then overflow entries).
|
||||||
chunk_builder = TempCompactIntVecBuilder::new(n)
|
|
||||||
inc_primary_bits(chunk_builder, …)
|
**`partial_group_all` / `partial_group_none`** (default): call `partial_group_presence_count`, then iterate slots to produce the bit result. O(n) extra pass, not chunked.
|
||||||
chunk_frozen = chunk_builder.freeze()
|
|
||||||
IntSliceMut::add(&mut result, &chunk_frozen)
|
### add_col_from — matrix builder integration
|
||||||
result.freeze()
|
|
||||||
|
Both matrix builders accept temp-file results directly:
|
||||||
|
|
||||||
|
```rust
|
||||||
|
// PersistentBitMatrixBuilder
|
||||||
|
fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()>
|
||||||
|
fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> // nonzero → 1
|
||||||
|
|
||||||
|
// PersistentCompactIntMatrixBuilder
|
||||||
|
fn add_col_from(&mut self, src: &TempCompactIntVec) -> io::Result<()>
|
||||||
|
fn add_col_from_bit(&mut self, src: &TempBitVec) -> io::Result<()> // bit → 0/1 u32
|
||||||
```
|
```
|
||||||
|
|
||||||
Non-additive predicates (`group_all`, `group_at_least(k)`) are **not** on the matrix — composed at the index level:
|
`add_col_from` copies the temp file to the matrix directory and increments `n_cols`; `close()` writes `meta.json` with the final column count. No separate `write_meta` step needed.
|
||||||
|
|
||||||
```
|
### mask_with
|
||||||
// "present in >= 2 ingroup columns with count >= 3, absent from all outgroup"
|
|
||||||
let presence = layers.map(|l| l.partial_group_presence_count(&ingroup, 3)?).add_all()?;
|
|
||||||
let in_mask = presence.geq(2);
|
|
||||||
|
|
||||||
let out_sum = layers.map(|l| l.partial_group_sum(&outgroup)?).add_all()?;
|
Direct method on `PersistentCompactIntVecBuilder` (and delegation via `TempCompactIntVecBuilder`). Zeros every slot where the corresponding mask bit is 0. Iterates only zero bits — O(n_zeros), O(1) when mask is all-ones.
|
||||||
let out_mask = out_sum.leq(0);
|
|
||||||
|
|
||||||
let mask = in_mask & &out_mask; // BitSliceMut::and — O(n/64)
|
|
||||||
```
|
|
||||||
|
|
||||||
### mask_with (IntSliceMut)
|
|
||||||
|
|
||||||
Provided method on `IntSliceMut`. Zeros every slot where the corresponding mask bit is 0. Iterates only zero bits — O(n_zeros), O(1) when mask is all-ones.
|
|
||||||
|
|
||||||
```
|
```
|
||||||
for (w_idx, word) in mask.words():
|
for (w_idx, word) in mask.words():
|
||||||
@@ -711,7 +513,7 @@ for (w_idx, word) in mask.words():
|
|||||||
while zeros != 0:
|
while zeros != 0:
|
||||||
bit = trailing_zeros(zeros)
|
bit = trailing_zeros(zeros)
|
||||||
s = w_idx * 64 + bit
|
s = w_idx * 64 + bit
|
||||||
if primary[s] != 0: self.set(s, 0) // clears overflow entry too
|
if primary[s] != 0: set(s, 0) // clears overflow entry too
|
||||||
zeros &= zeros − 1
|
zeros &= zeros − 1
|
||||||
```
|
```
|
||||||
|
|
||||||
|
|||||||
@@ -0,0 +1,143 @@
|
|||||||
|
# `obitaxonomy` — taxonomy concept paths
|
||||||
|
|
||||||
|
`obitaxonomy` is a dependency-free crate that defines a typed representation
|
||||||
|
of hierarchical concept paths (taxonomic or otherwise) stored in genome metadata.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Concept path syntax
|
||||||
|
|
||||||
|
A concept path is stored as a metadata value with the prefix `taxonomy:/`:
|
||||||
|
|
||||||
|
```
|
||||||
|
taxonomy:/enterobacteriaceae@family/Escherichia@genus/Escherichia coli@species
|
||||||
|
```
|
||||||
|
|
||||||
|
Structure:
|
||||||
|
|
||||||
|
- The `taxonomy:/` prefix is the type discriminator. Any metadata value starting
|
||||||
|
with it is parsed as a `TaxPath`; all others remain plain strings.
|
||||||
|
- The remainder is one or more `/`-separated segments.
|
||||||
|
- Each segment is `name` or `name@rank`, where `rank` is a label for the
|
||||||
|
taxonomic level (e.g. `family`, `genus`, `species`).
|
||||||
|
- Rank annotations are **optional per segment** and can be mixed freely.
|
||||||
|
- Spaces are allowed in both names and ranks.
|
||||||
|
|
||||||
|
### Reserved character
|
||||||
|
|
||||||
|
`@` is reserved throughout the taxonomy system and may **not** appear in:
|
||||||
|
|
||||||
|
| Context | Constraint |
|
||||||
|
|---------|------------|
|
||||||
|
| Segment name | forbidden |
|
||||||
|
| Rank/class label | forbidden |
|
||||||
|
| Metadata key names | forbidden (used as `key@rank` in predicate syntax) |
|
||||||
|
|
||||||
|
`@` is freely allowed in plain-text metadata values (non-taxonomy).
|
||||||
|
|
||||||
|
### Parse errors
|
||||||
|
|
||||||
|
| Condition | Error |
|
||||||
|
|-----------|-------|
|
||||||
|
| Value does not start with `taxonomy:/` | `MissingPrefix` |
|
||||||
|
| No segments after the prefix | `EmptyPath` |
|
||||||
|
| Segment with empty name (consecutive `/`) | `EmptySegmentName` |
|
||||||
|
| Segment with trailing `@` and no rank (`name@`) | `EmptyRankName` |
|
||||||
|
| Segment with more than one `@` | `AmbiguousRank` |
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Public API
|
||||||
|
|
||||||
|
### `TaxSegment`
|
||||||
|
|
||||||
|
A single node: a name and an optional rank.
|
||||||
|
|
||||||
|
```rust
|
||||||
|
seg.name() // &str
|
||||||
|
seg.rank() // Option<&str>
|
||||||
|
seg.to_string() // "name" or "name@rank"
|
||||||
|
TaxSegment::parse(s) // Result<TaxSegment, TaxError>
|
||||||
|
```
|
||||||
|
|
||||||
|
### `TaxPath`
|
||||||
|
|
||||||
|
```rust
|
||||||
|
TaxPath::parse(s) // Result<TaxPath, TaxError>
|
||||||
|
path.segments() // &[TaxSegment]
|
||||||
|
path.depth() // usize — number of segments
|
||||||
|
path.is_ancestor_of(&other) // bool — prefix match by name, ranks ignored
|
||||||
|
path.name_at_rank("genus") // Option<&str>
|
||||||
|
path.to_string() // reconstructs "taxonomy:/…"
|
||||||
|
```
|
||||||
|
|
||||||
|
`is_ancestor_of` compares segment **names** only — rank annotations are
|
||||||
|
informational and do not affect the ancestry relation.
|
||||||
|
|
||||||
|
```rust
|
||||||
|
let a: TaxPath = "taxonomy:/Enterobacteriaceae@family/Escherichia@genus".parse()?;
|
||||||
|
let b: TaxPath = "taxonomy:/Enterobacteriaceae@family/Escherichia@genus/Escherichia coli@species".parse()?;
|
||||||
|
|
||||||
|
assert!(a.is_ancestor_of(&b)); // true
|
||||||
|
assert!(b.is_ancestor_of(&a)); // false
|
||||||
|
assert!(a.is_ancestor_of(&a)); // true (equal ⇒ ancestor)
|
||||||
|
|
||||||
|
assert_eq!(b.name_at_rank("species"), Some("Escherichia coli"));
|
||||||
|
assert_eq!(b.name_at_rank("genus"), Some("Escherichia"));
|
||||||
|
assert_eq!(b.name_at_rank("order"), None);
|
||||||
|
```
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Integration with `GenomeInfo`
|
||||||
|
|
||||||
|
At index load time, every metadata value is inspected once:
|
||||||
|
|
||||||
|
- Starts with `taxonomy:/` → parsed into `TaxPath`, stored in `genome.taxonomy`.
|
||||||
|
- Otherwise → kept as-is in `genome.meta`.
|
||||||
|
|
||||||
|
```rust
|
||||||
|
struct GenomeInfo {
|
||||||
|
label: String,
|
||||||
|
meta: HashMap<String, String>, // plain text metadata
|
||||||
|
taxonomy: HashMap<String, TaxPath>, // parsed taxonomy metadata
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
The raw string is not duplicated. `TaxPath::to_string()` reconstructs the
|
||||||
|
original value losslessly for serialisation.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Predicate operators (in `filter` / `select`)
|
||||||
|
|
||||||
|
Path predicates use the `~` / `!~` operators. The **stored value** always starts
|
||||||
|
with `/` (rooted path); the **query pattern** does not need to.
|
||||||
|
|
||||||
|
### Path pattern syntax
|
||||||
|
|
||||||
|
| Pattern | Semantics |
|
||||||
|
|---------|-----------|
|
||||||
|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
|
||||||
|
| `/A/B` | value starts with A then B (start-anchored) |
|
||||||
|
| `A/B$` | value ends with A then B (end-anchored) |
|
||||||
|
| `/A/B$` | value is exactly A then B (fully anchored) |
|
||||||
|
| `A@x/B` | A with class `x` followed by B with any class |
|
||||||
|
| `A@x/B@y` | A with class `x` followed by B with class `y` |
|
||||||
|
|
||||||
|
A segment pattern without `@` matches the segment name regardless of its stored class.
|
||||||
|
|
||||||
|
### Rank-aware queries
|
||||||
|
|
||||||
|
```
|
||||||
|
key@rank=value
|
||||||
|
```
|
||||||
|
|
||||||
|
| Predicate form | Semantics |
|
||||||
|
|----------------|-----------|
|
||||||
|
| `key@rank=value` | genome's `key` has `value` at rank `rank` |
|
||||||
|
| `key@rank!=value` | does not |
|
||||||
|
| `key@rank=v1\|v2` | value at `rank` is `v1` or `v2` |
|
||||||
|
|
||||||
|
`~` combined with `@rank` on the key (e.g. `key@genus~pattern`) is not defined
|
||||||
|
and is rejected at parse time.
|
||||||
@@ -53,6 +53,7 @@ nav:
|
|||||||
- Merge parallelism & memory: implementation/merge_parallelism.md
|
- Merge parallelism & memory: implementation/merge_parallelism.md
|
||||||
- Kmer filtering: implementation/filtering.md
|
- Kmer filtering: implementation/filtering.md
|
||||||
- Select command: implementation/select.md
|
- Select command: implementation/select.md
|
||||||
|
- obitaxonomy crate: implementation/obitaxonomy.md
|
||||||
- Architecture:
|
- Architecture:
|
||||||
- Sequences: architecture/sequences/invariant.md
|
- Sequences: architecture/sequences/invariant.md
|
||||||
- Kmer index: architecture/index_architecture.md
|
- Kmer index: architecture/index_architecture.md
|
||||||
|
|||||||
Generated
+6
-1
@@ -1704,7 +1704,7 @@ dependencies = [
|
|||||||
|
|
||||||
[[package]]
|
[[package]]
|
||||||
name = "obikmer"
|
name = "obikmer"
|
||||||
version = "0.1.0"
|
version = "1.1.34"
|
||||||
dependencies = [
|
dependencies = [
|
||||||
"clap",
|
"clap",
|
||||||
"csv",
|
"csv",
|
||||||
@@ -1722,6 +1722,7 @@ dependencies = [
|
|||||||
"obiskbuilder",
|
"obiskbuilder",
|
||||||
"obiskio",
|
"obiskio",
|
||||||
"obisys",
|
"obisys",
|
||||||
|
"obitaxonomy",
|
||||||
"pprof",
|
"pprof",
|
||||||
"rayon",
|
"rayon",
|
||||||
"serde_json",
|
"serde_json",
|
||||||
@@ -1853,6 +1854,10 @@ dependencies = [
|
|||||||
"tracing",
|
"tracing",
|
||||||
]
|
]
|
||||||
|
|
||||||
|
[[package]]
|
||||||
|
name = "obitaxonomy"
|
||||||
|
version = "0.1.0"
|
||||||
|
|
||||||
[[package]]
|
[[package]]
|
||||||
name = "object"
|
name = "object"
|
||||||
version = "0.37.3"
|
version = "0.37.3"
|
||||||
|
|||||||
+1
-1
@@ -1,5 +1,5 @@
|
|||||||
[workspace]
|
[workspace]
|
||||||
resolver = "3"
|
resolver = "3"
|
||||||
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex"]
|
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"]
|
||||||
[profile.release]
|
[profile.release]
|
||||||
debug = 1
|
debug = 1
|
||||||
|
|||||||
@@ -7,13 +7,12 @@ use ndarray::{Array1, Array2};
|
|||||||
use rayon::prelude::*;
|
use rayon::prelude::*;
|
||||||
|
|
||||||
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
|
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
|
||||||
use crate::colgroup::{ColGroup, MatrixGroupOps, inc_primary_bits};
|
use crate::colgroup::{ColGroup, MatrixGroupOps};
|
||||||
use crate::memoryvec::MemoryBitVec;
|
|
||||||
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
|
|
||||||
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
|
||||||
use crate::traits::{BitSlice, BitSliceMut, IntSliceMut};
|
|
||||||
use crate::layer_meta::LayerMeta;
|
use crate::layer_meta::LayerMeta;
|
||||||
use crate::meta::MatrixMeta;
|
use crate::meta::MatrixMeta;
|
||||||
|
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
|
||||||
|
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
||||||
|
use crate::views::BitSliceView;
|
||||||
|
|
||||||
fn col_path(dir: &Path, col: usize) -> PathBuf {
|
fn col_path(dir: &Path, col: usize) -> PathBuf {
|
||||||
dir.join(format!("col_{col:06}.pbiv"))
|
dir.join(format!("col_{col:06}.pbiv"))
|
||||||
@@ -143,18 +142,14 @@ impl PackedBitMatrix {
|
|||||||
unsafe { std::slice::from_raw_parts(ptr, nw) }
|
unsafe { std::slice::from_raw_parts(ptr, nw) }
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn col_slice(&self, c: usize) -> PackedCol<'_> {
|
pub(crate) fn col_slice(&self, c: usize) -> BitSliceView<'_> {
|
||||||
PackedCol { words: self.col_words(c), n: self.n_rows }
|
BitSliceView::new(self.col_words(c), self.n_rows)
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
|
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
|
||||||
PersistentBitVecBuilder::from_raw_bytes(self.col_bytes(c), self.n_rows, path)
|
PersistentBitVecBuilder::from_raw_bytes(self.col_bytes(c), self.n_rows, path)
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn col_as_memory(&self, c: usize) -> MemoryBitVec {
|
|
||||||
MemoryBitVec::from(&self.col_slice(c))
|
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) fn count_ones(&self) -> Array1<u64> {
|
pub(crate) fn count_ones(&self) -> Array1<u64> {
|
||||||
Array1::from_vec(
|
Array1::from_vec(
|
||||||
(0..self.n_cols).into_par_iter()
|
(0..self.n_cols).into_par_iter()
|
||||||
@@ -165,47 +160,17 @@ impl PackedBitMatrix {
|
|||||||
|
|
||||||
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
|
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
|
||||||
pairwise2_matrix(self.n_cols, |i, j| {
|
pairwise2_matrix(self.n_cols, |i, j| {
|
||||||
self.col_slice(i).partial_jaccard_dist(&self.col_slice(j))
|
self.col_slice(i).partial_jaccard_dist(self.col_slice(j))
|
||||||
})
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
|
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
|
||||||
pairwise_matrix(self.n_cols, |i, j| {
|
pairwise_matrix(self.n_cols, |i, j| {
|
||||||
self.col_slice(i).hamming_dist(&self.col_slice(j))
|
self.col_slice(i).hamming_dist(self.col_slice(j))
|
||||||
})
|
})
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) struct PackedCol<'a> {
|
|
||||||
words: &'a [u64],
|
|
||||||
n: usize,
|
|
||||||
}
|
|
||||||
|
|
||||||
impl BitSlice for PackedCol<'_> {
|
|
||||||
fn len(&self) -> usize { self.n }
|
|
||||||
fn words(&self) -> &[u64] { self.words }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── BitColView — uniform column access across Columnar and Packed ─────────────
|
|
||||||
|
|
||||||
enum BitColViewInner<'a> {
|
|
||||||
Columnar(&'a PersistentBitVec),
|
|
||||||
Packed(PackedCol<'a>),
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Opaque column view returned by [`PersistentBitMatrix::col_view`].
|
|
||||||
/// Implements [`BitSlice`] uniformly for both Columnar and Packed matrix formats.
|
|
||||||
pub struct BitColView<'a>(BitColViewInner<'a>);
|
|
||||||
|
|
||||||
impl BitSlice for BitColView<'_> {
|
|
||||||
fn len(&self) -> usize {
|
|
||||||
match &self.0 { BitColViewInner::Columnar(c) => c.len(), BitColViewInner::Packed(c) => c.len() }
|
|
||||||
}
|
|
||||||
fn words(&self) -> &[u64] {
|
|
||||||
match &self.0 { BitColViewInner::Columnar(c) => c.words(), BitColViewInner::Packed(c) => c.words() }
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Build `presence/matrix.pbmx` from existing `col_*.pbiv` files.
|
/// Build `presence/matrix.pbmx` from existing `col_*.pbiv` files.
|
||||||
pub fn pack_bit_matrix(dir: &Path) -> io::Result<()> {
|
pub fn pack_bit_matrix(dir: &Path) -> io::Result<()> {
|
||||||
let packed_path = dir.join("matrix.pbmx");
|
let packed_path = dir.join("matrix.pbmx");
|
||||||
@@ -321,10 +286,10 @@ impl PersistentBitMatrix {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn col_view(&self, c: usize) -> BitColView<'_> {
|
pub fn col_view(&self, c: usize) -> BitSliceView<'_> {
|
||||||
match self {
|
match self {
|
||||||
Self::Columnar(m) => BitColView(BitColViewInner::Columnar(m.col(c))),
|
Self::Columnar(m) => m.col(c).view(),
|
||||||
Self::Packed(m) => BitColView(BitColViewInner::Packed(m.col_slice(c))),
|
Self::Packed(m) => m.col_slice(c),
|
||||||
Self::Implicit { .. } => panic!("col_view() not available on Implicit PersistentBitMatrix"),
|
Self::Implicit { .. } => panic!("col_view() not available on Implicit PersistentBitMatrix"),
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -334,21 +299,11 @@ impl PersistentBitMatrix {
|
|||||||
Self::Columnar(m) => PersistentBitVecBuilder::build_from(m.col(c), path),
|
Self::Columnar(m) => PersistentBitVecBuilder::build_from(m.col(c), path),
|
||||||
Self::Packed(m) => m.col_persist(c, path),
|
Self::Packed(m) => m.col_persist(c, path),
|
||||||
Self::Implicit { n_rows, .. } => {
|
Self::Implicit { n_rows, .. } => {
|
||||||
let mut b = PersistentBitVecBuilder::new(*n_rows, path)?;
|
PersistentBitVecBuilder::new_ones(*n_rows, path)
|
||||||
b.not();
|
|
||||||
Ok(b)
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn col_as_memory(&self, c: usize) -> MemoryBitVec {
|
|
||||||
match self {
|
|
||||||
Self::Columnar(m) => MemoryBitVec::from(m.col(c)),
|
|
||||||
Self::Packed(m) => m.col_as_memory(c),
|
|
||||||
Self::Implicit { n_rows, .. } => MemoryBitVec::ones(*n_rows),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn row(&self, slot: usize) -> Box<[bool]> {
|
pub fn row(&self, slot: usize) -> Box<[bool]> {
|
||||||
match self {
|
match self {
|
||||||
Self::Columnar(m) => m.row(slot),
|
Self::Columnar(m) => m.row(slot),
|
||||||
@@ -445,6 +400,26 @@ impl PersistentBitMatrixBuilder {
|
|||||||
PersistentBitVecBuilder::new(self.n, &path)
|
PersistentBitVecBuilder::new(self.n, &path)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
pub fn add_col_ones(&mut self) -> io::Result<PersistentBitVecBuilder> {
|
||||||
|
let path = col_path(&self.dir, self.n_cols);
|
||||||
|
self.n_cols += 1;
|
||||||
|
PersistentBitVecBuilder::new_ones(self.n, &path)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()> {
|
||||||
|
src.make_persistent(&col_path(&self.dir, self.n_cols))?;
|
||||||
|
self.n_cols += 1;
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> {
|
||||||
|
let path = col_path(&self.dir, self.n_cols);
|
||||||
|
self.n_cols += 1;
|
||||||
|
let mut b = PersistentBitVecBuilder::new(self.n, &path)?;
|
||||||
|
b.or_where(src.view(), |v| v > 0);
|
||||||
|
b.close()
|
||||||
|
}
|
||||||
|
|
||||||
pub fn close(self) -> io::Result<()> {
|
pub fn close(self) -> io::Result<()> {
|
||||||
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
|
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
|
||||||
}
|
}
|
||||||
@@ -458,27 +433,19 @@ impl MatrixGroupOps for PersistentBitMatrix {
|
|||||||
let n = self.n();
|
let n = self.n();
|
||||||
if g.indices.len() < 255 {
|
if g.indices.len() < 255 {
|
||||||
let mut builder = TempCompactIntVecBuilder::new(n)?;
|
let mut builder = TempCompactIntVecBuilder::new(n)?;
|
||||||
{
|
|
||||||
let primary = builder.primary_bytes_mut();
|
|
||||||
for &c in &g.indices {
|
for &c in &g.indices {
|
||||||
let mbv = MemoryBitVec::from(&self.col_view(c));
|
builder.inc_present_fast(self.col_view(c));
|
||||||
inc_primary_bits(primary, &mbv);
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
builder.freeze()
|
builder.freeze()
|
||||||
} else {
|
} else {
|
||||||
let mut result = TempCompactIntVecBuilder::new(n)?;
|
let mut result = TempCompactIntVecBuilder::new(n)?;
|
||||||
for chunk in g.indices.chunks(254) {
|
for chunk in g.indices.chunks(254) {
|
||||||
let mut chunk_builder = TempCompactIntVecBuilder::new(n)?;
|
let mut chunk_b = TempCompactIntVecBuilder::new(n)?;
|
||||||
{
|
|
||||||
let primary = chunk_builder.primary_bytes_mut();
|
|
||||||
for &c in chunk {
|
for &c in chunk {
|
||||||
let mbv = MemoryBitVec::from(&self.col_view(c));
|
chunk_b.inc_present_fast(self.col_view(c));
|
||||||
inc_primary_bits(primary, &mbv);
|
|
||||||
}
|
}
|
||||||
}
|
let frozen = chunk_b.freeze()?;
|
||||||
let chunk_frozen = chunk_builder.freeze()?;
|
result.add(frozen.view());
|
||||||
IntSliceMut::add(&mut result, &chunk_frozen);
|
|
||||||
}
|
}
|
||||||
result.freeze()
|
result.freeze()
|
||||||
}
|
}
|
||||||
@@ -493,10 +460,30 @@ impl MatrixGroupOps for PersistentBitMatrix {
|
|||||||
let n = self.n();
|
let n = self.n();
|
||||||
let mut result = TempBitVecBuilder::new(n)?;
|
let mut result = TempBitVecBuilder::new(n)?;
|
||||||
for &c in &g.indices {
|
for &c in &g.indices {
|
||||||
result.or(&self.col_view(c));
|
result.or(self.col_view(c));
|
||||||
}
|
}
|
||||||
result.freeze()
|
result.freeze()
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
|
||||||
|
// min of 0/1 values = AND: 1 only if ALL columns are 1
|
||||||
|
let n = self.n();
|
||||||
|
let mut result = TempCompactIntVecBuilder::new(n)?;
|
||||||
|
if let Some((&first, rest)) = g.indices.split_first() {
|
||||||
|
result.inc_present_fast(self.col_view(first));
|
||||||
|
for &c in rest { result.mask_with(self.col_view(c)); }
|
||||||
|
}
|
||||||
|
result.freeze()
|
||||||
|
}
|
||||||
|
|
||||||
|
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
|
||||||
|
// max of 0/1 values = OR: 1 if any column is 1
|
||||||
|
let any = self.partial_group_any(g, 1)?;
|
||||||
|
let n = any.len();
|
||||||
|
let mut result = TempCompactIntVecBuilder::new(n)?;
|
||||||
|
result.inc_present(any.view());
|
||||||
|
result.freeze()
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Shared matrix helpers (also used by intmatrix.rs) ─────────────────────────
|
// ── Shared matrix helpers (also used by intmatrix.rs) ─────────────────────────
|
||||||
@@ -513,17 +500,26 @@ where T: Clone + Default {
|
|||||||
}
|
}
|
||||||
|
|
||||||
/// Compute a symmetric `n×n` matrix in parallel by evaluating `f(i,j)` for
|
/// Compute a symmetric `n×n` matrix in parallel by evaluating `f(i,j)` for
|
||||||
/// all upper-triangle pairs. `T: Copy` avoids the `.clone()` needed for the
|
/// all upper-triangle pairs, plus `f(i,i)` for the diagonal. `T: Copy` avoids
|
||||||
/// lower-triangle mirror.
|
/// the `.clone()` needed for the lower-triangle mirror.
|
||||||
|
///
|
||||||
|
/// The diagonal is *not* generally `T::default()`: for a self-comparison,
|
||||||
|
/// `f(i,i)` is often the column's own weight (e.g. intersection-with-self —
|
||||||
|
/// see `pairwise2_matrix`), not zero. Distance finalisations that need a
|
||||||
|
/// zero diagonal (self-distance) already overwrite it explicitly.
|
||||||
pub(crate) fn pairwise_matrix<T>(n: usize, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T>
|
pub(crate) fn pairwise_matrix<T>(n: usize, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T>
|
||||||
where T: Copy + Default + Send {
|
where T: Copy + Default + Send {
|
||||||
let results: Vec<(usize, usize, T)> = upper_pairs(n)
|
let results: Vec<(usize, usize, T)> = upper_pairs(n)
|
||||||
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
|
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
|
||||||
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
|
let mut m = fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)));
|
||||||
|
for i in 0..n { m[[i, i]] = f(i, i); }
|
||||||
|
m
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Same as `pairwise_matrix` but `f` returns two values that fill two
|
/// Same as `pairwise_matrix` but `f` returns two values that fill two
|
||||||
/// symmetric matrices simultaneously (e.g. intersection + union for Jaccard).
|
/// symmetric matrices simultaneously (e.g. intersection + union for Jaccard).
|
||||||
|
/// The diagonal is `f(i,i)` (e.g. a genome's kmer count intersected with
|
||||||
|
/// itself), not `T::default()` — see `pairwise_matrix` for why that matters.
|
||||||
pub(crate) fn pairwise2_matrix<T>(n: usize, f: impl Fn(usize, usize) -> (T, T) + Sync) -> (Array2<T>, Array2<T>)
|
pub(crate) fn pairwise2_matrix<T>(n: usize, f: impl Fn(usize, usize) -> (T, T) + Sync) -> (Array2<T>, Array2<T>)
|
||||||
where T: Copy + Default + Send {
|
where T: Copy + Default + Send {
|
||||||
let results: Vec<(usize, usize, T, T)> = upper_pairs(n)
|
let results: Vec<(usize, usize, T, T)> = upper_pairs(n)
|
||||||
@@ -536,5 +532,10 @@ where T: Copy + Default + Send {
|
|||||||
m0[[i, j]] = a; m0[[j, i]] = a;
|
m0[[i, j]] = a; m0[[j, i]] = a;
|
||||||
m1[[i, j]] = b; m1[[j, i]] = b;
|
m1[[i, j]] = b; m1[[j, i]] = b;
|
||||||
}
|
}
|
||||||
|
for i in 0..n {
|
||||||
|
let (a, b) = f(i, i);
|
||||||
|
m0[[i, i]] = a;
|
||||||
|
m1[[i, i]] = b;
|
||||||
|
}
|
||||||
(m0, m1)
|
(m0, m1)
|
||||||
}
|
}
|
||||||
|
|||||||
+195
-102
@@ -5,25 +5,21 @@ use std::path::{Path, PathBuf};
|
|||||||
use memmap2::{Mmap, MmapMut};
|
use memmap2::{Mmap, MmapMut};
|
||||||
|
|
||||||
use crate::reader::PersistentCompactIntVec;
|
use crate::reader::PersistentCompactIntVec;
|
||||||
|
use crate::views::{BitSliceIter, BitSliceView, IntSliceView};
|
||||||
|
|
||||||
const MAGIC: [u8; 4] = *b"PBIV";
|
const MAGIC: [u8; 4] = *b"PBIV";
|
||||||
|
|
||||||
// Header: magic(4) + _pad(4) + n(8) = 16 bytes.
|
// Header: magic(4) + _pad(4) + n(8) = 16 bytes.
|
||||||
// Data starts at offset 16, which is divisible by 8 → u64-aligned
|
// Data starts at offset 16, u64-aligned (mmap base is page-aligned, 16 % 8 == 0).
|
||||||
// (mmap base is page-aligned, 16 % 8 == 0).
|
|
||||||
const HEADER_SIZE: usize = 16;
|
const HEADER_SIZE: usize = 16;
|
||||||
|
|
||||||
#[inline]
|
#[inline]
|
||||||
pub(crate) fn n_words(n: usize) -> usize {
|
pub(crate) fn n_words(n: usize) -> usize { n.div_ceil(64) }
|
||||||
n.div_ceil(64)
|
|
||||||
}
|
|
||||||
|
|
||||||
#[inline]
|
#[inline]
|
||||||
fn n_bytes_for_words(n: usize) -> usize {
|
fn n_bytes_for_words(n: usize) -> usize { n_words(n) * 8 }
|
||||||
n_words(n) * 8
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── Reader ────────────────────────────────────────────────────────────────────
|
// ── PersistentBitVec ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
pub struct PersistentBitVec {
|
pub struct PersistentBitVec {
|
||||||
mmap: Mmap,
|
mmap: Mmap,
|
||||||
@@ -35,44 +31,49 @@ impl PersistentBitVec {
|
|||||||
pub fn open(path: &Path) -> io::Result<Self> {
|
pub fn open(path: &Path) -> io::Result<Self> {
|
||||||
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
|
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
|
||||||
if mmap.len() < HEADER_SIZE {
|
if mmap.len() < HEADER_SIZE {
|
||||||
return Err(io::Error::new(
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "PBIV file too short"));
|
||||||
io::ErrorKind::InvalidData,
|
|
||||||
"PBIV file too short",
|
|
||||||
));
|
|
||||||
}
|
}
|
||||||
if &mmap[0..4] != &MAGIC {
|
if &mmap[0..4] != &MAGIC {
|
||||||
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PBIV magic"));
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PBIV magic"));
|
||||||
}
|
}
|
||||||
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
|
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
|
||||||
Ok(Self {
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
mmap,
|
|
||||||
n,
|
|
||||||
path: path.to_path_buf(),
|
|
||||||
})
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn path(&self) -> &Path {
|
pub fn path(&self) -> &Path { &self.path }
|
||||||
&self.path
|
pub fn len(&self) -> usize { self.n }
|
||||||
}
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
pub fn len(&self) -> usize {
|
|
||||||
self.n
|
|
||||||
}
|
|
||||||
pub fn is_empty(&self) -> bool {
|
|
||||||
self.n == 0
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn get(&self, slot: usize) -> bool {
|
pub fn get(&self, slot: usize) -> bool {
|
||||||
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
|
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
|
||||||
}
|
}
|
||||||
|
|
||||||
// SAFETY: mmap is page-aligned, HEADER_SIZE=16 is divisible by 8,
|
// SAFETY: mmap is page-aligned, HEADER_SIZE=16 divisible by 8 → u64-aligned.
|
||||||
// so &mmap[HEADER_SIZE] is u64-aligned. Slice length is n_words * 8 bytes.
|
|
||||||
fn data_words(&self) -> &[u64] {
|
fn data_words(&self) -> &[u64] {
|
||||||
let nw = n_words(self.n);
|
let nw = n_words(self.n);
|
||||||
let ptr = self.mmap[HEADER_SIZE..].as_ptr() as *const u64;
|
let ptr = self.mmap[HEADER_SIZE..].as_ptr() as *const u64;
|
||||||
unsafe { std::slice::from_raw_parts(ptr, nw) }
|
unsafe { std::slice::from_raw_parts(ptr, nw) }
|
||||||
}
|
}
|
||||||
|
|
||||||
|
pub fn view(&self) -> BitSliceView<'_> {
|
||||||
|
BitSliceView::new(self.data_words(), self.n)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn words(&self) -> &[u64] { self.data_words() }
|
||||||
|
|
||||||
|
pub fn count_ones(&self) -> u64 { self.view().count_ones() }
|
||||||
|
pub fn count_zeros(&self) -> u64 { self.view().count_zeros() }
|
||||||
|
|
||||||
|
pub fn partial_jaccard_dist(&self, other: &PersistentBitVec) -> (u64, u64) {
|
||||||
|
self.view().partial_jaccard_dist(other.view())
|
||||||
|
}
|
||||||
|
pub fn jaccard_dist(&self, other: &PersistentBitVec) -> f64 {
|
||||||
|
self.view().jaccard_dist(other.view())
|
||||||
|
}
|
||||||
|
pub fn hamming_dist(&self, other: &PersistentBitVec) -> u64 {
|
||||||
|
self.view().hamming_dist(other.view())
|
||||||
|
}
|
||||||
|
|
||||||
pub fn iter(&self) -> BitIter<'_> {
|
pub fn iter(&self) -> BitIter<'_> {
|
||||||
BitIter { words: self.data_words(), slot: 0, n: self.n }
|
BitIter { words: self.data_words(), slot: 0, n: self.n }
|
||||||
}
|
}
|
||||||
@@ -81,36 +82,34 @@ impl PersistentBitVec {
|
|||||||
impl<'a> IntoIterator for &'a PersistentBitVec {
|
impl<'a> IntoIterator for &'a PersistentBitVec {
|
||||||
type Item = bool;
|
type Item = bool;
|
||||||
type IntoIter = BitIter<'a>;
|
type IntoIter = BitIter<'a>;
|
||||||
fn into_iter(self) -> BitIter<'a> {
|
fn into_iter(self) -> BitIter<'a> { self.iter() }
|
||||||
self.iter()
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── BitIter ───────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
pub struct BitIter<'a> {
|
pub struct BitIter<'a> {
|
||||||
pub(crate) words: &'a [u64],
|
words: &'a [u64],
|
||||||
pub(crate) slot: usize,
|
slot: usize,
|
||||||
pub(crate) n: usize,
|
n: usize,
|
||||||
}
|
}
|
||||||
|
|
||||||
impl ExactSizeIterator for BitIter<'_> {}
|
impl ExactSizeIterator for BitIter<'_> {}
|
||||||
|
|
||||||
impl Iterator for BitIter<'_> {
|
impl Iterator for BitIter<'_> {
|
||||||
type Item = bool;
|
type Item = bool;
|
||||||
|
|
||||||
fn next(&mut self) -> Option<bool> {
|
fn next(&mut self) -> Option<bool> {
|
||||||
if self.slot >= self.n { return None; }
|
if self.slot >= self.n { return None; }
|
||||||
let v = (self.words[self.slot >> 6] >> (self.slot & 63)) & 1 != 0;
|
let v = (self.words[self.slot >> 6] >> (self.slot & 63)) & 1 != 0;
|
||||||
self.slot += 1;
|
self.slot += 1;
|
||||||
Some(v)
|
Some(v)
|
||||||
}
|
}
|
||||||
|
|
||||||
fn size_hint(&self) -> (usize, Option<usize>) {
|
fn size_hint(&self) -> (usize, Option<usize>) {
|
||||||
let rem = self.n - self.slot;
|
let rem = self.n - self.slot;
|
||||||
(rem, Some(rem))
|
(rem, Some(rem))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Builder ───────────────────────────────────────────────────────────────────
|
// ── PersistentBitVecBuilder ───────────────────────────────────────────────────
|
||||||
|
|
||||||
pub struct PersistentBitVecBuilder {
|
pub struct PersistentBitVecBuilder {
|
||||||
mmap: MmapMut,
|
mmap: MmapMut,
|
||||||
@@ -122,13 +121,10 @@ impl PersistentBitVecBuilder {
|
|||||||
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
|
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
|
||||||
let file_size = HEADER_SIZE + n_bytes_for_words(n);
|
let file_size = HEADER_SIZE + n_bytes_for_words(n);
|
||||||
let mut file = OpenOptions::new()
|
let mut file = OpenOptions::new()
|
||||||
.read(true)
|
.read(true).write(true).create(true).truncate(true)
|
||||||
.write(true)
|
|
||||||
.create(true)
|
|
||||||
.truncate(true)
|
|
||||||
.open(path)?;
|
.open(path)?;
|
||||||
file.write_all(&MAGIC)?;
|
file.write_all(&MAGIC)?;
|
||||||
file.write_all(&[0u8; 4])?; // padding
|
file.write_all(&[0u8; 4])?;
|
||||||
file.write_all(&(n as u64).to_le_bytes())?;
|
file.write_all(&(n as u64).to_le_bytes())?;
|
||||||
file.seek(SeekFrom::Start(0))?;
|
file.seek(SeekFrom::Start(0))?;
|
||||||
file.set_len(file_size as u64)?;
|
file.set_len(file_size as u64)?;
|
||||||
@@ -136,9 +132,7 @@ impl PersistentBitVecBuilder {
|
|||||||
Ok(Self { mmap, n, path: path.to_path_buf() })
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Create a PBIV file from raw packed bit-bytes, zero-padding to the next word boundary.
|
pub fn from_raw_bytes(bytes: &[u8], n: usize, path: &Path) -> io::Result<Self> {
|
||||||
/// `bytes` is `n.div_ceil(8)` bytes; `n` is the number of bits.
|
|
||||||
pub(crate) fn from_raw_bytes(bytes: &[u8], n: usize, path: &Path) -> io::Result<Self> {
|
|
||||||
let file_size = HEADER_SIZE + n_bytes_for_words(n);
|
let file_size = HEADER_SIZE + n_bytes_for_words(n);
|
||||||
let file = OpenOptions::new()
|
let file = OpenOptions::new()
|
||||||
.read(true).write(true).create(true).truncate(true)
|
.read(true).write(true).create(true).truncate(true)
|
||||||
@@ -151,6 +145,33 @@ impl PersistentBitVecBuilder {
|
|||||||
Ok(Self { mmap, n, path: path.to_path_buf() })
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Create an all-ones bit vector of length `n` at `path`.
|
||||||
|
///
|
||||||
|
/// More efficient than `new(n, path)` + `not()`: the data is written as
|
||||||
|
/// 0xFF bytes in a single sequential pass, with no intermediate all-zeros state.
|
||||||
|
pub fn new_ones(n: usize, path: &Path) -> io::Result<Self> {
|
||||||
|
let nw = n_words(n);
|
||||||
|
let file_size = HEADER_SIZE + nw * 8;
|
||||||
|
let mut file = OpenOptions::new()
|
||||||
|
.read(true).write(true).create(true).truncate(true)
|
||||||
|
.open(path)?;
|
||||||
|
file.write_all(&MAGIC)?;
|
||||||
|
file.write_all(&[0u8; 4])?;
|
||||||
|
file.write_all(&(n as u64).to_le_bytes())?;
|
||||||
|
file.write_all(&vec![0xFFu8; nw * 8])?;
|
||||||
|
file.seek(SeekFrom::Start(0))?;
|
||||||
|
file.set_len(file_size as u64)?;
|
||||||
|
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
|
||||||
|
// Clear padding bits in the last word so trailing bits are always 0.
|
||||||
|
let rem = n % 64;
|
||||||
|
if rem != 0 {
|
||||||
|
let ptr = mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
|
||||||
|
let words = unsafe { std::slice::from_raw_parts_mut(ptr, nw) };
|
||||||
|
words[nw - 1] &= (1u64 << rem) - 1;
|
||||||
|
}
|
||||||
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
|
}
|
||||||
|
|
||||||
pub fn build_from(source: &PersistentBitVec, path: &Path) -> io::Result<Self> {
|
pub fn build_from(source: &PersistentBitVec, path: &Path) -> io::Result<Self> {
|
||||||
fs::copy(source.path(), path)?;
|
fs::copy(source.path(), path)?;
|
||||||
let file = OpenOptions::new().read(true).write(true).open(path)?;
|
let file = OpenOptions::new().read(true).write(true).open(path)?;
|
||||||
@@ -159,17 +180,46 @@ impl PersistentBitVecBuilder {
|
|||||||
Ok(Self { mmap, n, path: path.to_path_buf() })
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn len(&self) -> usize {
|
pub fn build_from_counts(source: &PersistentCompactIntVec, threshold: u32, path: &Path) -> io::Result<Self> {
|
||||||
self.n
|
let n = source.len();
|
||||||
|
let file_size = HEADER_SIZE + n_bytes_for_words(n);
|
||||||
|
let mut file = OpenOptions::new()
|
||||||
|
.read(true).write(true).create(true).truncate(true)
|
||||||
|
.open(path)?;
|
||||||
|
file.write_all(&MAGIC)?;
|
||||||
|
file.write_all(&[0u8; 4])?;
|
||||||
|
file.write_all(&(n as u64).to_le_bytes())?;
|
||||||
|
file.seek(SeekFrom::Start(0))?;
|
||||||
|
file.set_len(file_size as u64)?;
|
||||||
|
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
|
||||||
|
{
|
||||||
|
let nw = n_words(n);
|
||||||
|
let ptr = mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
|
||||||
|
let words = unsafe { std::slice::from_raw_parts_mut(ptr, nw) };
|
||||||
|
for (slot, count) in source.iter().enumerate() {
|
||||||
|
if count >= threshold { words[slot >> 6] |= 1u64 << (slot & 63); }
|
||||||
}
|
}
|
||||||
pub fn is_empty(&self) -> bool {
|
|
||||||
self.n == 0
|
|
||||||
}
|
}
|
||||||
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn build_from_presence(source: &PersistentCompactIntVec, path: &Path) -> io::Result<Self> {
|
||||||
|
Self::build_from_counts(source, 1, path)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn len(&self) -> usize { self.n }
|
||||||
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
|
|
||||||
pub fn get(&self, slot: usize) -> bool {
|
pub fn get(&self, slot: usize) -> bool {
|
||||||
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
|
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
|
||||||
}
|
}
|
||||||
|
|
||||||
|
pub fn set(&mut self, slot: usize, value: bool) {
|
||||||
|
let bit = 1u64 << (slot & 63);
|
||||||
|
if value { self.data_words_mut()[slot >> 6] |= bit; }
|
||||||
|
else { self.data_words_mut()[slot >> 6] &= !bit; }
|
||||||
|
}
|
||||||
|
|
||||||
fn data_words(&self) -> &[u64] {
|
fn data_words(&self) -> &[u64] {
|
||||||
let nw = n_words(self.n);
|
let nw = n_words(self.n);
|
||||||
let ptr = self.mmap[HEADER_SIZE..].as_ptr() as *const u64;
|
let ptr = self.mmap[HEADER_SIZE..].as_ptr() as *const u64;
|
||||||
@@ -183,73 +233,116 @@ impl PersistentBitVecBuilder {
|
|||||||
unsafe { std::slice::from_raw_parts_mut(ptr, nw) }
|
unsafe { std::slice::from_raw_parts_mut(ptr, nw) }
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Convert a count vector to a bit vector: bit set iff count >= threshold.
|
pub fn view(&self) -> BitSliceView<'_> {
|
||||||
/// Fills u64 words directly from the count iterator — O(n), no bit-level set() overhead.
|
BitSliceView::new(self.data_words(), self.n)
|
||||||
pub fn build_from_counts(
|
}
|
||||||
source: &PersistentCompactIntVec,
|
|
||||||
threshold: u32,
|
|
||||||
path: &Path,
|
|
||||||
) -> io::Result<Self> {
|
|
||||||
let n = source.len();
|
|
||||||
let file_size = HEADER_SIZE + n_bytes_for_words(n);
|
|
||||||
let mut file = OpenOptions::new()
|
|
||||||
.read(true)
|
|
||||||
.write(true)
|
|
||||||
.create(true)
|
|
||||||
.truncate(true)
|
|
||||||
.open(path)?;
|
|
||||||
file.write_all(&MAGIC)?;
|
|
||||||
file.write_all(&[0u8; 4])?;
|
|
||||||
file.write_all(&(n as u64).to_le_bytes())?;
|
|
||||||
file.seek(SeekFrom::Start(0))?;
|
|
||||||
file.set_len(file_size as u64)?;
|
|
||||||
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
|
|
||||||
|
|
||||||
{
|
pub fn words(&self) -> &[u64] { self.data_words() }
|
||||||
|
|
||||||
|
pub fn copy_from(&mut self, src: BitSliceView<'_>) {
|
||||||
|
assert_eq!(self.n, src.len(), "BitSliceView length mismatch");
|
||||||
|
self.data_words_mut().copy_from_slice(src.words());
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn and(&mut self, other: BitSliceView<'_>) {
|
||||||
|
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
|
||||||
|
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w &= o; }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn or(&mut self, other: BitSliceView<'_>) {
|
||||||
|
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
|
||||||
|
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w |= o; }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn xor(&mut self, other: BitSliceView<'_>) {
|
||||||
|
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
|
||||||
|
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w ^= o; }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn not(&mut self) {
|
||||||
|
let rem = self.n % 64;
|
||||||
|
let words = self.data_words_mut();
|
||||||
|
for w in words.iter_mut() { *w ^= u64::MAX; }
|
||||||
|
if rem != 0 {
|
||||||
|
if let Some(last) = words.last_mut() { *last &= (1u64 << rem) - 1; }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// OR in bits at slots where `pred(col[slot])` is true.
|
||||||
|
pub fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
|
||||||
|
let n = self.n;
|
||||||
|
let primary = col.primary_bytes();
|
||||||
|
let words = self.data_words_mut();
|
||||||
let nw = n_words(n);
|
let nw = n_words(n);
|
||||||
let ptr = mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
|
for wi in 0..nw {
|
||||||
let words = unsafe { std::slice::from_raw_parts_mut(ptr, nw) };
|
let base = wi * 64;
|
||||||
for (slot, count) in source.iter().enumerate() {
|
let limit = (base + 64).min(n);
|
||||||
if count >= threshold {
|
let mut mask = 0u64;
|
||||||
words[slot >> 6] |= 1u64 << (slot & 63);
|
for bit in 0..(limit - base) {
|
||||||
|
let b = primary[base + bit];
|
||||||
|
if b < 255 && pred(b as u32) { mask |= 1u64 << bit; }
|
||||||
}
|
}
|
||||||
|
words[wi] |= mask;
|
||||||
|
}
|
||||||
|
for (slot, val) in col.overflow_entries() {
|
||||||
|
if pred(val) { words[slot >> 6] |= 1u64 << (slot & 63); }
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
Ok(Self { mmap, n, path: path.to_path_buf() })
|
/// Clear bits at slots where `pred(col[slot])` is false.
|
||||||
|
pub fn and_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
|
||||||
|
let n = self.n;
|
||||||
|
let primary = col.primary_bytes();
|
||||||
|
let words = self.data_words_mut();
|
||||||
|
let nw = n_words(n);
|
||||||
|
for wi in 0..nw {
|
||||||
|
let base = wi * 64;
|
||||||
|
let limit = (base + 64).min(n);
|
||||||
|
let mut mask = 0u64;
|
||||||
|
for bit in 0..(limit - base) {
|
||||||
|
let b = primary[base + bit];
|
||||||
|
if b < 255 && !pred(b as u32) { mask |= 1u64 << bit; }
|
||||||
|
}
|
||||||
|
words[wi] &= !mask;
|
||||||
|
}
|
||||||
|
for (slot, val) in col.overflow_entries() {
|
||||||
|
if !pred(val) { words[slot >> 6] &= !(1u64 << (slot & 63)); }
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Convert a count vector to a presence/absence bit vector (threshold = 1).
|
/// Toggle bits at slots where `pred(col[slot])` is true.
|
||||||
pub fn build_from_presence(source: &PersistentCompactIntVec, path: &Path) -> io::Result<Self> {
|
pub fn xor_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
Self::build_from_counts(source, 1, path)
|
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
|
||||||
|
let n = self.n;
|
||||||
|
let primary = col.primary_bytes();
|
||||||
|
let words = self.data_words_mut();
|
||||||
|
let nw = n_words(n);
|
||||||
|
for wi in 0..nw {
|
||||||
|
let base = wi * 64;
|
||||||
|
let limit = (base + 64).min(n);
|
||||||
|
let mut mask = 0u64;
|
||||||
|
for bit in 0..(limit - base) {
|
||||||
|
let b = primary[base + bit];
|
||||||
|
if b < 255 && pred(b as u32) { mask |= 1u64 << bit; }
|
||||||
|
}
|
||||||
|
words[wi] ^= mask;
|
||||||
|
}
|
||||||
|
for (slot, val) in col.overflow_entries() {
|
||||||
|
if pred(val) { words[slot >> 6] ^= 1u64 << (slot & 63); }
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn close(self) -> io::Result<()> {
|
pub fn iter(&self) -> BitSliceIter<'_> {
|
||||||
self.mmap.flush()
|
self.view().iter()
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Flush, close, and reopen as a read-only `PersistentBitVec`.
|
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
|
||||||
|
|
||||||
pub fn finish(self) -> io::Result<PersistentBitVec> {
|
pub fn finish(self) -> io::Result<PersistentBitVec> {
|
||||||
let path = self.path.clone();
|
let path = self.path.clone();
|
||||||
self.close()?;
|
self.close()?;
|
||||||
PersistentBitVec::open(&path)
|
PersistentBitVec::open(&path)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── BitSlice / BitSliceMut impls ──────────────────────────────────────────────
|
|
||||||
|
|
||||||
use crate::traits::{BitSlice, BitSliceMut};
|
|
||||||
|
|
||||||
impl BitSlice for PersistentBitVec {
|
|
||||||
fn len(&self) -> usize { self.n }
|
|
||||||
fn words(&self) -> &[u64] { self.data_words() }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl BitSlice for PersistentBitVecBuilder {
|
|
||||||
fn len(&self) -> usize { self.n }
|
|
||||||
fn words(&self) -> &[u64] { self.data_words() }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl BitSliceMut for PersistentBitVecBuilder {
|
|
||||||
fn words_mut(&mut self) -> &mut [u64] { self.data_words_mut() }
|
|
||||||
}
|
|
||||||
|
|||||||
@@ -7,6 +7,7 @@ use memmap2::MmapMut;
|
|||||||
|
|
||||||
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, finalize_pciv, parse_overflow_entry};
|
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, finalize_pciv, parse_overflow_entry};
|
||||||
use crate::reader::PersistentCompactIntVec;
|
use crate::reader::PersistentCompactIntVec;
|
||||||
|
use crate::views::{BitSliceView, IntSliceView};
|
||||||
|
|
||||||
pub struct PersistentCompactIntVecBuilder {
|
pub struct PersistentCompactIntVecBuilder {
|
||||||
path: PathBuf,
|
path: PathBuf,
|
||||||
@@ -16,44 +17,16 @@ pub struct PersistentCompactIntVecBuilder {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl PersistentCompactIntVecBuilder {
|
impl PersistentCompactIntVecBuilder {
|
||||||
/// Create a new, zero-filled PCIV at `path`. Primary is mmapped immediately.
|
|
||||||
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
|
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
|
||||||
let file = OpenOptions::new()
|
|
||||||
.read(true)
|
|
||||||
.write(true)
|
|
||||||
.create(true)
|
|
||||||
.truncate(true)
|
|
||||||
.open(path)?;
|
|
||||||
file.set_len((HEADER_SIZE + n) as u64)?;
|
|
||||||
let mmap = unsafe { MmapMut::map_mut(&file)? };
|
|
||||||
Ok(Self {
|
|
||||||
path: path.to_path_buf(),
|
|
||||||
mmap,
|
|
||||||
n,
|
|
||||||
overflow: HashMap::new(),
|
|
||||||
})
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Create from a [`MemoryIntVec`], copying primary bytes directly into the mmap.
|
|
||||||
/// O(n) memcpy + O(n_overflow) HashMap clone — no per-slot `set` overhead.
|
|
||||||
pub fn from_memory(src: &crate::memoryintvec::MemoryIntVec, path: &Path) -> io::Result<Self> {
|
|
||||||
let n = src.len();
|
|
||||||
let file = OpenOptions::new()
|
let file = OpenOptions::new()
|
||||||
.read(true).write(true).create(true).truncate(true)
|
.read(true).write(true).create(true).truncate(true)
|
||||||
.open(path)?;
|
.open(path)?;
|
||||||
file.set_len((HEADER_SIZE + n) as u64)?;
|
file.set_len((HEADER_SIZE + n) as u64)?;
|
||||||
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
|
let mmap = unsafe { MmapMut::map_mut(&file)? };
|
||||||
mmap[HEADER_SIZE..HEADER_SIZE + n].copy_from_slice(src.primary_bytes());
|
Ok(Self { path: path.to_path_buf(), mmap, n, overflow: HashMap::new() })
|
||||||
Ok(Self {
|
|
||||||
path: path.to_path_buf(),
|
|
||||||
mmap,
|
|
||||||
n,
|
|
||||||
overflow: src.overflow_map().clone(),
|
|
||||||
})
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Create from raw primary bytes + an already-built overflow map (no per-slot overhead).
|
pub fn from_raw_primary(primary: &[u8], overflow: HashMap<usize, u32>, path: &Path) -> io::Result<Self> {
|
||||||
pub(crate) fn from_raw_primary(primary: &[u8], overflow: HashMap<usize, u32>, path: &Path) -> io::Result<Self> {
|
|
||||||
let n = primary.len();
|
let n = primary.len();
|
||||||
let file = OpenOptions::new()
|
let file = OpenOptions::new()
|
||||||
.read(true).write(true).create(true).truncate(true)
|
.read(true).write(true).create(true).truncate(true)
|
||||||
@@ -64,39 +37,24 @@ impl PersistentCompactIntVecBuilder {
|
|||||||
Ok(Self { path: path.to_path_buf(), mmap, n, overflow })
|
Ok(Self { path: path.to_path_buf(), mmap, n, overflow })
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Copy `source`'s file to `path`, mmap the primary section, load overflow into RAM.
|
|
||||||
/// Avoids iterating all n slots: the file copy is OS-level, overflow loading is O(n_overflow).
|
|
||||||
pub fn build_from(source: &PersistentCompactIntVec, path: &Path) -> io::Result<Self> {
|
pub fn build_from(source: &PersistentCompactIntVec, path: &Path) -> io::Result<Self> {
|
||||||
fs::copy(source.path(), path)?;
|
fs::copy(source.path(), path)?;
|
||||||
|
|
||||||
let file = OpenOptions::new().read(true).write(true).open(path)?;
|
let file = OpenOptions::new().read(true).write(true).open(path)?;
|
||||||
let mmap = unsafe { MmapMut::map_mut(&file)? };
|
let mmap = unsafe { MmapMut::map_mut(&file)? };
|
||||||
|
|
||||||
let n = source.len();
|
let n = source.len();
|
||||||
let n_overflow = u64::from_le_bytes(mmap[16..24].try_into().unwrap()) as usize;
|
let n_overflow = u64::from_le_bytes(mmap[16..24].try_into().unwrap()) as usize;
|
||||||
let data_offset = HEADER_SIZE + n;
|
let data_offset = HEADER_SIZE + n;
|
||||||
|
|
||||||
let mut overflow = HashMap::with_capacity(n_overflow);
|
let mut overflow = HashMap::with_capacity(n_overflow);
|
||||||
for i in 0..n_overflow {
|
for i in 0..n_overflow {
|
||||||
let (slot, value) = parse_overflow_entry(&mmap, data_offset, i);
|
let (slot, value) = parse_overflow_entry(&mmap, data_offset, i);
|
||||||
overflow.insert(slot, value);
|
overflow.insert(slot, value);
|
||||||
}
|
}
|
||||||
|
Ok(Self { path: path.to_path_buf(), mmap, n, overflow })
|
||||||
Ok(Self {
|
|
||||||
path: path.to_path_buf(),
|
|
||||||
mmap,
|
|
||||||
n,
|
|
||||||
overflow,
|
|
||||||
})
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Get the value at the given slot, handling overflow if necessary.
|
|
||||||
pub fn get(&self, slot: usize) -> u32 {
|
pub fn get(&self, slot: usize) -> u32 {
|
||||||
match self.mmap[HEADER_SIZE + slot] {
|
match self.mmap[HEADER_SIZE + slot] {
|
||||||
255 => *self
|
255 => *self.overflow.get(&slot).expect("sentinel without overflow entry"),
|
||||||
.overflow
|
|
||||||
.get(&slot)
|
|
||||||
.expect("sentinel without overflow entry"),
|
|
||||||
v => v as u32,
|
v => v as u32,
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -111,15 +69,189 @@ impl PersistentCompactIntVecBuilder {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn len(&self) -> usize {
|
pub fn len(&self) -> usize { self.n }
|
||||||
self.n
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
|
|
||||||
|
pub fn primary_bytes(&self) -> &[u8] { &self.mmap[HEADER_SIZE..HEADER_SIZE + self.n] }
|
||||||
|
pub fn primary_bytes_mut(&mut self) -> &mut [u8] { &mut self.mmap[HEADER_SIZE..HEADER_SIZE + self.n] }
|
||||||
|
pub fn clear_overflow(&mut self) { self.overflow.clear(); }
|
||||||
|
|
||||||
|
pub fn sum(&self) -> u64 {
|
||||||
|
byte_sum(&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n], self.overflow.values().copied())
|
||||||
|
}
|
||||||
|
pub fn count_nonzero(&self) -> u64 {
|
||||||
|
byte_count_nonzero(&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n])
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn is_empty(&self) -> bool {
|
pub fn view(&self) -> IntSliceView<'_> {
|
||||||
self.n == 0
|
// Builder overflow is a HashMap, not sorted raw bytes — convert on the fly
|
||||||
|
// by collecting into a sorted vec and storing in a thread-local buffer.
|
||||||
|
// For read-back during building, just call get(slot) directly.
|
||||||
|
// view() is primarily useful AFTER freeze (on PersistentCompactIntVec).
|
||||||
|
// Here we expose it via a zero-alloc path: primary only, no overflow raw.
|
||||||
|
// Callers that need overflow_entries during building use overflow_entries().
|
||||||
|
let primary = &self.mmap[HEADER_SIZE..HEADER_SIZE + self.n];
|
||||||
|
IntSliceView::new(primary, &[], 0, self.n)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
|
||||||
|
self.overflow.iter().map(|(&k, &v)| (k, v))
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn inc(&mut self, slot: usize) {
|
||||||
|
let v = self.get(slot);
|
||||||
|
self.set(slot, v.saturating_add(1));
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Computation methods ───────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Increment one counter per 1-bit of `col`. Safe for any group size.
|
||||||
|
pub fn inc_present(&mut self, col: BitSliceView<'_>) {
|
||||||
|
let n = self.n;
|
||||||
|
for (wi, &word) in col.words().iter().enumerate() {
|
||||||
|
if word == 0 { continue; }
|
||||||
|
let mut w = word;
|
||||||
|
while w != 0 {
|
||||||
|
let bit = w.trailing_zeros() as usize;
|
||||||
|
let slot = wi * 64 + bit;
|
||||||
|
if slot < n { self.inc(slot); }
|
||||||
|
w &= w - 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Increment one counter per 1-bit of `col`, using raw u8 arithmetic.
|
||||||
|
/// Caller guarantees no counter will reach 255 (group size < 255).
|
||||||
|
pub fn inc_present_fast(&mut self, col: BitSliceView<'_>) {
|
||||||
|
{
|
||||||
|
let primary = self.primary_bytes_mut();
|
||||||
|
let n = primary.len();
|
||||||
|
for (wi, &word) in col.words().iter().enumerate() {
|
||||||
|
if word == 0 { continue; }
|
||||||
|
let mut w = word;
|
||||||
|
while w != 0 {
|
||||||
|
let bit = w.trailing_zeros() as usize;
|
||||||
|
let s = wi * 64 + bit;
|
||||||
|
if s < n { primary[s] += 1; }
|
||||||
|
w &= w - 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
debug_assert!(
|
||||||
|
!self.primary_bytes().contains(&255),
|
||||||
|
"sentinel 255 reached in inc_present_fast — group size must be < 255"
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Two-pass: primary bytes then overflow. Increments `self[slot]` for each
|
||||||
|
/// slot where `pred(col[slot])` is true. Safe for any group size.
|
||||||
|
pub fn inc_predicate(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
let n = col.len();
|
||||||
|
for slot in 0..n {
|
||||||
|
let b = col.primary_bytes()[slot];
|
||||||
|
if b < 255 && pred(b as u32) {
|
||||||
|
self.inc(slot);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
for (slot, val) in col.overflow_entries() {
|
||||||
|
if pred(val) { self.inc(slot); }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Fast two-pass: raw u8 arithmetic. Caller guarantees no counter reaches 255.
|
||||||
|
pub fn inc_predicate_fast(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
let n = col.len();
|
||||||
|
{
|
||||||
|
let primary = self.primary_bytes_mut();
|
||||||
|
for slot in 0..n {
|
||||||
|
let b = col.primary_bytes()[slot];
|
||||||
|
if b < 255 && pred(b as u32) {
|
||||||
|
primary[slot] += 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
for (slot, val) in col.overflow_entries() {
|
||||||
|
if pred(val) { self.primary_bytes_mut()[slot] += 1; }
|
||||||
|
}
|
||||||
|
debug_assert!(
|
||||||
|
!self.primary_bytes().contains(&255),
|
||||||
|
"sentinel 255 reached in inc_predicate_fast — group size must be < 255"
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn add(&mut self, other: IntSliceView<'_>) {
|
||||||
|
let n = self.n;
|
||||||
|
for s in 0..n {
|
||||||
|
let sb = self.primary_bytes()[s];
|
||||||
|
let ob = other.primary_bytes()[s];
|
||||||
|
if sb < 255 && ob < 255 {
|
||||||
|
let sum = sb as u32 + ob as u32;
|
||||||
|
if sum < 255 { self.primary_bytes_mut()[s] = sum as u8; }
|
||||||
|
else { self.set(s, sum); }
|
||||||
|
} else {
|
||||||
|
let sv = self.get(s);
|
||||||
|
let ov = other.get(s);
|
||||||
|
self.set(s, sv + ov);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn min(&mut self, other: IntSliceView<'_>) {
|
||||||
|
let self_ov: Vec<(usize, u32)> = self.overflow_entries().collect();
|
||||||
|
let other_ov: HashMap<usize, u32> = other.overflow_entries().collect();
|
||||||
|
self.clear_overflow();
|
||||||
|
for (a, &b) in self.primary_bytes_mut().iter_mut().zip(other.primary_bytes()) {
|
||||||
|
if b < *a { *a = b; }
|
||||||
|
}
|
||||||
|
for (slot, self_val) in self_ov {
|
||||||
|
if let Some(&other_val) = other_ov.get(&slot) {
|
||||||
|
self.set(slot, self_val.min(other_val));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn max(&mut self, other: IntSliceView<'_>) {
|
||||||
|
for (slot, other_val) in other.overflow_entries() {
|
||||||
|
let sv = self.get(slot);
|
||||||
|
self.set(slot, sv.max(other_val));
|
||||||
|
}
|
||||||
|
for (a, &b) in self.primary_bytes_mut().iter_mut().zip(other.primary_bytes()) {
|
||||||
|
if b > *a { *a = b; }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn diff(&mut self, other: IntSliceView<'_>) {
|
||||||
|
let n = self.n;
|
||||||
|
for s in 0..n {
|
||||||
|
let sb = self.primary_bytes()[s];
|
||||||
|
let ob = other.primary_bytes()[s];
|
||||||
|
if sb < 255 {
|
||||||
|
self.primary_bytes_mut()[s] = if ob < 255 { sb.saturating_sub(ob) } else { 0 };
|
||||||
|
} else {
|
||||||
|
let sv = self.get(s);
|
||||||
|
let ov = if ob < 255 { ob as u32 } else { other.get(s) };
|
||||||
|
self.set(s, sv.saturating_sub(ov));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn mask_with(&mut self, mask: BitSliceView<'_>) {
|
||||||
|
let n = self.n;
|
||||||
|
for (wi, &word) in mask.words().iter().enumerate() {
|
||||||
|
if word == u64::MAX { continue; }
|
||||||
|
let mut zeros = !word;
|
||||||
|
while zeros != 0 {
|
||||||
|
let bit = zeros.trailing_zeros() as usize;
|
||||||
|
let s = wi * 64 + bit;
|
||||||
|
if s < n {
|
||||||
|
let b = self.primary_bytes()[s];
|
||||||
|
if b != 0 { self.set(s, 0); }
|
||||||
|
}
|
||||||
|
zeros &= zeros - 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Flush the primary mmap, then write sorted overflow data + index and fix the header.
|
|
||||||
pub fn close(self) -> io::Result<()> {
|
pub fn close(self) -> io::Result<()> {
|
||||||
self.mmap.flush()?;
|
self.mmap.flush()?;
|
||||||
let Self { path, mmap, n, overflow } = self;
|
let Self { path, mmap, n, overflow } = self;
|
||||||
@@ -129,35 +261,9 @@ impl PersistentCompactIntVecBuilder {
|
|||||||
finalize_pciv(&path, n, &entries)
|
finalize_pciv(&path, n, &entries)
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Close and reopen as a read-only [`PersistentCompactIntVec`].
|
|
||||||
pub fn finish(self) -> io::Result<PersistentCompactIntVec> {
|
pub fn finish(self) -> io::Result<PersistentCompactIntVec> {
|
||||||
let path = self.path.clone();
|
let path = self.path.clone();
|
||||||
self.close()?;
|
self.close()?;
|
||||||
PersistentCompactIntVec::open(&path)
|
PersistentCompactIntVec::open(&path)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── IntSlice / IntSliceMut impls ──────────────────────────────────────────────
|
|
||||||
|
|
||||||
use crate::traits::{IntSlice, IntSliceMut};
|
|
||||||
|
|
||||||
impl IntSlice for PersistentCompactIntVecBuilder {
|
|
||||||
fn len(&self) -> usize { self.n }
|
|
||||||
fn get(&self, slot: usize) -> u32 { self.get(slot) }
|
|
||||||
fn primary_bytes(&self) -> &[u8] { &self.mmap[HEADER_SIZE..HEADER_SIZE + self.n] }
|
|
||||||
fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
|
|
||||||
self.overflow.iter().map(|(&k, &v)| (k, v))
|
|
||||||
}
|
|
||||||
fn sum(&self) -> u64 {
|
|
||||||
byte_sum(&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n], self.overflow.values().copied())
|
|
||||||
}
|
|
||||||
fn count_nonzero(&self) -> u64 {
|
|
||||||
byte_count_nonzero(&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n])
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
impl IntSliceMut for PersistentCompactIntVecBuilder {
|
|
||||||
fn set(&mut self, slot: usize, value: u32) { self.set(slot, value); }
|
|
||||||
fn primary_bytes_mut(&mut self) -> &mut [u8] { &mut self.mmap[HEADER_SIZE..HEADER_SIZE + self.n] }
|
|
||||||
fn clear_overflow(&mut self) { self.overflow.clear(); }
|
|
||||||
}
|
|
||||||
|
|||||||
@@ -1,9 +1,7 @@
|
|||||||
use std::io;
|
use std::io;
|
||||||
|
|
||||||
use crate::memoryvec::MemoryBitVec;
|
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
|
||||||
use crate::tempbitvec::TempBitVec;
|
|
||||||
use crate::tempintvec::TempCompactIntVec;
|
use crate::tempintvec::TempCompactIntVec;
|
||||||
use crate::traits::BitSlice;
|
|
||||||
|
|
||||||
// ── ColGroup ──────────────────────────────────────────────────────────────────
|
// ── ColGroup ──────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -25,12 +23,14 @@ impl ColGroup {
|
|||||||
|
|
||||||
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
|
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
/// Per-matrix group aggregations that return **additive intermediates**.
|
/// Per-matrix group aggregations.
|
||||||
///
|
///
|
||||||
/// Results must be composed by the caller (concat across partitions, add across
|
/// `partial_group_presence_count`, `partial_group_sum`, `partial_group_any`,
|
||||||
/// layers) before applying final predicates (`geq`, `leq`, …). Non-additive
|
/// `partial_group_min`, `partial_group_max` are the primitives; each impl must
|
||||||
/// predicates like `group_all` or `group_at_least(k)` are intentionally absent
|
/// provide all five.
|
||||||
/// — they are derived at the index level from these intermediates.
|
///
|
||||||
|
/// `partial_group_all` and `partial_group_none` have default implementations
|
||||||
|
/// derived from `partial_group_presence_count` and should rarely need overriding.
|
||||||
pub trait MatrixGroupOps {
|
pub trait MatrixGroupOps {
|
||||||
/// Per-slot count of group columns whose value ≥ `threshold`.
|
/// Per-slot count of group columns whose value ≥ `threshold`.
|
||||||
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32) -> io::Result<TempCompactIntVec>;
|
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32) -> io::Result<TempCompactIntVec>;
|
||||||
@@ -38,25 +38,100 @@ pub trait MatrixGroupOps {
|
|||||||
/// Per-slot sum of values across all group columns.
|
/// Per-slot sum of values across all group columns.
|
||||||
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
|
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
|
||||||
|
|
||||||
/// Per-slot OR: true if any group column has value ≥ `threshold`.
|
/// Per-slot OR: 1 if any group column has value ≥ `threshold`.
|
||||||
fn partial_group_any(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec>;
|
fn partial_group_any(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec>;
|
||||||
|
|
||||||
|
/// Per-slot min value across all group columns (0 if group is empty).
|
||||||
|
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
|
||||||
|
|
||||||
|
/// Per-slot max value across all group columns (0 if group is empty).
|
||||||
|
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
|
||||||
|
|
||||||
|
/// Per-slot AND: 1 if ALL group columns have value ≥ `threshold`.
|
||||||
|
fn partial_group_all(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec> {
|
||||||
|
let counts = self.partial_group_presence_count(g, threshold)?;
|
||||||
|
let n = counts.len();
|
||||||
|
let n_required = g.indices.len() as u32;
|
||||||
|
let mut b = TempBitVecBuilder::new(n)?;
|
||||||
|
b.or_where(counts.view(), |v| v >= n_required);
|
||||||
|
b.freeze()
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Per-slot NOR: 1 if NO group column has value ≥ `threshold`.
|
||||||
|
fn partial_group_none(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec> {
|
||||||
|
let counts = self.partial_group_presence_count(g, threshold)?;
|
||||||
|
let n = counts.len();
|
||||||
|
let mut b = TempBitVecBuilder::new(n)?;
|
||||||
|
b.or_where(counts.view(), |v| v == 0);
|
||||||
|
b.freeze()
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Internal helper ───────────────────────────────────────────────────────────
|
// ── FilterMask — expression tree for column-based slot filters ────────────────
|
||||||
|
|
||||||
/// Iterate 1-bits of a `MemoryBitVec` and increment the corresponding raw
|
/// A composable filter expression that can be evaluated against a matrix
|
||||||
/// byte. Caller must guarantee that no counter will reach 255 (group size
|
/// using only column operations (no MPHF lookup per kmer).
|
||||||
/// < 255 columns), so that incrementing `u8` is safe and no sentinel is
|
///
|
||||||
/// accidentally written.
|
/// `threshold` semantics follow [`MatrixGroupOps::partial_group_presence_count`]:
|
||||||
pub(crate) fn inc_primary_bits(primary: &mut [u8], mask: &MemoryBitVec) {
|
/// a slot contributes to the count when its value is **≥ threshold**.
|
||||||
let n = primary.len();
|
/// To match the row-level filter (`value > t`), callers should pass `t + 1`.
|
||||||
for (wi, &word) in mask.words().iter().enumerate() {
|
#[derive(Debug, Clone)]
|
||||||
let mut w = word;
|
pub enum FilterMask {
|
||||||
while w != 0 {
|
/// Slot passes if count of columns in `indices` with value ≥ `threshold` is ≥ `min_count`.
|
||||||
let bit = w.trailing_zeros() as usize;
|
PresenceGeq { indices: Vec<usize>, threshold: u32, min_count: usize },
|
||||||
let s = wi * 64 + bit;
|
/// Slot passes if count of columns in `indices` with value ≥ `threshold` is ≤ `max_count`.
|
||||||
if s < n { primary[s] += 1; }
|
PresenceLeq { indices: Vec<usize>, threshold: u32, max_count: usize },
|
||||||
w &= w - 1;
|
/// Slot passes if sum of values across `indices` columns is ≥ `min_sum`.
|
||||||
|
SumGeq { indices: Vec<usize>, min_sum: u32 },
|
||||||
|
/// Slot passes if sum of values across `indices` columns is ≤ `max_sum`.
|
||||||
|
SumLeq { indices: Vec<usize>, max_sum: u32 },
|
||||||
|
/// Slot passes if it passes all sub-expressions. Empty `And` is always true.
|
||||||
|
And(Vec<FilterMask>),
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Evaluate a [`FilterMask`] against `mat`, returning a per-slot `TempBitVec`
|
||||||
|
/// where bit=1 means the slot passes the filter.
|
||||||
|
pub fn eval_filter_mask(expr: &FilterMask, mat: &dyn MatrixGroupOps, n: usize) -> io::Result<TempBitVec> {
|
||||||
|
match expr {
|
||||||
|
FilterMask::PresenceGeq { indices, threshold, min_count } => {
|
||||||
|
let g = ColGroup::new("", indices.clone());
|
||||||
|
let counts = mat.partial_group_presence_count(&g, *threshold)?;
|
||||||
|
let mut b = TempBitVecBuilder::new(n)?;
|
||||||
|
let mc = *min_count as u32;
|
||||||
|
b.or_where(counts.view(), |v| v >= mc);
|
||||||
|
b.freeze()
|
||||||
|
}
|
||||||
|
FilterMask::PresenceLeq { indices, threshold, max_count } => {
|
||||||
|
let g = ColGroup::new("", indices.clone());
|
||||||
|
let counts = mat.partial_group_presence_count(&g, *threshold)?;
|
||||||
|
let mut b = TempBitVecBuilder::new(n)?;
|
||||||
|
let mc = *max_count as u32;
|
||||||
|
b.or_where(counts.view(), |v| v <= mc);
|
||||||
|
b.freeze()
|
||||||
|
}
|
||||||
|
FilterMask::SumGeq { indices, min_sum } => {
|
||||||
|
let g = ColGroup::new("", indices.clone());
|
||||||
|
let sums = mat.partial_group_sum(&g)?;
|
||||||
|
let mut b = TempBitVecBuilder::new(n)?;
|
||||||
|
let ms = *min_sum;
|
||||||
|
b.or_where(sums.view(), |v| v >= ms);
|
||||||
|
b.freeze()
|
||||||
|
}
|
||||||
|
FilterMask::SumLeq { indices, max_sum } => {
|
||||||
|
let g = ColGroup::new("", indices.clone());
|
||||||
|
let sums = mat.partial_group_sum(&g)?;
|
||||||
|
let mut b = TempBitVecBuilder::new(n)?;
|
||||||
|
let ms = *max_sum;
|
||||||
|
b.or_where(sums.view(), |v| v <= ms);
|
||||||
|
b.freeze()
|
||||||
|
}
|
||||||
|
FilterMask::And(parts) => {
|
||||||
|
let mut b = TempBitVecBuilder::new_ones(n)?;
|
||||||
|
for part in parts {
|
||||||
|
let m = eval_filter_mask(part, mat, n)?;
|
||||||
|
b.and(m.view());
|
||||||
|
}
|
||||||
|
b.freeze()
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,5 +1,3 @@
|
|||||||
use std::cmp::Ordering;
|
|
||||||
use std::collections::HashMap;
|
|
||||||
use std::fs::{self, File};
|
use std::fs::{self, File};
|
||||||
use std::io::{self, BufWriter, Write as _};
|
use std::io::{self, BufWriter, Write as _};
|
||||||
use std::path::{Path, PathBuf};
|
use std::path::{Path, PathBuf};
|
||||||
@@ -10,14 +8,13 @@ use rayon::prelude::*;
|
|||||||
|
|
||||||
use crate::bitmatrix::{pairwise_matrix, pairwise2_matrix};
|
use crate::bitmatrix::{pairwise_matrix, pairwise2_matrix};
|
||||||
use crate::builder::PersistentCompactIntVecBuilder;
|
use crate::builder::PersistentCompactIntVecBuilder;
|
||||||
use crate::colgroup::{ColGroup, MatrixGroupOps, inc_primary_bits};
|
use crate::colgroup::{ColGroup, MatrixGroupOps};
|
||||||
use crate::memoryintvec::MemoryIntVec;
|
use crate::format::{HEADER_SIZE, OVERFLOW_ENTRY_SIZE};
|
||||||
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
|
|
||||||
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
|
||||||
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, OVERFLOW_ENTRY_SIZE, parse_index_entry, parse_overflow_entry};
|
|
||||||
use crate::meta::MatrixMeta;
|
use crate::meta::MatrixMeta;
|
||||||
use crate::reader::PersistentCompactIntVec;
|
use crate::reader::PersistentCompactIntVec;
|
||||||
use crate::traits::{BitSliceMut, IntSlice, IntSliceMut};
|
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
|
||||||
|
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
||||||
|
use crate::views::IntSliceView;
|
||||||
|
|
||||||
fn col_path(dir: &Path, col: usize) -> PathBuf {
|
fn col_path(dir: &Path, col: usize) -> PathBuf {
|
||||||
dir.join(format!("col_{col:06}.pciv"))
|
dir.join(format!("col_{col:06}.pciv"))
|
||||||
@@ -48,9 +45,7 @@ impl ColumnarCompactIntMatrix {
|
|||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
|
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
|
||||||
for (c, col) in self.cols.iter().enumerate() {
|
for (c, col) in self.cols.iter().enumerate() { buf[c] = col.get(slot); }
|
||||||
buf[c] = col.get(slot);
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn sum(&self) -> Array1<u64> {
|
pub(crate) fn sum(&self) -> Array1<u64> {
|
||||||
@@ -72,31 +67,22 @@ impl ColumnarCompactIntMatrix {
|
|||||||
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
|
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
|
||||||
pairwise_matrix(self.n_cols(), |i, j| self.col(i).partial_bray_dist(self.col(j)))
|
pairwise_matrix(self.n_cols(), |i, j| self.col(i).partial_bray_dist(self.col(j)))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
|
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
|
||||||
pairwise_matrix(self.n_cols(), |i, j| self.col(i).partial_euclidean_dist(self.col(j)))
|
pairwise_matrix(self.n_cols(), |i, j| self.col(i).partial_euclidean_dist(self.col(j)))
|
||||||
}
|
}
|
||||||
|
pub(crate) fn partial_threshold_jaccard_dist_matrix(&self, threshold: u32) -> (Array2<u64>, Array2<u64>) {
|
||||||
pub(crate) fn partial_threshold_jaccard_dist_matrix(
|
pairwise2_matrix(self.n_cols(), |i, j| self.col(i).partial_threshold_jaccard_dist(self.col(j), threshold))
|
||||||
&self, threshold: u32,
|
|
||||||
) -> (Array2<u64>, Array2<u64>) {
|
|
||||||
pairwise2_matrix(self.n_cols(), |i, j| {
|
|
||||||
self.col(i).partial_threshold_jaccard_dist(self.col(j), threshold)
|
|
||||||
})
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
pub(crate) fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
||||||
pairwise_matrix(self.n_cols(), |i, j| {
|
pairwise_matrix(self.n_cols(), |i, j| {
|
||||||
self.col(i).partial_relfreq_bray_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
|
self.col(i).partial_relfreq_bray_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
|
||||||
})
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
pub(crate) fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
||||||
pairwise_matrix(self.n_cols(), |i, j| {
|
pairwise_matrix(self.n_cols(), |i, j| {
|
||||||
self.col(i).partial_relfreq_euclidean_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
|
self.col(i).partial_relfreq_euclidean_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
|
||||||
})
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
pub(crate) fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
||||||
pairwise_matrix(self.n_cols(), |i, j| {
|
pairwise_matrix(self.n_cols(), |i, j| {
|
||||||
self.col(i).partial_hellinger_euclidean_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
|
self.col(i).partial_hellinger_euclidean_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
|
||||||
@@ -111,7 +97,6 @@ impl ColumnarCompactIntMatrix {
|
|||||||
meta.n_cols += 1;
|
meta.n_cols += 1;
|
||||||
meta.save(dir)
|
meta.save(dir)
|
||||||
}
|
}
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── PackedCompactIntMatrix ────────────────────────────────────────────────────
|
// ── PackedCompactIntMatrix ────────────────────────────────────────────────────
|
||||||
@@ -119,153 +104,12 @@ impl ColumnarCompactIntMatrix {
|
|||||||
const PCMX_MAGIC: [u8; 4] = *b"PCMX";
|
const PCMX_MAGIC: [u8; 4] = *b"PCMX";
|
||||||
const PCMX_HEADER: usize = 24; // magic(4) + pad(4) + n_rows(8) + n_cols(8)
|
const PCMX_HEADER: usize = 24; // magic(4) + pad(4) + n_rows(8) + n_cols(8)
|
||||||
|
|
||||||
/// Per-column metadata pre-parsed from the embedded PCIV header.
|
|
||||||
struct ColInfo {
|
struct ColInfo {
|
||||||
primary_start: usize, // absolute mmap offset to primary array
|
primary_start: usize,
|
||||||
data_offset: usize, // absolute mmap offset to overflow array
|
data_offset: usize,
|
||||||
n_overflow: usize,
|
n_overflow: usize,
|
||||||
step: usize,
|
|
||||||
index: Vec<(usize, usize)>,
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── PackedIntCol — lightweight column view backed by the shared mmap ──────────
|
|
||||||
|
|
||||||
pub(crate) struct PackedIntCol<'a> {
|
|
||||||
primary: &'a [u8],
|
|
||||||
overflow: &'a [u8], // raw bytes: n_overflow × OVERFLOW_ENTRY_SIZE
|
|
||||||
n_overflow: usize,
|
|
||||||
step: usize,
|
|
||||||
index: &'a [(usize, usize)],
|
|
||||||
n: usize,
|
|
||||||
}
|
|
||||||
|
|
||||||
impl PackedIntCol<'_> {
|
|
||||||
fn overflow_get(&self, slot: usize) -> u32 {
|
|
||||||
let (pos_start, pos_end) = if self.step == 0 {
|
|
||||||
(0, self.n_overflow)
|
|
||||||
} else {
|
|
||||||
let i = self.index.partition_point(|&(s, _)| s <= slot).saturating_sub(1);
|
|
||||||
let start = self.index[i].1;
|
|
||||||
let end = if i + 1 < self.index.len() { self.index[i + 1].1 } else { self.n_overflow };
|
|
||||||
(start, end)
|
|
||||||
};
|
|
||||||
let mut lo = pos_start;
|
|
||||||
let mut hi = pos_end;
|
|
||||||
while lo < hi {
|
|
||||||
let mid = lo + (hi - lo) / 2;
|
|
||||||
let (stored, val) = parse_overflow_entry(self.overflow, 0, mid);
|
|
||||||
match stored.cmp(&slot) {
|
|
||||||
Ordering::Equal => return val,
|
|
||||||
Ordering::Less => lo = mid + 1,
|
|
||||||
Ordering::Greater => hi = mid,
|
|
||||||
}
|
|
||||||
}
|
|
||||||
panic!("slot {slot} marked overflow but not found")
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
impl IntSlice for PackedIntCol<'_> {
|
|
||||||
fn len(&self) -> usize { self.n }
|
|
||||||
|
|
||||||
fn get(&self, slot: usize) -> u32 {
|
|
||||||
let v = self.primary[slot];
|
|
||||||
if v < 255 { v as u32 } else { self.overflow_get(slot) }
|
|
||||||
}
|
|
||||||
|
|
||||||
fn primary_bytes(&self) -> &[u8] { self.primary }
|
|
||||||
|
|
||||||
fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
|
|
||||||
(0..self.n_overflow).map(|i| parse_overflow_entry(self.overflow, 0, i))
|
|
||||||
}
|
|
||||||
|
|
||||||
fn iter(&self) -> impl Iterator<Item = u32> + '_ {
|
|
||||||
PackedIntColIter {
|
|
||||||
primary: self.primary,
|
|
||||||
overflow: self.overflow,
|
|
||||||
slot: 0,
|
|
||||||
overflow_pos: 0,
|
|
||||||
n: self.n,
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
fn sum(&self) -> u64 {
|
|
||||||
byte_sum(self.primary, (0..self.n_overflow).map(|i| parse_overflow_entry(self.overflow, 0, i).1))
|
|
||||||
}
|
|
||||||
|
|
||||||
fn count_nonzero(&self) -> u64 { byte_count_nonzero(self.primary) }
|
|
||||||
}
|
|
||||||
|
|
||||||
struct PackedIntColIter<'a> {
|
|
||||||
primary: &'a [u8],
|
|
||||||
overflow: &'a [u8],
|
|
||||||
slot: usize,
|
|
||||||
overflow_pos: usize,
|
|
||||||
n: usize,
|
|
||||||
}
|
|
||||||
|
|
||||||
impl Iterator for PackedIntColIter<'_> {
|
|
||||||
type Item = u32;
|
|
||||||
|
|
||||||
fn next(&mut self) -> Option<u32> {
|
|
||||||
if self.slot >= self.n { return None; }
|
|
||||||
let v = self.primary[self.slot];
|
|
||||||
self.slot += 1;
|
|
||||||
if v < 255 {
|
|
||||||
Some(v as u32)
|
|
||||||
} else {
|
|
||||||
let (_, val) = parse_overflow_entry(self.overflow, 0, self.overflow_pos);
|
|
||||||
self.overflow_pos += 1;
|
|
||||||
Some(val)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
fn size_hint(&self) -> (usize, Option<usize>) {
|
|
||||||
let rem = self.n - self.slot;
|
|
||||||
(rem, Some(rem))
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
impl ExactSizeIterator for PackedIntColIter<'_> {}
|
|
||||||
|
|
||||||
// ── IntColView — uniform column access across Columnar and Packed ─────────────
|
|
||||||
|
|
||||||
enum IntColViewInner<'a> {
|
|
||||||
Columnar(&'a PersistentCompactIntVec),
|
|
||||||
Packed(PackedIntCol<'a>),
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Opaque column view returned by [`PersistentCompactIntMatrix::col_view`].
|
|
||||||
/// Implements [`IntSlice`] uniformly for both Columnar and Packed matrix formats.
|
|
||||||
pub struct IntColView<'a>(IntColViewInner<'a>);
|
|
||||||
|
|
||||||
impl IntSlice for IntColView<'_> {
|
|
||||||
fn len(&self) -> usize {
|
|
||||||
match &self.0 { IntColViewInner::Columnar(c) => c.len(), IntColViewInner::Packed(c) => c.len() }
|
|
||||||
}
|
|
||||||
fn get(&self, slot: usize) -> u32 {
|
|
||||||
match &self.0 { IntColViewInner::Columnar(c) => c.get(slot), IntColViewInner::Packed(c) => c.get(slot) }
|
|
||||||
}
|
|
||||||
fn primary_bytes(&self) -> &[u8] {
|
|
||||||
match &self.0 { IntColViewInner::Columnar(c) => c.primary_bytes(), IntColViewInner::Packed(c) => c.primary_bytes() }
|
|
||||||
}
|
|
||||||
fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
|
|
||||||
// Box<dyn Iterator> implements Iterator, satisfying RPITIT across two distinct types.
|
|
||||||
let it: Box<dyn Iterator<Item = (usize, u32)> + '_> = match &self.0 {
|
|
||||||
IntColViewInner::Columnar(c) => Box::new(c.overflow_entries()),
|
|
||||||
IntColViewInner::Packed(c) => Box::new(c.overflow_entries()),
|
|
||||||
};
|
|
||||||
it
|
|
||||||
}
|
|
||||||
fn sum(&self) -> u64 {
|
|
||||||
match &self.0 { IntColViewInner::Columnar(c) => c.sum(), IntColViewInner::Packed(c) => c.sum() }
|
|
||||||
}
|
|
||||||
fn count_nonzero(&self) -> u64 {
|
|
||||||
match &self.0 { IntColViewInner::Columnar(c) => c.count_nonzero(), IntColViewInner::Packed(c) => c.count_nonzero() }
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ─────────────────────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
pub struct PackedCompactIntMatrix {
|
pub struct PackedCompactIntMatrix {
|
||||||
mmap: Mmap,
|
mmap: Mmap,
|
||||||
n_rows: usize,
|
n_rows: usize,
|
||||||
@@ -289,52 +133,30 @@ impl PackedCompactIntMatrix {
|
|||||||
for c in 0..n_cols {
|
for c in 0..n_cols {
|
||||||
let off_pos = PCMX_HEADER + c * 8;
|
let off_pos = PCMX_HEADER + c * 8;
|
||||||
let col_base = u64::from_le_bytes(mmap[off_pos..off_pos+8].try_into().unwrap()) as usize;
|
let col_base = u64::from_le_bytes(mmap[off_pos..off_pos+8].try_into().unwrap()) as usize;
|
||||||
// Parse embedded PCIV header at col_base
|
|
||||||
let n_ov = u64::from_le_bytes(mmap[col_base+16..col_base+24].try_into().unwrap()) as usize;
|
let n_ov = u64::from_le_bytes(mmap[col_base+16..col_base+24].try_into().unwrap()) as usize;
|
||||||
let n_idx = u64::from_le_bytes(mmap[col_base+24..col_base+32].try_into().unwrap()) as usize;
|
|
||||||
let step = u64::from_le_bytes(mmap[col_base+32..col_base+40].try_into().unwrap()) as usize;
|
|
||||||
let n_pciv = u64::from_le_bytes(mmap[col_base+8..col_base+16].try_into().unwrap()) as usize;
|
let n_pciv = u64::from_le_bytes(mmap[col_base+8..col_base+16].try_into().unwrap()) as usize;
|
||||||
|
|
||||||
let primary_start = col_base + HEADER_SIZE;
|
let primary_start = col_base + HEADER_SIZE;
|
||||||
let data_offset = primary_start + n_pciv;
|
let data_offset = primary_start + n_pciv;
|
||||||
let index_offset = data_offset + n_ov * OVERFLOW_ENTRY_SIZE;
|
columns.push(ColInfo { primary_start, data_offset, n_overflow: n_ov });
|
||||||
|
|
||||||
let mut index = Vec::with_capacity(n_idx);
|
|
||||||
for i in 0..n_idx {
|
|
||||||
index.push(parse_index_entry(&mmap, index_offset, i));
|
|
||||||
}
|
}
|
||||||
columns.push(ColInfo { primary_start, data_offset, n_overflow: n_ov, step, index });
|
|
||||||
}
|
|
||||||
|
|
||||||
Ok(Self { mmap, n_rows, n_cols, columns })
|
Ok(Self { mmap, n_rows, n_cols, columns })
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn col_slice(&self, c: usize) -> PackedIntCol<'_> {
|
pub(crate) fn col_view(&self, c: usize) -> IntSliceView<'_> {
|
||||||
let ci = &self.columns[c];
|
let ci = &self.columns[c];
|
||||||
PackedIntCol {
|
let primary = &self.mmap[ci.primary_start..ci.primary_start + self.n_rows];
|
||||||
primary: &self.mmap[ci.primary_start..ci.primary_start + self.n_rows],
|
let overflow_raw = &self.mmap[ci.data_offset..ci.data_offset + ci.n_overflow * OVERFLOW_ENTRY_SIZE];
|
||||||
overflow: &self.mmap[ci.data_offset..ci.data_offset + ci.n_overflow * OVERFLOW_ENTRY_SIZE],
|
IntSliceView::new(primary, overflow_raw, ci.n_overflow, self.n_rows)
|
||||||
n_overflow: ci.n_overflow,
|
|
||||||
step: ci.step,
|
|
||||||
index: &ci.index,
|
|
||||||
n: self.n_rows,
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentCompactIntVecBuilder> {
|
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentCompactIntVecBuilder> {
|
||||||
let col = self.col_slice(c);
|
let view = self.col_view(c);
|
||||||
let overflow: HashMap<usize, u32> = col.overflow_entries().collect();
|
let overflow: std::collections::HashMap<usize, u32> = view.overflow_entries().collect();
|
||||||
PersistentCompactIntVecBuilder::from_raw_primary(col.primary, overflow, path)
|
PersistentCompactIntVecBuilder::from_raw_primary(view.primary_bytes(), overflow, path)
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) fn col_as_memory(&self, c: usize) -> MemoryIntVec {
|
|
||||||
MemoryIntVec::from(&self.col_slice(c))
|
|
||||||
}
|
}
|
||||||
|
|
||||||
#[inline]
|
#[inline]
|
||||||
pub(crate) fn get(&self, col: usize, slot: usize) -> u32 {
|
pub(crate) fn get(&self, col: usize, slot: usize) -> u32 { self.col_view(col).get(slot) }
|
||||||
self.col_slice(col).get(slot)
|
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
|
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
|
||||||
for c in 0..self.n_cols { buf[c] = self.get(c, slot); }
|
for c in 0..self.n_cols { buf[c] = self.get(c, slot); }
|
||||||
@@ -346,86 +168,61 @@ impl PackedCompactIntMatrix {
|
|||||||
|
|
||||||
pub(crate) fn sum(&self) -> Array1<u64> {
|
pub(crate) fn sum(&self) -> Array1<u64> {
|
||||||
Array1::from_vec(
|
Array1::from_vec(
|
||||||
(0..self.n_cols).into_par_iter()
|
(0..self.n_cols).into_par_iter().map(|c| self.col_view(c).sum()).collect()
|
||||||
.map(|c| self.col_slice(c).sum())
|
|
||||||
.collect()
|
|
||||||
)
|
)
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn count_nonzero(&self) -> Array1<u64> {
|
pub(crate) fn count_nonzero(&self) -> Array1<u64> {
|
||||||
Array1::from_vec(
|
Array1::from_vec(
|
||||||
(0..self.n_cols).into_par_iter()
|
(0..self.n_cols).into_par_iter().map(|c| self.col_view(c).count_nonzero()).collect()
|
||||||
.map(|c| self.col_slice(c).count_nonzero())
|
|
||||||
.collect()
|
|
||||||
)
|
)
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Pair primitives — sequential scan via col_slice().iter() ─────────────
|
|
||||||
|
|
||||||
fn pair_partial_bray(&self, i: usize, j: usize) -> u64 {
|
fn pair_partial_bray(&self, i: usize, j: usize) -> u64 {
|
||||||
self.col_slice(i).iter().zip(self.col_slice(j).iter())
|
self.col_view(i).iter().zip(self.col_view(j).iter()).map(|(a, b)| a.min(b) as u64).sum()
|
||||||
.map(|(a, b)| a.min(b) as u64)
|
|
||||||
.sum()
|
|
||||||
}
|
}
|
||||||
|
|
||||||
fn pair_partial_euclidean(&self, i: usize, j: usize) -> f64 {
|
fn pair_partial_euclidean(&self, i: usize, j: usize) -> f64 {
|
||||||
self.col_slice(i).iter().zip(self.col_slice(j).iter())
|
self.col_view(i).iter().zip(self.col_view(j).iter())
|
||||||
.map(|(a, b)| { let d = a as f64 - b as f64; d * d })
|
.map(|(a, b)| { let d = a as f64 - b as f64; d * d }).sum()
|
||||||
.sum()
|
|
||||||
}
|
}
|
||||||
|
|
||||||
fn pair_partial_threshold_jaccard(&self, i: usize, j: usize, t: u32) -> (u64, u64) {
|
fn pair_partial_threshold_jaccard(&self, i: usize, j: usize, t: u32) -> (u64, u64) {
|
||||||
self.col_slice(i).iter().zip(self.col_slice(j).iter())
|
self.col_view(i).iter().zip(self.col_view(j).iter())
|
||||||
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
|
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
|
||||||
let ap = a >= t;
|
let ap = a >= t; let bp = b >= t;
|
||||||
let bp = b >= t;
|
|
||||||
(inter + (ap & bp) as u64, uni + (ap | bp) as u64)
|
(inter + (ap & bp) as u64, uni + (ap | bp) as u64)
|
||||||
})
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
fn pair_partial_relfreq_bray(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
|
fn pair_partial_relfreq_bray(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
|
||||||
if si == 0.0 || sj == 0.0 { return 0.0; }
|
if si == 0.0 || sj == 0.0 { return 0.0; }
|
||||||
self.col_slice(i).iter().zip(self.col_slice(j).iter())
|
self.col_view(i).iter().zip(self.col_view(j).iter())
|
||||||
.map(|(a, b)| (a as f64 / si).min(b as f64 / sj))
|
.map(|(a, b)| (a as f64 / si).min(b as f64 / sj)).sum()
|
||||||
.sum()
|
|
||||||
}
|
}
|
||||||
|
|
||||||
fn pair_partial_relfreq_euclidean(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
|
fn pair_partial_relfreq_euclidean(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
|
||||||
if si == 0.0 || sj == 0.0 { return 0.0; }
|
if si == 0.0 || sj == 0.0 { return 0.0; }
|
||||||
self.col_slice(i).iter().zip(self.col_slice(j).iter())
|
self.col_view(i).iter().zip(self.col_view(j).iter())
|
||||||
.map(|(a, b)| { let d = a as f64 / si - b as f64 / sj; d * d })
|
.map(|(a, b)| { let d = a as f64 / si - b as f64 / sj; d * d }).sum()
|
||||||
.sum()
|
|
||||||
}
|
}
|
||||||
|
|
||||||
fn pair_partial_hellinger(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
|
fn pair_partial_hellinger(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
|
||||||
if si == 0.0 || sj == 0.0 { return 0.0; }
|
if si == 0.0 || sj == 0.0 { return 0.0; }
|
||||||
self.col_slice(i).iter().zip(self.col_slice(j).iter())
|
self.col_view(i).iter().zip(self.col_view(j).iter())
|
||||||
.map(|(a, b)| { let d = (a as f64 / si).sqrt() - (b as f64 / sj).sqrt(); d * d })
|
.map(|(a, b)| { let d = (a as f64 / si).sqrt() - (b as f64 / sj).sqrt(); d * d }).sum()
|
||||||
.sum()
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Matrix methods ────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
|
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
|
||||||
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_bray(i, j))
|
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_bray(i, j))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
|
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
|
||||||
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_euclidean(i, j))
|
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_euclidean(i, j))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_threshold_jaccard_dist_matrix(&self, t: u32) -> (Array2<u64>, Array2<u64>) {
|
pub(crate) fn partial_threshold_jaccard_dist_matrix(&self, t: u32) -> (Array2<u64>, Array2<u64>) {
|
||||||
pairwise2_matrix(self.n_cols, |i, j| self.pair_partial_threshold_jaccard(i, j, t))
|
pairwise2_matrix(self.n_cols, |i, j| self.pair_partial_threshold_jaccard(i, j, t))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
pub(crate) fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
||||||
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_relfreq_bray(i, j, col_sums[i] as f64, col_sums[j] as f64))
|
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_relfreq_bray(i, j, col_sums[i] as f64, col_sums[j] as f64))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
pub(crate) fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
||||||
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_relfreq_euclidean(i, j, col_sums[i] as f64, col_sums[j] as f64))
|
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_relfreq_euclidean(i, j, col_sums[i] as f64, col_sums[j] as f64))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub(crate) fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
pub(crate) fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
||||||
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_hellinger(i, j, col_sums[i] as f64, col_sums[j] as f64))
|
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_hellinger(i, j, col_sums[i] as f64, col_sums[j] as f64))
|
||||||
}
|
}
|
||||||
@@ -435,32 +232,21 @@ impl PackedCompactIntMatrix {
|
|||||||
pub fn pack_compact_int_matrix(dir: &Path) -> io::Result<()> {
|
pub fn pack_compact_int_matrix(dir: &Path) -> io::Result<()> {
|
||||||
let packed_path = dir.join("matrix.pcmx");
|
let packed_path = dir.join("matrix.pcmx");
|
||||||
if packed_path.exists() {
|
if packed_path.exists() {
|
||||||
// Matrix complete; remove any leftover column files from a killed cleanup.
|
|
||||||
if let Ok(meta) = MatrixMeta::load(dir) {
|
if let Ok(meta) = MatrixMeta::load(dir) {
|
||||||
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
|
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
|
||||||
let _ = fs::remove_file(dir.join("meta.json"));
|
let _ = fs::remove_file(dir.join("meta.json"));
|
||||||
}
|
}
|
||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
|
|
||||||
let meta = MatrixMeta::load(dir)?;
|
let meta = MatrixMeta::load(dir)?;
|
||||||
let n_cols = meta.n_cols;
|
let n_cols = meta.n_cols;
|
||||||
|
|
||||||
// Compute offsets from file sizes — no column data loaded into RAM.
|
|
||||||
let col_sizes: Vec<u64> = (0..n_cols)
|
let col_sizes: Vec<u64> = (0..n_cols)
|
||||||
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
|
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
|
||||||
.collect::<io::Result<_>>()?;
|
.collect::<io::Result<_>>()?;
|
||||||
|
|
||||||
let header_size = (PCMX_HEADER + n_cols * 8) as u64;
|
let header_size = (PCMX_HEADER + n_cols * 8) as u64;
|
||||||
let mut col_offset = header_size;
|
let mut col_offset = header_size;
|
||||||
let mut offsets = Vec::with_capacity(n_cols);
|
let mut offsets = Vec::with_capacity(n_cols);
|
||||||
for &size in &col_sizes {
|
for &size in &col_sizes { offsets.push(col_offset); col_offset += size; }
|
||||||
offsets.push(col_offset);
|
|
||||||
col_offset += size;
|
|
||||||
}
|
|
||||||
|
|
||||||
// Write to a temp file; rename atomically so a killed process never leaves
|
|
||||||
// a truncated matrix.pcmx that would be mistaken for a complete file.
|
|
||||||
let tmp_path = dir.join("matrix.pcmx.tmp");
|
let tmp_path = dir.join("matrix.pcmx.tmp");
|
||||||
let mut out = BufWriter::new(File::create(&tmp_path)?);
|
let mut out = BufWriter::new(File::create(&tmp_path)?);
|
||||||
out.write_all(&PCMX_MAGIC)?;
|
out.write_all(&PCMX_MAGIC)?;
|
||||||
@@ -468,13 +254,10 @@ pub fn pack_compact_int_matrix(dir: &Path) -> io::Result<()> {
|
|||||||
out.write_all(&(meta.n as u64).to_le_bytes())?;
|
out.write_all(&(meta.n as u64).to_le_bytes())?;
|
||||||
out.write_all(&(n_cols as u64).to_le_bytes())?;
|
out.write_all(&(n_cols as u64).to_le_bytes())?;
|
||||||
for &off in &offsets { out.write_all(&off.to_le_bytes())?; }
|
for &off in &offsets { out.write_all(&off.to_le_bytes())?; }
|
||||||
for c in 0..n_cols {
|
for c in 0..n_cols { io::copy(&mut File::open(col_path(dir, c))?, &mut out)?; }
|
||||||
io::copy(&mut File::open(col_path(dir, c))?, &mut out)?;
|
|
||||||
}
|
|
||||||
out.flush()?;
|
out.flush()?;
|
||||||
drop(out);
|
drop(out);
|
||||||
fs::rename(&tmp_path, &packed_path)?;
|
fs::rename(&tmp_path, &packed_path)?;
|
||||||
|
|
||||||
for c in 0..n_cols { fs::remove_file(col_path(dir, c))?; }
|
for c in 0..n_cols { fs::remove_file(col_path(dir, c))?; }
|
||||||
fs::remove_file(dir.join("meta.json"))?;
|
fs::remove_file(dir.join("meta.json"))?;
|
||||||
Ok(())
|
Ok(())
|
||||||
@@ -488,18 +271,14 @@ pub enum PersistentCompactIntMatrix {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl PersistentCompactIntMatrix {
|
impl PersistentCompactIntMatrix {
|
||||||
/// Open from `layer_dir`, auto-detecting Packed or Columnar.
|
|
||||||
pub fn open(layer_dir: &Path) -> io::Result<Self> {
|
pub fn open(layer_dir: &Path) -> io::Result<Self> {
|
||||||
let counts_dir = layer_dir.join("counts");
|
let counts_dir = layer_dir.join("counts");
|
||||||
|
|
||||||
if counts_dir.join("matrix.pcmx").exists() {
|
if counts_dir.join("matrix.pcmx").exists() {
|
||||||
return Ok(Self::Packed(PackedCompactIntMatrix::open(&counts_dir.join("matrix.pcmx"))?));
|
return Ok(Self::Packed(PackedCompactIntMatrix::open(&counts_dir.join("matrix.pcmx"))?));
|
||||||
}
|
}
|
||||||
|
|
||||||
if MatrixMeta::load(&counts_dir).is_ok() {
|
if MatrixMeta::load(&counts_dir).is_ok() {
|
||||||
return Ok(Self::Columnar(ColumnarCompactIntMatrix::open(&counts_dir)?));
|
return Ok(Self::Columnar(ColumnarCompactIntMatrix::open(&counts_dir)?));
|
||||||
}
|
}
|
||||||
|
|
||||||
Err(io::Error::new(
|
Err(io::Error::new(
|
||||||
io::ErrorKind::NotFound,
|
io::ErrorKind::NotFound,
|
||||||
format!("no count matrix found in {} — run 'obikmer upgrade'", layer_dir.display()),
|
format!("no count matrix found in {} — run 'obikmer upgrade'", layer_dir.display()),
|
||||||
@@ -509,7 +288,6 @@ impl PersistentCompactIntMatrix {
|
|||||||
pub fn n(&self) -> usize {
|
pub fn n(&self) -> usize {
|
||||||
match self { Self::Columnar(m) => m.n(), Self::Packed(m) => m.n_rows }
|
match self { Self::Columnar(m) => m.n(), Self::Packed(m) => m.n_rows }
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn n_cols(&self) -> usize {
|
pub fn n_cols(&self) -> usize {
|
||||||
match self { Self::Columnar(m) => m.n_cols(), Self::Packed(m) => m.n_cols }
|
match self { Self::Columnar(m) => m.n_cols(), Self::Packed(m) => m.n_cols }
|
||||||
}
|
}
|
||||||
@@ -521,10 +299,10 @@ impl PersistentCompactIntMatrix {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn col_view(&self, c: usize) -> IntColView<'_> {
|
pub fn col_view(&self, c: usize) -> IntSliceView<'_> {
|
||||||
match self {
|
match self {
|
||||||
Self::Columnar(m) => IntColView(IntColViewInner::Columnar(m.col(c))),
|
Self::Columnar(m) => m.col(c).view(),
|
||||||
Self::Packed(m) => IntColView(IntColViewInner::Packed(m.col_slice(c))),
|
Self::Packed(m) => m.col_view(c),
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -535,29 +313,18 @@ impl PersistentCompactIntMatrix {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn col_as_memory(&self, c: usize) -> MemoryIntVec {
|
|
||||||
match self {
|
|
||||||
Self::Columnar(m) => MemoryIntVec::from(m.col(c)),
|
|
||||||
Self::Packed(m) => m.col_as_memory(c),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn row(&self, slot: usize) -> Box<[u32]> {
|
pub fn row(&self, slot: usize) -> Box<[u32]> {
|
||||||
match self { Self::Columnar(m) => m.row(slot), Self::Packed(m) => m.row(slot) }
|
match self { Self::Columnar(m) => m.row(slot), Self::Packed(m) => m.row(slot) }
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn fill_row(&self, slot: usize, buf: &mut [u32]) {
|
pub fn fill_row(&self, slot: usize, buf: &mut [u32]) {
|
||||||
match self { Self::Columnar(m) => m.fill_row(slot, buf), Self::Packed(m) => m.fill_row(slot, buf) }
|
match self { Self::Columnar(m) => m.fill_row(slot, buf), Self::Packed(m) => m.fill_row(slot, buf) }
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn sum(&self) -> Array1<u64> {
|
pub fn sum(&self) -> Array1<u64> {
|
||||||
match self { Self::Columnar(m) => m.sum(), Self::Packed(m) => m.sum() }
|
match self { Self::Columnar(m) => m.sum(), Self::Packed(m) => m.sum() }
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn count_nonzero(&self) -> Array1<u64> {
|
pub fn count_nonzero(&self) -> Array1<u64> {
|
||||||
match self { Self::Columnar(m) => m.count_nonzero(), Self::Packed(m) => m.count_nonzero() }
|
match self { Self::Columnar(m) => m.count_nonzero(), Self::Packed(m) => m.count_nonzero() }
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn partial_bray_dist_matrix(&self) -> Array2<u64> {
|
pub fn partial_bray_dist_matrix(&self) -> Array2<u64> {
|
||||||
match self { Self::Columnar(m) => m.partial_bray_dist_matrix(), Self::Packed(m) => m.partial_bray_dist_matrix() }
|
match self { Self::Columnar(m) => m.partial_bray_dist_matrix(), Self::Packed(m) => m.partial_bray_dist_matrix() }
|
||||||
}
|
}
|
||||||
@@ -576,7 +343,6 @@ impl PersistentCompactIntMatrix {
|
|||||||
pub fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
pub fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
|
||||||
match self { Self::Columnar(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums), Self::Packed(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums) }
|
match self { Self::Columnar(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums), Self::Packed(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums) }
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn append_column(dir: &Path, value_of: impl Fn(usize) -> u32) -> io::Result<()> {
|
pub fn append_column(dir: &Path, value_of: impl Fn(usize) -> u32) -> io::Result<()> {
|
||||||
ColumnarCompactIntMatrix::append_column(dir, value_of)
|
ColumnarCompactIntMatrix::append_column(dir, value_of)
|
||||||
}
|
}
|
||||||
@@ -613,16 +379,28 @@ impl PersistentCompactIntMatrixBuilder {
|
|||||||
fs::create_dir_all(dir)?;
|
fs::create_dir_all(dir)?;
|
||||||
Ok(Self { dir: dir.to_path_buf(), n, n_cols: 0 })
|
Ok(Self { dir: dir.to_path_buf(), n, n_cols: 0 })
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn n(&self) -> usize { self.n }
|
pub fn n(&self) -> usize { self.n }
|
||||||
pub fn n_cols(&self) -> usize { self.n_cols }
|
pub fn n_cols(&self) -> usize { self.n_cols }
|
||||||
|
|
||||||
pub fn add_col(&mut self) -> io::Result<PersistentCompactIntVecBuilder> {
|
pub fn add_col(&mut self) -> io::Result<PersistentCompactIntVecBuilder> {
|
||||||
let path = col_path(&self.dir, self.n_cols);
|
let path = col_path(&self.dir, self.n_cols);
|
||||||
self.n_cols += 1;
|
self.n_cols += 1;
|
||||||
PersistentCompactIntVecBuilder::new(self.n, &path)
|
PersistentCompactIntVecBuilder::new(self.n, &path)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
pub fn add_col_from(&mut self, src: &TempCompactIntVec) -> io::Result<()> {
|
||||||
|
src.make_persistent(&col_path(&self.dir, self.n_cols))?;
|
||||||
|
self.n_cols += 1;
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn add_col_from_bit(&mut self, src: &TempBitVec) -> io::Result<()> {
|
||||||
|
let path = col_path(&self.dir, self.n_cols);
|
||||||
|
self.n_cols += 1;
|
||||||
|
let mut b = PersistentCompactIntVecBuilder::new(self.n, &path)?;
|
||||||
|
b.inc_present(src.view());
|
||||||
|
b.close()
|
||||||
|
}
|
||||||
|
|
||||||
pub fn close(self) -> io::Result<()> {
|
pub fn close(self) -> io::Result<()> {
|
||||||
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
|
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
|
||||||
}
|
}
|
||||||
@@ -634,30 +412,20 @@ impl MatrixGroupOps for PersistentCompactIntMatrix {
|
|||||||
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32) -> io::Result<TempCompactIntVec> {
|
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32) -> io::Result<TempCompactIntVec> {
|
||||||
let n = self.n();
|
let n = self.n();
|
||||||
if g.indices.len() < 255 {
|
if g.indices.len() < 255 {
|
||||||
// Fast path: counts fit in u8 — accumulate directly into raw bytes.
|
|
||||||
let mut builder = TempCompactIntVecBuilder::new(n)?;
|
let mut builder = TempCompactIntVecBuilder::new(n)?;
|
||||||
{
|
|
||||||
let primary = builder.primary_bytes_mut();
|
|
||||||
for &c in &g.indices {
|
for &c in &g.indices {
|
||||||
let mask = self.col_view(c).cmp_scalar(|v| v >= threshold);
|
builder.inc_predicate_fast(self.col_view(c), |v| v >= threshold);
|
||||||
inc_primary_bits(primary, &mask);
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
builder.freeze()
|
builder.freeze()
|
||||||
} else {
|
} else {
|
||||||
// Slow path: chunk by 254 to keep per-chunk u8 safe, then add chunks.
|
|
||||||
let mut result = TempCompactIntVecBuilder::new(n)?;
|
let mut result = TempCompactIntVecBuilder::new(n)?;
|
||||||
for chunk in g.indices.chunks(254) {
|
for chunk in g.indices.chunks(254) {
|
||||||
let mut chunk_builder = TempCompactIntVecBuilder::new(n)?;
|
let mut chunk_b = TempCompactIntVecBuilder::new(n)?;
|
||||||
{
|
|
||||||
let primary = chunk_builder.primary_bytes_mut();
|
|
||||||
for &c in chunk {
|
for &c in chunk {
|
||||||
let mask = self.col_view(c).cmp_scalar(|v| v >= threshold);
|
chunk_b.inc_predicate_fast(self.col_view(c), |v| v >= threshold);
|
||||||
inc_primary_bits(primary, &mask);
|
|
||||||
}
|
}
|
||||||
}
|
let frozen = chunk_b.freeze()?;
|
||||||
let chunk_frozen = chunk_builder.freeze()?;
|
result.add(frozen.view());
|
||||||
IntSliceMut::add(&mut result, &chunk_frozen);
|
|
||||||
}
|
}
|
||||||
result.freeze()
|
result.freeze()
|
||||||
}
|
}
|
||||||
@@ -666,10 +434,7 @@ impl MatrixGroupOps for PersistentCompactIntMatrix {
|
|||||||
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
|
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
|
||||||
let n = self.n();
|
let n = self.n();
|
||||||
let mut result = TempCompactIntVecBuilder::new(n)?;
|
let mut result = TempCompactIntVecBuilder::new(n)?;
|
||||||
for &c in &g.indices {
|
for &c in &g.indices { result.add(self.col_view(c)); }
|
||||||
let view = self.col_view(c);
|
|
||||||
IntSliceMut::add(&mut result, &view);
|
|
||||||
}
|
|
||||||
result.freeze()
|
result.freeze()
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -677,9 +442,25 @@ impl MatrixGroupOps for PersistentCompactIntMatrix {
|
|||||||
let n = self.n();
|
let n = self.n();
|
||||||
let mut result = TempBitVecBuilder::new(n)?;
|
let mut result = TempBitVecBuilder::new(n)?;
|
||||||
for &c in &g.indices {
|
for &c in &g.indices {
|
||||||
let mask = self.col_view(c).cmp_scalar(|v| v >= threshold);
|
result.or_where(self.col_view(c), |v| v >= threshold);
|
||||||
result.or(&mask);
|
|
||||||
}
|
}
|
||||||
result.freeze()
|
result.freeze()
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
|
||||||
|
let n = self.n();
|
||||||
|
let mut result = TempCompactIntVecBuilder::new(n)?;
|
||||||
|
if let Some((&first, rest)) = g.indices.split_first() {
|
||||||
|
result.add(self.col_view(first));
|
||||||
|
for &c in rest { result.min(self.col_view(c)); }
|
||||||
|
}
|
||||||
|
result.freeze()
|
||||||
|
}
|
||||||
|
|
||||||
|
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
|
||||||
|
let n = self.n();
|
||||||
|
let mut result = TempCompactIntVecBuilder::new(n)?;
|
||||||
|
for &c in &g.indices { result.max(self.col_view(c)); }
|
||||||
|
result.freeze()
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -5,26 +5,24 @@ mod colgroup;
|
|||||||
mod format;
|
mod format;
|
||||||
mod intmatrix;
|
mod intmatrix;
|
||||||
mod layer_meta;
|
mod layer_meta;
|
||||||
mod memoryintvec;
|
|
||||||
mod memoryvec;
|
|
||||||
mod meta;
|
mod meta;
|
||||||
mod reader;
|
mod reader;
|
||||||
mod tempbitvec;
|
mod tempbitvec;
|
||||||
mod tempintvec;
|
mod tempintvec;
|
||||||
|
mod views;
|
||||||
pub mod traits;
|
pub mod traits;
|
||||||
|
|
||||||
pub use bitvec::{BitIter, PersistentBitVec, PersistentBitVecBuilder};
|
pub use bitvec::{BitIter, PersistentBitVec, PersistentBitVecBuilder};
|
||||||
pub use bitmatrix::{BitColView, PersistentBitMatrix, PersistentBitMatrixBuilder, pack_bit_matrix};
|
pub use bitmatrix::{PersistentBitMatrix, PersistentBitMatrixBuilder, pack_bit_matrix};
|
||||||
pub use builder::PersistentCompactIntVecBuilder;
|
pub use builder::PersistentCompactIntVecBuilder;
|
||||||
pub use colgroup::{ColGroup, MatrixGroupOps};
|
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
|
||||||
pub use intmatrix::{IntColView, PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
|
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
|
||||||
pub use layer_meta::LayerMeta;
|
pub use layer_meta::LayerMeta;
|
||||||
pub use memoryintvec::{MemoryIntIter, MemoryIntVec};
|
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
|
||||||
pub use memoryvec::MemoryBitVec;
|
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
|
||||||
pub use reader::PersistentCompactIntVec;
|
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
||||||
pub use tempbitvec::TempBitVec;
|
pub use traits::{BitPartials, ColumnWeights, CountPartials};
|
||||||
pub use tempintvec::TempCompactIntVec;
|
pub use views::{BitSliceView, BitSliceIter, IntSliceView, IntSliceViewIter};
|
||||||
pub use traits::{BitPartials, BitSlice, BitSliceMut, BitToInt, ColumnWeights, CountPartials, IntSlice, IntSliceMut, IntToBit};
|
|
||||||
|
|
||||||
#[cfg(test)]
|
#[cfg(test)]
|
||||||
#[path = "tests/mod.rs"]
|
#[path = "tests/mod.rs"]
|
||||||
|
|||||||
@@ -1,186 +0,0 @@
|
|||||||
use std::collections::HashMap;
|
|
||||||
use std::io;
|
|
||||||
use std::ops::{Add, AddAssign, Sub, SubAssign};
|
|
||||||
use std::path::Path;
|
|
||||||
|
|
||||||
use crate::builder::PersistentCompactIntVecBuilder;
|
|
||||||
use crate::format::{byte_count_nonzero, byte_sum};
|
|
||||||
use crate::traits::{IntSlice, IntSliceMut};
|
|
||||||
|
|
||||||
// ── MemoryIntVec ──────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
#[derive(Clone)]
|
|
||||||
pub struct MemoryIntVec {
|
|
||||||
primary: Vec<u8>,
|
|
||||||
overflow: HashMap<usize, u32>,
|
|
||||||
n: usize,
|
|
||||||
}
|
|
||||||
|
|
||||||
impl MemoryIntVec {
|
|
||||||
pub fn new(n: usize) -> Self {
|
|
||||||
Self { primary: vec![0u8; n], overflow: HashMap::new(), n }
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn len(&self) -> usize { self.n }
|
|
||||||
pub fn is_empty(&self) -> bool { self.n == 0 }
|
|
||||||
|
|
||||||
/// Construct directly from a pre-built primary array (no overflow — all values < 255).
|
|
||||||
pub(crate) fn from_primary(primary: Vec<u8>) -> Self {
|
|
||||||
let n = primary.len();
|
|
||||||
Self { primary, overflow: HashMap::new(), n }
|
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) fn from_primary_and_overflow(primary: Vec<u8>, overflow: HashMap<usize, u32>) -> Self {
|
|
||||||
let n = primary.len();
|
|
||||||
Self { primary, overflow, n }
|
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) fn primary_bytes(&self) -> &[u8] { &self.primary }
|
|
||||||
pub(crate) fn overflow_map(&self) -> &HashMap<usize, u32> { &self.overflow }
|
|
||||||
|
|
||||||
pub fn get(&self, slot: usize) -> u32 {
|
|
||||||
match self.primary[slot] {
|
|
||||||
255 => *self.overflow.get(&slot).expect("sentinel without overflow entry"),
|
|
||||||
v => v as u32,
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn sum(&self) -> u64 {
|
|
||||||
byte_sum(&self.primary, self.overflow.values().copied())
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn count_nonzero(&self) -> u64 {
|
|
||||||
byte_count_nonzero(&self.primary)
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn filled(n: usize, value: u32) -> Self {
|
|
||||||
if value < 255 {
|
|
||||||
Self { primary: vec![value as u8; n], overflow: HashMap::new(), n }
|
|
||||||
} else {
|
|
||||||
Self { primary: vec![255u8; n], overflow: (0..n).map(|i| (i, value)).collect(), n }
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn iter(&self) -> MemoryIntIter<'_> {
|
|
||||||
MemoryIntIter { vec: self, slot: 0 }
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Write to disk and return a writable builder at `path`.
|
|
||||||
pub fn persist(&self, path: &Path) -> io::Result<PersistentCompactIntVecBuilder> {
|
|
||||||
PersistentCompactIntVecBuilder::from_memory(self, path)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── IntSlice / IntSliceMut ────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
impl IntSlice for MemoryIntVec {
|
|
||||||
fn len(&self) -> usize { self.n }
|
|
||||||
fn get(&self, slot: usize) -> u32 { self.get(slot) }
|
|
||||||
fn primary_bytes(&self) -> &[u8] { &self.primary }
|
|
||||||
fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
|
|
||||||
self.overflow.iter().map(|(&k, &v)| (k, v))
|
|
||||||
}
|
|
||||||
fn iter(&self) -> impl Iterator<Item = u32> + '_ { self.iter() }
|
|
||||||
fn sum(&self) -> u64 { self.sum() }
|
|
||||||
fn count_nonzero(&self) -> u64 { self.count_nonzero() }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl IntSliceMut for MemoryIntVec {
|
|
||||||
fn set(&mut self, slot: usize, value: u32) {
|
|
||||||
if value < 255 {
|
|
||||||
self.primary[slot] = value as u8;
|
|
||||||
self.overflow.remove(&slot);
|
|
||||||
} else {
|
|
||||||
self.primary[slot] = 255;
|
|
||||||
self.overflow.insert(slot, value);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
fn primary_bytes_mut(&mut self) -> &mut [u8] { &mut self.primary }
|
|
||||||
fn clear_overflow(&mut self) { self.overflow.clear(); }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── From conversions ──────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
impl MemoryIntVec {
|
|
||||||
/// Bulk copy from another `MemoryIntVec`: memcpy for the primary bytes,
|
|
||||||
/// clone for the overflow map.
|
|
||||||
pub fn copy_from_memory(&mut self, src: &MemoryIntVec) {
|
|
||||||
assert_eq!(self.n, src.n, "MemoryIntVec length mismatch");
|
|
||||||
self.primary.copy_from_slice(&src.primary);
|
|
||||||
self.overflow = src.overflow.clone();
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<S: IntSlice> From<&S> for MemoryIntVec {
|
|
||||||
fn from(src: &S) -> Self {
|
|
||||||
Self::from_primary_and_overflow(
|
|
||||||
src.primary_bytes().to_vec(),
|
|
||||||
src.overflow_entries().collect(),
|
|
||||||
)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── std::ops — owned (consumes lhs) ──────────────────────────────────────────
|
|
||||||
|
|
||||||
impl<B: IntSlice> Add<&B> for MemoryIntVec {
|
|
||||||
type Output = MemoryIntVec;
|
|
||||||
fn add(mut self, rhs: &B) -> MemoryIntVec { IntSliceMut::add(&mut self, rhs); self }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: IntSlice> Sub<&B> for MemoryIntVec {
|
|
||||||
type Output = MemoryIntVec;
|
|
||||||
fn sub(mut self, rhs: &B) -> MemoryIntVec { self.diff(rhs); self }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── std::ops — borrowed (clones lhs) ─────────────────────────────────────────
|
|
||||||
|
|
||||||
impl<B: IntSlice> Add<&B> for &MemoryIntVec {
|
|
||||||
type Output = MemoryIntVec;
|
|
||||||
fn add(self, rhs: &B) -> MemoryIntVec { self.clone().add(rhs) }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: IntSlice> Sub<&B> for &MemoryIntVec {
|
|
||||||
type Output = MemoryIntVec;
|
|
||||||
fn sub(self, rhs: &B) -> MemoryIntVec { self.clone().sub(rhs) }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── std::ops — in-place assign ────────────────────────────────────────────────
|
|
||||||
|
|
||||||
impl<B: IntSlice> AddAssign<&B> for MemoryIntVec {
|
|
||||||
fn add_assign(&mut self, rhs: &B) { IntSliceMut::add(self, rhs); }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: IntSlice> SubAssign<&B> for MemoryIntVec {
|
|
||||||
fn sub_assign(&mut self, rhs: &B) { self.diff(rhs); }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── Iterator ──────────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
pub struct MemoryIntIter<'a> {
|
|
||||||
vec: &'a MemoryIntVec,
|
|
||||||
slot: usize,
|
|
||||||
}
|
|
||||||
|
|
||||||
impl Iterator for MemoryIntIter<'_> {
|
|
||||||
type Item = u32;
|
|
||||||
|
|
||||||
fn next(&mut self) -> Option<u32> {
|
|
||||||
if self.slot >= self.vec.n { return None; }
|
|
||||||
let v = self.vec.get(self.slot);
|
|
||||||
self.slot += 1;
|
|
||||||
Some(v)
|
|
||||||
}
|
|
||||||
|
|
||||||
fn size_hint(&self) -> (usize, Option<usize>) {
|
|
||||||
let rem = self.vec.n - self.slot;
|
|
||||||
(rem, Some(rem))
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
impl ExactSizeIterator for MemoryIntIter<'_> {}
|
|
||||||
|
|
||||||
impl<'a> IntoIterator for &'a MemoryIntVec {
|
|
||||||
type Item = u32;
|
|
||||||
type IntoIter = MemoryIntIter<'a>;
|
|
||||||
fn into_iter(self) -> MemoryIntIter<'a> { self.iter() }
|
|
||||||
}
|
|
||||||
@@ -1,138 +0,0 @@
|
|||||||
use std::io;
|
|
||||||
use std::ops::{BitAnd, BitAndAssign, BitOr, BitOrAssign, BitXor, BitXorAssign, Not};
|
|
||||||
use std::path::Path;
|
|
||||||
|
|
||||||
use crate::bitvec::{BitIter, PersistentBitVecBuilder, n_words};
|
|
||||||
use crate::traits::{BitSlice, BitSliceMut};
|
|
||||||
|
|
||||||
// ── MemoryBitVec ──────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
#[derive(Clone)]
|
|
||||||
pub struct MemoryBitVec {
|
|
||||||
words: Vec<u64>,
|
|
||||||
n: usize,
|
|
||||||
}
|
|
||||||
|
|
||||||
impl MemoryBitVec {
|
|
||||||
pub fn new(n: usize) -> Self {
|
|
||||||
Self { words: vec![0u64; n_words(n)], n }
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn ones(n: usize) -> Self {
|
|
||||||
let rem = n % 64;
|
|
||||||
let mut words = vec![u64::MAX; n_words(n)];
|
|
||||||
if rem != 0 {
|
|
||||||
if let Some(last) = words.last_mut() { *last = (1u64 << rem) - 1; }
|
|
||||||
}
|
|
||||||
Self { words, n }
|
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) fn from_words(words: Vec<u64>, n: usize) -> Self {
|
|
||||||
Self { words, n }
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn len(&self) -> usize { self.n }
|
|
||||||
pub fn is_empty(&self) -> bool { self.n == 0 }
|
|
||||||
|
|
||||||
pub fn get(&self, slot: usize) -> bool {
|
|
||||||
(self.words[slot >> 6] >> (slot & 63)) & 1 != 0
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Write to disk and return a writable builder positioned at the same path.
|
|
||||||
pub fn persist(&self, path: &Path) -> io::Result<PersistentBitVecBuilder> {
|
|
||||||
let mut b = PersistentBitVecBuilder::new(self.n, path)?;
|
|
||||||
b.copy_from(self);
|
|
||||||
Ok(b)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── BitSlice / BitSliceMut ────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
impl BitSlice for MemoryBitVec {
|
|
||||||
fn len(&self) -> usize { self.n }
|
|
||||||
fn words(&self) -> &[u64] { &self.words }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl BitSliceMut for MemoryBitVec {
|
|
||||||
fn words_mut(&mut self) -> &mut [u64] { &mut self.words }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── From conversions ──────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
impl<S: BitSlice> From<&S> for MemoryBitVec {
|
|
||||||
fn from(src: &S) -> Self {
|
|
||||||
Self { words: src.words().to_vec(), n: src.len() }
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── std::ops — owned (consumes lhs) ──────────────────────────────────────────
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitAnd<&B> for MemoryBitVec {
|
|
||||||
type Output = MemoryBitVec;
|
|
||||||
fn bitand(mut self, rhs: &B) -> MemoryBitVec { self.and(rhs); self }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitOr<&B> for MemoryBitVec {
|
|
||||||
type Output = MemoryBitVec;
|
|
||||||
fn bitor(mut self, rhs: &B) -> MemoryBitVec { self.or(rhs); self }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitXor<&B> for MemoryBitVec {
|
|
||||||
type Output = MemoryBitVec;
|
|
||||||
fn bitxor(mut self, rhs: &B) -> MemoryBitVec { self.xor(rhs); self }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl Not for MemoryBitVec {
|
|
||||||
type Output = MemoryBitVec;
|
|
||||||
fn not(mut self) -> MemoryBitVec { BitSliceMut::not(&mut self); self }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── std::ops — borrowed (clones lhs) ─────────────────────────────────────────
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitAnd<&B> for &MemoryBitVec {
|
|
||||||
type Output = MemoryBitVec;
|
|
||||||
fn bitand(self, rhs: &B) -> MemoryBitVec { self.clone().bitand(rhs) }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitOr<&B> for &MemoryBitVec {
|
|
||||||
type Output = MemoryBitVec;
|
|
||||||
fn bitor(self, rhs: &B) -> MemoryBitVec { self.clone().bitor(rhs) }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitXor<&B> for &MemoryBitVec {
|
|
||||||
type Output = MemoryBitVec;
|
|
||||||
fn bitxor(self, rhs: &B) -> MemoryBitVec { self.clone().bitxor(rhs) }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl Not for &MemoryBitVec {
|
|
||||||
type Output = MemoryBitVec;
|
|
||||||
fn not(self) -> MemoryBitVec { !self.clone() }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── std::ops — in-place assign ────────────────────────────────────────────────
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitAndAssign<&B> for MemoryBitVec {
|
|
||||||
fn bitand_assign(&mut self, rhs: &B) { self.and(rhs); }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitOrAssign<&B> for MemoryBitVec {
|
|
||||||
fn bitor_assign(&mut self, rhs: &B) { self.or(rhs); }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<B: BitSlice> BitXorAssign<&B> for MemoryBitVec {
|
|
||||||
fn bitxor_assign(&mut self, rhs: &B) { self.xor(rhs); }
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── Iterator ──────────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
impl MemoryBitVec {
|
|
||||||
pub fn iter(&self) -> BitIter<'_> {
|
|
||||||
BitIter { words: &self.words, slot: 0, n: self.n }
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<'a> IntoIterator for &'a MemoryBitVec {
|
|
||||||
type Item = bool;
|
|
||||||
type IntoIter = BitIter<'a>;
|
|
||||||
fn into_iter(self) -> BitIter<'a> { self.iter() }
|
|
||||||
}
|
|
||||||
+55
-211
@@ -5,6 +5,7 @@ use std::path::{Path, PathBuf};
|
|||||||
use memmap2::Mmap;
|
use memmap2::Mmap;
|
||||||
|
|
||||||
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, MAGIC, OVERFLOW_ENTRY_SIZE, parse_index_entry};
|
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, MAGIC, OVERFLOW_ENTRY_SIZE, parse_index_entry};
|
||||||
|
use crate::views::IntSliceView;
|
||||||
|
|
||||||
pub struct PersistentCompactIntVec {
|
pub struct PersistentCompactIntVec {
|
||||||
mmap: Mmap,
|
mmap: Mmap,
|
||||||
@@ -18,15 +19,11 @@ pub struct PersistentCompactIntVec {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl PersistentCompactIntVec {
|
impl PersistentCompactIntVec {
|
||||||
/// Opens a persistent compact int vector from the given path.
|
|
||||||
pub fn open(path: &Path) -> io::Result<Self> {
|
pub fn open(path: &Path) -> io::Result<Self> {
|
||||||
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
|
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
|
||||||
|
|
||||||
if mmap.len() < HEADER_SIZE {
|
if mmap.len() < HEADER_SIZE {
|
||||||
return Err(io::Error::new(
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "PCIV file too short"));
|
||||||
io::ErrorKind::InvalidData,
|
|
||||||
"PCIV file too short",
|
|
||||||
));
|
|
||||||
}
|
}
|
||||||
if &mmap[0..4] != &MAGIC {
|
if &mmap[0..4] != &MAGIC {
|
||||||
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PCIV magic"));
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PCIV magic"));
|
||||||
@@ -46,34 +43,13 @@ impl PersistentCompactIntVec {
|
|||||||
index.push(parse_index_entry(&mmap, index_offset, i));
|
index.push(parse_index_entry(&mmap, index_offset, i));
|
||||||
}
|
}
|
||||||
|
|
||||||
Ok(Self {
|
Ok(Self { mmap, n, n_overflow, step, index, primary_offset, data_offset, path: path.to_path_buf() })
|
||||||
mmap,
|
|
||||||
n,
|
|
||||||
n_overflow,
|
|
||||||
step,
|
|
||||||
index,
|
|
||||||
primary_offset,
|
|
||||||
data_offset,
|
|
||||||
path: path.to_path_buf(),
|
|
||||||
})
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the path of the compact int vector file.
|
pub fn path(&self) -> &Path { &self.path }
|
||||||
pub fn path(&self) -> &Path {
|
pub fn len(&self) -> usize { self.n }
|
||||||
&self.path
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
}
|
|
||||||
|
|
||||||
/// Returns the length of the compact int vector.
|
|
||||||
pub fn len(&self) -> usize {
|
|
||||||
self.n
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Returns whether the compact int vector is empty.
|
|
||||||
pub fn is_empty(&self) -> bool {
|
|
||||||
self.n == 0
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Returns the value at the given slot.
|
|
||||||
pub fn get(&self, slot: usize) -> u32 {
|
pub fn get(&self, slot: usize) -> u32 {
|
||||||
match self.mmap[self.primary_offset + slot] {
|
match self.mmap[self.primary_offset + slot] {
|
||||||
255 => self.overflow_get(slot),
|
255 => self.overflow_get(slot),
|
||||||
@@ -81,27 +57,15 @@ impl PersistentCompactIntVec {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the value at the given slot from the overflow region.
|
|
||||||
fn overflow_get(&self, slot: usize) -> u32 {
|
fn overflow_get(&self, slot: usize) -> u32 {
|
||||||
let pos_start;
|
let (pos_start, pos_end) = if self.step == 0 {
|
||||||
let pos_end;
|
(0, self.n_overflow)
|
||||||
|
|
||||||
if self.step == 0 {
|
|
||||||
pos_start = 0;
|
|
||||||
pos_end = self.n_overflow;
|
|
||||||
} else {
|
} else {
|
||||||
let i = self
|
let i = self.index.partition_point(|&(s, _)| s <= slot).saturating_sub(1);
|
||||||
.index
|
let start = self.index[i].1;
|
||||||
.partition_point(|&(s, _)| s <= slot)
|
let end = if i + 1 < self.index.len() { self.index[i + 1].1 } else { self.n_overflow };
|
||||||
.saturating_sub(1);
|
(start, end)
|
||||||
pos_start = self.index[i].1;
|
|
||||||
pos_end = if i + 1 < self.index.len() {
|
|
||||||
self.index[i + 1].1
|
|
||||||
} else {
|
|
||||||
self.n_overflow
|
|
||||||
};
|
};
|
||||||
}
|
|
||||||
|
|
||||||
let mut lo = pos_start;
|
let mut lo = pos_start;
|
||||||
let mut hi = pos_end;
|
let mut hi = pos_end;
|
||||||
while lo < hi {
|
while lo < hi {
|
||||||
@@ -116,14 +80,12 @@ impl PersistentCompactIntVec {
|
|||||||
}
|
}
|
||||||
|
|
||||||
#[inline]
|
#[inline]
|
||||||
/// Returns the slot at the given index in the overflow region.
|
|
||||||
fn data_slot(&self, i: usize) -> usize {
|
fn data_slot(&self, i: usize) -> usize {
|
||||||
let off = self.data_offset + i * OVERFLOW_ENTRY_SIZE;
|
let off = self.data_offset + i * OVERFLOW_ENTRY_SIZE;
|
||||||
u64::from_le_bytes(self.mmap[off..off + 8].try_into().unwrap()) as usize
|
u64::from_le_bytes(self.mmap[off..off + 8].try_into().unwrap()) as usize
|
||||||
}
|
}
|
||||||
|
|
||||||
#[inline]
|
#[inline]
|
||||||
/// Returns the value at the given index in the overflow region.
|
|
||||||
fn data_value(&self, i: usize) -> u32 {
|
fn data_value(&self, i: usize) -> u32 {
|
||||||
let off = self.data_offset + i * OVERFLOW_ENTRY_SIZE + 8;
|
let off = self.data_offset + i * OVERFLOW_ENTRY_SIZE + 8;
|
||||||
u32::from_le_bytes(self.mmap[off..off + 4].try_into().unwrap())
|
u32::from_le_bytes(self.mmap[off..off + 4].try_into().unwrap())
|
||||||
@@ -139,121 +101,70 @@ impl PersistentCompactIntVec {
|
|||||||
byte_count_nonzero(primary)
|
byte_count_nonzero(primary)
|
||||||
}
|
}
|
||||||
|
|
||||||
#[inline]
|
/// Lightweight zero-copy view — primary and overflow point into the mmap.
|
||||||
/// Returns the Bray-Curtis distance between two compact int vectors.
|
pub fn view(&self) -> IntSliceView<'_> {
|
||||||
|
let primary = &self.mmap[self.primary_offset..self.primary_offset + self.n];
|
||||||
|
let overflow_raw = &self.mmap[self.data_offset..self.data_offset + self.n_overflow * OVERFLOW_ENTRY_SIZE];
|
||||||
|
IntSliceView::new(primary, overflow_raw, self.n_overflow, self.n)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn iter(&self) -> Iter<'_> {
|
||||||
|
Iter { pciv: self, slot: 0, overflow_pos: 0 }
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Distance methods ──────────────────────────────────────────────────────
|
||||||
|
|
||||||
pub fn bray_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
pub fn bray_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
||||||
let sum_min = self.partial_bray_dist(other);
|
let sum_min = self.partial_bray_dist(other);
|
||||||
let denom = self.sum() + other.sum();
|
let denom = self.sum() + other.sum();
|
||||||
if denom == 0 {
|
if denom == 0 { 0.0 } else { 1.0 - 2.0 * sum_min as f64 / denom as f64 }
|
||||||
return 0.0;
|
|
||||||
}
|
|
||||||
1.0 - 2.0 * sum_min as f64 / denom as f64
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns `Σ_slot min(self[slot], other[slot])` — the additive numerator of Bray-Curtis.
|
|
||||||
/// The denominator `sum_a + sum_b` is obtained from `self.sum() + other.sum()`.
|
|
||||||
pub fn partial_bray_dist(&self, other: &PersistentCompactIntVec) -> u64 {
|
pub fn partial_bray_dist(&self, other: &PersistentCompactIntVec) -> u64 {
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
assert_eq!(self.n, other.len(), "length mismatch");
|
||||||
self.iter()
|
self.iter().zip(other.iter()).map(|(a, b)| a.min(b) as u64).sum()
|
||||||
.zip(other.iter())
|
|
||||||
.map(|(a, b)| a.min(b) as u64)
|
|
||||||
.sum()
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the relative frequency Bray-Curtis distance between two compact int vectors.
|
|
||||||
///
|
|
||||||
/// This is a variant of [`bray_dist`] that uses relative frequencies instead of raw counts.
|
|
||||||
pub fn relfreq_bray_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
pub fn relfreq_bray_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
assert_eq!(self.n, other.len(), "length mismatch");
|
||||||
let sum_a = self.sum() as f64;
|
let sa = self.sum() as f64;
|
||||||
let sum_b = other.sum() as f64;
|
let sb = other.sum() as f64;
|
||||||
if sum_a == 0.0 && sum_b == 0.0 {
|
if sa == 0.0 && sb == 0.0 { return 0.0; }
|
||||||
return 0.0;
|
1.0 - self.partial_relfreq_bray_dist(other, sa, sb)
|
||||||
}
|
|
||||||
let sum_min = self.partial_relfreq_bray_dist(other, sum_a, sum_b);
|
|
||||||
1.0 - sum_min
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the partial relative frequency Bray-Curtis distance between two compact int vectors.
|
pub fn partial_relfreq_bray_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
|
||||||
///
|
|
||||||
/// This is used internally by [`relfreq_bray_dist`] and to easily compute the relative frequency
|
|
||||||
/// Bray-Curtis distance over a set of vector pairs.
|
|
||||||
///
|
|
||||||
/// Arguments:
|
|
||||||
/// - `other`: the other compact int vector to compare with
|
|
||||||
/// - `sum_a`: the sum of the first vector's counts
|
|
||||||
/// - `sum_b`: the sum of the second vector's counts
|
|
||||||
///
|
|
||||||
/// Returns the sum of the minimum relative frequencies at each index.
|
|
||||||
pub fn partial_relfreq_bray_dist(
|
|
||||||
&self,
|
|
||||||
other: &PersistentCompactIntVec,
|
|
||||||
sum_a: f64,
|
|
||||||
sum_b: f64,
|
|
||||||
) -> f64 {
|
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
assert_eq!(self.n, other.len(), "length mismatch");
|
||||||
let sum_min: f64 = self
|
self.iter().zip(other.iter())
|
||||||
.iter()
|
|
||||||
.zip(other.iter())
|
|
||||||
.map(|(a, b)| {
|
.map(|(a, b)| {
|
||||||
let pa = if sum_a > 0.0 { a as f64 / sum_a } else { 0.0 };
|
let pa = if sum_a > 0.0 { a as f64 / sum_a } else { 0.0 };
|
||||||
let pb = if sum_b > 0.0 { b as f64 / sum_b } else { 0.0 };
|
let pb = if sum_b > 0.0 { b as f64 / sum_b } else { 0.0 };
|
||||||
pa.min(pb)
|
pa.min(pb)
|
||||||
})
|
})
|
||||||
.sum();
|
.sum()
|
||||||
sum_min
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the euclidean distance between two compact int vectors.
|
|
||||||
pub fn euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
pub fn euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
||||||
self.partial_euclidean_dist(other).sqrt()
|
self.partial_euclidean_dist(other).sqrt()
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the partial euclidean distance between two compact int vectors.
|
|
||||||
///
|
|
||||||
/// This is used internally by [`euclidean_dist`] and to easily compute the euclidean distance
|
|
||||||
/// over a set of vector pairs.
|
|
||||||
///
|
|
||||||
/// The result is the sum of the squared differences between corresponding elements of the two
|
|
||||||
/// vectors.
|
|
||||||
pub fn partial_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
pub fn partial_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
assert_eq!(self.n, other.len(), "length mismatch");
|
||||||
self.iter()
|
self.iter().zip(other.iter())
|
||||||
.zip(other.iter())
|
.map(|(a, b)| { let d = a as f64 - b as f64; d * d })
|
||||||
.map(|(a, b)| {
|
|
||||||
let d = a as f64 - b as f64;
|
|
||||||
d * d
|
|
||||||
})
|
|
||||||
.sum()
|
.sum()
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the relative frequency euclidean distance between two compact int vectors.
|
|
||||||
///
|
|
||||||
/// This is a variant of [`euclidean_dist`] that uses relative frequencies instead of raw counts.
|
|
||||||
pub fn relfreq_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
pub fn relfreq_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
let sa = self.sum() as f64;
|
||||||
let sum_a = self.sum() as f64;
|
let sb = other.sum() as f64;
|
||||||
let sum_b = other.sum() as f64;
|
if sa == 0.0 && sb == 0.0 { return 0.0; }
|
||||||
if sum_a == 0.0 && sum_b == 0.0 {
|
self.partial_relfreq_euclidean_dist(other, sa, sb).sqrt()
|
||||||
return 0.0;
|
|
||||||
}
|
|
||||||
self.partial_relfreq_euclidean_dist(other, sum_a, sum_b)
|
|
||||||
.sqrt()
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the partial relative frequency euclidean distance between two compact int vectors.
|
pub fn partial_relfreq_euclidean_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
|
||||||
///
|
|
||||||
/// This is used internally by [`relfreq_euclidean_dist`] and to easily compute the relative frequency
|
|
||||||
/// euclidean distance over a set of vector pairs.
|
|
||||||
pub fn partial_relfreq_euclidean_dist(
|
|
||||||
&self,
|
|
||||||
other: &PersistentCompactIntVec,
|
|
||||||
sum_a: f64,
|
|
||||||
sum_b: f64,
|
|
||||||
) -> f64 {
|
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
assert_eq!(self.n, other.len(), "length mismatch");
|
||||||
self.iter()
|
self.iter().zip(other.iter())
|
||||||
.zip(other.iter())
|
|
||||||
.map(|(a, b)| {
|
.map(|(a, b)| {
|
||||||
let pa = if sum_a > 0.0 { a as f64 / sum_a } else { 0.0 };
|
let pa = if sum_a > 0.0 { a as f64 / sum_a } else { 0.0 };
|
||||||
let pb = if sum_b > 0.0 { b as f64 / sum_b } else { 0.0 };
|
let pb = if sum_b > 0.0 { b as f64 / sum_b } else { 0.0 };
|
||||||
@@ -263,46 +174,19 @@ impl PersistentCompactIntVec {
|
|||||||
.sum()
|
.sum()
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the Euclidean distance between two compact int vectors using the Hellinger transform.
|
|
||||||
///
|
|
||||||
/// The Hellinger transform is applied to the raw counts of each vector, and the result is
|
|
||||||
/// the Euclidean distance between the transformed vectors. The Hellinger transform is defined
|
|
||||||
/// as the square root of the relative frequencies.
|
|
||||||
pub fn hellinger_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
pub fn hellinger_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
let sa = self.sum() as f64;
|
||||||
let sum_a = self.sum() as f64;
|
let sb = other.sum() as f64;
|
||||||
let sum_b = other.sum() as f64;
|
if sa == 0.0 && sb == 0.0 { return 0.0; }
|
||||||
if sum_a == 0.0 && sum_b == 0.0 {
|
self.partial_hellinger_euclidean_dist(other, sa, sb).sqrt()
|
||||||
return 0.0;
|
|
||||||
}
|
|
||||||
self.partial_hellinger_euclidean_dist(other, sum_a, sum_b)
|
|
||||||
.sqrt()
|
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Returns the partial Hellinger Euclidean distance between two compact int vectors.
|
pub fn partial_hellinger_euclidean_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
|
||||||
///
|
|
||||||
/// This is used internally by [`hellinger_euclidean_dist`] and to easily compute the Hellinger
|
|
||||||
/// Euclidean distance over a set of vector pairs.
|
|
||||||
pub fn partial_hellinger_euclidean_dist(
|
|
||||||
&self,
|
|
||||||
other: &PersistentCompactIntVec,
|
|
||||||
sum_a: f64,
|
|
||||||
sum_b: f64,
|
|
||||||
) -> f64 {
|
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
assert_eq!(self.n, other.len(), "length mismatch");
|
||||||
self.iter()
|
self.iter().zip(other.iter())
|
||||||
.zip(other.iter())
|
|
||||||
.map(|(a, b)| {
|
.map(|(a, b)| {
|
||||||
let pa = if sum_a > 0.0 {
|
let pa = if sum_a > 0.0 { (a as f64 / sum_a).sqrt() } else { 0.0 };
|
||||||
(a as f64 / sum_a).sqrt()
|
let pb = if sum_b > 0.0 { (b as f64 / sum_b).sqrt() } else { 0.0 };
|
||||||
} else {
|
|
||||||
0.0
|
|
||||||
};
|
|
||||||
let pb = if sum_b > 0.0 {
|
|
||||||
(b as f64 / sum_b).sqrt()
|
|
||||||
} else {
|
|
||||||
0.0
|
|
||||||
};
|
|
||||||
let d = pa - pb;
|
let d = pa - pb;
|
||||||
d * d
|
d * d
|
||||||
})
|
})
|
||||||
@@ -314,22 +198,13 @@ impl PersistentCompactIntVec {
|
|||||||
}
|
}
|
||||||
|
|
||||||
pub fn threshold_jaccard_dist(&self, other: &PersistentCompactIntVec, threshold: u32) -> f64 {
|
pub fn threshold_jaccard_dist(&self, other: &PersistentCompactIntVec, threshold: u32) -> f64 {
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
|
||||||
let (intersection, union) = self.partial_threshold_jaccard_dist(other, threshold);
|
let (intersection, union) = self.partial_threshold_jaccard_dist(other, threshold);
|
||||||
if union == 0 {
|
if union == 0 { 0.0 } else { 1.0 - intersection as f64 / union as f64 }
|
||||||
return 0.0;
|
|
||||||
}
|
|
||||||
1.0 - intersection as f64 / union as f64
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn partial_threshold_jaccard_dist(
|
pub fn partial_threshold_jaccard_dist(&self, other: &PersistentCompactIntVec, threshold: u32) -> (u64, u64) {
|
||||||
&self,
|
|
||||||
other: &PersistentCompactIntVec,
|
|
||||||
threshold: u32,
|
|
||||||
) -> (u64, u64) {
|
|
||||||
assert_eq!(self.n, other.len(), "length mismatch");
|
assert_eq!(self.n, other.len(), "length mismatch");
|
||||||
self.iter()
|
self.iter().zip(other.iter())
|
||||||
.zip(other.iter())
|
|
||||||
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
|
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
|
||||||
let ap = a >= threshold;
|
let ap = a >= threshold;
|
||||||
let bp = b >= threshold;
|
let bp = b >= threshold;
|
||||||
@@ -340,41 +215,12 @@ impl PersistentCompactIntVec {
|
|||||||
pub fn jaccard_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
pub fn jaccard_dist(&self, other: &PersistentCompactIntVec) -> f64 {
|
||||||
self.threshold_jaccard_dist(other, 1)
|
self.threshold_jaccard_dist(other, 1)
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn iter(&self) -> Iter<'_> {
|
|
||||||
Iter {
|
|
||||||
pciv: self,
|
|
||||||
slot: 0,
|
|
||||||
overflow_pos: 0,
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── IntSlice impl ─────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
use crate::traits::IntSlice;
|
|
||||||
|
|
||||||
impl IntSlice for PersistentCompactIntVec {
|
|
||||||
fn len(&self) -> usize { self.n }
|
|
||||||
fn get(&self, slot: usize) -> u32 { self.get(slot) }
|
|
||||||
fn primary_bytes(&self) -> &[u8] {
|
|
||||||
&self.mmap[self.primary_offset..self.primary_offset + self.n]
|
|
||||||
}
|
|
||||||
fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
|
|
||||||
(0..self.n_overflow).map(|i| (self.data_slot(i), self.data_value(i)))
|
|
||||||
}
|
|
||||||
fn iter(&self) -> impl Iterator<Item = u32> + '_ { self.iter() }
|
|
||||||
fn sum(&self) -> u64 { self.sum() }
|
|
||||||
fn count_nonzero(&self) -> u64 { self.count_nonzero() }
|
|
||||||
}
|
}
|
||||||
|
|
||||||
impl<'a> IntoIterator for &'a PersistentCompactIntVec {
|
impl<'a> IntoIterator for &'a PersistentCompactIntVec {
|
||||||
type Item = u32;
|
type Item = u32;
|
||||||
type IntoIter = Iter<'a>;
|
type IntoIter = Iter<'a>;
|
||||||
|
fn into_iter(self) -> Iter<'a> { self.iter() }
|
||||||
fn into_iter(self) -> Iter<'a> {
|
|
||||||
self.iter()
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub struct Iter<'a> {
|
pub struct Iter<'a> {
|
||||||
@@ -389,9 +235,7 @@ impl Iterator for Iter<'_> {
|
|||||||
type Item = u32;
|
type Item = u32;
|
||||||
|
|
||||||
fn next(&mut self) -> Option<u32> {
|
fn next(&mut self) -> Option<u32> {
|
||||||
if self.slot >= self.pciv.n {
|
if self.slot >= self.pciv.n { return None; }
|
||||||
return None;
|
|
||||||
}
|
|
||||||
let v = self.pciv.mmap[self.pciv.primary_offset + self.slot];
|
let v = self.pciv.mmap[self.pciv.primary_offset + self.slot];
|
||||||
self.slot += 1;
|
self.slot += 1;
|
||||||
if v < 255 {
|
if v < 255 {
|
||||||
|
|||||||
@@ -4,13 +4,10 @@ use std::path::Path;
|
|||||||
use tempfile::TempDir;
|
use tempfile::TempDir;
|
||||||
|
|
||||||
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
|
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
|
||||||
use crate::traits::{BitSlice, BitSliceMut};
|
use crate::views::{BitSliceIter, BitSliceView, IntSliceView};
|
||||||
|
|
||||||
// ── TempBitVec — frozen read-only, auto-deleted on drop ──────────────────────
|
// ── TempBitVec — frozen read-only, auto-deleted on drop ──────────────────────
|
||||||
|
|
||||||
/// A bit vector backed by a temporary file.
|
|
||||||
/// Implements [`BitSlice`]; the file is deleted when this value is dropped.
|
|
||||||
/// Call [`make_persistent`](Self::make_persistent) to promote to a durable file.
|
|
||||||
pub struct TempBitVec {
|
pub struct TempBitVec {
|
||||||
vec: PersistentBitVec,
|
vec: PersistentBitVec,
|
||||||
// Dropped after `vec` (field order), so the mmap is released before the
|
// Dropped after `vec` (field order), so the mmap is released before the
|
||||||
@@ -19,51 +16,96 @@ pub struct TempBitVec {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl TempBitVec {
|
impl TempBitVec {
|
||||||
/// Copy to a permanent file and open as a [`PersistentBitVec`].
|
|
||||||
pub fn make_persistent(&self, path: &Path) -> io::Result<PersistentBitVec> {
|
pub fn make_persistent(&self, path: &Path) -> io::Result<PersistentBitVec> {
|
||||||
std::fs::copy(self.vec.path(), path)?;
|
std::fs::copy(self.vec.path(), path)?;
|
||||||
PersistentBitVec::open(path)
|
PersistentBitVec::open(path)
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn len(&self) -> usize { self.vec.len() }
|
pub fn len(&self) -> usize {
|
||||||
pub fn is_empty(&self) -> bool { self.vec.is_empty() }
|
self.vec.len()
|
||||||
}
|
}
|
||||||
|
pub fn is_empty(&self) -> bool {
|
||||||
impl BitSlice for TempBitVec {
|
self.vec.is_empty()
|
||||||
fn len(&self) -> usize { self.vec.len() }
|
}
|
||||||
fn words(&self) -> &[u64] { self.vec.words() }
|
pub fn get(&self, slot: usize) -> bool {
|
||||||
|
self.vec.get(slot)
|
||||||
|
}
|
||||||
|
pub fn count_ones(&self) -> u64 {
|
||||||
|
self.vec.count_ones()
|
||||||
|
}
|
||||||
|
pub fn view(&self) -> BitSliceView<'_> {
|
||||||
|
self.vec.view()
|
||||||
|
}
|
||||||
|
pub fn iter(&self) -> BitSliceIter<'_> {
|
||||||
|
self.view().iter()
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── TempBitVecBuilder — mutable, becomes TempBitVec on freeze ────────────────
|
// ── TempBitVecBuilder — mutable, becomes TempBitVec on freeze ────────────────
|
||||||
|
|
||||||
/// Writable builder for a [`TempBitVec`]. `pub(crate)` — callers receive
|
pub struct TempBitVecBuilder {
|
||||||
/// only the frozen result via [`freeze`](Self::freeze).
|
|
||||||
pub(crate) struct TempBitVecBuilder {
|
|
||||||
builder: PersistentBitVecBuilder,
|
builder: PersistentBitVecBuilder,
|
||||||
temp: TempDir,
|
temp: TempDir,
|
||||||
}
|
}
|
||||||
|
|
||||||
impl TempBitVecBuilder {
|
impl TempBitVecBuilder {
|
||||||
pub(crate) fn new(n: usize) -> io::Result<Self> {
|
pub fn new(n: usize) -> io::Result<Self> {
|
||||||
let temp = TempDir::new()?;
|
let temp = TempDir::new()?;
|
||||||
let path = temp.path().join("data.pbiv");
|
let path = temp.path().join("data.pbiv");
|
||||||
let builder = PersistentBitVecBuilder::new(n, &path)?;
|
let builder = PersistentBitVecBuilder::new(n, &path)?;
|
||||||
Ok(Self { builder, temp })
|
Ok(Self { builder, temp })
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Finalize writes and return a frozen, read-only [`TempBitVec`].
|
pub fn new_ones(n: usize) -> io::Result<Self> {
|
||||||
pub(crate) fn freeze(self) -> io::Result<TempBitVec> {
|
let temp = TempDir::new()?;
|
||||||
|
let path = temp.path().join("data.pbiv");
|
||||||
|
let builder = PersistentBitVecBuilder::new_ones(n, &path)?;
|
||||||
|
Ok(Self { builder, temp })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn freeze(self) -> io::Result<TempBitVec> {
|
||||||
let Self { builder, temp } = self;
|
let Self { builder, temp } = self;
|
||||||
let vec = builder.finish()?;
|
let vec = builder.finish()?;
|
||||||
Ok(TempBitVec { vec, _temp: temp })
|
Ok(TempBitVec { vec, _temp: temp })
|
||||||
}
|
}
|
||||||
}
|
|
||||||
|
|
||||||
impl BitSlice for TempBitVecBuilder {
|
pub fn set(&mut self, slot: usize, value: bool) {
|
||||||
fn len(&self) -> usize { self.builder.len() }
|
self.builder.set(slot, value);
|
||||||
fn words(&self) -> &[u64] { self.builder.words() }
|
}
|
||||||
}
|
|
||||||
|
|
||||||
impl BitSliceMut for TempBitVecBuilder {
|
pub fn view(&self) -> BitSliceView<'_> {
|
||||||
fn words_mut(&mut self) -> &mut [u64] { self.builder.words_mut() }
|
self.builder.view()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn or(&mut self, other: BitSliceView<'_>) {
|
||||||
|
self.builder.or(other);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn and(&mut self, other: BitSliceView<'_>) {
|
||||||
|
self.builder.and(other);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn xor(&mut self, other: BitSliceView<'_>) {
|
||||||
|
self.builder.xor(other);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn not(&mut self) {
|
||||||
|
self.builder.not();
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn copy_from(&mut self, src: BitSliceView<'_>) {
|
||||||
|
self.builder.copy_from(src);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
self.builder.or_where(col, pred);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn and_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
self.builder.and_where(col, pred);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn xor_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
self.builder.xor_where(col, pred);
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -5,13 +5,10 @@ use tempfile::TempDir;
|
|||||||
|
|
||||||
use crate::builder::PersistentCompactIntVecBuilder;
|
use crate::builder::PersistentCompactIntVecBuilder;
|
||||||
use crate::reader::PersistentCompactIntVec;
|
use crate::reader::PersistentCompactIntVec;
|
||||||
use crate::traits::{IntSlice, IntSliceMut};
|
use crate::views::{BitSliceView, IntSliceView};
|
||||||
|
|
||||||
// ── TempCompactIntVec — frozen read-only, auto-deleted on drop ────────────────
|
// ── TempCompactIntVec — frozen read-only, auto-deleted on drop ────────────────
|
||||||
|
|
||||||
/// A compact int vector backed by a temporary file.
|
|
||||||
/// Implements [`IntSlice`]; the file is deleted when this value is dropped.
|
|
||||||
/// Call [`make_persistent`](Self::make_persistent) to promote to a durable file.
|
|
||||||
pub struct TempCompactIntVec {
|
pub struct TempCompactIntVec {
|
||||||
vec: PersistentCompactIntVec,
|
vec: PersistentCompactIntVec,
|
||||||
// Dropped after `vec` (field order), so the mmap is released before the
|
// Dropped after `vec` (field order), so the mmap is released before the
|
||||||
@@ -20,7 +17,6 @@ pub struct TempCompactIntVec {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl TempCompactIntVec {
|
impl TempCompactIntVec {
|
||||||
/// Copy to a permanent file and open as a [`PersistentCompactIntVec`].
|
|
||||||
pub fn make_persistent(&self, path: &Path) -> io::Result<PersistentCompactIntVec> {
|
pub fn make_persistent(&self, path: &Path) -> io::Result<PersistentCompactIntVec> {
|
||||||
std::fs::copy(self.vec.path(), path)?;
|
std::fs::copy(self.vec.path(), path)?;
|
||||||
PersistentCompactIntVec::open(path)
|
PersistentCompactIntVec::open(path)
|
||||||
@@ -28,55 +24,66 @@ impl TempCompactIntVec {
|
|||||||
|
|
||||||
pub fn len(&self) -> usize { self.vec.len() }
|
pub fn len(&self) -> usize { self.vec.len() }
|
||||||
pub fn is_empty(&self) -> bool { self.vec.is_empty() }
|
pub fn is_empty(&self) -> bool { self.vec.is_empty() }
|
||||||
}
|
pub fn get(&self, slot: usize) -> u32 { self.vec.get(slot) }
|
||||||
|
pub fn sum(&self) -> u64 { self.vec.sum() }
|
||||||
impl IntSlice for TempCompactIntVec {
|
pub fn view(&self) -> IntSliceView<'_> { self.vec.view() }
|
||||||
fn len(&self) -> usize { self.vec.len() }
|
pub fn iter(&self) -> crate::reader::Iter<'_> { self.vec.iter() }
|
||||||
fn get(&self, slot: usize) -> u32 { self.vec.get(slot) }
|
|
||||||
fn primary_bytes(&self) -> &[u8] { self.vec.primary_bytes() }
|
|
||||||
fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
|
|
||||||
self.vec.overflow_entries()
|
|
||||||
}
|
|
||||||
fn sum(&self) -> u64 { self.vec.sum() }
|
|
||||||
fn count_nonzero(&self) -> u64 { self.vec.count_nonzero() }
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── TempCompactIntVecBuilder — mutable, becomes TempCompactIntVec on freeze ──
|
// ── TempCompactIntVecBuilder — mutable, becomes TempCompactIntVec on freeze ──
|
||||||
|
|
||||||
/// Writable builder for a [`TempCompactIntVec`]. `pub(crate)` — callers
|
pub struct TempCompactIntVecBuilder {
|
||||||
/// receive only the frozen result via [`freeze`](Self::freeze).
|
|
||||||
pub(crate) struct TempCompactIntVecBuilder {
|
|
||||||
builder: PersistentCompactIntVecBuilder,
|
builder: PersistentCompactIntVecBuilder,
|
||||||
temp: TempDir,
|
temp: TempDir,
|
||||||
}
|
}
|
||||||
|
|
||||||
impl TempCompactIntVecBuilder {
|
impl TempCompactIntVecBuilder {
|
||||||
pub(crate) fn new(n: usize) -> io::Result<Self> {
|
pub fn new(n: usize) -> io::Result<Self> {
|
||||||
let temp = TempDir::new()?;
|
let temp = TempDir::new()?;
|
||||||
let path = temp.path().join("data.pciv");
|
let path = temp.path().join("data.pciv");
|
||||||
let builder = PersistentCompactIntVecBuilder::new(n, &path)?;
|
let builder = PersistentCompactIntVecBuilder::new(n, &path)?;
|
||||||
Ok(Self { builder, temp })
|
Ok(Self { builder, temp })
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Finalize writes and return a frozen, read-only [`TempCompactIntVec`].
|
pub fn freeze(self) -> io::Result<TempCompactIntVec> {
|
||||||
pub(crate) fn freeze(self) -> io::Result<TempCompactIntVec> {
|
|
||||||
let Self { builder, temp } = self;
|
let Self { builder, temp } = self;
|
||||||
let vec = builder.finish()?;
|
let vec = builder.finish()?;
|
||||||
Ok(TempCompactIntVec { vec, _temp: temp })
|
Ok(TempCompactIntVec { vec, _temp: temp })
|
||||||
}
|
}
|
||||||
}
|
|
||||||
|
|
||||||
impl IntSlice for TempCompactIntVecBuilder {
|
pub fn n(&self) -> usize { self.builder.len() }
|
||||||
fn len(&self) -> usize { self.builder.len() }
|
|
||||||
fn get(&self, slot: usize) -> u32 { self.builder.get(slot) }
|
pub fn set(&mut self, slot: usize, value: u32) { self.builder.set(slot, value); }
|
||||||
fn primary_bytes(&self) -> &[u8] { self.builder.primary_bytes() }
|
pub fn get(&self, slot: usize) -> u32 { self.builder.get(slot) }
|
||||||
fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
|
|
||||||
self.builder.overflow_entries()
|
pub fn primary_bytes(&self) -> &[u8] { self.builder.primary_bytes() }
|
||||||
|
pub fn primary_bytes_mut(&mut self) -> &mut [u8] { self.builder.primary_bytes_mut() }
|
||||||
|
|
||||||
|
pub fn inc_present(&mut self, col: BitSliceView<'_>) {
|
||||||
|
self.builder.inc_present(col);
|
||||||
}
|
}
|
||||||
}
|
|
||||||
|
|
||||||
impl IntSliceMut for TempCompactIntVecBuilder {
|
pub fn inc_present_fast(&mut self, col: BitSliceView<'_>) {
|
||||||
fn set(&mut self, slot: usize, value: u32) { self.builder.set(slot, value); }
|
self.builder.inc_present_fast(col);
|
||||||
fn primary_bytes_mut(&mut self) -> &mut [u8] { self.builder.primary_bytes_mut() }
|
}
|
||||||
fn clear_overflow(&mut self) { self.builder.clear_overflow(); }
|
|
||||||
|
pub fn inc_predicate(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
self.builder.inc_predicate(col, pred);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn inc_predicate_fast(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
|
||||||
|
self.builder.inc_predicate_fast(col, pred);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn add(&mut self, other: IntSliceView<'_>) {
|
||||||
|
self.builder.add(other);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn mask_with(&mut self, mask: BitSliceView<'_>) {
|
||||||
|
self.builder.mask_with(mask);
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn min(&mut self, other: IntSliceView<'_>) { self.builder.min(other); }
|
||||||
|
pub fn max(&mut self, other: IntSliceView<'_>) { self.builder.max(other); }
|
||||||
|
pub fn diff(&mut self, other: IntSliceView<'_>) { self.builder.diff(other); }
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
use tempfile::tempdir;
|
use tempfile::tempdir;
|
||||||
|
|
||||||
use crate::{pack_bit_matrix, PersistentBitMatrix, PersistentBitMatrixBuilder};
|
use crate::{pack_bit_matrix, PersistentBitMatrix, PersistentBitMatrixBuilder};
|
||||||
use crate::traits::{BitPartials, BitSlice, BitSliceMut};
|
use crate::traits::BitPartials;
|
||||||
|
|
||||||
fn make_matrix(cols: &[&[bool]]) -> (tempfile::TempDir, PersistentBitMatrix) {
|
fn make_matrix(cols: &[&[bool]]) -> (tempfile::TempDir, PersistentBitMatrix) {
|
||||||
let n = cols.first().map_or(0, |c| c.len());
|
let n = cols.first().map_or(0, |c| c.len());
|
||||||
|
|||||||
@@ -1,6 +1,5 @@
|
|||||||
use tempfile::tempdir;
|
use tempfile::tempdir;
|
||||||
|
|
||||||
use crate::traits::{BitSlice, BitSliceMut};
|
|
||||||
use crate::{PersistentBitVec, PersistentBitVecBuilder, PersistentCompactIntVec, PersistentCompactIntVecBuilder};
|
use crate::{PersistentBitVec, PersistentBitVecBuilder, PersistentCompactIntVec, PersistentCompactIntVecBuilder};
|
||||||
|
|
||||||
fn make_bv(bits: &[bool]) -> (tempfile::TempDir, PersistentBitVec) {
|
fn make_bv(bits: &[bool]) -> (tempfile::TempDir, PersistentBitVec) {
|
||||||
@@ -78,7 +77,7 @@ fn op_and() {
|
|||||||
let dir = tempdir().unwrap();
|
let dir = tempdir().unwrap();
|
||||||
let path = dir.path().join("out.pbiv");
|
let path = dir.path().join("out.pbiv");
|
||||||
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
|
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
|
||||||
b.and(&rb);
|
b.and(rb.view());
|
||||||
b.close().unwrap();
|
b.close().unwrap();
|
||||||
let r = PersistentBitVec::open(&path).unwrap();
|
let r = PersistentBitVec::open(&path).unwrap();
|
||||||
assert_eq!(r.iter().collect::<Vec<_>>(), vec![true, false, false, false]);
|
assert_eq!(r.iter().collect::<Vec<_>>(), vec![true, false, false, false]);
|
||||||
@@ -91,7 +90,7 @@ fn op_or() {
|
|||||||
let dir = tempdir().unwrap();
|
let dir = tempdir().unwrap();
|
||||||
let path = dir.path().join("out.pbiv");
|
let path = dir.path().join("out.pbiv");
|
||||||
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
|
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
|
||||||
b.or(&rb);
|
b.or(rb.view());
|
||||||
b.close().unwrap();
|
b.close().unwrap();
|
||||||
let r = PersistentBitVec::open(&path).unwrap();
|
let r = PersistentBitVec::open(&path).unwrap();
|
||||||
assert_eq!(r.iter().collect::<Vec<_>>(), vec![true, true, true, false]);
|
assert_eq!(r.iter().collect::<Vec<_>>(), vec![true, true, true, false]);
|
||||||
@@ -104,7 +103,7 @@ fn op_xor() {
|
|||||||
let dir = tempdir().unwrap();
|
let dir = tempdir().unwrap();
|
||||||
let path = dir.path().join("out.pbiv");
|
let path = dir.path().join("out.pbiv");
|
||||||
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
|
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
|
||||||
b.xor(&rb);
|
b.xor(rb.view());
|
||||||
b.close().unwrap();
|
b.close().unwrap();
|
||||||
let r = PersistentBitVec::open(&path).unwrap();
|
let r = PersistentBitVec::open(&path).unwrap();
|
||||||
assert_eq!(r.iter().collect::<Vec<_>>(), vec![false, true, true, false]);
|
assert_eq!(r.iter().collect::<Vec<_>>(), vec![false, true, true, false]);
|
||||||
|
|||||||
@@ -5,8 +5,7 @@ use crate::{
|
|||||||
PersistentBitMatrix, PersistentBitMatrixBuilder,
|
PersistentBitMatrix, PersistentBitMatrixBuilder,
|
||||||
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
||||||
};
|
};
|
||||||
use crate::traits::{BitSlice, BitSliceMut, IntSlice, IntSliceMut};
|
use crate::{PersistentBitVecBuilder, PersistentCompactIntVec, PersistentCompactIntVecBuilder};
|
||||||
use crate::{MemoryBitVec, MemoryIntVec};
|
|
||||||
|
|
||||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -114,42 +113,51 @@ fn int_partial_group_any() {
|
|||||||
#[test]
|
#[test]
|
||||||
fn mask_with_zeros_selected_slots() {
|
fn mask_with_zeros_selected_slots() {
|
||||||
// count vec [10, 20, 30, 40], mask [T, F, T, F] → [10, 0, 30, 0]
|
// count vec [10, 20, 30, 40], mask [T, F, T, F] → [10, 0, 30, 0]
|
||||||
let mut v = MemoryIntVec::new(4);
|
let dir = tempdir().unwrap();
|
||||||
|
let mut v = PersistentCompactIntVecBuilder::new(4, &dir.path().join("v.pciv")).unwrap();
|
||||||
v.set(0, 10); v.set(1, 20); v.set(2, 30); v.set(3, 40);
|
v.set(0, 10); v.set(1, 20); v.set(2, 30); v.set(3, 40);
|
||||||
let mut mask = MemoryBitVec::new(4);
|
let mut mask = PersistentBitVecBuilder::new(4, &dir.path().join("m.pbiv")).unwrap();
|
||||||
mask.set(0, true); mask.set(2, true);
|
mask.set(0, true); mask.set(2, true);
|
||||||
v.mask_with(&mask);
|
v.mask_with(mask.view());
|
||||||
assert_eq!(v.get(0), 10);
|
v.close().unwrap();
|
||||||
assert_eq!(v.get(1), 0);
|
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
|
||||||
assert_eq!(v.get(2), 30);
|
assert_eq!(r.get(0), 10);
|
||||||
assert_eq!(v.get(3), 0);
|
assert_eq!(r.get(1), 0);
|
||||||
|
assert_eq!(r.get(2), 30);
|
||||||
|
assert_eq!(r.get(3), 0);
|
||||||
}
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn mask_with_overflow_slot_zeroed() {
|
fn mask_with_overflow_slot_zeroed() {
|
||||||
// overflow slot (value 500) masked out → removed from overflow, primary=0
|
// overflow slot (value 500) masked out → removed from overflow, primary=0
|
||||||
let mut v = MemoryIntVec::new(3);
|
let dir = tempdir().unwrap();
|
||||||
|
let mut v = PersistentCompactIntVecBuilder::new(3, &dir.path().join("v.pciv")).unwrap();
|
||||||
v.set(0, 10); v.set(1, 500); v.set(2, 5);
|
v.set(0, 10); v.set(1, 500); v.set(2, 5);
|
||||||
let mut mask = MemoryBitVec::new(3);
|
let mut mask = PersistentBitVecBuilder::new(3, &dir.path().join("m.pbiv")).unwrap();
|
||||||
mask.set(0, true); mask.set(2, true); // slot 1 masked out
|
mask.set(0, true); mask.set(2, true); // slot 1 masked out
|
||||||
v.mask_with(&mask);
|
v.mask_with(mask.view());
|
||||||
assert_eq!(v.get(0), 10);
|
v.close().unwrap();
|
||||||
assert_eq!(v.get(1), 0);
|
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
|
||||||
assert_eq!(v.get(2), 5);
|
assert_eq!(r.get(0), 10);
|
||||||
let ov: Vec<_> = v.overflow_entries().collect();
|
assert_eq!(r.get(1), 0);
|
||||||
|
assert_eq!(r.get(2), 5);
|
||||||
|
let ov: Vec<_> = r.view().overflow_entries().collect();
|
||||||
assert!(ov.is_empty(), "overflow entry for masked-out slot should be gone");
|
assert!(ov.is_empty(), "overflow entry for masked-out slot should be gone");
|
||||||
}
|
}
|
||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn mask_with_all_ones_is_noop() {
|
fn mask_with_all_ones_is_noop() {
|
||||||
let mut v = MemoryIntVec::new(4);
|
let dir = tempdir().unwrap();
|
||||||
|
let mut v = PersistentCompactIntVecBuilder::new(4, &dir.path().join("v.pciv")).unwrap();
|
||||||
v.set(0, 300); v.set(1, 1); v.set(2, 0); v.set(3, 42);
|
v.set(0, 300); v.set(1, 1); v.set(2, 0); v.set(3, 42);
|
||||||
let mask = MemoryBitVec::ones(4);
|
let mask = PersistentBitVecBuilder::new_ones(4, &dir.path().join("m.pbiv")).unwrap();
|
||||||
v.mask_with(&mask);
|
v.mask_with(mask.view());
|
||||||
assert_eq!(v.get(0), 300);
|
v.close().unwrap();
|
||||||
assert_eq!(v.get(1), 1);
|
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
|
||||||
assert_eq!(v.get(2), 0);
|
assert_eq!(r.get(0), 300);
|
||||||
assert_eq!(v.get(3), 42);
|
assert_eq!(r.get(1), 1);
|
||||||
|
assert_eq!(r.get(2), 0);
|
||||||
|
assert_eq!(r.get(3), 42);
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── BitMatrix: partial_group_presence_count ───────────────────────────────────
|
// ── BitMatrix: partial_group_presence_count ───────────────────────────────────
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
use tempfile::tempdir;
|
use tempfile::tempdir;
|
||||||
|
|
||||||
use crate::{pack_compact_int_matrix, PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder};
|
use crate::{pack_compact_int_matrix, PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder};
|
||||||
use crate::traits::{CountPartials, IntSlice};
|
use crate::traits::CountPartials;
|
||||||
|
|
||||||
fn make_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
|
fn make_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
|
||||||
let n = cols.first().map_or(0, |c| c.len());
|
let n = cols.first().map_or(0, |c| c.len());
|
||||||
@@ -290,7 +290,7 @@ fn col_view_packed_matches_columnar() {
|
|||||||
}
|
}
|
||||||
assert_eq!(col_view.sum(), col_ref.sum(), "col={c} sum");
|
assert_eq!(col_view.sum(), col_ref.sum(), "col={c} sum");
|
||||||
let mut ov_view: Vec<(usize, u32)> = col_view.overflow_entries().collect();
|
let mut ov_view: Vec<(usize, u32)> = col_view.overflow_entries().collect();
|
||||||
let mut ov_ref: Vec<(usize, u32)> = col_ref.overflow_entries().collect();
|
let mut ov_ref: Vec<(usize, u32)> = col_ref.view().overflow_entries().collect();
|
||||||
ov_view.sort_unstable_by_key(|&(s, _)| s);
|
ov_view.sort_unstable_by_key(|&(s, _)| s);
|
||||||
ov_ref.sort_unstable_by_key(|&(s, _)| s);
|
ov_ref.sort_unstable_by_key(|&(s, _)| s);
|
||||||
assert_eq!(ov_view, ov_ref, "col={c} overflow_entries");
|
assert_eq!(ov_view, ov_ref, "col={c} overflow_entries");
|
||||||
|
|||||||
@@ -1,484 +0,0 @@
|
|||||||
use tempfile::tempdir;
|
|
||||||
|
|
||||||
use crate::traits::{BitSlice, BitSliceMut, BitToInt, IntSlice, IntSliceMut, IntToBit};
|
|
||||||
use crate::{MemoryBitVec, MemoryIntVec, PersistentBitVec, PersistentBitVecBuilder};
|
|
||||||
|
|
||||||
// ── MemoryBitVec ──────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_new_all_zero() {
|
|
||||||
let v = MemoryBitVec::new(10);
|
|
||||||
assert_eq!(v.len(), 10);
|
|
||||||
assert!(!(0..10).any(|s| v.get(s)));
|
|
||||||
assert_eq!(v.count_ones(), 0);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_ones_all_set() {
|
|
||||||
let v = MemoryBitVec::ones(10);
|
|
||||||
assert!((0..10).all(|s| v.get(s)));
|
|
||||||
assert_eq!(v.count_ones(), 10);
|
|
||||||
assert_eq!(v.count_zeros(), 0);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_ones_no_padding_leak() {
|
|
||||||
// 5 bits: padding bits in last word must stay 0
|
|
||||||
let v = MemoryBitVec::ones(5);
|
|
||||||
assert_eq!(v.words()[0], 0b11111);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_set_get_roundtrip() {
|
|
||||||
let mut v = MemoryBitVec::new(64);
|
|
||||||
v.set(0, true);
|
|
||||||
v.set(63, true);
|
|
||||||
assert!(v.get(0));
|
|
||||||
assert!(!v.get(1));
|
|
||||||
assert!(v.get(63));
|
|
||||||
assert_eq!(v.count_ones(), 2);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_and() {
|
|
||||||
let mut a = MemoryBitVec::new(4);
|
|
||||||
a.set(0, true); a.set(1, true);
|
|
||||||
let mut b = MemoryBitVec::new(4);
|
|
||||||
b.set(0, true); b.set(2, true);
|
|
||||||
a.and(&b);
|
|
||||||
assert!(a.get(0)); assert!(!a.get(1)); assert!(!a.get(2));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_or() {
|
|
||||||
let mut a = MemoryBitVec::new(4);
|
|
||||||
a.set(0, true); a.set(1, true);
|
|
||||||
let mut b = MemoryBitVec::new(4);
|
|
||||||
b.set(0, true); b.set(2, true);
|
|
||||||
a.or(&b);
|
|
||||||
assert!(a.get(0)); assert!(a.get(1)); assert!(a.get(2)); assert!(!a.get(3));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_xor() {
|
|
||||||
let mut a = MemoryBitVec::new(4);
|
|
||||||
a.set(0, true); a.set(1, true);
|
|
||||||
let mut b = MemoryBitVec::new(4);
|
|
||||||
b.set(0, true); b.set(2, true);
|
|
||||||
a.xor(&b);
|
|
||||||
assert!(!a.get(0)); assert!(a.get(1)); assert!(a.get(2)); assert!(!a.get(3));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_not() {
|
|
||||||
let mut a = MemoryBitVec::new(4);
|
|
||||||
a.set(0, true); a.set(2, true);
|
|
||||||
a.not();
|
|
||||||
assert!(!a.get(0)); assert!(a.get(1)); assert!(!a.get(2)); assert!(a.get(3));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_not_no_padding_leak() {
|
|
||||||
let mut v = MemoryBitVec::new(5);
|
|
||||||
v.not();
|
|
||||||
assert_eq!(v.count_ones(), 5);
|
|
||||||
assert_eq!(v.words()[0], 0b11111);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_ops_chaining() {
|
|
||||||
let mut a = MemoryBitVec::ones(8);
|
|
||||||
let b = MemoryBitVec::new(8); // all zeros
|
|
||||||
a.and(&b).or(&b).not();
|
|
||||||
assert_eq!(a.count_ones(), 8);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_std_ops_owned() {
|
|
||||||
let mut a = MemoryBitVec::new(4);
|
|
||||||
a.set(0, true); a.set(1, true);
|
|
||||||
let mut b = MemoryBitVec::new(4);
|
|
||||||
b.set(1, true); b.set(2, true);
|
|
||||||
let c = a & &b;
|
|
||||||
assert!(!c.get(0)); assert!(c.get(1)); assert!(!c.get(2));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_std_ops_assign() {
|
|
||||||
let mut a = MemoryBitVec::new(4);
|
|
||||||
a.set(0, true); a.set(1, true);
|
|
||||||
let mut b = MemoryBitVec::new(4);
|
|
||||||
b.set(1, true); b.set(2, true);
|
|
||||||
a &= &b;
|
|
||||||
assert!(!a.get(0)); assert!(a.get(1));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_from_persistent() {
|
|
||||||
let dir = tempdir().unwrap();
|
|
||||||
let path = dir.path().join("v.pbiv");
|
|
||||||
let mut builder = PersistentBitVecBuilder::new(4, &path).unwrap();
|
|
||||||
builder.set(1, true); builder.set(3, true);
|
|
||||||
builder.close().unwrap();
|
|
||||||
let pv = PersistentBitVec::open(&path).unwrap();
|
|
||||||
let mv = MemoryBitVec::from(&pv);
|
|
||||||
assert!(!mv.get(0)); assert!(mv.get(1)); assert!(!mv.get(2)); assert!(mv.get(3));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn mbv_persist_roundtrip() {
|
|
||||||
let dir = tempdir().unwrap();
|
|
||||||
let path = dir.path().join("out.pbiv");
|
|
||||||
let mut v = MemoryBitVec::new(8);
|
|
||||||
v.set(2, true); v.set(5, true);
|
|
||||||
let builder = v.persist(&path).unwrap();
|
|
||||||
builder.close().unwrap();
|
|
||||||
let pv = PersistentBitVec::open(&path).unwrap();
|
|
||||||
assert!(pv.get(2)); assert!(pv.get(5));
|
|
||||||
assert_eq!(pv.count_ones(), 2);
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── MemoryIntVec ──────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_new_all_zero() {
|
|
||||||
let v = MemoryIntVec::new(10);
|
|
||||||
assert_eq!(v.len(), 10);
|
|
||||||
assert!((0..10).all(|s| v.get(s) == 0));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_set_get_roundtrip() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.set(0, 42); v.set(3, 200);
|
|
||||||
assert_eq!(v.get(0), 42);
|
|
||||||
assert_eq!(v.get(1), 0);
|
|
||||||
assert_eq!(v.get(3), 200);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_overflow_roundtrip() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.set(1, 1000);
|
|
||||||
assert_eq!(v.get(1), 1000);
|
|
||||||
assert_eq!(v.get(0), 0);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_inc_dec() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.inc(2); v.inc(2); v.inc(2);
|
|
||||||
assert_eq!(v.get(2), 3);
|
|
||||||
v.dec(2);
|
|
||||||
assert_eq!(v.get(2), 2);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_dec_saturates_at_zero() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.dec(0);
|
|
||||||
assert_eq!(v.get(0), 0);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_add_at() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.add_at(1, 100); v.add_at(1, 200);
|
|
||||||
assert_eq!(v.get(1), 300);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_min_max() {
|
|
||||||
let mut a = MemoryIntVec::new(4);
|
|
||||||
a.set(0, 5); a.set(1, 2); a.set(2, 8);
|
|
||||||
let mut b = MemoryIntVec::new(4);
|
|
||||||
b.set(0, 3); b.set(1, 7); b.set(2, 8);
|
|
||||||
let mut c = MemoryIntVec::from(&a);
|
|
||||||
IntSliceMut::min(&mut c, &b);
|
|
||||||
assert_eq!(c.get(0), 3); assert_eq!(c.get(1), 2); assert_eq!(c.get(2), 8);
|
|
||||||
let mut d = MemoryIntVec::from(&a);
|
|
||||||
IntSliceMut::max(&mut d, &b);
|
|
||||||
assert_eq!(d.get(0), 5); assert_eq!(d.get(1), 7); assert_eq!(d.get(2), 8);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_add_diff() {
|
|
||||||
let mut a = MemoryIntVec::new(3);
|
|
||||||
a.set(0, 10); a.set(1, 5);
|
|
||||||
let mut b = MemoryIntVec::new(3);
|
|
||||||
b.set(0, 3); b.set(1, 8);
|
|
||||||
let mut c = MemoryIntVec::from(&a);
|
|
||||||
c.add(&b);
|
|
||||||
assert_eq!(c.get(0), 13); assert_eq!(c.get(1), 13);
|
|
||||||
let mut d = MemoryIntVec::from(&a);
|
|
||||||
d.diff(&b);
|
|
||||||
assert_eq!(d.get(0), 7); assert_eq!(d.get(1), 0); // saturating sub
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_std_ops() {
|
|
||||||
let mut a = MemoryIntVec::new(3);
|
|
||||||
a.set(0, 10); a.set(1, 5);
|
|
||||||
let mut b = MemoryIntVec::new(3);
|
|
||||||
b.set(0, 3); b.set(1, 8);
|
|
||||||
let c = &a + &b;
|
|
||||||
assert_eq!(c.get(0), 13); assert_eq!(c.get(1), 13);
|
|
||||||
let d = &a - &b;
|
|
||||||
assert_eq!(d.get(0), 7); assert_eq!(d.get(1), 0);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_from_persistent() {
|
|
||||||
use crate::{PersistentCompactIntVec, PersistentCompactIntVecBuilder};
|
|
||||||
let dir = tempdir().unwrap();
|
|
||||||
let path = dir.path().join("v.pciv");
|
|
||||||
let mut b = PersistentCompactIntVecBuilder::new(4, &path).unwrap();
|
|
||||||
b.set(1, 42); b.set(3, 1000);
|
|
||||||
b.close().unwrap();
|
|
||||||
let pv = PersistentCompactIntVec::open(&path).unwrap();
|
|
||||||
let mv = MemoryIntVec::from(&pv);
|
|
||||||
assert_eq!(mv.get(0), 0); assert_eq!(mv.get(1), 42); assert_eq!(mv.get(3), 1000);
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── Cross-type conversions ────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn to_bitvec_threshold() {
|
|
||||||
let mut v = MemoryIntVec::new(5);
|
|
||||||
v.set(0, 0); v.set(1, 1); v.set(2, 5); v.set(3, 10); v.set(4, 3);
|
|
||||||
let bv = v.to_bitvec(4); // > 4: slots 2 (5) and 3 (10) pass
|
|
||||||
assert!(!bv.get(0)); assert!(!bv.get(1)); assert!(bv.get(2));
|
|
||||||
assert!(bv.get(3)); assert!(!bv.get(4));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn to_presence() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.set(1, 1); v.set(3, 100);
|
|
||||||
let bv = v.to_presence();
|
|
||||||
assert!(!bv.get(0)); assert!(bv.get(1)); assert!(!bv.get(2)); assert!(bv.get(3));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn to_intvec_roundtrip() {
|
|
||||||
let mut bv = MemoryBitVec::new(8);
|
|
||||||
bv.set(0, true); bv.set(3, true); bv.set(7, true);
|
|
||||||
let iv = bv.to_intvec();
|
|
||||||
assert_eq!(iv.get(0), 1); assert_eq!(iv.get(1), 0);
|
|
||||||
assert_eq!(iv.get(3), 1); assert_eq!(iv.get(7), 1);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn to_intvec_word_boundary() {
|
|
||||||
// 65 bits: spans two words
|
|
||||||
let mut bv = MemoryBitVec::new(65);
|
|
||||||
bv.set(63, true); bv.set(64, true);
|
|
||||||
let iv = bv.to_intvec();
|
|
||||||
assert_eq!(iv.get(63), 1); assert_eq!(iv.get(64), 1); assert_eq!(iv.get(62), 0);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn count_bits_accumulates() {
|
|
||||||
let mut count = MemoryIntVec::new(8);
|
|
||||||
let mut b1 = MemoryBitVec::new(8);
|
|
||||||
b1.set(0, true); b1.set(2, true);
|
|
||||||
let mut b2 = MemoryBitVec::new(8);
|
|
||||||
b2.set(0, true); b2.set(3, true);
|
|
||||||
let mut b3 = MemoryBitVec::new(8);
|
|
||||||
b3.set(2, true); b3.set(3, true);
|
|
||||||
count.count_bits(&b1).count_bits(&b2).count_bits(&b3);
|
|
||||||
assert_eq!(count.get(0), 2);
|
|
||||||
assert_eq!(count.get(2), 2);
|
|
||||||
assert_eq!(count.get(3), 2);
|
|
||||||
assert_eq!(count.get(1), 0);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn count_bits_skips_zero_words() {
|
|
||||||
// Entire first word is zero — should not touch those slots
|
|
||||||
let mut count = MemoryIntVec::new(128);
|
|
||||||
let mut bv = MemoryBitVec::new(128);
|
|
||||||
bv.set(64, true); bv.set(127, true);
|
|
||||||
count.count_bits(&bv);
|
|
||||||
assert_eq!(count.get(0), 0);
|
|
||||||
assert_eq!(count.get(64), 1);
|
|
||||||
assert_eq!(count.get(127), 1);
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── min / max / add / diff — overflow edge cases ──────────────────────────────
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_min_overflow_edges() {
|
|
||||||
// [300, 50, 400, 300] min [50, 300, 500, 200]
|
|
||||||
// slot 0: self=overflow(300), other=primary(50) → 50 (overflow removed)
|
|
||||||
// slot 1: self=primary(50), other=overflow(300) → 50 (no overflow created)
|
|
||||||
// slot 2: self=overflow(400), other=overflow(500) → 400 (overflow updated)
|
|
||||||
// slot 3: self=overflow(300), other=primary(200) → 200 (overflow removed, 200 < 255)
|
|
||||||
let mut a = MemoryIntVec::new(4);
|
|
||||||
a.set(0, 300); a.set(1, 50); a.set(2, 400); a.set(3, 300);
|
|
||||||
let mut b = MemoryIntVec::new(4);
|
|
||||||
b.set(0, 50); b.set(1, 300); b.set(2, 500); b.set(3, 200);
|
|
||||||
IntSliceMut::min(&mut a, &b);
|
|
||||||
assert_eq!(a.get(0), 50);
|
|
||||||
assert_eq!(a.get(1), 50);
|
|
||||||
assert_eq!(a.get(2), 400);
|
|
||||||
assert_eq!(a.get(3), 200);
|
|
||||||
// Only slot 2 should still have an overflow entry.
|
|
||||||
let ov: std::collections::HashMap<usize, u32> = a.overflow_entries().collect();
|
|
||||||
assert_eq!(ov.len(), 1);
|
|
||||||
assert_eq!(ov[&2], 400);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_max_overflow_edges() {
|
|
||||||
// [50, 300, 100, 400] max [300, 50, 500, 200]
|
|
||||||
// slot 0: self=primary(50), other=overflow(300) → 300 (overflow created)
|
|
||||||
// slot 1: self=overflow(300), other=primary(50) → 300 (overflow unchanged)
|
|
||||||
// slot 2: self=primary(100), other=overflow(500) → 500 (overflow created)
|
|
||||||
// slot 3: self=overflow(400), other=overflow(200) → 400 (overflow unchanged, 200 < 255 wait...)
|
|
||||||
// Wait — 200 < 255 so other slot 3 is NOT overflow. Correct: max(400, 200) = 400.
|
|
||||||
let mut a = MemoryIntVec::new(4);
|
|
||||||
a.set(0, 50); a.set(1, 300); a.set(2, 100); a.set(3, 400);
|
|
||||||
let mut b = MemoryIntVec::new(4);
|
|
||||||
b.set(0, 300); b.set(1, 50); b.set(2, 500); b.set(3, 200);
|
|
||||||
IntSliceMut::max(&mut a, &b);
|
|
||||||
assert_eq!(a.get(0), 300);
|
|
||||||
assert_eq!(a.get(1), 300);
|
|
||||||
assert_eq!(a.get(2), 500);
|
|
||||||
assert_eq!(a.get(3), 400);
|
|
||||||
let ov: std::collections::HashMap<usize, u32> = a.overflow_entries().collect();
|
|
||||||
assert_eq!(ov.len(), 4); // all four results >= 255
|
|
||||||
assert_eq!(ov[&0], 300);
|
|
||||||
assert_eq!(ov[&1], 300);
|
|
||||||
assert_eq!(ov[&2], 500);
|
|
||||||
assert_eq!(ov[&3], 400);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_add_overflow_edges() {
|
|
||||||
// [300, 50, 400, 200] + [50, 300, 200, 200]
|
|
||||||
// slot 0: self=overflow(300), other=primary(50) → 350 (overflow updated)
|
|
||||||
// slot 1: self=primary(50), other=overflow(300) → 350 (overflow created from primary)
|
|
||||||
// slot 2: self=overflow(400), other=overflow(200... wait 200 < 255)
|
|
||||||
// other slot 2 is primary(200); 400+200=600 (overflow updated)
|
|
||||||
// slot 3: self=primary(200), other=primary(200) → 400 (overflow created, 400 >= 255)
|
|
||||||
let mut a = MemoryIntVec::new(4);
|
|
||||||
a.set(0, 300); a.set(1, 50); a.set(2, 400); a.set(3, 200);
|
|
||||||
let mut b = MemoryIntVec::new(4);
|
|
||||||
b.set(0, 50); b.set(1, 300); b.set(2, 200); b.set(3, 200);
|
|
||||||
a.add(&b);
|
|
||||||
assert_eq!(a.get(0), 350);
|
|
||||||
assert_eq!(a.get(1), 350);
|
|
||||||
assert_eq!(a.get(2), 600);
|
|
||||||
assert_eq!(a.get(3), 400);
|
|
||||||
let ov: std::collections::HashMap<usize, u32> = a.overflow_entries().collect();
|
|
||||||
assert_eq!(ov.len(), 4);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_add_both_overflow() {
|
|
||||||
// [300] + [400] = [700]
|
|
||||||
let mut a = MemoryIntVec::new(1);
|
|
||||||
a.set(0, 300);
|
|
||||||
let mut b = MemoryIntVec::new(1);
|
|
||||||
b.set(0, 400);
|
|
||||||
a.add(&b);
|
|
||||||
assert_eq!(a.get(0), 700);
|
|
||||||
let ov: std::collections::HashMap<usize, u32> = a.overflow_entries().collect();
|
|
||||||
assert_eq!(ov[&0], 700);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn miv_diff_overflow_edges() {
|
|
||||||
// [300, 400, 400, 50] - [100, 50, 350, 300]
|
|
||||||
// slot 0: self=overflow(300), other=primary(100) → 200 (overflow removed, 200 < 255)
|
|
||||||
// slot 1: self=overflow(400), other=primary(50) → 350 (overflow updated, 350 >= 255)
|
|
||||||
// slot 2: self=overflow(400), other=overflow(350) → 50 (overflow removed, 50 < 255)
|
|
||||||
// slot 3: self=primary(50), other=overflow(300) → 0 (saturating, stays primary)
|
|
||||||
let mut a = MemoryIntVec::new(4);
|
|
||||||
a.set(0, 300); a.set(1, 400); a.set(2, 400); a.set(3, 50);
|
|
||||||
let mut b = MemoryIntVec::new(4);
|
|
||||||
b.set(0, 100); b.set(1, 50); b.set(2, 350); b.set(3, 300);
|
|
||||||
a.diff(&b);
|
|
||||||
assert_eq!(a.get(0), 200);
|
|
||||||
assert_eq!(a.get(1), 350);
|
|
||||||
assert_eq!(a.get(2), 50);
|
|
||||||
assert_eq!(a.get(3), 0);
|
|
||||||
let ov: std::collections::HashMap<usize, u32> = a.overflow_entries().collect();
|
|
||||||
assert_eq!(ov.len(), 1); // only slot 1 remains overflow
|
|
||||||
assert_eq!(ov[&1], 350);
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── Comparison operators ──────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn cmp_gt() {
|
|
||||||
let mut v = MemoryIntVec::new(5);
|
|
||||||
v.set(0, 0); v.set(1, 3); v.set(2, 5); v.set(3, 3); v.set(4, 10);
|
|
||||||
let bv = v.gt(3);
|
|
||||||
assert!(!bv.get(0)); assert!(!bv.get(1)); assert!(bv.get(2));
|
|
||||||
assert!(!bv.get(3)); assert!(bv.get(4));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn cmp_geq() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.set(0, 2); v.set(1, 3); v.set(2, 4); v.set(3, 1);
|
|
||||||
let bv = v.geq(3);
|
|
||||||
assert!(!bv.get(0)); assert!(bv.get(1)); assert!(bv.get(2)); assert!(!bv.get(3));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn cmp_lt() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.set(0, 2); v.set(1, 3); v.set(2, 4); v.set(3, 0);
|
|
||||||
let bv = v.lt(3);
|
|
||||||
assert!(bv.get(0)); assert!(!bv.get(1)); assert!(!bv.get(2)); assert!(bv.get(3));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn cmp_leq() {
|
|
||||||
let mut v = MemoryIntVec::new(4);
|
|
||||||
v.set(0, 2); v.set(1, 3); v.set(2, 4); v.set(3, 3);
|
|
||||||
let bv = v.leq(3);
|
|
||||||
assert!(bv.get(0)); assert!(bv.get(1)); assert!(!bv.get(2)); assert!(bv.get(3));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn cmp_scalar_with_overflow() {
|
|
||||||
// Slots: [10, 1000, 50, 500, 0]
|
|
||||||
// geq(100): slots 1 (1000) and 3 (500) → both overflow, must qualify
|
|
||||||
// lt(500): slots 0 (10), 2 (50), 4 (0) → primary; slot 1 (1000) → no; slot 3 (500) → no
|
|
||||||
// geq(2000): only slot 1 (1000) fails, no slot qualifies
|
|
||||||
let mut v = MemoryIntVec::new(5);
|
|
||||||
v.set(0, 10); v.set(1, 1000); v.set(2, 50); v.set(3, 500); v.set(4, 0);
|
|
||||||
|
|
||||||
let bv = v.geq(100);
|
|
||||||
assert!(!bv.get(0)); assert!(bv.get(1)); assert!(!bv.get(2));
|
|
||||||
assert!(bv.get(3)); assert!(!bv.get(4));
|
|
||||||
|
|
||||||
let bv = v.lt(500);
|
|
||||||
assert!(bv.get(0)); assert!(!bv.get(1)); assert!(bv.get(2));
|
|
||||||
assert!(!bv.get(3)); assert!(bv.get(4));
|
|
||||||
|
|
||||||
let bv = v.geq(2000);
|
|
||||||
assert!(!(0..5).any(|s| bv.get(s)));
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn filter_pattern() {
|
|
||||||
// Typical filter: ingroup >= min_count AND outgroup <= max_outgroup
|
|
||||||
let mut ingroup = MemoryIntVec::new(6);
|
|
||||||
let mut outgroup = MemoryIntVec::new(6);
|
|
||||||
// slot 2: ingroup=3, outgroup=0 → keep
|
|
||||||
// slot 4: ingroup=2, outgroup=1 → drop (outgroup > 0)
|
|
||||||
// slot 5: ingroup=1, outgroup=0 → drop (ingroup < 2)
|
|
||||||
ingroup.set(2, 3); ingroup.set(4, 2); ingroup.set(5, 1);
|
|
||||||
outgroup.set(4, 1);
|
|
||||||
let out_mask = outgroup.leq(0);
|
|
||||||
let mut in_mask = ingroup.geq(2);
|
|
||||||
let keep = in_mask.and(&out_mask);
|
|
||||||
assert!(!keep.get(0)); assert!(!keep.get(1));
|
|
||||||
assert!(keep.get(2));
|
|
||||||
assert!(!keep.get(4)); assert!(!keep.get(5));
|
|
||||||
}
|
|
||||||
@@ -2,12 +2,9 @@ mod bitmatrix;
|
|||||||
mod bitvec;
|
mod bitvec;
|
||||||
mod colgroup;
|
mod colgroup;
|
||||||
mod intmatrix;
|
mod intmatrix;
|
||||||
mod memoryvec;
|
|
||||||
|
|
||||||
use tempfile::tempdir;
|
use tempfile::tempdir;
|
||||||
|
|
||||||
use crate::traits::IntSliceMut;
|
|
||||||
|
|
||||||
use crate::{PersistentCompactIntVec, PersistentCompactIntVecBuilder};
|
use crate::{PersistentCompactIntVec, PersistentCompactIntVecBuilder};
|
||||||
|
|
||||||
fn roundtrip(values: &[(usize, u32)], n: usize) -> Vec<u32> {
|
fn roundtrip(values: &[(usize, u32)], n: usize) -> Vec<u32> {
|
||||||
@@ -173,7 +170,7 @@ fn combine_min() {
|
|||||||
let dir = tempdir().unwrap();
|
let dir = tempdir().unwrap();
|
||||||
let path = dir.path().join("out.pciv");
|
let path = dir.path().join("out.pciv");
|
||||||
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
|
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
|
||||||
b.min(&rb);
|
b.min(rb.view());
|
||||||
b.close().unwrap();
|
b.close().unwrap();
|
||||||
let r = PersistentCompactIntVec::open(&path).unwrap();
|
let r = PersistentCompactIntVec::open(&path).unwrap();
|
||||||
assert_eq!(r.iter().collect::<Vec<_>>(), vec![10, 100, 0, 800]);
|
assert_eq!(r.iter().collect::<Vec<_>>(), vec![10, 100, 0, 800]);
|
||||||
@@ -186,7 +183,7 @@ fn combine_max() {
|
|||||||
let dir = tempdir().unwrap();
|
let dir = tempdir().unwrap();
|
||||||
let path = dir.path().join("out.pciv");
|
let path = dir.path().join("out.pciv");
|
||||||
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
|
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
|
||||||
b.max(&rb);
|
b.max(rb.view());
|
||||||
b.close().unwrap();
|
b.close().unwrap();
|
||||||
let r = PersistentCompactIntVec::open(&path).unwrap();
|
let r = PersistentCompactIntVec::open(&path).unwrap();
|
||||||
assert_eq!(r.iter().collect::<Vec<_>>(), vec![20, 300, 500, 1000]);
|
assert_eq!(r.iter().collect::<Vec<_>>(), vec![20, 300, 500, 1000]);
|
||||||
@@ -199,7 +196,7 @@ fn combine_add() {
|
|||||||
let dir = tempdir().unwrap();
|
let dir = tempdir().unwrap();
|
||||||
let path = dir.path().join("out.pciv");
|
let path = dir.path().join("out.pciv");
|
||||||
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
|
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
|
||||||
b.add(&rb);
|
b.add(rb.view());
|
||||||
b.close().unwrap();
|
b.close().unwrap();
|
||||||
let r = PersistentCompactIntVec::open(&path).unwrap();
|
let r = PersistentCompactIntVec::open(&path).unwrap();
|
||||||
assert_eq!(r.iter().collect::<Vec<_>>(), vec![30, 300, 5, 101]);
|
assert_eq!(r.iter().collect::<Vec<_>>(), vec![30, 300, 5, 101]);
|
||||||
@@ -224,7 +221,7 @@ fn combine_diff() {
|
|||||||
let dir = tempdir().unwrap();
|
let dir = tempdir().unwrap();
|
||||||
let path = dir.path().join("out.pciv");
|
let path = dir.path().join("out.pciv");
|
||||||
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
|
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
|
||||||
b.diff(&rb);
|
b.diff(rb.view());
|
||||||
b.close().unwrap();
|
b.close().unwrap();
|
||||||
let r = PersistentCompactIntVec::open(&path).unwrap();
|
let r = PersistentCompactIntVec::open(&path).unwrap();
|
||||||
assert_eq!(r.iter().collect::<Vec<_>>(), vec![10, 700, 0, 0]);
|
assert_eq!(r.iter().collect::<Vec<_>>(), vec![10, 700, 0, 0]);
|
||||||
|
|||||||
@@ -1,353 +1,5 @@
|
|||||||
use std::collections::HashMap;
|
|
||||||
|
|
||||||
use ndarray::{Array1, Array2};
|
use ndarray::{Array1, Array2};
|
||||||
|
|
||||||
// ── BitSlice / BitSliceMut ────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
/// Read-only view over the u64 word array of a bit vector.
|
|
||||||
///
|
|
||||||
/// Bit `i` is in `words()[i >> 6]` at position `i & 63`.
|
|
||||||
/// Padding bits in the last word are zero.
|
|
||||||
pub trait BitSlice {
|
|
||||||
fn len(&self) -> usize;
|
|
||||||
fn words(&self) -> &[u64];
|
|
||||||
fn is_empty(&self) -> bool { self.len() == 0 }
|
|
||||||
fn get(&self, slot: usize) -> bool {
|
|
||||||
(self.words()[slot >> 6] >> (slot & 63)) & 1 != 0
|
|
||||||
}
|
|
||||||
fn count_ones(&self) -> u64 {
|
|
||||||
self.words().iter().map(|w| w.count_ones() as u64).sum()
|
|
||||||
}
|
|
||||||
fn count_zeros(&self) -> u64 { self.len() as u64 - self.count_ones() }
|
|
||||||
fn partial_jaccard_dist<S: BitSlice>(&self, other: &S) -> (u64, u64) {
|
|
||||||
assert_eq!(self.len(), other.len(), "length mismatch");
|
|
||||||
self.words().iter().zip(other.words())
|
|
||||||
.fold((0u64, 0u64), |(i, u), (&a, &b)| {
|
|
||||||
(i + (a & b).count_ones() as u64, u + (a | b).count_ones() as u64)
|
|
||||||
})
|
|
||||||
}
|
|
||||||
fn jaccard_dist<S: BitSlice>(&self, other: &S) -> f64 {
|
|
||||||
let (inter, union) = self.partial_jaccard_dist(other);
|
|
||||||
if union == 0 { 0.0 } else { 1.0 - inter as f64 / union as f64 }
|
|
||||||
}
|
|
||||||
fn hamming_dist<S: BitSlice>(&self, other: &S) -> u64 {
|
|
||||||
assert_eq!(self.len(), other.len(), "length mismatch");
|
|
||||||
self.words().iter().zip(other.words())
|
|
||||||
.map(|(&a, &b)| (a ^ b).count_ones() as u64)
|
|
||||||
.sum()
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Mutable view over a bit-vector word array; default methods maintain the
|
|
||||||
/// zero-padding invariant on the last word.
|
|
||||||
pub trait BitSliceMut: BitSlice {
|
|
||||||
fn words_mut(&mut self) -> &mut [u64];
|
|
||||||
|
|
||||||
fn set(&mut self, slot: usize, value: bool) {
|
|
||||||
let bit = 1u64 << (slot & 63);
|
|
||||||
if value { self.words_mut()[slot >> 6] |= bit; } else { self.words_mut()[slot >> 6] &= !bit; }
|
|
||||||
}
|
|
||||||
|
|
||||||
fn copy_from<S: BitSlice>(&mut self, src: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), src.len(), "BitSlice length mismatch");
|
|
||||||
self.words_mut().copy_from_slice(src.words());
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn and<S: BitSlice>(&mut self, other: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), other.len(), "BitSlice length mismatch");
|
|
||||||
for (w, &o) in self.words_mut().iter_mut().zip(other.words()) { *w &= o; }
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn or<S: BitSlice>(&mut self, other: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), other.len(), "BitSlice length mismatch");
|
|
||||||
for (w, &o) in self.words_mut().iter_mut().zip(other.words()) { *w |= o; }
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn xor<S: BitSlice>(&mut self, other: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), other.len(), "BitSlice length mismatch");
|
|
||||||
for (w, &o) in self.words_mut().iter_mut().zip(other.words()) { *w ^= o; }
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn not(&mut self) -> &mut Self {
|
|
||||||
let rem = self.len() % 64;
|
|
||||||
let words = self.words_mut();
|
|
||||||
for w in words.iter_mut() { *w ^= u64::MAX; }
|
|
||||||
if rem != 0 {
|
|
||||||
if let Some(last) = words.last_mut() { *last &= (1u64 << rem) - 1; }
|
|
||||||
}
|
|
||||||
self
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── IntSlice / IntSliceMut ────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
/// Read-only access to a compact integer vector (values encoded as u32).
|
|
||||||
pub trait IntSlice {
|
|
||||||
fn len(&self) -> usize;
|
|
||||||
fn get(&self, slot: usize) -> u32;
|
|
||||||
/// Raw primary byte slice (sentinel 255 marks overflow slots).
|
|
||||||
fn primary_bytes(&self) -> &[u8];
|
|
||||||
/// Iterator over `(slot, true_value)` pairs for all overflow entries (value >= 255).
|
|
||||||
fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_;
|
|
||||||
fn is_empty(&self) -> bool { self.len() == 0 }
|
|
||||||
fn iter(&self) -> impl Iterator<Item = u32> + '_ { (0..self.len()).map(|i| self.get(i)) }
|
|
||||||
fn sum(&self) -> u64 { self.iter().map(|v| v as u64).sum() }
|
|
||||||
fn count_nonzero(&self) -> u64 { self.iter().filter(|v| *v > 0).count() as u64 }
|
|
||||||
|
|
||||||
fn lt(&self, threshold: u32) -> MemoryBitVec { self.cmp_scalar(|v| v < threshold) }
|
|
||||||
fn leq(&self, threshold: u32) -> MemoryBitVec { self.cmp_scalar(|v| v <= threshold) }
|
|
||||||
fn gt(&self, threshold: u32) -> MemoryBitVec { self.cmp_scalar(|v| v > threshold) }
|
|
||||||
fn geq(&self, threshold: u32) -> MemoryBitVec { self.cmp_scalar(|v| v >= threshold) }
|
|
||||||
|
|
||||||
fn cmp_scalar(&self, pred: impl Fn(u32) -> bool) -> MemoryBitVec {
|
|
||||||
let n = self.len();
|
|
||||||
let mut words = vec![0u64; n.div_ceil(64)];
|
|
||||||
let primary = self.primary_bytes();
|
|
||||||
// Pass 1: byte scan — no HashMap access, vectorisable for simple predicates.
|
|
||||||
// Overflow slots (b == 255) are left as 0 and fixed in pass 2.
|
|
||||||
for s in 0..n {
|
|
||||||
let b = primary[s];
|
|
||||||
if b < 255 && pred(b as u32) {
|
|
||||||
words[s >> 6] |= 1u64 << (s & 63);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
// Pass 2: fix up overflow slots — O(k), negligible.
|
|
||||||
for (s, val) in self.overflow_entries() {
|
|
||||||
if pred(val) { words[s >> 6] |= 1u64 << (s & 63); }
|
|
||||||
}
|
|
||||||
MemoryBitVec::from_words(words, n)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Mutable access; default methods use only `get` / `set` and maintain the
|
|
||||||
/// compact encoding invariants on the implementor's side.
|
|
||||||
pub trait IntSliceMut: IntSlice {
|
|
||||||
fn set(&mut self, slot: usize, value: u32);
|
|
||||||
fn primary_bytes_mut(&mut self) -> &mut [u8];
|
|
||||||
fn clear_overflow(&mut self);
|
|
||||||
|
|
||||||
fn inc(&mut self, slot: usize) -> &mut Self {
|
|
||||||
let v = self.get(slot);
|
|
||||||
self.set(slot, v.saturating_add(1));
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn dec(&mut self, slot: usize) -> &mut Self {
|
|
||||||
let v = self.get(slot);
|
|
||||||
self.set(slot, v.saturating_sub(1));
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn add_at(&mut self, slot: usize, delta: u32) -> &mut Self {
|
|
||||||
let v = self.get(slot);
|
|
||||||
self.set(slot, v.saturating_add(delta));
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn copy_from<S: IntSlice>(&mut self, src: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), src.len(), "IntSlice length mismatch");
|
|
||||||
self.primary_bytes_mut().copy_from_slice(src.primary_bytes());
|
|
||||||
self.clear_overflow();
|
|
||||||
for (slot, val) in src.overflow_entries() { self.set(slot, val); }
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn min<S: IntSlice>(&mut self, other: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), other.len(), "IntSlice length mismatch");
|
|
||||||
// Snapshot both overflow sets (O(k), tiny) before mutating self.
|
|
||||||
// 255 = +∞ on u8, so byte-level min is correct in all cases except
|
|
||||||
// both-overflow: only those slots need a fixup pass.
|
|
||||||
let self_ov: Vec<(usize, u32)> = self.overflow_entries().collect();
|
|
||||||
let other_ov: HashMap<usize, u32> = other.overflow_entries().collect();
|
|
||||||
self.clear_overflow();
|
|
||||||
// Pass 1 — SIMD-vectorizable byte min over the full primary array.
|
|
||||||
for (a, &b) in self.primary_bytes_mut().iter_mut().zip(other.primary_bytes()) {
|
|
||||||
if b < *a { *a = b; }
|
|
||||||
}
|
|
||||||
// Pass 2 — fixup slots where BOTH sides were overflow (primary = 255 after pass 1,
|
|
||||||
// but the overflow value may have changed). Slots where only self was overflow are
|
|
||||||
// already correct: pass 1 wrote other.primary[slot] < 255 and clear_overflow removed
|
|
||||||
// the stale entry.
|
|
||||||
for (slot, self_val) in self_ov {
|
|
||||||
if let Some(&other_val) = other_ov.get(&slot) {
|
|
||||||
self.set(slot, self_val.min(other_val));
|
|
||||||
}
|
|
||||||
}
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn max<S: IntSlice>(&mut self, other: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), other.len(), "IntSlice length mismatch");
|
|
||||||
// Pre-pass — process other's overflow entries BEFORE the byte pass.
|
|
||||||
// After the byte pass, self.primary[slot] = 255 for all slots in other_ov,
|
|
||||||
// making it impossible to recover the original self value; we need it now.
|
|
||||||
for (slot, other_val) in other.overflow_entries() {
|
|
||||||
let self_val = self.get(slot);
|
|
||||||
self.set(slot, self_val.max(other_val));
|
|
||||||
}
|
|
||||||
// Pass 1 — SIMD-vectorizable byte max over the full primary array.
|
|
||||||
// 255 = +∞ on u8 → max(a, 255) = 255 is the correct sentinel for all
|
|
||||||
// overflow slots, whether handled by the pre-pass or already in self.
|
|
||||||
for (a, &b) in self.primary_bytes_mut().iter_mut().zip(other.primary_bytes()) {
|
|
||||||
if b > *a { *a = b; }
|
|
||||||
}
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn add<S: IntSlice>(&mut self, other: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), other.len(), "IntSlice length mismatch");
|
|
||||||
let n = self.len();
|
|
||||||
for s in 0..n {
|
|
||||||
// Read both primary bytes first — u8 is Copy, borrows released immediately.
|
|
||||||
let sb = self.primary_bytes()[s];
|
|
||||||
let ob = other.primary_bytes()[s];
|
|
||||||
if sb < 255 && ob < 255 {
|
|
||||||
// Hot path: no overflow lookup, no HashMap write in the common case.
|
|
||||||
let sum = sb as u32 + ob as u32;
|
|
||||||
if sum < 255 { self.primary_bytes_mut()[s] = sum as u8; }
|
|
||||||
else { self.set(s, sum); }
|
|
||||||
} else {
|
|
||||||
// At least one side is in overflow — get() is unavoidable.
|
|
||||||
let self_val = self.get(s);
|
|
||||||
let other_val = other.get(s);
|
|
||||||
self.set(s, self_val + other_val);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
fn diff<S: IntSlice>(&mut self, other: &S) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), other.len(), "IntSlice length mismatch");
|
|
||||||
let n = self.len();
|
|
||||||
for s in 0..n {
|
|
||||||
let sb = self.primary_bytes()[s];
|
|
||||||
let ob = other.primary_bytes()[s];
|
|
||||||
if sb < 255 {
|
|
||||||
// Result is always < 255 — no overflow created or consulted.
|
|
||||||
// ob == 255 means b ≥ 255 > a, so saturating result = 0.
|
|
||||||
self.primary_bytes_mut()[s] = if ob < 255 { sb.saturating_sub(ob) } else { 0 };
|
|
||||||
} else {
|
|
||||||
// sb == 255: self has overflow — get() unavoidable.
|
|
||||||
// other.get() only needed when ob == 255 too (both-overflow case).
|
|
||||||
let self_val = self.get(s);
|
|
||||||
let other_val = if ob < 255 { ob as u32 } else { other.get(s) };
|
|
||||||
self.set(s, self_val.saturating_sub(other_val));
|
|
||||||
}
|
|
||||||
}
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
/// For each slot where `bits` is true, increment `self` by 1.
|
|
||||||
/// Skips zero words entirely — O(n_ones) rather than O(n).
|
|
||||||
fn count_bits<B: BitSlice>(&mut self, bits: &B) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), bits.len(), "IntSlice/BitSlice length mismatch");
|
|
||||||
for (w_idx, &word) in bits.words().iter().enumerate() {
|
|
||||||
if word == 0 { continue; }
|
|
||||||
let base = w_idx * 64;
|
|
||||||
let mut w = word;
|
|
||||||
while w != 0 {
|
|
||||||
let bit = w.trailing_zeros() as usize;
|
|
||||||
let slot = base + bit;
|
|
||||||
if slot < self.len() { self.inc(slot); }
|
|
||||||
w &= w - 1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
self
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Zero every slot where the corresponding bit in `mask` is 0.
|
|
||||||
/// Iterates only the zero bits — O(n_zeros), O(1) when mask is all-ones.
|
|
||||||
fn mask_with<B: BitSlice>(&mut self, mask: &B) -> &mut Self {
|
|
||||||
assert_eq!(self.len(), mask.len(), "IntSlice/BitSlice length mismatch");
|
|
||||||
let n = self.len();
|
|
||||||
for (wi, &word) in mask.words().iter().enumerate() {
|
|
||||||
if word == u64::MAX { continue; }
|
|
||||||
let mut zeros = !word;
|
|
||||||
while zeros != 0 {
|
|
||||||
let bit = zeros.trailing_zeros() as usize;
|
|
||||||
let s = wi * 64 + bit;
|
|
||||||
if s < n {
|
|
||||||
// u8 is Copy — the immutable borrow from primary_bytes() ends
|
|
||||||
// before the mutable borrow from set() begins.
|
|
||||||
let b = self.primary_bytes()[s];
|
|
||||||
if b != 0 { self.set(s, 0); }
|
|
||||||
}
|
|
||||||
zeros &= zeros - 1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
self
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── IntSlice → MemoryBitVec conversions ───────────────────────────────────────
|
|
||||||
|
|
||||||
use crate::memoryvec::MemoryBitVec;
|
|
||||||
|
|
||||||
pub trait IntToBit: IntSlice {
|
|
||||||
/// Bit set iff value >= threshold. Consistent with `geq` and `build_from_counts`.
|
|
||||||
fn to_bitvec(&self, threshold: u32) -> MemoryBitVec { self.geq(threshold) }
|
|
||||||
|
|
||||||
/// Bit set iff value >= 1 (slot is present).
|
|
||||||
fn to_presence(&self) -> MemoryBitVec { self.geq(1) }
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<T: IntSlice> IntToBit for T {}
|
|
||||||
|
|
||||||
// ── BitSlice → MemoryIntVec conversion ───────────────────────────────────────
|
|
||||||
|
|
||||||
use crate::memoryintvec::MemoryIntVec;
|
|
||||||
|
|
||||||
// Maps each byte value to its 8 constituent bits as individual u8 (0 or 1).
|
|
||||||
static EXPAND_BYTE: [[u8; 8]; 256] = {
|
|
||||||
let mut table = [[0u8; 8]; 256];
|
|
||||||
let mut b = 0usize;
|
|
||||||
while b < 256 {
|
|
||||||
let mut bit = 0usize;
|
|
||||||
while bit < 8 {
|
|
||||||
table[b][bit] = ((b >> bit) & 1) as u8;
|
|
||||||
bit += 1;
|
|
||||||
}
|
|
||||||
b += 1;
|
|
||||||
}
|
|
||||||
table
|
|
||||||
};
|
|
||||||
|
|
||||||
pub trait BitToInt: BitSlice {
|
|
||||||
fn to_intvec(&self) -> MemoryIntVec {
|
|
||||||
let n = self.len();
|
|
||||||
let mut primary = vec![0u8; n];
|
|
||||||
|
|
||||||
let words = self.words();
|
|
||||||
let full_words = n / 64;
|
|
||||||
|
|
||||||
for (w_idx, &word) in words[..full_words].iter().enumerate() {
|
|
||||||
let base = w_idx * 64;
|
|
||||||
for byte_off in 0..8usize {
|
|
||||||
let byte = (word >> (byte_off * 8)) as u8;
|
|
||||||
primary[base + byte_off * 8..base + byte_off * 8 + 8]
|
|
||||||
.copy_from_slice(&EXPAND_BYTE[byte as usize]);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
let rem = n % 64;
|
|
||||||
if rem > 0 {
|
|
||||||
let word = words[full_words];
|
|
||||||
let base = full_words * 64;
|
|
||||||
for bit in 0..rem {
|
|
||||||
primary[base + bit] = ((word >> bit) & 1) as u8;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
MemoryIntVec::from_primary(primary)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
impl<T: BitSlice> BitToInt for T {}
|
|
||||||
|
|
||||||
// ── Column-level weight statistic — total count or presence count per column.
|
// ── Column-level weight statistic — total count or presence count per column.
|
||||||
/// Additive across layers and partitions; used as denominator in normalised distances.
|
/// Additive across layers and partitions; used as denominator in normalised distances.
|
||||||
///
|
///
|
||||||
|
|||||||
@@ -0,0 +1,278 @@
|
|||||||
|
use crate::format::{byte_count_nonzero, byte_sum, parse_overflow_entry};
|
||||||
|
|
||||||
|
// ── BitSliceView ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Lightweight, copy-able read-only view over a u64 word array.
|
||||||
|
/// Bit `i` is in `words[i >> 6]` at position `i & 63`. Padding bits are zero.
|
||||||
|
#[derive(Clone, Copy)]
|
||||||
|
pub struct BitSliceView<'a> {
|
||||||
|
pub(crate) words: &'a [u64],
|
||||||
|
pub(crate) n: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl<'a> BitSliceView<'a> {
|
||||||
|
#[inline]
|
||||||
|
pub fn new(words: &'a [u64], n: usize) -> Self { Self { words, n } }
|
||||||
|
|
||||||
|
pub fn len(&self) -> usize { self.n }
|
||||||
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
|
pub fn words(&self) -> &'a [u64] { self.words }
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
pub fn get(&self, slot: usize) -> bool {
|
||||||
|
(self.words[slot >> 6] >> (slot & 63)) & 1 != 0
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn count_ones(&self) -> u64 {
|
||||||
|
self.words.iter().map(|w| w.count_ones() as u64).sum()
|
||||||
|
}
|
||||||
|
pub fn count_zeros(&self) -> u64 { self.n as u64 - self.count_ones() }
|
||||||
|
|
||||||
|
pub fn iter(&self) -> BitSliceIter<'a> {
|
||||||
|
BitSliceIter { words: self.words, slot: 0, n: self.n }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn partial_jaccard_dist(self, other: BitSliceView<'_>) -> (u64, u64) {
|
||||||
|
assert_eq!(self.n, other.n, "BitSliceView length mismatch");
|
||||||
|
self.words.iter().zip(other.words)
|
||||||
|
.fold((0u64, 0u64), |(i, u), (&a, &b)| {
|
||||||
|
(i + (a & b).count_ones() as u64, u + (a | b).count_ones() as u64)
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn jaccard_dist(self, other: BitSliceView<'_>) -> f64 {
|
||||||
|
let (inter, union) = self.partial_jaccard_dist(other);
|
||||||
|
if union == 0 { 0.0 } else { 1.0 - inter as f64 / union as f64 }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn hamming_dist(self, other: BitSliceView<'_>) -> u64 {
|
||||||
|
assert_eq!(self.n, other.n, "BitSliceView length mismatch");
|
||||||
|
self.words.iter().zip(other.words)
|
||||||
|
.map(|(&a, &b)| (a ^ b).count_ones() as u64)
|
||||||
|
.sum()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── BitSliceIter ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub struct BitSliceIter<'a> {
|
||||||
|
words: &'a [u64],
|
||||||
|
slot: usize,
|
||||||
|
n: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl Iterator for BitSliceIter<'_> {
|
||||||
|
type Item = bool;
|
||||||
|
fn next(&mut self) -> Option<bool> {
|
||||||
|
if self.slot >= self.n { return None; }
|
||||||
|
let v = (self.words[self.slot >> 6] >> (self.slot & 63)) & 1 != 0;
|
||||||
|
self.slot += 1;
|
||||||
|
Some(v)
|
||||||
|
}
|
||||||
|
fn size_hint(&self) -> (usize, Option<usize>) {
|
||||||
|
let rem = self.n - self.slot;
|
||||||
|
(rem, Some(rem))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
impl ExactSizeIterator for BitSliceIter<'_> {}
|
||||||
|
|
||||||
|
// ── IntSliceView ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Lightweight, copy-able read-only view over a compact-int primary array plus
|
||||||
|
/// its sorted raw overflow bytes. Zero-copy: all data lives in the caller's mmap.
|
||||||
|
#[derive(Clone, Copy)]
|
||||||
|
pub struct IntSliceView<'a> {
|
||||||
|
pub(crate) primary: &'a [u8],
|
||||||
|
pub(crate) overflow_raw: &'a [u8], // n_overflow × OVERFLOW_ENTRY_SIZE bytes, sorted by slot
|
||||||
|
pub(crate) n_overflow: usize,
|
||||||
|
pub(crate) n: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl<'a> IntSliceView<'a> {
|
||||||
|
#[inline]
|
||||||
|
pub fn new(primary: &'a [u8], overflow_raw: &'a [u8], n_overflow: usize, n: usize) -> Self {
|
||||||
|
Self { primary, overflow_raw, n_overflow, n }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn len(&self) -> usize { self.n }
|
||||||
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
|
pub fn primary_bytes(&self) -> &'a [u8] { self.primary }
|
||||||
|
pub fn n_overflow(&self) -> usize { self.n_overflow }
|
||||||
|
|
||||||
|
pub fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + 'a {
|
||||||
|
let raw = self.overflow_raw;
|
||||||
|
let n_ov = self.n_overflow;
|
||||||
|
(0..n_ov).map(move |i| parse_overflow_entry(raw, 0, i))
|
||||||
|
}
|
||||||
|
|
||||||
|
/// O(log n_overflow) via binary search (overflow is always sorted by slot).
|
||||||
|
pub fn get(&self, slot: usize) -> u32 {
|
||||||
|
let b = self.primary[slot];
|
||||||
|
if b < 255 { return b as u32; }
|
||||||
|
let mut lo = 0usize;
|
||||||
|
let mut hi = self.n_overflow;
|
||||||
|
while lo < hi {
|
||||||
|
let mid = lo + (hi - lo) / 2;
|
||||||
|
let (s, v) = parse_overflow_entry(self.overflow_raw, 0, mid);
|
||||||
|
match s.cmp(&slot) {
|
||||||
|
std::cmp::Ordering::Equal => return v,
|
||||||
|
std::cmp::Ordering::Less => lo = mid + 1,
|
||||||
|
std::cmp::Ordering::Greater => hi = mid,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
panic!("slot {slot} marked overflow but not found")
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Sequential merge scan: yields all n values in slot order.
|
||||||
|
pub fn iter(&self) -> IntSliceViewIter<'a> {
|
||||||
|
IntSliceViewIter {
|
||||||
|
primary: self.primary,
|
||||||
|
overflow_raw: self.overflow_raw,
|
||||||
|
slot: 0,
|
||||||
|
overflow_pos: 0,
|
||||||
|
n: self.n,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn sum(&self) -> u64 {
|
||||||
|
byte_sum(self.primary, self.overflow_entries().map(|(_, v)| v))
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn count_nonzero(&self) -> u64 {
|
||||||
|
byte_count_nonzero(self.primary)
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Distance methods ──────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub fn partial_bray_dist(self, other: IntSliceView<'_>) -> u64 {
|
||||||
|
assert_eq!(self.n, other.n, "length mismatch");
|
||||||
|
self.iter().zip(other.iter()).map(|(a, b)| a.min(b) as u64).sum()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn bray_dist(self, other: IntSliceView<'_>) -> f64 {
|
||||||
|
let sum_min = self.partial_bray_dist(other);
|
||||||
|
let denom = self.sum() + other.sum();
|
||||||
|
if denom == 0 { 0.0 } else { 1.0 - 2.0 * sum_min as f64 / denom as f64 }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn partial_relfreq_bray_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
|
||||||
|
assert_eq!(self.n, other.n, "length mismatch");
|
||||||
|
self.iter().zip(other.iter())
|
||||||
|
.map(|(a, b)| {
|
||||||
|
let pa = if sa > 0.0 { a as f64 / sa } else { 0.0 };
|
||||||
|
let pb = if sb > 0.0 { b as f64 / sb } else { 0.0 };
|
||||||
|
pa.min(pb)
|
||||||
|
})
|
||||||
|
.sum()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn relfreq_bray_dist(self, other: IntSliceView<'_>) -> f64 {
|
||||||
|
let sa = self.sum() as f64;
|
||||||
|
let sb = other.sum() as f64;
|
||||||
|
if sa == 0.0 && sb == 0.0 { return 0.0; }
|
||||||
|
1.0 - self.partial_relfreq_bray_dist(other, sa, sb)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn partial_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
|
||||||
|
assert_eq!(self.n, other.n, "length mismatch");
|
||||||
|
self.iter().zip(other.iter())
|
||||||
|
.map(|(a, b)| { let d = a as f64 - b as f64; d * d })
|
||||||
|
.sum()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
|
||||||
|
self.partial_euclidean_dist(other).sqrt()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn partial_relfreq_euclidean_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
|
||||||
|
assert_eq!(self.n, other.n, "length mismatch");
|
||||||
|
self.iter().zip(other.iter())
|
||||||
|
.map(|(a, b)| {
|
||||||
|
let pa = if sa > 0.0 { a as f64 / sa } else { 0.0 };
|
||||||
|
let pb = if sb > 0.0 { b as f64 / sb } else { 0.0 };
|
||||||
|
let d = pa - pb;
|
||||||
|
d * d
|
||||||
|
})
|
||||||
|
.sum()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn relfreq_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
|
||||||
|
let sa = self.sum() as f64;
|
||||||
|
let sb = other.sum() as f64;
|
||||||
|
if sa == 0.0 && sb == 0.0 { return 0.0; }
|
||||||
|
self.partial_relfreq_euclidean_dist(other, sa, sb).sqrt()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn partial_hellinger_euclidean_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
|
||||||
|
assert_eq!(self.n, other.n, "length mismatch");
|
||||||
|
self.iter().zip(other.iter())
|
||||||
|
.map(|(a, b)| {
|
||||||
|
let pa = if sa > 0.0 { (a as f64 / sa).sqrt() } else { 0.0 };
|
||||||
|
let pb = if sb > 0.0 { (b as f64 / sb).sqrt() } else { 0.0 };
|
||||||
|
let d = pa - pb;
|
||||||
|
d * d
|
||||||
|
})
|
||||||
|
.sum()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn hellinger_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
|
||||||
|
let sa = self.sum() as f64;
|
||||||
|
let sb = other.sum() as f64;
|
||||||
|
if sa == 0.0 && sb == 0.0 { return 0.0; }
|
||||||
|
self.partial_hellinger_euclidean_dist(other, sa, sb).sqrt()
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn hellinger_dist(self, other: IntSliceView<'_>) -> f64 {
|
||||||
|
self.hellinger_euclidean_dist(other) / std::f64::consts::SQRT_2
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn partial_threshold_jaccard_dist(self, other: IntSliceView<'_>, threshold: u32) -> (u64, u64) {
|
||||||
|
assert_eq!(self.n, other.n, "length mismatch");
|
||||||
|
self.iter().zip(other.iter())
|
||||||
|
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
|
||||||
|
let ap = a >= threshold;
|
||||||
|
let bp = b >= threshold;
|
||||||
|
(inter + (ap & bp) as u64, uni + (ap | bp) as u64)
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn threshold_jaccard_dist(self, other: IntSliceView<'_>, threshold: u32) -> f64 {
|
||||||
|
let (inter, union) = self.partial_threshold_jaccard_dist(other, threshold);
|
||||||
|
if union == 0 { 0.0 } else { 1.0 - inter as f64 / union as f64 }
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn jaccard_dist(self, other: IntSliceView<'_>) -> f64 {
|
||||||
|
self.threshold_jaccard_dist(other, 1)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── IntSliceViewIter ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub struct IntSliceViewIter<'a> {
|
||||||
|
primary: &'a [u8],
|
||||||
|
overflow_raw: &'a [u8],
|
||||||
|
slot: usize,
|
||||||
|
overflow_pos: usize,
|
||||||
|
n: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl Iterator for IntSliceViewIter<'_> {
|
||||||
|
type Item = u32;
|
||||||
|
fn next(&mut self) -> Option<u32> {
|
||||||
|
if self.slot >= self.n { return None; }
|
||||||
|
let v = self.primary[self.slot];
|
||||||
|
self.slot += 1;
|
||||||
|
if v < 255 {
|
||||||
|
Some(v as u32)
|
||||||
|
} else {
|
||||||
|
let (_, val) = parse_overflow_entry(self.overflow_raw, 0, self.overflow_pos);
|
||||||
|
self.overflow_pos += 1;
|
||||||
|
Some(val)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
fn size_hint(&self) -> (usize, Option<usize>) {
|
||||||
|
let rem = self.n - self.slot;
|
||||||
|
(rem, Some(rem))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
impl ExactSizeIterator for IntSliceViewIter<'_> {}
|
||||||
@@ -3,6 +3,7 @@ use crossbeam_channel;
|
|||||||
use hashbrown::HashMap;
|
use hashbrown::HashMap;
|
||||||
use obikseq::k;
|
use obikseq::k;
|
||||||
use obikseq::{CanonicalKmer, Sequence, Unitig};
|
use obikseq::{CanonicalKmer, Sequence, Unitig};
|
||||||
|
#[cfg(not(any(test, feature = "test-utils")))]
|
||||||
use rayon::iter::{IntoParallelRefIterator, ParallelIterator};
|
use rayon::iter::{IntoParallelRefIterator, ParallelIterator};
|
||||||
use std::cell::RefCell;
|
use std::cell::RefCell;
|
||||||
use std::fmt;
|
use std::fmt;
|
||||||
|
|||||||
@@ -17,4 +17,8 @@ serde = { version = "1", features = ["derive"] }
|
|||||||
serde_json = "1"
|
serde_json = "1"
|
||||||
indicatif = "0.17"
|
indicatif = "0.17"
|
||||||
tracing = "0.1.44"
|
tracing = "0.1.44"
|
||||||
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"] }
|
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
|
||||||
|
|
||||||
|
[features]
|
||||||
|
default = ["numa"]
|
||||||
|
numa = ["hwlocality"]
|
||||||
|
|||||||
@@ -11,7 +11,7 @@ use obilayeredmap::IndexMode;
|
|||||||
use crate::error::{OKIError, OKIResult};
|
use crate::error::{OKIError, OKIResult};
|
||||||
use crate::index::KmerIndex;
|
use crate::index::KmerIndex;
|
||||||
use crate::meta::{GenomeInfo, IndexMeta};
|
use crate::meta::{GenomeInfo, IndexMeta};
|
||||||
use crate::state::IndexState;
|
use crate::state::{IndexState, SENTINEL_INDEXED};
|
||||||
|
|
||||||
pub use obikpartitionner::MergeMode;
|
pub use obikpartitionner::MergeMode;
|
||||||
|
|
||||||
@@ -263,6 +263,8 @@ impl KmerIndex {
|
|||||||
rep.push(t.stop());
|
rep.push(t.stop());
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fs::File::create(output.join(SENTINEL_INDEXED)).map_err(OKIError::Io)?;
|
||||||
|
|
||||||
KmerIndex::open(output)
|
KmerIndex::open(output)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
+332
-86
@@ -5,45 +5,48 @@
|
|||||||
// CPUs. Linux first-touch policy then places graph allocations in local DRAM
|
// CPUs. Linux first-touch policy then places graph allocations in local DRAM
|
||||||
// automatically — no explicit memory binding needed.
|
// automatically — no explicit memory binding needed.
|
||||||
//
|
//
|
||||||
// Returns None when:
|
// UMA systems (single socket, Apple Silicon, etc.) are the degenerate case:
|
||||||
// - hwloc topology initialisation fails
|
// one synthetic node containing all cores, no pool, no pinning.
|
||||||
// - the system has only one NUMA node (UMA, Apple Silicon, single-socket)
|
|
||||||
// - any per-node pool fails to build
|
|
||||||
|
|
||||||
use std::sync::Arc;
|
use std::sync::Arc;
|
||||||
use std::time::{Duration, Instant};
|
use std::time::{Duration, Instant};
|
||||||
|
|
||||||
use crossbeam_channel::unbounded;
|
use crossbeam_channel::unbounded;
|
||||||
|
#[cfg(feature = "numa")]
|
||||||
use hwlocality::Topology;
|
use hwlocality::Topology;
|
||||||
|
#[cfg(feature = "numa")]
|
||||||
use hwlocality::cpu::binding::CpuBindingFlags;
|
use hwlocality::cpu::binding::CpuBindingFlags;
|
||||||
|
#[cfg(feature = "numa")]
|
||||||
use hwlocality::cpu::cpuset::CpuSet;
|
use hwlocality::cpu::cpuset::CpuSet;
|
||||||
|
#[cfg(feature = "numa")]
|
||||||
use hwlocality::object::types::ObjectType;
|
use hwlocality::object::types::ObjectType;
|
||||||
|
use obisys::{CpuSample, IoSample};
|
||||||
use tracing::debug;
|
use tracing::debug;
|
||||||
|
|
||||||
// ── Public interface ──────────────────────────────────────────────────────────
|
// ── Public interface ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
pub struct NumaSetup {
|
pub struct NumaSetup {
|
||||||
pub pools: Vec<Arc<rayon::ThreadPool>>,
|
/// One entry per NUMA node. `None` on UMA systems (no pool, no pinning).
|
||||||
|
pub pools: Vec<Option<Arc<rayon::ThreadPool>>>,
|
||||||
/// CPU indices for each NUMA node, in node order.
|
/// CPU indices for each NUMA node, in node order.
|
||||||
pub cpus_per_node: Vec<Vec<usize>>,
|
pub cpus_per_node: Vec<Vec<usize>>,
|
||||||
}
|
}
|
||||||
|
|
||||||
impl NumaSetup {
|
impl NumaSetup {
|
||||||
/// Workers to activate per NUMA node.
|
/// Maximum worker slots per node (one per physical core in the node).
|
||||||
/// Empirically ~3 workers saturate one node's memory bandwidth.
|
|
||||||
pub fn workers_per_node(&self) -> usize {
|
pub fn workers_per_node(&self) -> usize {
|
||||||
self.cpus_per_node
|
self.cpus_per_node
|
||||||
.first()
|
.first()
|
||||||
.map(|c| (c.len() / 8).max(3).min(8))
|
.map(|c| c.len().max(1))
|
||||||
.unwrap_or(3)
|
.unwrap_or(1)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Detect NUMA topology and build per-node Rayon pools.
|
/// Detect NUMA topology and build per-node Rayon pools.
|
||||||
/// Returns None on UMA systems, single-node machines, or on failure.
|
/// Always succeeds: falls back to a single synthetic UMA node on failure.
|
||||||
pub fn build() -> Option<NumaSetup> {
|
#[cfg(feature = "numa")]
|
||||||
let topology = Topology::new().ok()?;
|
pub fn build() -> NumaSetup {
|
||||||
|
if let Ok(topology) = Topology::new() {
|
||||||
let nodes: Vec<Vec<usize>> = topology
|
let nodes: Vec<Vec<usize>> = topology
|
||||||
.objects_with_type(ObjectType::NUMANode)
|
.objects_with_type(ObjectType::NUMANode)
|
||||||
.filter_map(|obj| obj.cpuset())
|
.filter_map(|obj| obj.cpuset())
|
||||||
@@ -56,28 +59,55 @@ pub fn build() -> Option<NumaSetup> {
|
|||||||
.filter(|v| !v.is_empty())
|
.filter(|v| !v.is_empty())
|
||||||
.collect();
|
.collect();
|
||||||
|
|
||||||
if nodes.len() <= 1 {
|
if nodes.len() > 1 {
|
||||||
return None;
|
if let Some(pools) = nodes
|
||||||
}
|
.iter()
|
||||||
|
.map(|cpus| build_pool(cpus).map(|p| Some(Arc::new(p))))
|
||||||
|
.collect::<Option<Vec<_>>>()
|
||||||
|
{
|
||||||
debug!(
|
debug!(
|
||||||
"NUMA topology: {} node(s), {} core(s)/node",
|
"NUMA topology: {} node(s), {} core(s)/node",
|
||||||
nodes.len(),
|
nodes.len(),
|
||||||
nodes.first().map_or(0, |v| v.len()),
|
nodes.first().map_or(0, |v| v.len()),
|
||||||
);
|
);
|
||||||
|
return NumaSetup {
|
||||||
|
pools,
|
||||||
|
cpus_per_node: nodes,
|
||||||
|
};
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
let pools = nodes
|
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
|
||||||
.iter()
|
let n_cores = std::thread::available_parallelism()
|
||||||
.map(|cpus| build_pool(cpus).map(Arc::new))
|
.map(|n| n.get())
|
||||||
.collect::<Option<Vec<_>>>()?;
|
.unwrap_or(1);
|
||||||
|
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
||||||
|
NumaSetup {
|
||||||
|
pools: vec![None],
|
||||||
|
cpus_per_node: vec![(0..n_cores).collect()],
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
Some(NumaSetup { pools, cpus_per_node: nodes })
|
#[cfg(not(feature = "numa"))]
|
||||||
|
pub fn build() -> NumaSetup {
|
||||||
|
let n_cores = std::thread::available_parallelism()
|
||||||
|
.map(|n| n.get())
|
||||||
|
.unwrap_or(1);
|
||||||
|
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
||||||
|
NumaSetup {
|
||||||
|
pools: vec![None],
|
||||||
|
cpus_per_node: vec![(0..n_cores).collect()],
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Bind the calling thread to `cpu_indices` using hwloc.
|
/// Bind the calling thread to `cpu_indices` using hwloc.
|
||||||
/// Silently returns on any error so the thread still runs, just unbound.
|
/// Silently returns on any error so the thread still runs, just unbound.
|
||||||
|
#[cfg(feature = "numa")]
|
||||||
pub fn pin_current_thread(cpu_indices: &[usize]) {
|
pub fn pin_current_thread(cpu_indices: &[usize]) {
|
||||||
let Ok(topology) = Topology::new() else { return };
|
let Ok(topology) = Topology::new() else {
|
||||||
|
return;
|
||||||
|
};
|
||||||
let mut cpuset = CpuSet::new();
|
let mut cpuset = CpuSet::new();
|
||||||
for &idx in cpu_indices {
|
for &idx in cpu_indices {
|
||||||
cpuset.set(idx);
|
cpuset.set(idx);
|
||||||
@@ -85,8 +115,12 @@ pub fn pin_current_thread(cpu_indices: &[usize]) {
|
|||||||
let _ = topology.bind_cpu(&cpuset, CpuBindingFlags::THREAD);
|
let _ = topology.bind_cpu(&cpuset, CpuBindingFlags::THREAD);
|
||||||
}
|
}
|
||||||
|
|
||||||
|
#[cfg(not(feature = "numa"))]
|
||||||
|
pub fn pin_current_thread(_cpu_indices: &[usize]) {}
|
||||||
|
|
||||||
// ── Internal helpers ──────────────────────────────────────────────────────────
|
// ── Internal helpers ──────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
#[cfg(feature = "numa")]
|
||||||
fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> {
|
fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> {
|
||||||
let cpus = cpus.to_vec();
|
let cpus = cpus.to_vec();
|
||||||
rayon::ThreadPoolBuilder::new()
|
rayon::ThreadPoolBuilder::new()
|
||||||
@@ -103,7 +137,22 @@ fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> {
|
|||||||
.ok()
|
.ok()
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── PartitionRunner ───────────────────────────────────────────────────────────
|
// ── PartitionRunner ─────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Growth step (fraction of a node's worker capacity added per activation
|
||||||
|
/// event, see [`NodeActivation::grow`]).
|
||||||
|
const GROWTH_DIVISOR: usize = 8;
|
||||||
|
/// Minimum CPU efficiency growth to activate more workers, as a fraction of
|
||||||
|
/// the size of the *last growth step* (e.g. `0.2` after adding 8 workers
|
||||||
|
/// requires the next check to show at least +1.6 cores of growth — 20 % of
|
||||||
|
/// the ~8 cores those 8 workers should contribute if the workload is truly
|
||||||
|
/// CPU-bound). Scaling by the last step's size — not the cumulative total —
|
||||||
|
/// keeps the bar meaningful regardless of how many workers are already
|
||||||
|
/// active, instead of demanding an ever-larger absolute jump as the pool
|
||||||
|
/// grows.
|
||||||
|
const CPU_SPAWN_THRESHOLD: f64 = 0.2;
|
||||||
|
/// Minimum I/O throughput growth (relative) to activate more workers.
|
||||||
|
const IO_SPAWN_THRESHOLD: f64 = 0.2;
|
||||||
|
|
||||||
struct NodeConfig {
|
struct NodeConfig {
|
||||||
pool: Option<Arc<rayon::ThreadPool>>,
|
pool: Option<Arc<rayon::ThreadPool>>,
|
||||||
@@ -113,19 +162,24 @@ struct NodeConfig {
|
|||||||
|
|
||||||
/// Generic NUMA-aware runner for partition-level parallel work.
|
/// Generic NUMA-aware runner for partition-level parallel work.
|
||||||
///
|
///
|
||||||
/// Workers are distributed round-robin across NUMA nodes and pinned to their
|
/// Workers are distributed evenly across NUMA nodes and pinned to their
|
||||||
/// node's CPUs. UMA systems are the degenerate case: one node, no pinning.
|
/// node's CPUs. UMA is the degenerate case: one node, no pinning.
|
||||||
|
///
|
||||||
|
/// Workers are pre-spawned dormant, one activation channel per node so
|
||||||
|
/// growth always targets a specific node rather than whichever dormant
|
||||||
|
/// worker happens to wake up first on a shared channel. Growth (both the
|
||||||
|
/// initial count and each subsequent step) is expressed as a fraction of
|
||||||
|
/// `workers_per_node`, applied identically to every node, so the pace of
|
||||||
|
/// ramp-up depends on node size rather than node count — a single-NUMA-node
|
||||||
|
/// (UMA) machine ramps just as fast as an 8-node one.
|
||||||
///
|
///
|
||||||
/// # Termination
|
/// # Termination
|
||||||
///
|
///
|
||||||
/// Termination is driven entirely by channel closure:
|
|
||||||
///
|
|
||||||
/// ```text
|
/// ```text
|
||||||
/// drop(part_tx) → part_rx drains → workers exit → drop their result_tx
|
/// drop(part_tx) → part_rx drains → workers exit → drop their result_tx
|
||||||
/// drop(result_tx) → result_rx closes → controller loop exits
|
/// drop(result_tx) → result_rx closes → controller loop exits
|
||||||
|
/// drop(activate_txs) → dormant workers exit cleanly
|
||||||
/// ```
|
/// ```
|
||||||
///
|
|
||||||
/// No explicit counter or sentinel needed.
|
|
||||||
pub struct PartitionRunner {
|
pub struct PartitionRunner {
|
||||||
nodes: Vec<NodeConfig>,
|
nodes: Vec<NodeConfig>,
|
||||||
}
|
}
|
||||||
@@ -136,111 +190,185 @@ impl PartitionRunner {
|
|||||||
self.nodes.iter().map(|n| n.max_workers).sum()
|
self.nodes.iter().map(|n| n.max_workers).sum()
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Detect topology and build. Falls back to a single-node UMA runner on
|
/// Detect topology and build. Always succeeds.
|
||||||
/// macOS, single-socket machines, or hwloc failure.
|
|
||||||
pub fn new() -> Self {
|
pub fn new() -> Self {
|
||||||
match build() {
|
let ns = build();
|
||||||
Some(ns) => {
|
|
||||||
let wpn = ns.workers_per_node();
|
let wpn = ns.workers_per_node();
|
||||||
debug!(
|
debug!(
|
||||||
"PartitionRunner: NUMA mode — {} node(s) × {} worker(s)/node",
|
"PartitionRunner: {} node(s) × {} worker(s)/node max",
|
||||||
ns.pools.len(), wpn,
|
ns.pools.len(),
|
||||||
|
wpn,
|
||||||
);
|
);
|
||||||
let nodes = ns.pools
|
let nodes = ns
|
||||||
|
.pools
|
||||||
.into_iter()
|
.into_iter()
|
||||||
.zip(ns.cpus_per_node)
|
.zip(ns.cpus_per_node)
|
||||||
.map(|(pool, cpu_ids)| NodeConfig {
|
.map(|(pool, cpu_ids)| NodeConfig {
|
||||||
pool: Some(pool),
|
pool,
|
||||||
cpu_ids,
|
cpu_ids,
|
||||||
max_workers: wpn,
|
max_workers: wpn,
|
||||||
})
|
})
|
||||||
.collect();
|
.collect();
|
||||||
Self { nodes }
|
Self { nodes }
|
||||||
}
|
}
|
||||||
None => {
|
|
||||||
let n_cores = std::thread::available_parallelism()
|
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1);
|
|
||||||
let max_workers = (n_cores / 2).max(1);
|
|
||||||
debug!("PartitionRunner: UMA mode — {} worker(s)", max_workers);
|
|
||||||
Self {
|
|
||||||
nodes: vec![NodeConfig {
|
|
||||||
pool: None,
|
|
||||||
cpu_ids: vec![],
|
|
||||||
max_workers,
|
|
||||||
}],
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Run `f(i)` for every index in `order`.
|
/// Run `f(i)` for every index in `order`.
|
||||||
///
|
///
|
||||||
/// Workers are spawned upfront and distributed round-robin across NUMA
|
/// Workers are pre-spawned dormant and activated adaptively, per node:
|
||||||
/// nodes. `on_done(i, result, elapsed)` is called from the controller
|
/// `(workers_per_node / INITIAL_DIVISOR).max(1)` are woken immediately on
|
||||||
/// thread as each partition completes — suitable for progress bars and
|
/// every node, then `(workers_per_node / GROWTH_DIVISOR).max(1)` more per
|
||||||
/// result aggregation.
|
/// node each time the check below fires. A timer thread fires that check
|
||||||
|
/// every `TIMER_SECS` seconds; each completed partition resets that timer
|
||||||
|
/// (forcing an immediate check) and also triggers its own inline check. A
|
||||||
|
/// growth step happens whenever CPU efficiency grows by at least
|
||||||
|
/// `CPU_SPAWN_THRESHOLD` of what the last growth step should have
|
||||||
|
/// contributed, or I/O throughput grows by at least `IO_SPAWN_THRESHOLD`
|
||||||
|
/// (relative) since the last check — whichever resource is the actual
|
||||||
|
/// bottleneck still shows headroom.
|
||||||
|
///
|
||||||
|
/// `on_done(i, result, elapsed)` is called from the controller thread as
|
||||||
|
/// each partition completes — suitable for progress bars and result
|
||||||
|
/// aggregation.
|
||||||
///
|
///
|
||||||
/// Returns the first error produced by `f`, if any.
|
/// Returns the first error produced by `f`, if any.
|
||||||
pub fn run<F, R, E, C>(
|
pub fn run<F, R, E, C>(&self, order: &[usize], f: F, mut on_done: C) -> Result<(), E>
|
||||||
&self,
|
|
||||||
order: &[usize],
|
|
||||||
f: F,
|
|
||||||
mut on_done: C,
|
|
||||||
) -> Result<(), E>
|
|
||||||
where
|
where
|
||||||
F: Fn(usize) -> Result<R, E> + Send + Sync,
|
F: Fn(usize) -> Result<R, E> + Send + Sync,
|
||||||
R: Send,
|
R: Send,
|
||||||
E: Send,
|
E: Send,
|
||||||
C: FnMut(usize, R, Duration) + Send,
|
C: FnMut(usize, R, Duration) + Send,
|
||||||
{
|
{
|
||||||
// Pre-load the work queue, then drop the sender so workers' part_rx
|
let n_total = order.len();
|
||||||
// iterators terminate when the queue is drained.
|
if n_total == 0 {
|
||||||
|
return Ok(());
|
||||||
|
}
|
||||||
|
|
||||||
|
const TIMER_SECS: u64 = 30;
|
||||||
|
const INITIAL_DIVISOR: usize = 4;
|
||||||
|
|
||||||
|
// ── Channels ──────────────────────────────────────────────────────────
|
||||||
let (part_tx, part_rx) = unbounded::<usize>();
|
let (part_tx, part_rx) = unbounded::<usize>();
|
||||||
for &i in order { part_tx.send(i).ok(); }
|
// reset_tx: controller → timer ("reset the 30 s window")
|
||||||
|
let (reset_tx, reset_rx) = unbounded::<()>();
|
||||||
|
// event_tx: workers + timer → controller (unified event stream)
|
||||||
|
let (event_tx, event_rx) = unbounded::<WorkerEvent<R, E>>();
|
||||||
|
// One activation channel per node: growth always targets a specific
|
||||||
|
// node, rather than whichever dormant worker happens to win the race
|
||||||
|
// on a channel shared across all nodes.
|
||||||
|
let (activate_txs, activate_rxs): (Vec<_>, Vec<_>) =
|
||||||
|
(0..self.nodes.len()).map(|_| unbounded::<()>()).unzip();
|
||||||
|
|
||||||
|
for &i in order {
|
||||||
|
part_tx.send(i).ok();
|
||||||
|
}
|
||||||
drop(part_tx);
|
drop(part_tx);
|
||||||
|
|
||||||
let (result_tx, result_rx) = unbounded::<(usize, Result<R, E>, Duration)>();
|
let max_workers = self.max_workers();
|
||||||
let n_nodes = self.nodes.len();
|
let node_caps: Vec<usize> = self.nodes.iter().map(|n| n.max_workers).collect();
|
||||||
let f = &f; // shared borrow; F: Sync so concurrent calls are safe
|
let f = &f;
|
||||||
|
|
||||||
let mut first_err: Option<E> = None;
|
let mut first_err: Option<E> = None;
|
||||||
|
|
||||||
std::thread::scope(|s| {
|
std::thread::scope(|s| {
|
||||||
// Spawn all workers upfront, round-robin across NUMA nodes.
|
// ── Timer thread ──────────────────────────────────────────────────
|
||||||
for w in 0..self.max_workers() {
|
// Sends TimerTick every TIMER_SECS seconds. Resets its window each
|
||||||
let node = &self.nodes[w % n_nodes];
|
// time reset_rx receives a message (i.e. on partition completion).
|
||||||
let prx = part_rx.clone();
|
let timer_tx = event_tx.clone();
|
||||||
let rtx = result_tx.clone();
|
s.spawn(move || {
|
||||||
let pool = node.pool.clone();
|
let period = Duration::from_secs(TIMER_SECS);
|
||||||
|
loop {
|
||||||
|
crossbeam_channel::select! {
|
||||||
|
recv(reset_rx) -> r => {
|
||||||
|
if r.is_err() { break; } // reset_tx dropped → exit
|
||||||
|
}
|
||||||
|
default(period) => {
|
||||||
|
if timer_tx.send(WorkerEvent::TimerTick).is_err() { break; }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
});
|
||||||
|
|
||||||
|
// ── Pre-spawn workers dormant, grouped by node ────────────────────
|
||||||
|
// Each worker listens on its own node's activation channel only.
|
||||||
|
for (node, arx) in self.nodes.iter().zip(activate_rxs.iter()) {
|
||||||
let cpu_ids = &node.cpu_ids;
|
let cpu_ids = &node.cpu_ids;
|
||||||
|
for _ in 0..node.max_workers {
|
||||||
|
let prx = part_rx.clone();
|
||||||
|
let etx = event_tx.clone();
|
||||||
|
let arx = arx.clone();
|
||||||
|
let pool = node.pool.clone();
|
||||||
|
|
||||||
s.spawn(move || {
|
s.spawn(move || {
|
||||||
if !cpu_ids.is_empty() { pin_current_thread(cpu_ids); }
|
if arx.recv().is_err() {
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
if !cpu_ids.is_empty() {
|
||||||
|
pin_current_thread(cpu_ids);
|
||||||
|
}
|
||||||
for i in &prx {
|
for i in &prx {
|
||||||
let t = Instant::now();
|
let t = Instant::now();
|
||||||
let r = match &pool {
|
let r = match &pool {
|
||||||
Some(p) => p.install(|| f(i)),
|
Some(p) => p.install(|| f(i)),
|
||||||
None => f(i),
|
None => f(i),
|
||||||
};
|
};
|
||||||
rtx.send((i, r, t.elapsed())).ok();
|
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
|
||||||
}
|
}
|
||||||
});
|
});
|
||||||
}
|
}
|
||||||
|
}
|
||||||
|
// Drop controller's event_tx: event_rx closes when all workers +
|
||||||
|
// timer have exited.
|
||||||
|
drop(event_tx);
|
||||||
|
|
||||||
// Drop the controller's sender: result_rx closes once all worker
|
// ── Controller ────────────────────────────────────────────────────
|
||||||
// rtx clones are dropped (i.e. all workers have exited).
|
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
|
||||||
drop(result_tx);
|
activation.activate_initial(INITIAL_DIVISOR, n_total);
|
||||||
|
|
||||||
// Drain results concurrently with workers. The for loop exits
|
let mut cpu_sample = CpuSample::now();
|
||||||
// when result_rx is disconnected — at that point all workers are
|
let mut io_sample = IoSample::now();
|
||||||
// done and the scope join below is instantaneous.
|
let mut completed = 0usize;
|
||||||
for (i, r, dur) in &result_rx {
|
|
||||||
|
while completed < n_total {
|
||||||
|
let Ok(event) = event_rx.recv() else { break };
|
||||||
|
match event {
|
||||||
|
WorkerEvent::Completed(i, r, dur) => {
|
||||||
match r {
|
match r {
|
||||||
Ok(v) => on_done(i, v, dur),
|
Ok(v) => on_done(i, v, dur),
|
||||||
Err(e) => { if first_err.is_none() { first_err = Some(e); } }
|
Err(e) => {
|
||||||
|
if first_err.is_none() {
|
||||||
|
first_err = Some(e);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
}
|
||||||
|
completed += 1;
|
||||||
|
// Reset the 30 s timer.
|
||||||
|
reset_tx.send(()).ok();
|
||||||
|
// Inline check: same logic as a timer tick.
|
||||||
|
maybe_activate(
|
||||||
|
&mut activation,
|
||||||
|
&mut cpu_sample,
|
||||||
|
&mut io_sample,
|
||||||
|
completed,
|
||||||
|
n_total,
|
||||||
|
);
|
||||||
|
}
|
||||||
|
WorkerEvent::TimerTick => {
|
||||||
|
maybe_activate(
|
||||||
|
&mut activation,
|
||||||
|
&mut cpu_sample,
|
||||||
|
&mut io_sample,
|
||||||
|
completed,
|
||||||
|
n_total,
|
||||||
|
);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Dormant workers exit once every sender for their node's channel
|
||||||
|
// is dropped — `activate_txs` holds the only ones.
|
||||||
|
drop(activate_txs);
|
||||||
|
// Timer thread exits when reset_tx closes.
|
||||||
|
drop(reset_tx);
|
||||||
});
|
});
|
||||||
|
|
||||||
match first_err {
|
match first_err {
|
||||||
@@ -249,3 +377,121 @@ impl PartitionRunner {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── Internal event type ───────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
enum WorkerEvent<R, E> {
|
||||||
|
Completed(usize, Result<R, E>, Duration),
|
||||||
|
TimerTick,
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Tracks how many of each node's dormant workers have been woken, and
|
||||||
|
/// grows every node by the same amount at each step (capped by that node's
|
||||||
|
/// remaining dormant workers and by the run's total budget) so load stays
|
||||||
|
/// balanced across nodes at every point in time — never just "one more
|
||||||
|
/// worker somewhere". Also remembers the size of the last real growth step
|
||||||
|
/// (`last_step`), used to scale the CPU activation threshold to what that
|
||||||
|
/// step could plausibly have contributed (see `maybe_activate`).
|
||||||
|
struct NodeActivation<'a> {
|
||||||
|
txs: &'a [crossbeam_channel::Sender<()>],
|
||||||
|
caps: &'a [usize],
|
||||||
|
active: Vec<usize>,
|
||||||
|
total: usize,
|
||||||
|
max: usize,
|
||||||
|
last_step: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl<'a> NodeActivation<'a> {
|
||||||
|
fn new(txs: &'a [crossbeam_channel::Sender<()>], caps: &'a [usize], max: usize) -> Self {
|
||||||
|
Self {
|
||||||
|
txs,
|
||||||
|
caps,
|
||||||
|
active: vec![0; txs.len()],
|
||||||
|
total: 0,
|
||||||
|
max,
|
||||||
|
last_step: 0,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
fn total(&self) -> usize {
|
||||||
|
self.total
|
||||||
|
}
|
||||||
|
fn last_step(&self) -> usize {
|
||||||
|
self.last_step
|
||||||
|
}
|
||||||
|
fn max(&self) -> usize {
|
||||||
|
self.max
|
||||||
|
}
|
||||||
|
fn is_full(&self) -> bool {
|
||||||
|
self.total >= self.max
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Wake up to `(node_cap / divisor).max(1)` dormant workers on every
|
||||||
|
/// node, capped by `n_total`. Called once at startup, unconditionally.
|
||||||
|
fn activate_initial(&mut self, divisor: usize, n_total: usize) {
|
||||||
|
self.grow(divisor, n_total);
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Same per-node sizing as [`activate_initial`](Self::activate_initial),
|
||||||
|
/// applied as a growth step. Returns the number of workers actually
|
||||||
|
/// activated (may be less than requested once a node or the total
|
||||||
|
/// budget is exhausted). Updates `last_step` when it actually grew.
|
||||||
|
fn grow(&mut self, divisor: usize, n_total: usize) -> usize {
|
||||||
|
let before = self.total;
|
||||||
|
for idx in 0..self.txs.len() {
|
||||||
|
let wanted = (self.caps[idx] / divisor).max(1);
|
||||||
|
let room = self.caps[idx].saturating_sub(self.active[idx]);
|
||||||
|
let grow = wanted.min(room).min(n_total.saturating_sub(self.total));
|
||||||
|
for _ in 0..grow {
|
||||||
|
self.txs[idx].send(()).ok();
|
||||||
|
}
|
||||||
|
self.active[idx] += grow;
|
||||||
|
self.total += grow;
|
||||||
|
}
|
||||||
|
let grew = self.total - before;
|
||||||
|
if grew > 0 {
|
||||||
|
self.last_step = grew;
|
||||||
|
}
|
||||||
|
grew
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
fn maybe_activate(
|
||||||
|
activation: &mut NodeActivation,
|
||||||
|
cpu_sample: &mut CpuSample,
|
||||||
|
io_sample: &mut IoSample,
|
||||||
|
completed: usize,
|
||||||
|
n_total: usize,
|
||||||
|
) {
|
||||||
|
if activation.is_full() || completed >= n_total {
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
|
||||||
|
// Expect roughly 1 core of extra efficiency per worker activated in the
|
||||||
|
// last growth step (CPU-bound case); require at least CPU_SPAWN_THRESHOLD
|
||||||
|
// (20 %) of that expected gain before growing again. Scaling by the last
|
||||||
|
// step's size — not the cumulative total — keeps the bar meaningful
|
||||||
|
// regardless of how many workers are already active: growing by 8 should
|
||||||
|
// always take ~+1.6 cores to confirm, whether that's the 2nd growth step
|
||||||
|
// or the 20th.
|
||||||
|
let cpu_threshold = CPU_SPAWN_THRESHOLD * activation.last_step() as f64;
|
||||||
|
|
||||||
|
// Call both unconditionally (no `||` short-circuit): each sampler must
|
||||||
|
// advance its own window every tick, regardless of what the other one
|
||||||
|
// reports, or it would starve behind whichever signal fires first.
|
||||||
|
let cpu_wants_more = cpu_sample.do_i_activate(cpu_threshold);
|
||||||
|
let io_wants_more = io_sample.do_i_activate(IO_SPAWN_THRESHOLD * activation.last_step() as f64);
|
||||||
|
if !(cpu_wants_more || io_wants_more) {
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
|
||||||
|
let grew = activation.grow(GROWTH_DIVISOR, n_total);
|
||||||
|
if grew > 0 {
|
||||||
|
debug!(
|
||||||
|
"activated {} worker(s) — {}/{} active",
|
||||||
|
grew,
|
||||||
|
activation.total(),
|
||||||
|
activation.max()
|
||||||
|
);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|||||||
@@ -3,7 +3,7 @@ use std::io;
|
|||||||
use std::path::Path;
|
use std::path::Path;
|
||||||
|
|
||||||
use obikpartitionner::{KmerPartition, OutputCol, PARTITIONS_SUBDIR};
|
use obikpartitionner::{KmerPartition, OutputCol, PARTITIONS_SUBDIR};
|
||||||
use obisys::{Stage, progress_bar};
|
use obisys::{Reporter, Stage, progress_bar};
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
use crate::error::{OKIError, OKIResult};
|
use crate::error::{OKIError, OKIResult};
|
||||||
@@ -25,6 +25,7 @@ impl KmerIndex {
|
|||||||
threshold: u32,
|
threshold: u32,
|
||||||
output_presence: bool,
|
output_presence: bool,
|
||||||
force: bool,
|
force: bool,
|
||||||
|
rep: &mut Reporter,
|
||||||
) -> OKIResult<Self> {
|
) -> OKIResult<Self> {
|
||||||
let output = output.as_ref();
|
let output = output.as_ref();
|
||||||
|
|
||||||
@@ -80,13 +81,14 @@ impl KmerIndex {
|
|||||||
).map_err(OKIError::Partition)?;
|
).map_err(OKIError::Partition)?;
|
||||||
|
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
|
rep.push(t.stop());
|
||||||
let _ = t.stop();
|
|
||||||
|
|
||||||
fs::File::create(output.join(SENTINEL_INDEXED))?;
|
fs::File::create(output.join(SENTINEL_INDEXED))?;
|
||||||
|
|
||||||
let idx = KmerIndex::open(output)?;
|
let idx = KmerIndex::open(output)?;
|
||||||
|
let t_pack = Stage::start("pack");
|
||||||
idx.pack_matrices()?;
|
idx.pack_matrices()?;
|
||||||
|
rep.push(t_pack.stop());
|
||||||
Ok(idx)
|
Ok(idx)
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -98,6 +100,7 @@ impl KmerIndex {
|
|||||||
specs: &[OutputCol],
|
specs: &[OutputCol],
|
||||||
threshold: u32,
|
threshold: u32,
|
||||||
output_presence: bool,
|
output_presence: bool,
|
||||||
|
rep: &mut Reporter,
|
||||||
) -> OKIResult<()> {
|
) -> OKIResult<()> {
|
||||||
if self.state() != IndexState::Indexed {
|
if self.state() != IndexState::Indexed {
|
||||||
return Err(OKIError::NotIndexed(self.root_path.clone()));
|
return Err(OKIError::NotIndexed(self.root_path.clone()));
|
||||||
@@ -106,7 +109,6 @@ impl KmerIndex {
|
|||||||
let n_src_genomes = self.meta.genomes.len();
|
let n_src_genomes = self.meta.genomes.len();
|
||||||
let n_partitions = self.partition.n_partitions();
|
let n_partitions = self.partition.n_partitions();
|
||||||
|
|
||||||
// Open a second handle to the same path so we can borrow src and dst simultaneously.
|
|
||||||
let src_partition = KmerPartition::open_with_config(
|
let src_partition = KmerPartition::open_with_config(
|
||||||
&self.root_path,
|
&self.root_path,
|
||||||
self.meta.config.kmer_size,
|
self.meta.config.kmer_size,
|
||||||
@@ -132,17 +134,17 @@ impl KmerIndex {
|
|||||||
).map_err(OKIError::Partition)?;
|
).map_err(OKIError::Partition)?;
|
||||||
|
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
|
rep.push(t.stop());
|
||||||
|
|
||||||
let _ = t.stop();
|
|
||||||
|
|
||||||
// Update index.meta with new genome list and with_counts flag.
|
|
||||||
self.meta.config.with_counts = !output_presence;
|
self.meta.config.with_counts = !output_presence;
|
||||||
self.meta.genomes = specs.iter()
|
self.meta.genomes = specs.iter()
|
||||||
.map(|s| GenomeInfo::new(s.label.clone()))
|
.map(|s| GenomeInfo::new(s.label.clone()))
|
||||||
.collect();
|
.collect();
|
||||||
self.meta.write(&self.root_path)?;
|
self.meta.write(&self.root_path)?;
|
||||||
|
|
||||||
|
let t_pack = Stage::start("pack");
|
||||||
self.pack_matrices()?;
|
self.pack_matrices()?;
|
||||||
|
rep.push(t_pack.stop());
|
||||||
Ok(())
|
Ok(())
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,6 +1,6 @@
|
|||||||
[package]
|
[package]
|
||||||
name = "obikmer"
|
name = "obikmer"
|
||||||
version = "0.1.0"
|
version = "1.1.34"
|
||||||
edition = "2024"
|
edition = "2024"
|
||||||
|
|
||||||
[[bin]]
|
[[bin]]
|
||||||
@@ -18,7 +18,8 @@ obikrope = { path = "../obikrope" }
|
|||||||
obikpartitionner = { path = "../obikpartitionner" }
|
obikpartitionner = { path = "../obikpartitionner" }
|
||||||
obisys = { path = "../obisys" }
|
obisys = { path = "../obisys" }
|
||||||
obiskio = { path = "../obiskio" }
|
obiskio = { path = "../obiskio" }
|
||||||
obikindex = { path = "../obikindex" }
|
obikindex = { path = "../obikindex", default-features = false }
|
||||||
|
obitaxonomy = { path = "../obitaxonomy" }
|
||||||
obilayeredmap = { path = "../obilayeredmap" }
|
obilayeredmap = { path = "../obilayeredmap" }
|
||||||
clap = { version = "4", features = ["derive"] }
|
clap = { version = "4", features = ["derive"] }
|
||||||
serde_json = "1"
|
serde_json = "1"
|
||||||
@@ -32,4 +33,6 @@ tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
|
|||||||
pprof = { version = "0.13", features = ["prost-codec"], optional = true }
|
pprof = { version = "0.13", features = ["prost-codec"], optional = true }
|
||||||
|
|
||||||
[features]
|
[features]
|
||||||
|
default = ["numa"]
|
||||||
|
numa = ["obikindex/numa"]
|
||||||
profiling = ["dep:pprof"]
|
profiling = ["dep:pprof"]
|
||||||
|
|||||||
@@ -3,6 +3,7 @@ use std::collections::HashMap;
|
|||||||
use clap::Args;
|
use clap::Args;
|
||||||
use obikindex::GenomeInfo;
|
use obikindex::GenomeInfo;
|
||||||
use obikpartitionner::{GroupQuorumFilter, KmerFilter};
|
use obikpartitionner::{GroupQuorumFilter, KmerFilter};
|
||||||
|
use obitaxonomy::{TaxPath, TaxPattern};
|
||||||
|
|
||||||
// ── Operator ──────────────────────────────────────────────────────────────────
|
// ── Operator ──────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -49,7 +50,6 @@ impl MetaPred {
|
|||||||
if values.iter().any(|v| v.is_empty()) {
|
if values.iter().any(|v| v.is_empty()) {
|
||||||
return Err(format!("empty value in predicate: {s}"));
|
return Err(format!("empty value in predicate: {s}"));
|
||||||
}
|
}
|
||||||
|
|
||||||
Ok(Self { key, op, values })
|
Ok(Self { key, op, values })
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -70,18 +70,15 @@ impl MetaPred {
|
|||||||
|
|
||||||
// ── Path matching ─────────────────────────────────────────────────────────────
|
// ── Path matching ─────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
/// True if `value` is equal to `pattern` or is a descendant of it in a `/`-separated hierarchy.
|
/// True if the stored taxonomy `value` matches `pattern`.
|
||||||
///
|
///
|
||||||
/// - Absolute pattern (`/a/b`): `value` must start with `/a/b` at a segment boundary.
|
/// `value` must be a valid `TaxPath` (starts with `taxonomy:/`).
|
||||||
/// - Bare segment (`b`): `value` must contain `b` as an exact segment anywhere.
|
/// `pattern` is a `TaxPattern` query (see `obitaxonomy::TaxPattern` for syntax).
|
||||||
|
/// Returns `false` if either fails to parse.
|
||||||
fn path_matches(value: &str, pattern: &str) -> bool {
|
fn path_matches(value: &str, pattern: &str) -> bool {
|
||||||
if pattern.starts_with('/') {
|
let Ok(path) = TaxPath::parse(value) else { return false };
|
||||||
value == pattern
|
let Ok(pat) = TaxPattern::parse(pattern) else { return false };
|
||||||
|| (value.starts_with(pattern)
|
pat.matches(&path)
|
||||||
&& value[pattern.len()..].starts_with('/'))
|
|
||||||
} else {
|
|
||||||
value.split('/').any(|seg| seg == pattern)
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Three-value group evaluation ──────────────────────────────────────────────
|
// ── Three-value group evaluation ──────────────────────────────────────────────
|
||||||
|
|||||||
@@ -4,6 +4,7 @@ use std::path::PathBuf;
|
|||||||
use clap::{Args, ValueEnum};
|
use clap::{Args, ValueEnum};
|
||||||
use obikindex::{GenomeInfo, KmerIndex};
|
use obikindex::{GenomeInfo, KmerIndex};
|
||||||
use obikpartitionner::{AggOp, OutputCol};
|
use obikpartitionner::{AggOp, OutputCol};
|
||||||
|
use obisys::Reporter;
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
use super::predicate::matching_genome_indices;
|
use super::predicate::matching_genome_indices;
|
||||||
@@ -229,20 +230,24 @@ pub fn run(args: SelectArgs) {
|
|||||||
if output_presence { "presence" } else { "count" },
|
if output_presence { "presence" } else { "count" },
|
||||||
);
|
);
|
||||||
|
|
||||||
|
let mut rep = Reporter::new();
|
||||||
|
|
||||||
if args.in_place {
|
if args.in_place {
|
||||||
src.select_in_place(&specs, args.presence_threshold, output_presence)
|
src.select_in_place(&specs, args.presence_threshold, output_presence, &mut rep)
|
||||||
.unwrap_or_else(|e| {
|
.unwrap_or_else(|e| {
|
||||||
eprintln!("select error: {e}");
|
eprintln!("select error: {e}");
|
||||||
std::process::exit(1);
|
std::process::exit(1);
|
||||||
});
|
});
|
||||||
|
rep.print();
|
||||||
info!("selected in-place → {}", args.source.display());
|
info!("selected in-place → {}", args.source.display());
|
||||||
} else {
|
} else {
|
||||||
let output = args.output.unwrap();
|
let output = args.output.unwrap();
|
||||||
KmerIndex::select(&output, &src, &specs, args.presence_threshold, output_presence, args.force)
|
KmerIndex::select(&output, &src, &specs, args.presence_threshold, output_presence, args.force, &mut rep)
|
||||||
.unwrap_or_else(|e| {
|
.unwrap_or_else(|e| {
|
||||||
eprintln!("select error: {e}");
|
eprintln!("select error: {e}");
|
||||||
std::process::exit(1);
|
std::process::exit(1);
|
||||||
});
|
});
|
||||||
|
rep.print();
|
||||||
info!("selected index → {}", output.display());
|
info!("selected index → {}", output.display());
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -6,7 +6,7 @@ use clap::{Parser, Subcommand};
|
|||||||
use tracing_subscriber::{EnvFilter, fmt};
|
use tracing_subscriber::{EnvFilter, fmt};
|
||||||
|
|
||||||
#[derive(Parser)]
|
#[derive(Parser)]
|
||||||
#[command(name = "obikmer", about = "DNA k-mer tools")]
|
#[command(name = "obikmer", about = "DNA k-mer tools", version)]
|
||||||
struct Cli {
|
struct Cli {
|
||||||
#[command(subcommand)]
|
#[command(subcommand)]
|
||||||
command: Commands,
|
command: Commands,
|
||||||
|
|||||||
@@ -3,7 +3,6 @@ use std::io;
|
|||||||
use std::path::{Path, PathBuf};
|
use std::path::{Path, PathBuf};
|
||||||
|
|
||||||
use obicompactvec::{PersistentBitVecBuilder, PersistentCompactIntVecBuilder};
|
use obicompactvec::{PersistentBitVecBuilder, PersistentCompactIntVecBuilder};
|
||||||
use obicompactvec::traits::BitSliceMut;
|
|
||||||
use obilayeredmap::meta::PartitionMeta;
|
use obilayeredmap::meta::PartitionMeta;
|
||||||
use obilayeredmap::{IndexMode, OLMError};
|
use obilayeredmap::{IndexMode, OLMError};
|
||||||
use obiskio::{SKError, SKResult};
|
use obiskio::{SKError, SKResult};
|
||||||
|
|||||||
@@ -1,9 +1,24 @@
|
|||||||
|
use obicompactvec::FilterMask;
|
||||||
|
|
||||||
/// Trait for kmer row filters.
|
/// Trait for kmer row filters.
|
||||||
///
|
///
|
||||||
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
|
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
|
||||||
/// `n_genomes` equals `row.len()`.
|
/// `n_genomes` equals `row.len()`.
|
||||||
pub trait KmerFilter: Send + Sync {
|
pub trait KmerFilter: Send + Sync {
|
||||||
fn passes(&self, row: &[u32], n_genomes: usize) -> bool;
|
fn passes(&self, row: &[u32], n_genomes: usize) -> bool;
|
||||||
|
|
||||||
|
/// Express this filter as a [`FilterMask`] column-operation expression.
|
||||||
|
///
|
||||||
|
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix
|
||||||
|
/// column aggregates (no per-kmer row scan needed). Returns `None` if the
|
||||||
|
/// filter requires row-level inspection.
|
||||||
|
///
|
||||||
|
/// `threshold` semantics in the returned mask use `>= threshold`, matching
|
||||||
|
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
|
||||||
|
/// row-level threshold that uses strict `>` comparison.
|
||||||
|
fn column_mask_expr(&self, _n_genomes: usize) -> Option<FilterMask> {
|
||||||
|
None
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// True when `row` passes every filter in `filters`.
|
/// True when `row` passes every filter in `filters`.
|
||||||
@@ -29,6 +44,16 @@ impl KmerFilter for MinGenomeFraction {
|
|||||||
let p = present_count(row, self.threshold);
|
let p = present_count(row, self.threshold);
|
||||||
p as f64 / n_genomes as f64 >= self.frac
|
p as f64 / n_genomes as f64 >= self.frac
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn column_mask_expr(&self, n_genomes: usize) -> Option<FilterMask> {
|
||||||
|
let t = self.threshold.checked_add(1)?;
|
||||||
|
let min_count = (self.frac * n_genomes as f64).ceil() as usize;
|
||||||
|
Some(FilterMask::PresenceGeq {
|
||||||
|
indices: (0..n_genomes).collect(),
|
||||||
|
threshold: t,
|
||||||
|
min_count,
|
||||||
|
})
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// At most `frac` fraction of genomes contain this kmer (count > `threshold`).
|
/// At most `frac` fraction of genomes contain this kmer (count > `threshold`).
|
||||||
@@ -42,6 +67,16 @@ impl KmerFilter for MaxGenomeFraction {
|
|||||||
let p = present_count(row, self.threshold);
|
let p = present_count(row, self.threshold);
|
||||||
p as f64 / n_genomes as f64 <= self.frac
|
p as f64 / n_genomes as f64 <= self.frac
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn column_mask_expr(&self, n_genomes: usize) -> Option<FilterMask> {
|
||||||
|
let t = self.threshold.checked_add(1)?;
|
||||||
|
let max_count = (self.frac * n_genomes as f64).floor() as usize;
|
||||||
|
Some(FilterMask::PresenceLeq {
|
||||||
|
indices: (0..n_genomes).collect(),
|
||||||
|
threshold: t,
|
||||||
|
max_count,
|
||||||
|
})
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// At least `count` genomes contain this kmer (count > `threshold`).
|
/// At least `count` genomes contain this kmer (count > `threshold`).
|
||||||
@@ -54,6 +89,15 @@ impl KmerFilter for MinGenomeCount {
|
|||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
present_count(row, self.threshold) >= self.count
|
present_count(row, self.threshold) >= self.count
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn column_mask_expr(&self, n_genomes: usize) -> Option<FilterMask> {
|
||||||
|
let t = self.threshold.checked_add(1)?;
|
||||||
|
Some(FilterMask::PresenceGeq {
|
||||||
|
indices: (0..n_genomes).collect(),
|
||||||
|
threshold: t,
|
||||||
|
min_count: self.count,
|
||||||
|
})
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// At most `count` genomes contain this kmer (count > `threshold`).
|
/// At most `count` genomes contain this kmer (count > `threshold`).
|
||||||
@@ -66,6 +110,15 @@ impl KmerFilter for MaxGenomeCount {
|
|||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
present_count(row, self.threshold) <= self.count
|
present_count(row, self.threshold) <= self.count
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn column_mask_expr(&self, n_genomes: usize) -> Option<FilterMask> {
|
||||||
|
let t = self.threshold.checked_add(1)?;
|
||||||
|
Some(FilterMask::PresenceLeq {
|
||||||
|
indices: (0..n_genomes).collect(),
|
||||||
|
threshold: t,
|
||||||
|
max_count: self.count,
|
||||||
|
})
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Total-count filters (count indexes only) ───────────────────────────────────
|
// ── Total-count filters (count indexes only) ───────────────────────────────────
|
||||||
@@ -79,6 +132,13 @@ impl KmerFilter for MinTotalCount {
|
|||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
row.iter().sum::<u32>() >= self.total
|
row.iter().sum::<u32>() >= self.total
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn column_mask_expr(&self, n_genomes: usize) -> Option<FilterMask> {
|
||||||
|
Some(FilterMask::SumGeq {
|
||||||
|
indices: (0..n_genomes).collect(),
|
||||||
|
min_sum: self.total,
|
||||||
|
})
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Sum of counts across all genomes <= `total`.
|
/// Sum of counts across all genomes <= `total`.
|
||||||
@@ -90,6 +150,13 @@ impl KmerFilter for MaxTotalCount {
|
|||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
row.iter().sum::<u32>() <= self.total
|
row.iter().sum::<u32>() <= self.total
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn column_mask_expr(&self, n_genomes: usize) -> Option<FilterMask> {
|
||||||
|
Some(FilterMask::SumLeq {
|
||||||
|
indices: (0..n_genomes).collect(),
|
||||||
|
max_sum: self.total,
|
||||||
|
})
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Group-based quorum filter ─────────────────────────────────────────────────
|
// ── Group-based quorum filter ─────────────────────────────────────────────────
|
||||||
@@ -113,6 +180,37 @@ pub struct GroupQuorumFilter {
|
|||||||
pub max_outgroup_frac: f64,
|
pub max_outgroup_frac: f64,
|
||||||
}
|
}
|
||||||
|
|
||||||
|
impl GroupQuorumFilter {
|
||||||
|
// Build PresenceGeq/PresenceLeq constraints for one group (ingroup or outgroup).
|
||||||
|
fn group_mask_parts(
|
||||||
|
indices: &[usize],
|
||||||
|
threshold: u32,
|
||||||
|
min_count: usize,
|
||||||
|
max_count: usize,
|
||||||
|
min_frac: f64,
|
||||||
|
max_frac: f64,
|
||||||
|
parts: &mut Vec<FilterMask>,
|
||||||
|
) {
|
||||||
|
let n = indices.len();
|
||||||
|
let geq = min_count.max((min_frac * n as f64).ceil() as usize);
|
||||||
|
if geq > 0 {
|
||||||
|
parts.push(FilterMask::PresenceGeq {
|
||||||
|
indices: indices.to_vec(),
|
||||||
|
threshold,
|
||||||
|
min_count: geq,
|
||||||
|
});
|
||||||
|
}
|
||||||
|
let leq = max_count.min((max_frac * n as f64).floor() as usize);
|
||||||
|
if leq < n {
|
||||||
|
parts.push(FilterMask::PresenceLeq {
|
||||||
|
indices: indices.to_vec(),
|
||||||
|
threshold,
|
||||||
|
max_count: leq,
|
||||||
|
});
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
impl KmerFilter for GroupQuorumFilter {
|
impl KmerFilter for GroupQuorumFilter {
|
||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
if !self.ingroup_idx.is_empty() {
|
if !self.ingroup_idx.is_empty() {
|
||||||
@@ -139,4 +237,26 @@ impl KmerFilter for GroupQuorumFilter {
|
|||||||
}
|
}
|
||||||
true
|
true
|
||||||
}
|
}
|
||||||
|
|
||||||
|
fn column_mask_expr(&self, _n_genomes: usize) -> Option<FilterMask> {
|
||||||
|
let t = self.threshold.checked_add(1)?;
|
||||||
|
let mut parts: Vec<FilterMask> = Vec::new();
|
||||||
|
if !self.ingroup_idx.is_empty() {
|
||||||
|
Self::group_mask_parts(
|
||||||
|
&self.ingroup_idx, t,
|
||||||
|
self.min_count, self.max_count,
|
||||||
|
self.min_frac, self.max_frac,
|
||||||
|
&mut parts,
|
||||||
|
);
|
||||||
|
}
|
||||||
|
if !self.outgroup_idx.is_empty() {
|
||||||
|
Self::group_mask_parts(
|
||||||
|
&self.outgroup_idx, t,
|
||||||
|
self.min_outgroup_count, self.max_outgroup_count,
|
||||||
|
self.min_outgroup_frac, self.max_outgroup_frac,
|
||||||
|
&mut parts,
|
||||||
|
);
|
||||||
|
}
|
||||||
|
Some(FilterMask::And(parts))
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -10,6 +10,7 @@ use obipipeline::{
|
|||||||
};
|
};
|
||||||
|
|
||||||
use obicompactvec::{
|
use obicompactvec::{
|
||||||
|
MatrixGroupOps,
|
||||||
PersistentBitMatrix, PersistentBitMatrixBuilder, PersistentBitVecBuilder,
|
PersistentBitMatrix, PersistentBitMatrixBuilder, PersistentBitVecBuilder,
|
||||||
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, PersistentCompactIntVecBuilder,
|
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, PersistentCompactIntVecBuilder,
|
||||||
};
|
};
|
||||||
@@ -78,6 +79,41 @@ impl SrcLayerData {
|
|||||||
}
|
}
|
||||||
buf
|
buf
|
||||||
}
|
}
|
||||||
|
|
||||||
|
pub(crate) fn n_slots(&self) -> usize {
|
||||||
|
match self {
|
||||||
|
SrcLayerData::Presence(_, mat) => mat.n(),
|
||||||
|
SrcLayerData::Count(_, mat) => mat.n(),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// MPHF lookup: returns the slot index for `kmer` (kmer must be in the domain).
|
||||||
|
#[inline]
|
||||||
|
pub(crate) fn slot(&self, kmer: CanonicalKmer) -> usize {
|
||||||
|
match self {
|
||||||
|
SrcLayerData::Presence(mphf, _) => mphf.index(kmer),
|
||||||
|
SrcLayerData::Count(mphf, _) => mphf.index(kmer),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Row lookup by slot index, bypassing the MPHF.
|
||||||
|
#[inline]
|
||||||
|
pub(crate) fn fill_row_by_slot(&self, slot: usize, n_genomes: usize) -> Vec<u32> {
|
||||||
|
let mut buf = vec![0u32; n_genomes];
|
||||||
|
match self {
|
||||||
|
SrcLayerData::Presence(_, mat) => mat.fill_row(slot, &mut buf),
|
||||||
|
SrcLayerData::Count(_, mat) => mat.fill_row(slot, &mut buf),
|
||||||
|
}
|
||||||
|
buf
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Call `f` with a reference to the underlying matrix as `&dyn MatrixGroupOps`.
|
||||||
|
pub(crate) fn with_matrix<R>(&self, f: impl FnOnce(&dyn MatrixGroupOps) -> R) -> R {
|
||||||
|
match self {
|
||||||
|
SrcLayerData::Presence(_, mat) => f(mat),
|
||||||
|
SrcLayerData::Count(_, mat) => f(mat),
|
||||||
|
}
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||||
|
|||||||
@@ -1,8 +1,9 @@
|
|||||||
use std::path::Path;
|
use std::path::Path;
|
||||||
|
|
||||||
use obicompactvec::{
|
use obicompactvec::{
|
||||||
PersistentBitMatrixBuilder, PersistentBitVecBuilder, PersistentCompactIntMatrixBuilder,
|
FilterMask, eval_filter_mask,
|
||||||
PersistentCompactIntVecBuilder,
|
PersistentBitMatrixBuilder, PersistentBitVecBuilder,
|
||||||
|
PersistentCompactIntMatrixBuilder, PersistentCompactIntVecBuilder,
|
||||||
};
|
};
|
||||||
use obidebruinj::GraphDeBruijn;
|
use obidebruinj::GraphDeBruijn;
|
||||||
use obikseq::CanonicalKmer;
|
use obikseq::CanonicalKmer;
|
||||||
@@ -10,18 +11,135 @@ use obilayeredmap::meta::PartitionMeta;
|
|||||||
use obilayeredmap::{IndexMode, MphfLayer};
|
use obilayeredmap::{IndexMode, MphfLayer};
|
||||||
use obiskio::{SKError, SKResult, UnitigFileReader};
|
use obiskio::{SKError, SKResult, UnitigFileReader};
|
||||||
|
|
||||||
use crate::common::{ColBuilder, col_path_bit, col_path_int, load_meta, olm_to_sk, write_matrix_meta};
|
use crate::common::{load_meta, olm_to_sk};
|
||||||
use crate::filter::{KmerFilter, passes_all};
|
use crate::filter::KmerFilter;
|
||||||
use crate::graph_pipeline::materialize_layer;
|
use crate::graph_pipeline::materialize_layer;
|
||||||
use crate::merge_layer::{MergeMode, SrcLayerData};
|
use crate::merge_layer::{MergeMode, SrcLayerData};
|
||||||
use crate::partition::KmerPartition;
|
use crate::partition::KmerPartition;
|
||||||
|
|
||||||
const INDEX_SUBDIR: &str = "index";
|
const INDEX_SUBDIR: &str = "index";
|
||||||
|
|
||||||
/// Iterate all kmers in `src_index_dir` that pass `filters`, yielding `(kmer, row)`.
|
// ── Builders — pair matrix builder + column builders for one mode ─────────────
|
||||||
|
|
||||||
|
enum Builders {
|
||||||
|
Presence(PersistentBitMatrixBuilder, Vec<PersistentBitVecBuilder>),
|
||||||
|
Count(PersistentCompactIntMatrixBuilder, Vec<PersistentCompactIntVecBuilder>),
|
||||||
|
}
|
||||||
|
|
||||||
|
impl Builders {
|
||||||
|
fn new(mode: MergeMode, n: usize, dir: &Path, n_genomes: usize) -> SKResult<Self> {
|
||||||
|
match mode {
|
||||||
|
MergeMode::Presence => {
|
||||||
|
let mut mat = PersistentBitMatrixBuilder::new(n, dir).map_err(SKError::Io)?;
|
||||||
|
let mut cols = Vec::with_capacity(n_genomes);
|
||||||
|
for _ in 0..n_genomes { cols.push(mat.add_col().map_err(SKError::Io)?); }
|
||||||
|
Ok(Builders::Presence(mat, cols))
|
||||||
|
}
|
||||||
|
MergeMode::Count => {
|
||||||
|
let mut mat = PersistentCompactIntMatrixBuilder::new(n, dir).map_err(SKError::Io)?;
|
||||||
|
let mut cols = Vec::with_capacity(n_genomes);
|
||||||
|
for _ in 0..n_genomes { cols.push(mat.add_col().map_err(SKError::Io)?); }
|
||||||
|
Ok(Builders::Count(mat, cols))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
fn set_val(&mut self, col: usize, slot: usize, value: u32) {
|
||||||
|
match self {
|
||||||
|
Builders::Presence(_, cols) => cols[col].set(slot, value > 0),
|
||||||
|
Builders::Count(_, cols) => cols[col].set(slot, value),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
fn close(self) -> SKResult<()> {
|
||||||
|
match self {
|
||||||
|
Builders::Presence(mat, cols) => {
|
||||||
|
for b in cols { b.close().map_err(SKError::Io)?; }
|
||||||
|
mat.close().map_err(SKError::Io)
|
||||||
|
}
|
||||||
|
Builders::Count(mat, cols) => {
|
||||||
|
for b in cols { b.close().map_err(SKError::Io)?; }
|
||||||
|
mat.close().map_err(SKError::Io)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── try_compute_combined_mask ─────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Build a per-slot `TempBitVec` mask from `filters` using column operations
|
||||||
|
/// on the source matrix — no per-kmer MPHF lookup or row read needed.
|
||||||
///
|
///
|
||||||
/// Uses [`SrcLayerData`] semantics: counts take priority over presence when
|
/// Returns `Some(mask)` when every filter in `filters` can express itself as
|
||||||
/// `mode = Count`; presence (or implicit all-ones) is used for `Presence`.
|
/// a [`FilterMask`] expression. Returns `None` when any filter requires
|
||||||
|
/// row-level inspection (fall back to `passes_all`).
|
||||||
|
fn try_compute_combined_mask(
|
||||||
|
filters: &[Box<dyn KmerFilter>],
|
||||||
|
src_data: &SrcLayerData,
|
||||||
|
n_genomes: usize,
|
||||||
|
) -> SKResult<Option<obicompactvec::TempBitVec>> {
|
||||||
|
if filters.is_empty() {
|
||||||
|
return Ok(None);
|
||||||
|
}
|
||||||
|
let mut exprs: Vec<FilterMask> = Vec::with_capacity(filters.len());
|
||||||
|
for f in filters {
|
||||||
|
match f.column_mask_expr(n_genomes) {
|
||||||
|
Some(expr) => exprs.push(expr),
|
||||||
|
None => return Ok(None),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
let combined = FilterMask::And(exprs);
|
||||||
|
let n = src_data.n_slots();
|
||||||
|
let mask = src_data
|
||||||
|
.with_matrix(|mat| eval_filter_mask(&combined, mat, n))
|
||||||
|
.map_err(SKError::Io)?;
|
||||||
|
Ok(Some(mask))
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── iter_src_kmers_masked (pass 1) ────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Iterate all passing kmers in `src_index_dir`, yielding only the kmer value.
|
||||||
|
///
|
||||||
|
/// When all filters can be expressed as column operations, a per-slot mask is
|
||||||
|
/// computed once per layer and used for O(1) slot-check per kmer instead of a
|
||||||
|
/// full row read. Falls back to row-level `passes_all` otherwise.
|
||||||
|
fn iter_src_kmers_masked(
|
||||||
|
src_index_dir: &Path,
|
||||||
|
mode: MergeMode,
|
||||||
|
n_genomes: usize,
|
||||||
|
filters: &[Box<dyn KmerFilter>],
|
||||||
|
mut cb: impl FnMut(CanonicalKmer),
|
||||||
|
) -> SKResult<()> {
|
||||||
|
let src_meta = load_meta(src_index_dir, "rebuild")?;
|
||||||
|
for l in 0..src_meta.n_layers {
|
||||||
|
let src_layer_dir = src_index_dir.join(format!("layer_{l}"));
|
||||||
|
let unitigs_path = src_layer_dir.join("unitigs.bin");
|
||||||
|
if !unitigs_path.exists() { continue; }
|
||||||
|
|
||||||
|
let src_data = SrcLayerData::open(&src_layer_dir, mode)?;
|
||||||
|
let mask = try_compute_combined_mask(filters, &src_data, n_genomes)?;
|
||||||
|
let reader = UnitigFileReader::open_sequential(&unitigs_path)?;
|
||||||
|
|
||||||
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
|
let slot = src_data.slot(kmer);
|
||||||
|
let passes = match &mask {
|
||||||
|
Some(m) => m.get(slot),
|
||||||
|
None => {
|
||||||
|
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
||||||
|
filters.iter().all(|f| f.passes(&row, n_genomes))
|
||||||
|
}
|
||||||
|
};
|
||||||
|
if passes { cb(kmer); }
|
||||||
|
}
|
||||||
|
}
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── iter_src_layers (pass 2) ──────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Iterate all passing kmers in `src_index_dir`, yielding `(kmer, row)`.
|
||||||
|
///
|
||||||
|
/// When the slot mask is available, skips the row read for filtered-out slots.
|
||||||
fn iter_src_layers(
|
fn iter_src_layers(
|
||||||
src_index_dir: &Path,
|
src_index_dir: &Path,
|
||||||
mode: MergeMode,
|
mode: MergeMode,
|
||||||
@@ -33,17 +151,23 @@ fn iter_src_layers(
|
|||||||
for l in 0..src_meta.n_layers {
|
for l in 0..src_meta.n_layers {
|
||||||
let src_layer_dir = src_index_dir.join(format!("layer_{l}"));
|
let src_layer_dir = src_index_dir.join(format!("layer_{l}"));
|
||||||
let unitigs_path = src_layer_dir.join("unitigs.bin");
|
let unitigs_path = src_layer_dir.join("unitigs.bin");
|
||||||
if !unitigs_path.exists() {
|
if !unitigs_path.exists() { continue; }
|
||||||
continue;
|
|
||||||
}
|
|
||||||
|
|
||||||
let reader = UnitigFileReader::open_sequential(&unitigs_path)?;
|
|
||||||
let src_data = SrcLayerData::open(&src_layer_dir, mode)?;
|
let src_data = SrcLayerData::open(&src_layer_dir, mode)?;
|
||||||
|
let mask = try_compute_combined_mask(filters, &src_data, n_genomes)?;
|
||||||
|
let reader = UnitigFileReader::open_sequential(&unitigs_path)?;
|
||||||
|
|
||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
let row = src_data.lookup(kmer, n_genomes);
|
let slot = src_data.slot(kmer);
|
||||||
if passes_all(filters, &row, n_genomes) {
|
if let Some(ref m) = mask {
|
||||||
|
if !m.get(slot) { continue; }
|
||||||
|
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
||||||
cb(kmer, row.into_boxed_slice());
|
cb(kmer, row.into_boxed_slice());
|
||||||
|
} else {
|
||||||
|
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
||||||
|
if filters.iter().all(|f| f.passes(&row, n_genomes)) {
|
||||||
|
cb(kmer, row.into_boxed_slice());
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -81,7 +205,7 @@ impl KmerPartition {
|
|||||||
|
|
||||||
// ── Pass 1: collect filtered kmers into de Bruijn graph ───────────────
|
// ── Pass 1: collect filtered kmers into de Bruijn graph ───────────────
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
iter_src_layers(&src_index_dir, mode, n_genomes, filters, |kmer, _row| {
|
iter_src_kmers_masked(&src_index_dir, mode, n_genomes, filters, |kmer| {
|
||||||
g.push(kmer);
|
g.push(kmer);
|
||||||
})?;
|
})?;
|
||||||
|
|
||||||
@@ -103,51 +227,19 @@ impl KmerPartition {
|
|||||||
MergeMode::Count => dst_layer_dir.join("counts"),
|
MergeMode::Count => dst_layer_dir.join("counts"),
|
||||||
};
|
};
|
||||||
std::fs::create_dir_all(&data_dir)?;
|
std::fs::create_dir_all(&data_dir)?;
|
||||||
|
let mut builders = Builders::new(mode, n_new, &data_dir, n_genomes)?;
|
||||||
let mut builders: Vec<ColBuilder> = match mode {
|
|
||||||
MergeMode::Presence => {
|
|
||||||
PersistentBitMatrixBuilder::new(n_new, &data_dir)
|
|
||||||
.map_err(SKError::Io)?
|
|
||||||
.close()
|
|
||||||
.map_err(SKError::Io)?;
|
|
||||||
(0..n_genomes)
|
|
||||||
.map(|g| -> SKResult<ColBuilder> {
|
|
||||||
let b = PersistentBitVecBuilder::new(n_new, &col_path_bit(&data_dir, g))?;
|
|
||||||
Ok(ColBuilder::Bit(b))
|
|
||||||
})
|
|
||||||
.collect::<SKResult<_>>()?
|
|
||||||
}
|
|
||||||
MergeMode::Count => {
|
|
||||||
PersistentCompactIntMatrixBuilder::new(n_new, &data_dir)
|
|
||||||
.map_err(SKError::Io)?
|
|
||||||
.close()
|
|
||||||
.map_err(SKError::Io)?;
|
|
||||||
(0..n_genomes)
|
|
||||||
.map(|g| -> SKResult<ColBuilder> {
|
|
||||||
let b = PersistentCompactIntVecBuilder::new(
|
|
||||||
n_new,
|
|
||||||
&col_path_int(&data_dir, g),
|
|
||||||
)?;
|
|
||||||
Ok(ColBuilder::Int(b))
|
|
||||||
})
|
|
||||||
.collect::<SKResult<_>>()?
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
// ── Pass 2: fill builders ─────────────────────────────────────────────
|
// ── Pass 2: fill builders ─────────────────────────────────────────────
|
||||||
iter_src_layers(&src_index_dir, mode, n_genomes, filters, |kmer, row| {
|
iter_src_layers(&src_index_dir, mode, n_genomes, filters, |kmer, row| {
|
||||||
if let Some(slot) = dst_mphf.find(kmer) {
|
if let Some(slot) = dst_mphf.find(kmer) {
|
||||||
for (col, &value) in row.iter().enumerate() {
|
for (col, &value) in row.iter().enumerate() {
|
||||||
builders[col].set_val(slot, value);
|
builders.set_val(col, slot, value);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
})?;
|
})?;
|
||||||
|
|
||||||
// ── Close builders, write metadata ────────────────────────────────────
|
// ── Close builders and write metadata ─────────────────────────────────
|
||||||
for b in builders {
|
builders.close()?;
|
||||||
b.close()?;
|
|
||||||
}
|
|
||||||
write_matrix_meta(&data_dir, n_new, n_genomes).map_err(SKError::Io)?;
|
|
||||||
|
|
||||||
PartitionMeta {
|
PartitionMeta {
|
||||||
n_layers: 1,
|
n_layers: 1,
|
||||||
|
|||||||
@@ -3,10 +3,10 @@ use std::io;
|
|||||||
use std::path::{Path, PathBuf};
|
use std::path::{Path, PathBuf};
|
||||||
|
|
||||||
use obicompactvec::{
|
use obicompactvec::{
|
||||||
PersistentBitMatrix, PersistentBitMatrixBuilder, PersistentBitVecBuilder,
|
ColGroup, MatrixGroupOps,
|
||||||
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, PersistentCompactIntVecBuilder,
|
PersistentBitMatrix, PersistentBitMatrixBuilder,
|
||||||
|
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
||||||
};
|
};
|
||||||
use obicompactvec::traits::BitSliceMut;
|
|
||||||
use obilayeredmap::meta::PartitionMeta;
|
use obilayeredmap::meta::PartitionMeta;
|
||||||
use obilayeredmap::OLMError;
|
use obilayeredmap::OLMError;
|
||||||
use obiskio::{SKError, SKResult};
|
use obiskio::{SKError, SKResult};
|
||||||
@@ -41,52 +41,6 @@ pub struct OutputCol {
|
|||||||
pub op: AggOp,
|
pub op: AggOp,
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Aggregation ───────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
#[inline]
|
|
||||||
fn aggregate(op: AggOp, indices: &[usize], src_row: &[u32], threshold: u32) -> u32 {
|
|
||||||
match op {
|
|
||||||
AggOp::Any => {
|
|
||||||
if indices.iter().any(|&i| src_row[i] > threshold) { 1 } else { 0 }
|
|
||||||
}
|
|
||||||
AggOp::All => {
|
|
||||||
if indices.is_empty() { return 0; }
|
|
||||||
if indices.iter().all(|&i| src_row[i] > threshold) { 1 } else { 0 }
|
|
||||||
}
|
|
||||||
AggOp::None => {
|
|
||||||
if indices.iter().all(|&i| src_row[i] <= threshold) { 1 } else { 0 }
|
|
||||||
}
|
|
||||||
AggOp::Sum => {
|
|
||||||
indices.iter().map(|&i| src_row[i]).fold(0u32, |a, b| a.saturating_add(b))
|
|
||||||
}
|
|
||||||
AggOp::Min => indices.iter().map(|&i| src_row[i]).min().unwrap_or(0),
|
|
||||||
AggOp::Max => indices.iter().map(|&i| src_row[i]).max().unwrap_or(0),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── ColBuilder ────────────────────────────────────────────────────────────────
|
|
||||||
|
|
||||||
enum ColBuilder {
|
|
||||||
Bit(PersistentBitVecBuilder),
|
|
||||||
Int(PersistentCompactIntVecBuilder),
|
|
||||||
}
|
|
||||||
|
|
||||||
impl ColBuilder {
|
|
||||||
fn set_val(&mut self, slot: usize, value: u32) {
|
|
||||||
match self {
|
|
||||||
ColBuilder::Bit(b) => b.set(slot, value > 0),
|
|
||||||
ColBuilder::Int(b) => b.set(slot, value),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
fn close(self) -> SKResult<()> {
|
|
||||||
match self {
|
|
||||||
ColBuilder::Bit(b) => b.close().map_err(SKError::Io),
|
|
||||||
ColBuilder::Int(b) => b.close().map_err(SKError::Io),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ── Helpers ───────────────────────────────────────────────────────────────────
|
// ── Helpers ───────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
fn olm_to_sk(e: OLMError) -> SKError {
|
fn olm_to_sk(e: OLMError) -> SKError {
|
||||||
@@ -96,21 +50,6 @@ fn olm_to_sk(e: OLMError) -> SKError {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
fn col_path_bit(dir: &Path, col: usize) -> PathBuf {
|
|
||||||
dir.join(format!("col_{col:06}.pbiv"))
|
|
||||||
}
|
|
||||||
|
|
||||||
fn col_path_int(dir: &Path, col: usize) -> PathBuf {
|
|
||||||
dir.join(format!("col_{col:06}.pciv"))
|
|
||||||
}
|
|
||||||
|
|
||||||
fn write_matrix_meta(dir: &Path, n: usize, n_cols: usize) -> io::Result<()> {
|
|
||||||
fs::write(
|
|
||||||
dir.join("meta.json"),
|
|
||||||
format!("{{\"n\":{n},\"n_cols\":{n_cols}}}\n"),
|
|
||||||
)
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Copy all plain files (not subdirectories) from `src_dir` to `dst_dir`.
|
/// Copy all plain files (not subdirectories) from `src_dir` to `dst_dir`.
|
||||||
fn copy_layer_files(src_dir: &Path, dst_dir: &Path) -> io::Result<()> {
|
fn copy_layer_files(src_dir: &Path, dst_dir: &Path) -> io::Result<()> {
|
||||||
for entry in fs::read_dir(src_dir)? {
|
for entry in fs::read_dir(src_dir)? {
|
||||||
@@ -126,30 +65,64 @@ fn copy_layer_files(src_dir: &Path, dst_dir: &Path) -> io::Result<()> {
|
|||||||
// ── fill_builders ─────────────────────────────────────────────────────────────
|
// ── fill_builders ─────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
fn fill_builders(
|
fn fill_builders(
|
||||||
builders: &mut [ColBuilder],
|
|
||||||
specs: &[OutputCol],
|
specs: &[OutputCol],
|
||||||
n: usize,
|
|
||||||
n_src: usize,
|
|
||||||
src_layer_dir: &Path,
|
src_layer_dir: &Path,
|
||||||
src_is_count: bool,
|
src_is_count: bool,
|
||||||
threshold: u32,
|
threshold: u32,
|
||||||
|
output_presence: bool,
|
||||||
|
mut dst_bit: Option<&mut PersistentBitMatrixBuilder>,
|
||||||
|
mut dst_int: Option<&mut PersistentCompactIntMatrixBuilder>,
|
||||||
) -> SKResult<()> {
|
) -> SKResult<()> {
|
||||||
let mut src_buf = vec![0u32; n_src];
|
|
||||||
|
|
||||||
if src_is_count {
|
if src_is_count {
|
||||||
let mat = PersistentCompactIntMatrix::open(src_layer_dir).map_err(SKError::Io)?;
|
let mat = PersistentCompactIntMatrix::open(src_layer_dir).map_err(SKError::Io)?;
|
||||||
for slot in 0..n {
|
for spec in specs {
|
||||||
mat.fill_row(slot, &mut src_buf);
|
let g = ColGroup::new(&spec.label, spec.indices.clone());
|
||||||
for (col, spec) in specs.iter().enumerate() {
|
if output_presence {
|
||||||
builders[col].set_val(slot, aggregate(spec.op, &spec.indices, &src_buf, threshold));
|
let b = dst_bit.as_deref_mut().unwrap();
|
||||||
|
match spec.op {
|
||||||
|
AggOp::Any => b.add_col_from (&mat.partial_group_any (&g, threshold).map_err(SKError::Io)?),
|
||||||
|
AggOp::All => b.add_col_from (&mat.partial_group_all (&g, threshold).map_err(SKError::Io)?),
|
||||||
|
AggOp::None => b.add_col_from (&mat.partial_group_none(&g, threshold).map_err(SKError::Io)?),
|
||||||
|
AggOp::Sum => b.add_col_from_int(&mat.partial_group_sum (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Min => b.add_col_from_int(&mat.partial_group_min (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Max => b.add_col_from_int(&mat.partial_group_max (&g).map_err(SKError::Io)?),
|
||||||
|
}.map_err(SKError::Io)?;
|
||||||
|
} else {
|
||||||
|
let b = dst_int.as_deref_mut().unwrap();
|
||||||
|
match spec.op {
|
||||||
|
AggOp::Sum => b.add_col_from (&mat.partial_group_sum (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Min => b.add_col_from (&mat.partial_group_min (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Max => b.add_col_from (&mat.partial_group_max (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Any => b.add_col_from_bit(&mat.partial_group_any (&g, threshold).map_err(SKError::Io)?),
|
||||||
|
AggOp::All => b.add_col_from_bit(&mat.partial_group_all (&g, threshold).map_err(SKError::Io)?),
|
||||||
|
AggOp::None => b.add_col_from_bit(&mat.partial_group_none(&g, threshold).map_err(SKError::Io)?),
|
||||||
|
}.map_err(SKError::Io)?;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
} else {
|
} else {
|
||||||
let mat = PersistentBitMatrix::open(src_layer_dir).map_err(SKError::Io)?;
|
let mat = PersistentBitMatrix::open(src_layer_dir).map_err(SKError::Io)?;
|
||||||
for slot in 0..n {
|
for spec in specs {
|
||||||
mat.fill_row(slot, &mut src_buf);
|
let g = ColGroup::new(&spec.label, spec.indices.clone());
|
||||||
for (col, spec) in specs.iter().enumerate() {
|
if output_presence {
|
||||||
builders[col].set_val(slot, aggregate(spec.op, &spec.indices, &src_buf, threshold));
|
let b = dst_bit.as_deref_mut().unwrap();
|
||||||
|
match spec.op {
|
||||||
|
AggOp::Any => b.add_col_from (&mat.partial_group_any (&g, 1).map_err(SKError::Io)?),
|
||||||
|
AggOp::All => b.add_col_from (&mat.partial_group_all (&g, 1).map_err(SKError::Io)?),
|
||||||
|
AggOp::None => b.add_col_from (&mat.partial_group_none(&g, 1).map_err(SKError::Io)?),
|
||||||
|
AggOp::Sum => b.add_col_from_int(&mat.partial_group_sum (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Min => b.add_col_from_int(&mat.partial_group_min (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Max => b.add_col_from_int(&mat.partial_group_max (&g).map_err(SKError::Io)?),
|
||||||
|
}.map_err(SKError::Io)?;
|
||||||
|
} else {
|
||||||
|
let b = dst_int.as_deref_mut().unwrap();
|
||||||
|
match spec.op {
|
||||||
|
AggOp::Sum => b.add_col_from (&mat.partial_group_sum (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Min => b.add_col_from (&mat.partial_group_min (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Max => b.add_col_from (&mat.partial_group_max (&g).map_err(SKError::Io)?),
|
||||||
|
AggOp::Any => b.add_col_from_bit(&mat.partial_group_any (&g, 1).map_err(SKError::Io)?),
|
||||||
|
AggOp::All => b.add_col_from_bit(&mat.partial_group_all (&g, 1).map_err(SKError::Io)?),
|
||||||
|
AggOp::None => b.add_col_from_bit(&mat.partial_group_none(&g, 1).map_err(SKError::Io)?),
|
||||||
|
}.map_err(SKError::Io)?;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -169,7 +142,7 @@ impl KmerPartition {
|
|||||||
src: &KmerPartition,
|
src: &KmerPartition,
|
||||||
i: usize,
|
i: usize,
|
||||||
specs: &[OutputCol],
|
specs: &[OutputCol],
|
||||||
n_src_genomes: usize,
|
_n_src_genomes: usize,
|
||||||
threshold: u32,
|
threshold: u32,
|
||||||
output_presence: bool,
|
output_presence: bool,
|
||||||
in_place: bool,
|
in_place: bool,
|
||||||
@@ -189,7 +162,6 @@ impl KmerPartition {
|
|||||||
fs::create_dir_all(&dst_index_dir)?;
|
fs::create_dir_all(&dst_index_dir)?;
|
||||||
}
|
}
|
||||||
|
|
||||||
let n_out = specs.len();
|
|
||||||
let data_subdir = if output_presence { "presence" } else { "counts" };
|
let data_subdir = if output_presence { "presence" } else { "counts" };
|
||||||
|
|
||||||
for l in 0..src_meta.n_layers {
|
for l in 0..src_meta.n_layers {
|
||||||
@@ -202,7 +174,7 @@ impl KmerPartition {
|
|||||||
let presence_dir = src_layer_dir.join("presence");
|
let presence_dir = src_layer_dir.join("presence");
|
||||||
let src_is_count = counts_dir.exists() && !presence_dir.exists();
|
let src_is_count = counts_dir.exists() && !presence_dir.exists();
|
||||||
|
|
||||||
// Determine number of slots from the source matrix.
|
// Determine number of slots and detect implicit layers.
|
||||||
let n = if counts_dir.exists() {
|
let n = if counts_dir.exists() {
|
||||||
PersistentCompactIntMatrix::open(&src_layer_dir).map_err(SKError::Io)?.n()
|
PersistentCompactIntMatrix::open(&src_layer_dir).map_err(SKError::Io)?.n()
|
||||||
} else if presence_dir.exists() {
|
} else if presence_dir.exists() {
|
||||||
@@ -217,7 +189,7 @@ impl KmerPartition {
|
|||||||
};
|
};
|
||||||
|
|
||||||
// Choose the output data directory (temp name for in-place).
|
// Choose the output data directory (temp name for in-place).
|
||||||
let (dst_data_dir, final_data_dir) = if in_place {
|
let (dst_data_dir, final_data_dir): (PathBuf, PathBuf) = if in_place {
|
||||||
let tmp = dst_layer_dir.join(format!("{data_subdir}_new"));
|
let tmp = dst_layer_dir.join(format!("{data_subdir}_new"));
|
||||||
let perm = dst_layer_dir.join(data_subdir);
|
let perm = dst_layer_dir.join(data_subdir);
|
||||||
(tmp, perm)
|
(tmp, perm)
|
||||||
@@ -232,37 +204,22 @@ impl KmerPartition {
|
|||||||
}
|
}
|
||||||
fs::create_dir_all(&dst_data_dir)?;
|
fs::create_dir_all(&dst_data_dir)?;
|
||||||
|
|
||||||
// Initialise packed-format skeleton.
|
let (mut dst_bit, mut dst_int) = if output_presence {
|
||||||
if output_presence {
|
(Some(PersistentBitMatrixBuilder::new(n, &dst_data_dir).map_err(SKError::Io)?), None)
|
||||||
PersistentBitMatrixBuilder::new(n, &dst_data_dir)
|
|
||||||
.map_err(SKError::Io)?.close().map_err(SKError::Io)?;
|
|
||||||
} else {
|
} else {
|
||||||
PersistentCompactIntMatrixBuilder::new(n, &dst_data_dir)
|
(None, Some(PersistentCompactIntMatrixBuilder::new(n, &dst_data_dir).map_err(SKError::Io)?))
|
||||||
.map_err(SKError::Io)?.close().map_err(SKError::Io)?;
|
};
|
||||||
}
|
|
||||||
|
|
||||||
// Create column builders.
|
|
||||||
let mut builders: Vec<ColBuilder> = (0..n_out)
|
|
||||||
.map(|col| -> SKResult<ColBuilder> {
|
|
||||||
if output_presence {
|
|
||||||
Ok(ColBuilder::Bit(PersistentBitVecBuilder::new(
|
|
||||||
n, &col_path_bit(&dst_data_dir, col),
|
|
||||||
)?))
|
|
||||||
} else {
|
|
||||||
Ok(ColBuilder::Int(PersistentCompactIntVecBuilder::new(
|
|
||||||
n, &col_path_int(&dst_data_dir, col),
|
|
||||||
)?))
|
|
||||||
}
|
|
||||||
})
|
|
||||||
.collect::<SKResult<_>>()?;
|
|
||||||
|
|
||||||
fill_builders(
|
fill_builders(
|
||||||
&mut builders, specs, n, n_src_genomes,
|
specs, &src_layer_dir, src_is_count, threshold, output_presence,
|
||||||
&src_layer_dir, src_is_count, threshold,
|
dst_bit.as_mut(), dst_int.as_mut(),
|
||||||
)?;
|
)?;
|
||||||
|
|
||||||
for b in builders { b.close()?; }
|
if output_presence {
|
||||||
write_matrix_meta(&dst_data_dir, n, n_out).map_err(SKError::Io)?;
|
dst_bit.unwrap().close().map_err(SKError::Io)?;
|
||||||
|
} else {
|
||||||
|
dst_int.unwrap().close().map_err(SKError::Io)?;
|
||||||
|
}
|
||||||
|
|
||||||
// In-place: swap old data dir for new.
|
// In-place: swap old data dir for new.
|
||||||
if in_place {
|
if in_place {
|
||||||
|
|||||||
@@ -6,7 +6,6 @@ use obicompactvec::{
|
|||||||
PersistentBitMatrix, PersistentBitMatrixBuilder,
|
PersistentBitMatrix, PersistentBitMatrixBuilder,
|
||||||
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
||||||
};
|
};
|
||||||
use obicompactvec::traits::BitSliceMut;
|
|
||||||
use obikseq::CanonicalKmer;
|
use obikseq::CanonicalKmer;
|
||||||
use obiskio::{UnitigFileReader, UnitigFileWriter};
|
use obiskio::{UnitigFileReader, UnitigFileWriter};
|
||||||
|
|
||||||
@@ -107,11 +106,7 @@ impl Layer<()> {
|
|||||||
let presence_dir = layer_dir.join(PRESENCE_DIR);
|
let presence_dir = layer_dir.join(PRESENCE_DIR);
|
||||||
fs::create_dir_all(&presence_dir).map_err(OLMError::Io)?;
|
fs::create_dir_all(&presence_dir).map_err(OLMError::Io)?;
|
||||||
let mut mb = PersistentBitMatrixBuilder::new(n_kmers, &presence_dir).map_err(OLMError::Io)?;
|
let mut mb = PersistentBitMatrixBuilder::new(n_kmers, &presence_dir).map_err(OLMError::Io)?;
|
||||||
let mut col = mb.add_col().map_err(OLMError::Io)?;
|
mb.add_col_ones().map_err(OLMError::Io)?.close().map_err(OLMError::Io)?;
|
||||||
for slot in 0..n_kmers {
|
|
||||||
col.set(slot, true);
|
|
||||||
}
|
|
||||||
col.close().map_err(OLMError::Io)?;
|
|
||||||
mb.close().map_err(OLMError::Io)
|
mb.close().map_err(OLMError::Io)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -102,7 +102,6 @@ mod tests {
|
|||||||
PersistentBitMatrix, PersistentBitMatrixBuilder,
|
PersistentBitMatrix, PersistentBitMatrixBuilder,
|
||||||
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
||||||
};
|
};
|
||||||
use obicompactvec::traits::BitSliceMut;
|
|
||||||
use tempfile::tempdir;
|
use tempfile::tempdir;
|
||||||
|
|
||||||
fn make_int_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
|
fn make_int_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
|
||||||
|
|||||||
+248
-47
@@ -4,7 +4,7 @@ use std::sync::{Condvar, Mutex};
|
|||||||
use std::time::{Duration, Instant};
|
use std::time::{Duration, Instant};
|
||||||
|
|
||||||
use indicatif::{ProgressBar, ProgressStyle};
|
use indicatif::{ProgressBar, ProgressStyle};
|
||||||
use tracing::{info, warn};
|
use tracing::{debug, info, warn};
|
||||||
|
|
||||||
const BRAILLE: &[&str] = &["⠋", "⠙", "⠹", "⠸", "⠼", "⠴", "⠦", "⠧", "⠇", "⠏"];
|
const BRAILLE: &[&str] = &["⠋", "⠙", "⠹", "⠸", "⠼", "⠴", "⠦", "⠧", "⠇", "⠏"];
|
||||||
|
|
||||||
@@ -31,7 +31,8 @@ impl TracedBar {
|
|||||||
let pct10 = (pos * 10) / self.total; // 0..=10
|
let pct10 = (pos * 10) / self.total; // 0..=10
|
||||||
let last = self.last_pct.load(Ordering::Relaxed);
|
let last = self.last_pct.load(Ordering::Relaxed);
|
||||||
if pct10 > last
|
if pct10 > last
|
||||||
&& self.last_pct
|
&& self
|
||||||
|
.last_pct
|
||||||
.compare_exchange(last, pct10, Ordering::Relaxed, Ordering::Relaxed)
|
.compare_exchange(last, pct10, Ordering::Relaxed, Ordering::Relaxed)
|
||||||
.is_ok()
|
.is_ok()
|
||||||
{
|
{
|
||||||
@@ -49,14 +50,14 @@ impl TracedBar {
|
|||||||
let msg = msg.into();
|
let msg = msg.into();
|
||||||
if self.pb.is_hidden() {
|
if self.pb.is_hidden() {
|
||||||
if self.total > 0 {
|
if self.total > 0 {
|
||||||
// bounded bar: always log (already rate-limited by 10% threshold in inc)
|
debug!(stage = %self.label, "{msg}");
|
||||||
info!(stage = %self.label, "{msg}");
|
|
||||||
} else {
|
} else {
|
||||||
// spinner: throttle to ~10 s
|
// spinner: throttle to ~10 s
|
||||||
let now_ms = self.start.elapsed().as_millis() as u64;
|
let now_ms = self.start.elapsed().as_millis() as u64;
|
||||||
let last = self.last_log_ms.load(Ordering::Relaxed);
|
let last = self.last_log_ms.load(Ordering::Relaxed);
|
||||||
if now_ms >= last + 10_000
|
if now_ms >= last + 10_000
|
||||||
&& self.last_log_ms
|
&& self
|
||||||
|
.last_log_ms
|
||||||
.compare_exchange(last, now_ms, Ordering::Relaxed, Ordering::Relaxed)
|
.compare_exchange(last, now_ms, Ordering::Relaxed, Ordering::Relaxed)
|
||||||
.is_ok()
|
.is_ok()
|
||||||
{
|
{
|
||||||
@@ -83,8 +84,13 @@ pub fn spinner(label: &str) -> TracedBar {
|
|||||||
);
|
);
|
||||||
pb.enable_steady_tick(Duration::from_millis(100));
|
pb.enable_steady_tick(Duration::from_millis(100));
|
||||||
TracedBar {
|
TracedBar {
|
||||||
pb, label: label.to_string(), unit: String::new(), total: 0,
|
pb,
|
||||||
start: Instant::now(), last_pct: AtomicU64::new(0), last_log_ms: AtomicU64::new(0),
|
label: label.to_string(),
|
||||||
|
unit: String::new(),
|
||||||
|
total: 0,
|
||||||
|
start: Instant::now(),
|
||||||
|
last_pct: AtomicU64::new(0),
|
||||||
|
last_log_ms: AtomicU64::new(0),
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -101,8 +107,13 @@ pub fn progress_bar(label: &str, n: u64, unit: &str) -> TracedBar {
|
|||||||
);
|
);
|
||||||
pb.enable_steady_tick(Duration::from_millis(100));
|
pb.enable_steady_tick(Duration::from_millis(100));
|
||||||
TracedBar {
|
TracedBar {
|
||||||
pb, label: label.to_string(), unit: unit.to_string(), total: n,
|
pb,
|
||||||
start: Instant::now(), last_pct: AtomicU64::new(0), last_log_ms: AtomicU64::new(0),
|
label: label.to_string(),
|
||||||
|
unit: unit.to_string(),
|
||||||
|
total: n,
|
||||||
|
start: Instant::now(),
|
||||||
|
last_pct: AtomicU64::new(0),
|
||||||
|
last_log_ms: AtomicU64::new(0),
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -204,13 +215,19 @@ fn tv_to_secs(tv: timeval) -> f64 {
|
|||||||
}
|
}
|
||||||
|
|
||||||
#[cfg(target_os = "macos")]
|
#[cfg(target_os = "macos")]
|
||||||
fn rss_to_bytes(ru: &rusage) -> u64 { ru.ru_maxrss as u64 }
|
fn rss_to_bytes(ru: &rusage) -> u64 {
|
||||||
|
ru.ru_maxrss as u64
|
||||||
|
}
|
||||||
|
|
||||||
#[cfg(not(target_os = "macos"))]
|
#[cfg(not(target_os = "macos"))]
|
||||||
fn rss_to_bytes(ru: &rusage) -> u64 { ru.ru_maxrss as u64 * 1024 }
|
fn rss_to_bytes(ru: &rusage) -> u64 {
|
||||||
|
ru.ru_maxrss as u64 * 1024
|
||||||
|
}
|
||||||
|
|
||||||
// Monotonically increasing counters — negative delta would be a kernel bug.
|
// Monotonically increasing counters — negative delta would be a kernel bug.
|
||||||
fn delta(end: i64, start: i64) -> u64 { (end - start).max(0) as u64 }
|
fn delta(end: i64, start: i64) -> u64 {
|
||||||
|
(end - start).max(0) as u64
|
||||||
|
}
|
||||||
|
|
||||||
// ── CpuSample ─────────────────────────────────────────────────────────────────
|
// ── CpuSample ─────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -221,6 +238,7 @@ pub struct CpuSample {
|
|||||||
wall: Instant,
|
wall: Instant,
|
||||||
user_secs: f64,
|
user_secs: f64,
|
||||||
sys_secs: f64,
|
sys_secs: f64,
|
||||||
|
previous: f64,
|
||||||
}
|
}
|
||||||
|
|
||||||
impl CpuSample {
|
impl CpuSample {
|
||||||
@@ -230,6 +248,7 @@ impl CpuSample {
|
|||||||
wall: Instant::now(),
|
wall: Instant::now(),
|
||||||
user_secs: tv_to_secs(ru.ru_utime),
|
user_secs: tv_to_secs(ru.ru_utime),
|
||||||
sys_secs: tv_to_secs(ru.ru_stime),
|
sys_secs: tv_to_secs(ru.ru_stime),
|
||||||
|
previous: 0.0,
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -238,11 +257,129 @@ impl CpuSample {
|
|||||||
pub fn cpu_efficiency(&self, n_cores: usize) -> f64 {
|
pub fn cpu_efficiency(&self, n_cores: usize) -> f64 {
|
||||||
let ru = get_rusage();
|
let ru = get_rusage();
|
||||||
let wall = self.wall.elapsed().as_secs_f64();
|
let wall = self.wall.elapsed().as_secs_f64();
|
||||||
if wall < 0.1 { return 0.0; }
|
if wall < 0.1 {
|
||||||
let cpu = (tv_to_secs(ru.ru_utime) - self.user_secs)
|
return 0.0;
|
||||||
+ (tv_to_secs(ru.ru_stime) - self.sys_secs);
|
}
|
||||||
|
let cpu =
|
||||||
|
(tv_to_secs(ru.ru_utime) - self.user_secs) + (tv_to_secs(ru.ru_stime) - self.sys_secs);
|
||||||
cpu / (wall * n_cores as f64)
|
cpu / (wall * n_cores as f64)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
|
||||||
|
let delta_wall = self.wall.elapsed().as_secs_f64();
|
||||||
|
if delta_wall < 0.1 {
|
||||||
|
// Window too short to be meaningful — leave state untouched so it
|
||||||
|
// keeps accumulating until a real sample can be taken.
|
||||||
|
return false;
|
||||||
|
}
|
||||||
|
|
||||||
|
let n = CpuSample::now();
|
||||||
|
let delta_ru = (n.user_secs - self.user_secs) + (n.sys_secs - self.sys_secs);
|
||||||
|
|
||||||
|
let efficiency = delta_ru / delta_wall;
|
||||||
|
let activate = 0f64.max(efficiency - self.previous) >= threshold;
|
||||||
|
|
||||||
|
debug!(
|
||||||
|
"Do I activate : {} -> {} = {} Activate: {}",
|
||||||
|
self.previous,
|
||||||
|
efficiency,
|
||||||
|
0f64.max(efficiency - self.previous),
|
||||||
|
activate
|
||||||
|
);
|
||||||
|
self.previous = efficiency;
|
||||||
|
self.user_secs = n.user_secs;
|
||||||
|
self.sys_secs = n.sys_secs;
|
||||||
|
self.wall = n.wall;
|
||||||
|
|
||||||
|
activate
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── IoSample ──────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Snapshot of process-wide block I/O (bytes read + written) + wall clock.
|
||||||
|
///
|
||||||
|
/// Same activation protocol as [`CpuSample`], but the growth check in
|
||||||
|
/// [`do_i_activate`](Self::do_i_activate) is *relative* rather than absolute:
|
||||||
|
/// raw I/O throughput has no portable scale across storage devices, unlike a
|
||||||
|
/// core count.
|
||||||
|
pub struct IoSample {
|
||||||
|
wall: Instant,
|
||||||
|
bytes: u64,
|
||||||
|
previous_rate: f64,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl IoSample {
|
||||||
|
pub fn now() -> Self {
|
||||||
|
Self {
|
||||||
|
wall: Instant::now(),
|
||||||
|
bytes: Self::read_bytes(),
|
||||||
|
previous_rate: 0.0,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Bytes actually submitted to the block layer (read + write), summed
|
||||||
|
/// process-wide. Returns 0 if unavailable — degrades gracefully to a
|
||||||
|
/// signal that never triggers activation (CPU-only heuristic).
|
||||||
|
#[cfg(target_os = "linux")]
|
||||||
|
fn read_bytes() -> u64 {
|
||||||
|
let Ok(io) = std::fs::read_to_string("/proc/self/io") else {
|
||||||
|
return 0;
|
||||||
|
};
|
||||||
|
io.lines()
|
||||||
|
.filter_map(|l| {
|
||||||
|
l.strip_prefix("read_bytes: ")
|
||||||
|
.or_else(|| l.strip_prefix("write_bytes: "))
|
||||||
|
})
|
||||||
|
.filter_map(|v| v.trim().parse::<u64>().ok())
|
||||||
|
.sum()
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cfg(target_os = "macos")]
|
||||||
|
fn read_bytes() -> u64 {
|
||||||
|
use libc::{RUSAGE_INFO_V4, getpid, proc_pid_rusage, rusage_info_v4};
|
||||||
|
let mut info: rusage_info_v4 = unsafe { std::mem::zeroed() };
|
||||||
|
let ret =
|
||||||
|
unsafe { proc_pid_rusage(getpid(), RUSAGE_INFO_V4, &mut info as *mut _ as *mut _) };
|
||||||
|
if ret != 0 {
|
||||||
|
return 0;
|
||||||
|
}
|
||||||
|
info.ri_diskio_bytesread + info.ri_diskio_byteswritten
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cfg(not(any(target_os = "linux", target_os = "macos")))]
|
||||||
|
fn read_bytes() -> u64 {
|
||||||
|
0
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Same protocol as [`CpuSample::do_i_activate`] (0.1 s minimum window,
|
||||||
|
/// state untouched on early return), but growth is measured relative to
|
||||||
|
/// the previous rate. `threshold` is a fraction, e.g. `0.2` for a 20 %
|
||||||
|
/// increase in throughput since the last real sample.
|
||||||
|
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
|
||||||
|
let elapsed = self.wall.elapsed().as_secs_f64();
|
||||||
|
if elapsed < 0.1 {
|
||||||
|
return false;
|
||||||
|
}
|
||||||
|
|
||||||
|
let n = Self::read_bytes();
|
||||||
|
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
|
||||||
|
let activate = if self.previous_rate == 0.0 {
|
||||||
|
rate > 0.0 // bootstrap: any measured throughput is signal enough
|
||||||
|
} else {
|
||||||
|
(rate - self.previous_rate) / self.previous_rate >= threshold
|
||||||
|
};
|
||||||
|
|
||||||
|
debug!(
|
||||||
|
"Do I activate (I/O) : {} -> {} Activate: {}",
|
||||||
|
self.previous_rate, rate, activate
|
||||||
|
);
|
||||||
|
self.previous_rate = rate;
|
||||||
|
self.bytes = n;
|
||||||
|
self.wall = Instant::now();
|
||||||
|
|
||||||
|
activate
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── public API ────────────────────────────────────────────────────────────────
|
// ── public API ────────────────────────────────────────────────────────────────
|
||||||
@@ -259,7 +396,11 @@ impl Stage {
|
|||||||
pub fn start(label: impl Into<String>) -> Self {
|
pub fn start(label: impl Into<String>) -> Self {
|
||||||
let label = label.into();
|
let label = label.into();
|
||||||
info!(stage = %label, "started");
|
info!(stage = %label, "started");
|
||||||
Self { label, wall: Instant::now(), ru: get_rusage() }
|
Self {
|
||||||
|
label,
|
||||||
|
wall: Instant::now(),
|
||||||
|
ru: get_rusage(),
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn stop(self) -> StageStats {
|
pub fn stop(self) -> StageStats {
|
||||||
@@ -318,8 +459,11 @@ pub struct StageStats {
|
|||||||
impl StageStats {
|
impl StageStats {
|
||||||
/// (user + sys) / wall — effective thread count utilisation.
|
/// (user + sys) / wall — effective thread count utilisation.
|
||||||
pub fn parallelism(&self) -> f64 {
|
pub fn parallelism(&self) -> f64 {
|
||||||
if self.wall_secs > 1e-9 { (self.user_secs + self.sys_secs) / self.wall_secs }
|
if self.wall_secs > 1e-9 {
|
||||||
else { 0.0 }
|
(self.user_secs + self.sys_secs) / self.wall_secs
|
||||||
|
} else {
|
||||||
|
0.0
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
/// parallelism / n_cores — fraction of available CPU power used (0..1+).
|
/// parallelism / n_cores — fraction of available CPU power used (0..1+).
|
||||||
@@ -335,11 +479,19 @@ pub struct Reporter {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl Reporter {
|
impl Reporter {
|
||||||
pub fn new() -> Self { Self::default() }
|
pub fn new() -> Self {
|
||||||
pub fn push(&mut self, stats: StageStats) { self.stages.push(stats); }
|
Self::default()
|
||||||
pub fn stages(&self) -> &[StageStats] { &self.stages }
|
}
|
||||||
|
pub fn push(&mut self, stats: StageStats) {
|
||||||
|
self.stages.push(stats);
|
||||||
|
}
|
||||||
|
pub fn stages(&self) -> &[StageStats] {
|
||||||
|
&self.stages
|
||||||
|
}
|
||||||
/// Print the summary to stderr.
|
/// Print the summary to stderr.
|
||||||
pub fn print(&self) { eprint!("{self}"); }
|
pub fn print(&self) {
|
||||||
|
eprint!("{self}");
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── diagnosis ─────────────────────────────────────────────────────────────────
|
// ── diagnosis ─────────────────────────────────────────────────────────────────
|
||||||
@@ -387,26 +539,43 @@ fn diagnose(s: &StageStats, n_cores: usize) -> Diagnosis {
|
|||||||
)),
|
)),
|
||||||
};
|
};
|
||||||
}
|
}
|
||||||
Diagnosis { tag: "—", detail: None }
|
Diagnosis {
|
||||||
|
tag: "—",
|
||||||
|
detail: None,
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── display helpers ───────────────────────────────────────────────────────────
|
// ── display helpers ───────────────────────────────────────────────────────────
|
||||||
|
|
||||||
fn fmt_secs(s: f64) -> String {
|
fn fmt_secs(s: f64) -> String {
|
||||||
if s >= 100.0 { format!("{:.0}s", s) }
|
if s >= 100.0 {
|
||||||
else if s >= 10.0 { format!("{:.1}s", s) }
|
format!("{:.0}s", s)
|
||||||
else if s >= 1.0 { format!("{:.2}s", s) }
|
} else if s >= 10.0 {
|
||||||
else { format!("{:.0}ms", s * 1000.0) }
|
format!("{:.1}s", s)
|
||||||
|
} else if s >= 1.0 {
|
||||||
|
format!("{:.2}s", s)
|
||||||
|
} else {
|
||||||
|
format!("{:.0}ms", s * 1000.0)
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
fn fmt_bytes(b: u64) -> String {
|
fn fmt_bytes(b: u64) -> String {
|
||||||
if b >= 1 << 30 { format!("{:.1} GB", b as f64 / (1u64 << 30) as f64) }
|
if b >= 1 << 30 {
|
||||||
else if b >= 1 << 20 { format!("{:.0} MB", b as f64 / (1u64 << 20) as f64) }
|
format!("{:.1} GB", b as f64 / (1u64 << 30) as f64)
|
||||||
else { format!("{:.0} KB", b as f64 / 1024.0) }
|
} else if b >= 1 << 20 {
|
||||||
|
format!("{:.0} MB", b as f64 / (1u64 << 20) as f64)
|
||||||
|
} else {
|
||||||
|
format!("{:.0} KB", b as f64 / 1024.0)
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
fn fmt_efficiency(par: f64, n_cores: usize) -> String {
|
fn fmt_efficiency(par: f64, n_cores: usize) -> String {
|
||||||
format!("{:.1}×/{} ({:.0}%)", par, n_cores, par / n_cores as f64 * 100.0)
|
format!(
|
||||||
|
"{:.1}×/{} ({:.0}%)",
|
||||||
|
par,
|
||||||
|
n_cores,
|
||||||
|
par / n_cores as f64 * 100.0
|
||||||
|
)
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Display ───────────────────────────────────────────────────────────────────
|
// ── Display ───────────────────────────────────────────────────────────────────
|
||||||
@@ -434,7 +603,11 @@ impl MemoryBudget {
|
|||||||
pub fn new(total: u64) -> Self {
|
pub fn new(total: u64) -> Self {
|
||||||
Self {
|
Self {
|
||||||
total,
|
total,
|
||||||
inner: Mutex::new(BudgetInner { remaining: total, active: 0, peak_active: 0 }),
|
inner: Mutex::new(BudgetInner {
|
||||||
|
remaining: total,
|
||||||
|
active: 0,
|
||||||
|
peak_active: 0,
|
||||||
|
}),
|
||||||
condvar: Condvar::new(),
|
condvar: Condvar::new(),
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -459,24 +632,40 @@ impl MemoryBudget {
|
|||||||
self.condvar.notify_all();
|
self.condvar.notify_all();
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn total(&self) -> u64 { self.total }
|
pub fn total(&self) -> u64 {
|
||||||
pub fn active(&self) -> usize { self.inner.lock().unwrap().active }
|
self.total
|
||||||
pub fn remaining(&self) -> u64 { self.inner.lock().unwrap().remaining }
|
}
|
||||||
pub fn peak_active(&self) -> usize { self.inner.lock().unwrap().peak_active }
|
pub fn active(&self) -> usize {
|
||||||
|
self.inner.lock().unwrap().active
|
||||||
|
}
|
||||||
|
pub fn remaining(&self) -> u64 {
|
||||||
|
self.inner.lock().unwrap().remaining
|
||||||
|
}
|
||||||
|
pub fn peak_active(&self) -> usize {
|
||||||
|
self.inner.lock().unwrap().peak_active
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Display ───────────────────────────────────────────────────────────────────
|
// ── Display ───────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
impl fmt::Display for Reporter {
|
impl fmt::Display for Reporter {
|
||||||
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
||||||
if self.stages.is_empty() { return Ok(()); }
|
if self.stages.is_empty() {
|
||||||
|
return Ok(());
|
||||||
|
}
|
||||||
|
|
||||||
let n_cores = std::thread::available_parallelism()
|
let n_cores = std::thread::available_parallelism()
|
||||||
.map(|n| n.get())
|
.map(|n| n.get())
|
||||||
.unwrap_or(1);
|
.unwrap_or(1);
|
||||||
|
|
||||||
// column widths
|
// column widths
|
||||||
let nw = self.stages.iter().map(|s| s.label.len()).max().unwrap_or(5).max(5);
|
let nw = self
|
||||||
|
.stages
|
||||||
|
.iter()
|
||||||
|
.map(|s| s.label.len())
|
||||||
|
.max()
|
||||||
|
.unwrap_or(5)
|
||||||
|
.max(5);
|
||||||
// efficiency col: worst-case width for this run's n_cores value
|
// efficiency col: worst-case width for this run's n_cores value
|
||||||
let ew = format!("{:.1}×/{} (100%)", 99.9f64, n_cores).len();
|
let ew = format!("{:.1}×/{} (100%)", 99.9f64, n_cores).len();
|
||||||
|
|
||||||
@@ -484,18 +673,21 @@ impl fmt::Display for Reporter {
|
|||||||
let sep = "─".repeat(sep_w);
|
let sep = "─".repeat(sep_w);
|
||||||
|
|
||||||
// header
|
// header
|
||||||
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8} status",
|
writeln!(
|
||||||
"stage", "wall", "efficiency", "peak RSS")?;
|
f,
|
||||||
|
"{:<nw$} {:>7} {:>ew$} {:>8} status",
|
||||||
|
"stage", "wall", "efficiency", "peak RSS"
|
||||||
|
)?;
|
||||||
writeln!(f, "{sep}")?;
|
writeln!(f, "{sep}")?;
|
||||||
|
|
||||||
// compute all diagnoses up front (needed for both table and footnotes)
|
// compute all diagnoses up front (needed for both table and footnotes)
|
||||||
let diagnoses: Vec<Diagnosis> = self.stages.iter()
|
let diagnoses: Vec<Diagnosis> = self.stages.iter().map(|s| diagnose(s, n_cores)).collect();
|
||||||
.map(|s| diagnose(s, n_cores))
|
|
||||||
.collect();
|
|
||||||
|
|
||||||
// per-stage rows
|
// per-stage rows
|
||||||
for (s, d) in self.stages.iter().zip(diagnoses.iter()) {
|
for (s, d) in self.stages.iter().zip(diagnoses.iter()) {
|
||||||
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8} {}",
|
writeln!(
|
||||||
|
f,
|
||||||
|
"{:<nw$} {:>7} {:>ew$} {:>8} {}",
|
||||||
s.label,
|
s.label,
|
||||||
fmt_secs(s.wall_secs),
|
fmt_secs(s.wall_secs),
|
||||||
fmt_efficiency(s.parallelism(), n_cores),
|
fmt_efficiency(s.parallelism(), n_cores),
|
||||||
@@ -508,11 +700,18 @@ impl fmt::Display for Reporter {
|
|||||||
let tw = self.stages.iter().map(|s| s.wall_secs).sum::<f64>();
|
let tw = self.stages.iter().map(|s| s.wall_secs).sum::<f64>();
|
||||||
let tu = self.stages.iter().map(|s| s.user_secs).sum::<f64>();
|
let tu = self.stages.iter().map(|s| s.user_secs).sum::<f64>();
|
||||||
let ts = self.stages.iter().map(|s| s.sys_secs).sum::<f64>();
|
let ts = self.stages.iter().map(|s| s.sys_secs).sum::<f64>();
|
||||||
let trss = self.stages.iter().map(|s| s.max_rss_bytes).max().unwrap_or(0);
|
let trss = self
|
||||||
|
.stages
|
||||||
|
.iter()
|
||||||
|
.map(|s| s.max_rss_bytes)
|
||||||
|
.max()
|
||||||
|
.unwrap_or(0);
|
||||||
let tpar = if tw > 1e-9 { (tu + ts) / tw } else { 0.0 };
|
let tpar = if tw > 1e-9 { (tu + ts) / tw } else { 0.0 };
|
||||||
|
|
||||||
writeln!(f, "{sep}")?;
|
writeln!(f, "{sep}")?;
|
||||||
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8}",
|
writeln!(
|
||||||
|
f,
|
||||||
|
"{:<nw$} {:>7} {:>ew$} {:>8}",
|
||||||
"TOTAL",
|
"TOTAL",
|
||||||
fmt_secs(tw),
|
fmt_secs(tw),
|
||||||
fmt_efficiency(tpar, n_cores),
|
fmt_efficiency(tpar, n_cores),
|
||||||
@@ -520,7 +719,9 @@ impl fmt::Display for Reporter {
|
|||||||
)?;
|
)?;
|
||||||
|
|
||||||
// bottleneck footnotes (only if at least one anomaly detected)
|
// bottleneck footnotes (only if at least one anomaly detected)
|
||||||
let bottlenecks: Vec<(&str, &str)> = self.stages.iter()
|
let bottlenecks: Vec<(&str, &str)> = self
|
||||||
|
.stages
|
||||||
|
.iter()
|
||||||
.zip(diagnoses.iter())
|
.zip(diagnoses.iter())
|
||||||
.filter_map(|(s, d)| d.detail.as_deref().map(|det| (s.label.as_str(), det)))
|
.filter_map(|(s, d)| d.detail.as_deref().map(|det| (s.label.as_str(), det)))
|
||||||
.collect();
|
.collect();
|
||||||
|
|||||||
@@ -0,0 +1,6 @@
|
|||||||
|
[package]
|
||||||
|
name = "obitaxonomy"
|
||||||
|
version = "0.1.0"
|
||||||
|
edition = "2024"
|
||||||
|
|
||||||
|
[dependencies]
|
||||||
@@ -0,0 +1,38 @@
|
|||||||
|
use std::fmt;
|
||||||
|
|
||||||
|
#[derive(Debug, Clone, PartialEq, Eq)]
|
||||||
|
pub enum TaxError {
|
||||||
|
/// Stored value does not start with the `taxonomy:/` prefix.
|
||||||
|
MissingPrefix,
|
||||||
|
/// Stored path contains no segments after the prefix.
|
||||||
|
EmptyPath,
|
||||||
|
/// Query pattern contains no segments (after stripping anchors).
|
||||||
|
EmptyPattern,
|
||||||
|
/// A segment has an empty name (e.g. consecutive `/`).
|
||||||
|
EmptySegmentName,
|
||||||
|
/// A segment has a trailing `@` with no rank name.
|
||||||
|
EmptyRankName { segment: String },
|
||||||
|
/// A segment contains more than one `@`.
|
||||||
|
AmbiguousRank { segment: String },
|
||||||
|
}
|
||||||
|
|
||||||
|
impl fmt::Display for TaxError {
|
||||||
|
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
||||||
|
match self {
|
||||||
|
TaxError::MissingPrefix =>
|
||||||
|
write!(f, "taxonomy path must start with \"taxonomy:/\""),
|
||||||
|
TaxError::EmptyPath =>
|
||||||
|
write!(f, "taxonomy path has no segments"),
|
||||||
|
TaxError::EmptyPattern =>
|
||||||
|
write!(f, "taxonomy query pattern has no segments"),
|
||||||
|
TaxError::EmptySegmentName =>
|
||||||
|
write!(f, "segment has an empty name"),
|
||||||
|
TaxError::EmptyRankName { segment } =>
|
||||||
|
write!(f, "segment has '@' with no rank name: {segment:?}"),
|
||||||
|
TaxError::AmbiguousRank { segment } =>
|
||||||
|
write!(f, "segment contains more than one '@': {segment:?}"),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
impl std::error::Error for TaxError {}
|
||||||
@@ -0,0 +1,11 @@
|
|||||||
|
mod error;
|
||||||
|
mod segment;
|
||||||
|
mod segment_pattern;
|
||||||
|
mod path;
|
||||||
|
mod pattern;
|
||||||
|
|
||||||
|
pub use error::TaxError;
|
||||||
|
pub use segment::TaxSegment;
|
||||||
|
pub use segment_pattern::SegmentPattern;
|
||||||
|
pub use path::{TaxPath, PREFIX};
|
||||||
|
pub use pattern::TaxPattern;
|
||||||
@@ -0,0 +1,82 @@
|
|||||||
|
use std::fmt;
|
||||||
|
use std::str::FromStr;
|
||||||
|
|
||||||
|
use crate::error::TaxError;
|
||||||
|
use crate::segment::TaxSegment;
|
||||||
|
|
||||||
|
/// The prefix that marks a metadata value as a taxonomy path.
|
||||||
|
pub const PREFIX: &str = "taxonomy:/";
|
||||||
|
|
||||||
|
/// A rooted, `/`-separated taxonomy path with optional per-segment rank annotations.
|
||||||
|
///
|
||||||
|
/// Stored form: `taxonomy:/seg1@rank1/seg2/seg3@rank3`
|
||||||
|
/// The leading `taxonomy:/` is the discriminator; the remainder is one or more
|
||||||
|
/// `/`-separated segments, each of the form `name` or `name@rank`.
|
||||||
|
///
|
||||||
|
/// `@` is reserved and may not appear in segment names or rank names.
|
||||||
|
#[derive(Debug, Clone, PartialEq, Eq)]
|
||||||
|
pub struct TaxPath {
|
||||||
|
segments: Vec<TaxSegment>,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl TaxPath {
|
||||||
|
pub fn parse(s: &str) -> Result<Self, TaxError> {
|
||||||
|
let tail = s.strip_prefix(PREFIX).ok_or(TaxError::MissingPrefix)?;
|
||||||
|
if tail.is_empty() {
|
||||||
|
return Err(TaxError::EmptyPath);
|
||||||
|
}
|
||||||
|
let segments = tail.split('/')
|
||||||
|
.map(TaxSegment::parse)
|
||||||
|
.collect::<Result<Vec<_>, _>>()?;
|
||||||
|
Ok(Self { segments })
|
||||||
|
}
|
||||||
|
|
||||||
|
/// True if `self` is an ancestor of — or equal to — `other`.
|
||||||
|
///
|
||||||
|
/// Comparison is by segment name only; rank annotations are ignored.
|
||||||
|
/// `self` must be a prefix of `other` at segment granularity.
|
||||||
|
pub fn is_ancestor_of(&self, other: &TaxPath) -> bool {
|
||||||
|
self.segments.len() <= other.segments.len()
|
||||||
|
&& self.segments.iter().zip(other.segments.iter())
|
||||||
|
.all(|(a, b)| a.name() == b.name())
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Returns the name of the first segment whose rank equals `rank`, if any.
|
||||||
|
pub fn name_at_rank(&self, rank: &str) -> Option<&str> {
|
||||||
|
self.segments.iter()
|
||||||
|
.find(|s| s.rank() == Some(rank))
|
||||||
|
.map(|s| s.name())
|
||||||
|
}
|
||||||
|
|
||||||
|
/// True if any segment has the given rank.
|
||||||
|
pub fn has_rank(&self, rank: &str) -> bool {
|
||||||
|
self.segments.iter().any(|s| s.rank() == Some(rank))
|
||||||
|
}
|
||||||
|
|
||||||
|
/// True if the path contains a segment with both the given rank and name.
|
||||||
|
pub fn matches_rank(&self, rank: &str, name: &str) -> bool {
|
||||||
|
self.segments.iter().any(|s| s.rank() == Some(rank) && s.name() == name)
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn segments(&self) -> &[TaxSegment] { &self.segments }
|
||||||
|
pub fn depth(&self) -> usize { self.segments.len() }
|
||||||
|
pub fn is_empty(&self) -> bool { self.segments.is_empty() }
|
||||||
|
}
|
||||||
|
|
||||||
|
impl fmt::Display for TaxPath {
|
||||||
|
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
||||||
|
write!(f, "{}", PREFIX)?;
|
||||||
|
let mut first = true;
|
||||||
|
for seg in &self.segments {
|
||||||
|
if !first { write!(f, "/")?; }
|
||||||
|
write!(f, "{seg}")?;
|
||||||
|
first = false;
|
||||||
|
}
|
||||||
|
Ok(())
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
impl FromStr for TaxPath {
|
||||||
|
type Err = TaxError;
|
||||||
|
fn from_str(s: &str) -> Result<Self, Self::Err> { Self::parse(s) }
|
||||||
|
}
|
||||||
@@ -0,0 +1,72 @@
|
|||||||
|
use crate::error::TaxError;
|
||||||
|
use crate::path::TaxPath;
|
||||||
|
use crate::segment::TaxSegment;
|
||||||
|
use crate::segment_pattern::SegmentPattern;
|
||||||
|
|
||||||
|
/// A query pattern for matching against stored `TaxPath` values.
|
||||||
|
///
|
||||||
|
/// Syntax:
|
||||||
|
///
|
||||||
|
/// | Form | Semantics |
|
||||||
|
/// |----------|-----------|
|
||||||
|
/// | `A/B` | A then B as a contiguous sub-path, anywhere in the value |
|
||||||
|
/// | `/A/B` | value starts with A then B (start-anchored) |
|
||||||
|
/// | `A/B$` | value ends with A then B (end-anchored) |
|
||||||
|
/// | `/A/B$` | value is exactly A then B (fully anchored) |
|
||||||
|
/// | `A@x/B` | A with rank `x`, followed by B with any rank |
|
||||||
|
///
|
||||||
|
/// A segment pattern without `@` matches any segment with that name regardless
|
||||||
|
/// of its stored rank.
|
||||||
|
#[derive(Debug, Clone, PartialEq, Eq)]
|
||||||
|
pub struct TaxPattern {
|
||||||
|
start_anchored: bool,
|
||||||
|
end_anchored: bool,
|
||||||
|
segments: Vec<SegmentPattern>,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl TaxPattern {
|
||||||
|
pub fn parse(s: &str) -> Result<Self, TaxError> {
|
||||||
|
let s = s.trim();
|
||||||
|
|
||||||
|
let start_anchored = s.starts_with('/');
|
||||||
|
let s = if start_anchored { &s[1..] } else { s };
|
||||||
|
|
||||||
|
let end_anchored = s.ends_with('$');
|
||||||
|
let s = if end_anchored { &s[..s.len() - 1] } else { s };
|
||||||
|
|
||||||
|
if s.is_empty() {
|
||||||
|
return Err(TaxError::EmptyPattern);
|
||||||
|
}
|
||||||
|
|
||||||
|
let segments = s.split('/')
|
||||||
|
.map(SegmentPattern::parse)
|
||||||
|
.collect::<Result<Vec<_>, _>>()?;
|
||||||
|
|
||||||
|
Ok(Self { start_anchored, end_anchored, segments })
|
||||||
|
}
|
||||||
|
|
||||||
|
/// True if this pattern matches `path` according to the anchor flags.
|
||||||
|
///
|
||||||
|
/// The pattern must match a contiguous run of segments in the path.
|
||||||
|
/// Start/end anchors restrict where that run may begin or end.
|
||||||
|
pub fn matches(&self, path: &TaxPath) -> bool {
|
||||||
|
let n = self.segments.len();
|
||||||
|
let m = path.depth();
|
||||||
|
|
||||||
|
if n > m { return false; }
|
||||||
|
|
||||||
|
let segs = path.segments();
|
||||||
|
match (self.start_anchored, self.end_anchored) {
|
||||||
|
(true, true) => n == m && self.window_matches(segs, 0),
|
||||||
|
(true, false) => self.window_matches(segs, 0),
|
||||||
|
(false, true) => self.window_matches(segs, m - n),
|
||||||
|
(false, false) => (0..=(m - n)).any(|i| self.window_matches(segs, i)),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
fn window_matches(&self, segs: &[TaxSegment], start: usize) -> bool {
|
||||||
|
self.segments.iter()
|
||||||
|
.zip(segs[start..start + self.segments.len()].iter())
|
||||||
|
.all(|(pat, seg)| pat.matches(seg))
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,49 @@
|
|||||||
|
use std::fmt;
|
||||||
|
|
||||||
|
use crate::error::TaxError;
|
||||||
|
|
||||||
|
/// A single node in a taxonomy path: a name and an optional rank.
|
||||||
|
///
|
||||||
|
/// Neither `name` nor `rank` may contain `@` (reserved separator).
|
||||||
|
/// Serialised form: `name` or `name@rank`.
|
||||||
|
#[derive(Debug, Clone, PartialEq, Eq)]
|
||||||
|
pub struct TaxSegment {
|
||||||
|
name: String,
|
||||||
|
rank: Option<String>,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl TaxSegment {
|
||||||
|
pub fn parse(raw: &str) -> Result<Self, TaxError> {
|
||||||
|
let parts: Vec<&str> = raw.splitn(3, '@').collect();
|
||||||
|
|
||||||
|
let (name_raw, rank_raw) = match parts.as_slice() {
|
||||||
|
[name] => (*name, None),
|
||||||
|
[name, rank] => (*name, Some(*rank)),
|
||||||
|
_ => return Err(TaxError::AmbiguousRank { segment: raw.to_string() }),
|
||||||
|
};
|
||||||
|
|
||||||
|
if name_raw.is_empty() {
|
||||||
|
return Err(TaxError::EmptySegmentName);
|
||||||
|
}
|
||||||
|
|
||||||
|
let rank = match rank_raw {
|
||||||
|
None => None,
|
||||||
|
Some("") => return Err(TaxError::EmptyRankName { segment: raw.to_string() }),
|
||||||
|
Some(r) => Some(r.to_string()),
|
||||||
|
};
|
||||||
|
|
||||||
|
Ok(Self { name: name_raw.to_string(), rank })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn name(&self) -> &str { &self.name }
|
||||||
|
pub fn rank(&self) -> Option<&str> { self.rank.as_deref() }
|
||||||
|
}
|
||||||
|
|
||||||
|
impl fmt::Display for TaxSegment {
|
||||||
|
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
||||||
|
match &self.rank {
|
||||||
|
None => write!(f, "{}", self.name),
|
||||||
|
Some(r) => write!(f, "{}@{}", self.name, r),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,41 @@
|
|||||||
|
use crate::error::TaxError;
|
||||||
|
use crate::segment::TaxSegment;
|
||||||
|
|
||||||
|
/// A single segment in a query pattern: a required name and an optional rank filter.
|
||||||
|
///
|
||||||
|
/// If `rank` is `None`, the pattern matches any segment with the given name,
|
||||||
|
/// regardless of its stored rank. If `rank` is `Some(r)`, both name and rank
|
||||||
|
/// must match exactly.
|
||||||
|
#[derive(Debug, Clone, PartialEq, Eq)]
|
||||||
|
pub struct SegmentPattern {
|
||||||
|
name: String,
|
||||||
|
rank: Option<String>,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl SegmentPattern {
|
||||||
|
pub fn parse(raw: &str) -> Result<Self, TaxError> {
|
||||||
|
let parts: Vec<&str> = raw.splitn(3, '@').collect();
|
||||||
|
let (name_raw, rank_raw) = match parts.as_slice() {
|
||||||
|
[name] => (*name, None),
|
||||||
|
[name, rank] => (*name, Some(*rank)),
|
||||||
|
_ => return Err(TaxError::AmbiguousRank { segment: raw.to_string() }),
|
||||||
|
};
|
||||||
|
if name_raw.is_empty() {
|
||||||
|
return Err(TaxError::EmptySegmentName);
|
||||||
|
}
|
||||||
|
let rank = match rank_raw {
|
||||||
|
None => None,
|
||||||
|
Some("") => return Err(TaxError::EmptyRankName { segment: raw.to_string() }),
|
||||||
|
Some(r) => Some(r.to_string()),
|
||||||
|
};
|
||||||
|
Ok(Self { name: name_raw.to_string(), rank })
|
||||||
|
}
|
||||||
|
|
||||||
|
/// True if this pattern matches `seg`.
|
||||||
|
/// Name must match exactly. If a rank is specified in the pattern, the
|
||||||
|
/// segment's rank must match; otherwise any rank (or no rank) is accepted.
|
||||||
|
pub fn matches(&self, seg: &TaxSegment) -> bool {
|
||||||
|
self.name == seg.name()
|
||||||
|
&& self.rank.as_deref().map_or(true, |r| seg.rank() == Some(r))
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -1,28 +0,0 @@
|
|||||||
>F1FE4776BF3E1F06 {"seq_length":51,"kmer_size":31,"minimizer_size":11,"partition":229,"minimizer":"AAAAAAAATTA"}
|
|
||||||
GAGTATACTCATGTGAGGGTAAAAAAAATTAAGTCCCATATTGAAACATTA
|
|
||||||
>C14BF81526DD6CB7 {"seq_length":31,"kmer_size":31,"minimizer_size":11,"partition":84,"minimizer":"AAAAAAATTAA"}
|
|
||||||
AAAAAAATTAAGTCCCATATTGAAACATTAT
|
|
||||||
>9156D79605E4AC23 {"seq_length":31,"kmer_size":31,"minimizer_size":11,"partition":87,"minimizer":"AAAAAATTAAG"}
|
|
||||||
AAAAAATTAAGTCCCATATTGAAACATTATC
|
|
||||||
>74666D1D78812D1E {"seq_length":31,"kmer_size":31,"minimizer_size":11,"partition":118,"minimizer":"AAAAATTAAGT"}
|
|
||||||
AAAAATTAAGTCCCATATTGAAACATTATCA
|
|
||||||
>45EEFC3520FBDA9A {"seq_length":31,"kmer_size":31,"minimizer_size":11,"partition":32,"minimizer":"AAAATTAAGTC"}
|
|
||||||
AAAATTAAGTCCCATATTGAAACATTATCAC
|
|
||||||
>5F44864B90170AF4 {"seq_length":49,"kmer_size":31,"minimizer_size":11,"partition":137,"minimizer":"AAACATTATCA"}
|
|
||||||
AAATTAAGTCCCATATTGAAACATTATCACAAATGTGAGTTGTTAATAT
|
|
||||||
>8D10A11C86F8EF26 {"seq_length":42,"kmer_size":31,"minimizer_size":11,"partition":26,"minimizer":"AAATGTGAGTT"}
|
|
||||||
AACATTATCACAAATGTGAGTTGTTAATATTACATAATTGGG
|
|
||||||
>C18F1086D0AF6E34 {"seq_length":32,"kmer_size":31,"minimizer_size":11,"partition":9,"minimizer":"TGTGAGTTGTT"}
|
|
||||||
AATGTGAGTTGTTAATATTACATAATTGGGTT
|
|
||||||
>933477394DAF03BB {"seq_length":31,"kmer_size":31,"minimizer_size":11,"partition":48,"minimizer":"TAATTGGGTTT"}
|
|
||||||
TGTGAGTTGTTAATATTACATAATTGGGTTT
|
|
||||||
>3CEE7E5227956042 {"seq_length":36,"kmer_size":31,"minimizer_size":11,"partition":252,"minimizer":"AATTGGGTTTT"}
|
|
||||||
GTGAGTTGTTAATATTACATAATTGGGTTTTATGCT
|
|
||||||
>1BAF5B8767D63D0B {"seq_length":33,"kmer_size":31,"minimizer_size":11,"partition":201,"minimizer":"AAAGGCTCCCT"}
|
|
||||||
TGAAAGGCTCCCTAGCGTGTTAATTAATCTCCC
|
|
||||||
>8368A897DB263C6F {"seq_length":38,"kmer_size":31,"minimizer_size":11,"partition":22,"minimizer":"CCTAGCGTGTT"}
|
|
||||||
AAGGCTCCCTAGCGTGTTAATTAATCTCCCTGACAAGT
|
|
||||||
>247DC82E11CF8055 {"seq_length":35,"kmer_size":31,"minimizer_size":11,"partition":128,"minimizer":"AATCTCCCTGA"}
|
|
||||||
CTAGCGTGTTAATTAATCTCCCTGACAAGTAGTGT
|
|
||||||
>11C93BBC8A5F6327 {"seq_length":35,"kmer_size":31,"minimizer_size":11,"partition":62,"minimizer":"CAAGTAGTGTT"}
|
|
||||||
GTGTTAATTAATCTCCCTGACAAGTAGTGTTAGTG
|
|
||||||
Reference in New Issue
Block a user