Compare commits

...
4 Commits
Author SHA1 Message Date
Eric Coissac fd2c23e7df refactor: remove equivalence class folding from entropy pipeline
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 8m17s
Release / build-macos-arm64 (push) Successful in 1m41s
CI / build (pull_request) Successful in 3m33s
Removes circular-reverse complement machinery and explicit k-mer canonicalization across the entropy pipeline. Frequency tallying and Shannon entropy computation now operate directly on raw k-mer values, eliminating prior score inflation and alignment-dependent artifacts while preserving orientation invariance. Updates build scripts to generate normalized lookup tables for k-mer lengths 1–6, restricts the public API to `EntropyTracker`, and bumps crate versions. Documentation is updated to reflect the simplified raw-value approach and revised module structure.
2026-07-08 19:36:30 +02:00
Eric Coissac 912f788f7f feat: extract k-mer entropy computation into new obikentropy crate
Extracts streaming entropy logic and sliding-window frequency tracking from obiskbuilder into a dedicated obikentropy crate. Introduces an EntropyTracker accumulator for O(1) per-base normalized Shannon entropy, replaces inline rolling statistics with delegated state management, and updates workspace dependencies across obikindex, obikpartitionner, and obiskbuilder. Adds criterion benchmarks to validate the refactored pipeline throughput.
2026-07-08 18:36:16 +02:00
Eric Coissac e725523898 feat: add entropy-driven k-mer complexity filtering
Introduces a MinComplexity filter driven by new CLI arguments, enabling sequence-aware threshold checks during index reconstruction and partitioning. Adds the kmer_entropy module for normalized complexity scoring, updates the KmerFilter trait to evaluate per-kmer context, and refactors test modules for better organization.
2026-07-08 12:48:25 +02:00
coissac 165982fb07 Merge pull request 'Bump obikmer version to 1.1.38 and add memory footprint logging' (#60) from push-slxmykzqmzzv into main
Reviewed-on: #60
2026-07-08 10:15:51 +00:00
26 changed files with 822 additions and 631 deletions
+32 -16
View File
@@ -1,6 +1,6 @@
# Kmer entropy filter # Kmer entropy filter
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for two sources of bias: the small number of observations within a single kmer, and the unequal sizes of circular equivalence classes. Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for one source of bias: the small number of observations within a single kmer relative to the number of possible sub-words.
## Sub-word frequencies ## Sub-word frequencies
@@ -8,17 +8,15 @@ For a kmer of length k and a sub-word size ws (1 ≤ ws ≤ ws_max, typically ws
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$ $$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
Each sub-word is mapped to its **circular canonical form**: the lexicographic minimum among all cyclic rotations of the word **and all cyclic rotations of its reverse complement**. This extended equivalence relation ensures that entropy(K) = entropy(revcomp(K)) — the filter is strand-symmetric. Let $s_j$ be the size of equivalence class $j$ (number of distinct raw words mapping to canonical form $j$), and $f_j$ the count of canonical form $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$). Each sub-word is tallied under its own raw 2-bit-packed value — **no canonicalization**. Let $f_j$ be the count of raw word $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$), over the $4^{ws}$ possible raw words.
An earlier version of this filter first folded each sub-word into a circular+reverse-complement equivalence class, then "unfolded" the observed class frequency back onto its members to correct for unequal class sizes. That machinery bought nothing it was claimed for — see *Why no equivalence classes* below — while measurably weakening detection of the very sequences the filter exists to catch, so it was removed.
## Corrected Shannon entropy ## Corrected Shannon entropy
The circular equivalence classes have unequal sizes: under a uniform distribution over all $4^{ws}$ raw words, class $j$ is visited with probability $s_j / 4^{ws}$, not $1/n_a$. Computing entropy directly over canonical classes therefore underestimates the entropy of a random sequence. $$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j$$
The correction "unfolds" each canonical class back to its member raw words, redistributing each observation of class $j$ equally among its $s_j$ members: This is a plain Shannon entropy over the observed raw-word frequencies.
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j + \frac{1}{n_{\text{words}}} \sum_j f_j \log s_j$$
The last term is the correction for unequal class sizes. For a uniformly random sequence ($f_j \approx n_{\text{words}} \cdot s_j / 4^{ws}$), this gives $H_{\text{corr}} \approx \log(4^{ws}) = 2 \cdot ws \cdot \log 2$, the maximum entropy over raw words.
## Maximum entropy correction for small samples ## Maximum entropy correction for small samples
@@ -42,27 +40,45 @@ $$\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)$$
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc. A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
## Why no equivalence classes
A prior design folded each sub-word into the canonical form of its circular-rotation + reverse-complement equivalence class before tallying, on the reasoning that (a) it guarantees $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, and (b) collapsing phase-shifted repeats (e.g. `ATG``TGA``GAT`) into one class better reflects that they are "the same" low-complexity pattern.
Both properties already hold for the raw, unfolded entropy above, without any class machinery:
- **Reverse complement**: for any K of length n, window $j$ of $\text{revcomp}(K)$ equals $\text{revcomp}$ of window $(n{-}ws{-}j)$ of K. This is a bijection between the window sets under which each window maps to its own revcomp — and revcomp is itself a bijection (involution) on the space of raw ws-mers. So the multiset of raw-word frequencies for $\text{revcomp}(K)$ is exactly a relabeling of the multiset for K, and Shannon entropy — a function of the frequency multiset alone — is exactly invariant. No folding required, for any K.
- **Tandem repeats**: a period-p repeat sampled by a stride-1 sliding window naturally cycles through its own rotations as raw tokens (e.g. `ATGATGATG…` yields the raw words `ATG`, `TGA`, `GAT` in rotation as the window slides). The low diversity this represents (few distinct raw words out of $4^{ws}$ possible) is already visible in the raw frequency distribution — no folding needed to detect it.
What the fold-then-unfold step actually did was credit each observed class with the frequency of equivalence-class members that were **never observed on the read strand**, inflating $H_{\text{corr}}$ for genuine repeats. Worked example: k=31, ws=3, kmer = `ATG` repeated ($n_{\text{words}}=29$, all 29 windows fall into one class of size 6 under the old scheme — 3 rotations × forward/revcomp):
| | $H_{\text{corr}}$ | normalized |
|---|---|---|
| old (folded, class size 6) | $\log 6 \approx 1.79$ | $\approx 0.53$ |
| current (raw, unfolded) | $\log 3 \approx 1.10$ | $\approx 0.33$ |
The gap is not a rounding artifact: per sub-word order, the folded score for this same repeat swings from 0.53 (ws=3, aligned with the period) up to **1.03** (ws=5, misaligned with the period) — i.e. a period-3 repeat could score *above* the theoretical maximum for a random sequence, depending on which ws happens to divide the repeat's period. The raw formula stays flat at ≈0.33–0.40 across ws=2..6 regardless of alignment, which is the robustness the "minimum across ws" design was meant to provide in the first place.
## Interpretation as an effective number of classes ## Interpretation as an effective number of classes
$H_{\text{corr}}$ is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable classes that would yield the same entropy. $H_{\text{corr}}$ is a standard Shannon entropy over raw words, so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable raw words that would yield the same entropy.
For the normalised score $\hat{H}$, dividing by $H_{\text{max}}$ changes the logarithm base: For the normalised score $\hat{H}$, dividing by $H_{\max}$ changes the logarithm base:
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\text{max}}} = \log_{N_{\text{max}}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\text{max}}^{\,\hat{H}}$$ $$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\max}} = \log_{N_{\max}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\max}^{\,\hat{H}}$$
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\text{max}}$) of the effective number of equi-represented classes. The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\max}$) of the effective number of equi-represented raw words.
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\text{max}} \approx 4^{ws}$, giving: In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\max} \approx 4^{ws}$, giving:
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$ $$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective classes out of 16 are occupied. This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective words out of 16 are occupied.
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\text{max}} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\text{max}}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$. In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\max} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\max}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
## Properties ## Properties
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences: The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, guaranteed by the strand-symmetric canonical form. - **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$ — see *Why no equivalence classes* above for why this holds without any explicit strand-folding step.
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers. - **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
+7 -3
View File
@@ -3,10 +3,14 @@
## Code couvert ## Code couvert
- `obiskbuilder/src/entropy_table.rs` — filtre Shannon sur les kmers à basse complexité - `obikentropy/src/table.rs`, `obikentropy/src/tracker.rs` — formule d'entropie et tables de correction petits effectifs
- `obiskbuilder/src/lib.rs` — application du filtre lors du scatter (phase 1) - `obikentropy/src/kmer_entropy.rs` — entropie d'un kmer isolé (`KmerEntropy`)
- `obiskbuilder/src/rolling_stat.rs` — composition de `obikentropy::EntropyTracker` dans le suivi streaming (sélection de minimiseur + entropie)
- `obiskbuilder/src/iter.rs`, `obiskbuilder/src/stream_iter.rs` — application du filtre lors du scatter (phase 1)
## Notes ## Notes
Document théorique stable. Vérifier que les paramètres `theta` et `level_max` dans le CLI Le repli en classes d'équivalence circulaires + brin inverse (décrit dans une version antérieure de ce document) a été supprimé : voir la section « Why no equivalence classes » de `entropy.md` pour la justification théorique et numérique.
Vérifier que les paramètres `theta` et `level_max` dans le CLI
(`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit. (`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit.
+11 -1
View File
@@ -1682,6 +1682,13 @@ dependencies = [
"xxhash-rust", "xxhash-rust",
] ]
[[package]]
name = "obikentropy"
version = "0.1.0"
dependencies = [
"obikseq",
]
[[package]] [[package]]
name = "obikindex" name = "obikindex"
version = "0.1.0" version = "0.1.0"
@@ -1704,7 +1711,7 @@ dependencies = [
[[package]] [[package]]
name = "obikmer" name = "obikmer"
version = "1.1.38" version = "1.1.39"
dependencies = [ dependencies = [
"clap", "clap",
"csv", "csv",
@@ -1742,6 +1749,7 @@ dependencies = [
"niffler 3.0.0", "niffler 3.0.0",
"obicompactvec", "obicompactvec",
"obidebruinj", "obidebruinj",
"obikentropy",
"obikrope", "obikrope",
"obikseq", "obikseq",
"obilayeredmap", "obilayeredmap",
@@ -1824,7 +1832,9 @@ dependencies = [
name = "obiskbuilder" name = "obiskbuilder"
version = "0.1.0" version = "0.1.0"
dependencies = [ dependencies = [
"criterion2",
"lazy_static", "lazy_static",
"obikentropy",
"obikrope", "obikrope",
"obikseq", "obikseq",
"obiread", "obiread",
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace] [workspace]
resolver = "3" resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"] members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy"]
[profile.release] [profile.release]
debug = 1 debug = 1
+10
View File
@@ -0,0 +1,10 @@
[package]
name = "obikentropy"
version = "0.1.0"
edition = "2024"
[dependencies]
obikseq = { path = "../obikseq" }
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
@@ -4,57 +4,6 @@ use std::path::PathBuf;
const K_MAX: usize = 32; const K_MAX: usize = 32;
const WS_MAX: usize = 6; const WS_MAX: usize = 6;
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
for _ in 0..ws - 1 {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
}
canonical
}
fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
fn build_normalized_kmer(k: usize) -> Vec<u64> {
let n = 1usize << (k * 2);
let shift = 64 - k * 2;
let mut result = vec![0u64; n];
for i in 0..n {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
}
result
}
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
let n = norm.len();
let mut sizes = vec![0u32; n];
for &c in norm {
sizes[c as usize] += 1;
}
norm.iter()
.map(|&c| {
let s = sizes[c as usize];
if s > 0 { (s as f64).ln() } else { 0.0 }
})
.collect()
}
fn build_n_log_n() -> [f64; K_MAX + 1] { fn build_n_log_n() -> [f64; K_MAX + 1] {
let mut t = [0.0f64; K_MAX + 1]; let mut t = [0.0f64; K_MAX + 1];
for n in 1..=K_MAX { for n in 1..=K_MAX {
@@ -63,6 +12,9 @@ fn build_n_log_n() -> [f64; K_MAX + 1] {
t t
} }
/// Max achievable entropy over `4^ws` raw sub-words given only `nwords`
/// observations (most-uniform integer partition), per
/// `docmd/theory/entropy.md`.
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] { fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1]; let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
for k in 2..=K_MAX { for k in 2..=K_MAX {
@@ -125,13 +77,6 @@ fn main() {
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap()); let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
let mut out = String::new(); let mut out = String::new();
for k in 1..=6usize {
let n = 1usize << (k * 2);
let norm = build_normalized_kmer(k);
let ln_class = build_ln_class(&norm);
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
}
let n_log_n = build_n_log_n(); let n_log_n = build_n_log_n();
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n); emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
@@ -141,5 +86,5 @@ fn main() {
let log_nwords = build_log_nwords(); let log_nwords = build_log_nwords();
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords); emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap(); fs::write(out_dir.join("entropy_tables.rs"), out).unwrap();
} }
+41
View File
@@ -0,0 +1,41 @@
//! Normalized entropy of an isolated, already-built k-mer (e.g. one
//! reconstructed from an index's `unitigs.bin`, with no surrounding
//! sequence) — drives the window through [`EntropyTracker`] one base at a
//! time, exactly like the streaming path, so a `theta` threshold means the
//! same thing whether applied during index construction or after the fact
//! (e.g. `obikmer filter`).
use obikseq::CanonicalKmer;
use crate::tracker::EntropyTracker;
/// Extension trait: compute the normalized entropy of a single canonical
/// k-mer, independent of any surrounding sequence.
pub trait KmerEntropy {
/// Normalized entropy across sub-word orders `1..=level_max` (the
/// minimum is taken across orders). Lower means less complex; `theta`
/// in `index`/`filter` rejects k-mers with a score `< theta`.
fn entropy(&self, level_max: usize) -> f64;
}
impl KmerEntropy for CanonicalKmer {
fn entropy(&self, level_max: usize) -> f64 {
let raw = self.raw(); // left-aligned, 2 bits/base, MSB-first
let k = obikseq::params::k();
let mask = (!0u64) >> (64 - k * 2);
let mut tracker = EntropyTracker::new(k);
let mut rolling: u64 = 0;
for i in 0..k {
let shift = 64 - 2 * (i + 1);
let base = (raw >> shift) & 3;
rolling = ((rolling << 2) | base) & mask;
tracker.push(i + 1, rolling);
}
tracker.normalized_entropy(level_max)
}
}
#[cfg(test)]
#[path = "tests/kmer_entropy.rs"]
mod tests;
+17
View File
@@ -0,0 +1,17 @@
//! Normalized k-mer entropy: formulas, tables, and a streaming tracker.
//!
//! This crate holds every piece of the entropy computation described in
//! `docmd/theory/entropy.md`: the compile-time tables ([`table`], private),
//! the incremental accumulator ([`EntropyTracker`]) that callers compose
//! into their own streaming state, and the [`KmerEntropy`] convenience trait
//! for scoring a single, already-built k-mer.
#![deny(missing_docs)]
mod kmer_entropy;
mod ring;
mod table;
mod tracker;
pub use kmer_entropy::KmerEntropy;
pub use tracker::EntropyTracker;
+40
View File
@@ -0,0 +1,40 @@
//! Stack-allocated ring buffer backing the sliding sub-word windows.
/// Fixed-capacity ring buffer backed by a stack array.
/// N must be a power of two; operations are branchless via `% N`.
pub(crate) struct Ring<T: Copy + Default, const N: usize> {
buf: [T; N],
head: usize,
len: usize,
}
impl<T: Copy + Default, const N: usize> Ring<T, N> {
#[inline]
pub(crate) fn new() -> Self {
Self {
buf: [T::default(); N],
head: 0,
len: 0,
}
}
#[inline]
pub(crate) fn clear(&mut self) {
self.len = 0;
self.head = 0;
}
#[inline]
pub(crate) fn push_back(&mut self, val: T) {
self.buf[(self.head + self.len) % N] = val;
self.len += 1;
}
#[inline]
pub(crate) fn pop_front(&mut self) -> T {
let val = self.buf[self.head];
self.head = (self.head + 1) % N;
self.len -= 1;
val
}
}
+30
View File
@@ -0,0 +1,30 @@
//! Compile-time tables backing the normalized k-mer entropy formula: the
//! max-entropy correction for small samples. See `docmd/theory/entropy.md`.
//!
//! Entropy is computed directly on raw (non-canonicalized) sub-words — no
//! equivalence-class folding. Empirically (see the discussion that produced
//! this crate's history), folding sub-words into circular/revcomp classes
//! before unfolding them back buys nothing for the invariances it was meant
//! to guarantee (both hold for raw sub-word entropy already, by a direct
//! bijection argument for revcomp and by the sliding window's own dynamics
//! for tandem repeats), while it measurably *weakens* detection of the
//! low-complexity sequences the filter exists to catch.
include!(concat!(env!("OUT_DIR"), "/entropy_tables.rs"));
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
+52
View File
@@ -0,0 +1,52 @@
use super::*;
use obikseq::Sequence;
use obikseq::kmer::Kmer;
const K: usize = 21;
const LEVEL_MAX: usize = 6;
fn kmer_from_ascii(seq: &[u8]) -> CanonicalKmer {
obikseq::set_k(K);
Kmer::from_ascii(seq).expect("valid k-mer sequence").canonical()
}
#[test]
fn homopolymer_scores_lower_than_diverse_sequence() {
let homopolymer = kmer_from_ascii(b"AAAAAAAAAAAAAAAAAAAAA"); // 21 bases
let diverse = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT"); // 21 bases, same as used elsewhere in this workspace's tests
let e_homopolymer = homopolymer.entropy(LEVEL_MAX);
let e_diverse = diverse.entropy(LEVEL_MAX);
assert!(
e_homopolymer < e_diverse,
"homopolymer ({e_homopolymer}) should score lower than a diverse sequence ({e_diverse})"
);
// A pure homopolymer is the most degenerate case representable — its
// score should sit near the bottom of the range, not just "somewhat lower".
assert!(e_homopolymer < 0.3, "homopolymer entropy unexpectedly high: {e_homopolymer}");
}
#[test]
fn entropy_is_deterministic_for_the_same_kmer() {
let a = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
let b = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
assert_eq!(a.entropy(LEVEL_MAX), b.entropy(LEVEL_MAX));
}
#[test]
fn entropy_is_within_zero_one_range() {
let mut repeat = "AT".repeat(K / 2 + 1);
repeat.truncate(K);
for seq in [
"AAAAAAAAAAAAAAAAAAAAA".to_string(),
repeat,
"CATTAGCGTACCTGATCAGGT".to_string(),
] {
assert_eq!(seq.len(), K, "test sequence must be exactly K bases: {seq:?}");
let kmer = kmer_from_ascii(seq.as_bytes());
let e = kmer.entropy(LEVEL_MAX);
assert!((0.0..=1.0).contains(&e), "entropy {e} out of [0,1] for {seq:?}");
}
}
+255
View File
@@ -0,0 +1,255 @@
//! Incremental (streaming) normalized k-mer entropy.
//!
//! [`EntropyTracker`] maintains, over a sliding window of the last `k` bases,
//! the per-sub-word-size raw-word frequency statistics needed to evaluate
//! the corrected Shannon entropy described in `docmd/theory/entropy.md`,
//! updated in O(1) per base rather than recomputed from scratch. No
//! canonicalization is applied — each sub-word is tallied under its own raw
//! 2-bit-packed value; only the small-sample max-entropy correction departs
//! from a textbook Shannon entropy.
//!
//! It carries no notion of minimizers or superkmer segmentation — callers
//! that need both (e.g. `obiskbuilder::RollingStat`) compose an
//! `EntropyTracker` as a plain field alongside their own state, so the two
//! concerns update in the same streaming pass without being conflated in one
//! struct.
use crate::ring::Ring;
use crate::table::{WS_MAX, emax, log_nwords, n_log_n};
/// Incremental normalized-entropy accumulator over a sliding window of `k`
/// bases. Composed as a plain field by callers that also need other
/// per-base state (e.g. minimizer selection) in the same streaming pass.
pub struct EntropyTracker {
k: usize,
steady: bool,
// Sliding-window queues over the last `k` raw sub-words, one per word
// size — stack-allocated, capacity ≤ k ≤ 31.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
// Frequency count arrays, indexed by the raw sub-word value (2 bits per
// base). Max count per cell ≤ k ≤ 31 → u8 is sufficient.
k1c: [u8; 4],
k2c: [u8; 16],
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
}
impl EntropyTracker {
/// New tracker for a window of `k` bases (1..=31).
pub fn new(k: usize) -> Self {
Self {
k,
steady: false,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
k1c: [0; 4],
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
}
}
/// Clear all accumulated state, ready to track a new window from
/// scratch (`k` is unchanged).
pub fn reset(&mut self) {
self.steady = false;
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.sum_f_log_f = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], f: usize) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
}
#[inline]
fn update_sums_increment<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], g: usize) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
}
/// Advance the window by one base. `received` is the caller's running
/// count of bases pushed so far (1-based, i.e. after this base);
/// `rolling_kmer` is the current right-aligned, 2-bit-packed k-mer
/// window (same convention as `obiskbuilder::RollingStat::rolling_k`).
pub fn push(&mut self, received: usize, rolling_kmer: u64) {
let raw1 = rolling_kmer & 3;
let raw2 = rolling_kmer & 15;
let raw3 = rolling_kmer & 63;
let raw4 = rolling_kmer & 255;
let raw5 = rolling_kmer & 1023;
let raw6 = rolling_kmer & 4095;
if received > self.k {
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(&mut self.sum_f_log_f, f1);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(&mut self.sum_f_log_f, f2);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(&mut self.sum_f_log_f, f3);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(&mut self.sum_f_log_f, f4);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(&mut self.sum_f_log_f, f5);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(&mut self.sum_f_log_f, f6);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
} else {
self.push_warmup_increments(received, raw1, raw2, raw3, raw4, raw5, raw6);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
received: usize,
raw1: u64, raw2: u64, raw3: u64,
raw4: u64, raw5: u64, raw6: u64,
) {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
if received >= 2 {
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
if received >= 3 {
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
if received >= 4 {
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
if received >= 5 {
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
if received >= 6 {
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
self.steady = true;
}
}
}
}
}
}
/// Normalized entropy at sub-word size `order` (1..=6). The caller is
/// responsible for not calling this before the window is full (`k`
/// bases pushed) — an empty/partial window yields a meaningless value.
pub fn entropy(&self, order: usize) -> f64 {
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return 1.0;
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw - self.sum_f_log_f[order] / nw_f;
(h_corr / em).max(0.0)
}
/// Minimum of [`Self::entropy`] over sub-word sizes `1..=order_max`, same
/// caller responsibility re: window readiness as `entropy`.
pub fn normalized_entropy(&self, order_max: usize) -> f64 {
let min_e = (1..=order_max)
.map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
if min_e == f64::MAX { 1.0 } else { min_e }
}
}
+1 -1
View File
@@ -1,6 +1,6 @@
[package] [package]
name = "obikmer" name = "obikmer"
version = "1.1.38" version = "1.1.39"
edition = "2024" edition = "2024"
[[bin]] [[bin]]
+18 -3
View File
@@ -2,14 +2,14 @@ use std::path::PathBuf;
use clap::Args; use clap::Args;
use obikindex::{KmerIndex, MergeMode}; use obikindex::{KmerIndex, MergeMode};
use obikpartitionner::filter::{MaxTotalCount, MinTotalCount}; use obikpartitionner::filter::{MaxTotalCount, MinComplexity, MinTotalCount};
use obisys::Reporter; use obisys::Reporter;
use tracing::info; use tracing::info;
use super::predicate::FilterArgs as KmerFilterArgs; use super::predicate::FilterArgs as KmerFilterArgs;
#[derive(Args)] #[derive(Args)]
pub struct FilterArgs { pub struct FilterCmdArgs {
/// Source index directory /// Source index directory
pub source: PathBuf, pub source: PathBuf,
@@ -28,6 +28,18 @@ pub struct FilterArgs {
#[arg(long)] #[arg(long)]
pub max_total_count: Option<u32>, pub max_total_count: Option<u32>,
/// Minimum normalized entropy (complexity) to keep a k-mer — same metric
/// as `obikmer index`'s --theta, applied here to k-mers already committed
/// to the source index (reconstructed from unitigs.bin). K-mers scoring
/// below this are removed.
#[arg(long)]
pub min_complexity: Option<f64>,
/// Maximum sub-word size for the complexity computation (see `obikmer
/// index`'s --level-max). Only used when --min-complexity is set.
#[arg(long, default_value_t = 6)]
pub complexity_level_max: usize,
/// Output as presence/absence instead of counts /// Output as presence/absence instead of counts
#[arg(long)] #[arg(long)]
pub presence: bool, pub presence: bool,
@@ -37,7 +49,7 @@ pub struct FilterArgs {
pub force: bool, pub force: bool,
} }
pub fn run(args: FilterArgs) { pub fn run(args: FilterCmdArgs) {
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| { let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
eprintln!("error opening source index: {e}"); eprintln!("error opening source index: {e}");
std::process::exit(1); std::process::exit(1);
@@ -62,6 +74,9 @@ pub fn run(args: FilterArgs) {
if let Some(v) = args.max_total_count { if let Some(v) = args.max_total_count {
filters.push(Box::new(MaxTotalCount { total: v })); filters.push(Box::new(MaxTotalCount { total: v }));
} }
if let Some(theta) = args.min_complexity {
filters.push(Box::new(MinComplexity { level_max: args.complexity_level_max, theta }));
}
let mut rep = Reporter::new(); let mut rep = Reporter::new();
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep) KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
+1 -1
View File
@@ -21,7 +21,7 @@ enum Commands {
/// Merge multiple built indexes into one /// Merge multiple built indexes into one
Merge(cmd::merge::MergeArgs), Merge(cmd::merge::MergeArgs),
/// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates /// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates
Filter(cmd::filter::FilterArgs), Filter(cmd::filter::FilterCmdArgs),
/// Project and/or aggregate genome columns into a new or in-place index /// Project and/or aggregate genome columns into a new or in-place index
Select(cmd::select::SelectArgs), Select(cmd::select::SelectArgs),
/// Query an index with sequences and annotate matches /// Query an index with sequences and annotate matches
+2 -1
View File
@@ -6,7 +6,6 @@ edition = "2024"
[dev-dependencies] [dev-dependencies]
tempfile = "3" tempfile = "3"
obikseq = { path = "../obikseq", features = ["test-utils"] } obikseq = { path = "../obikseq", features = ["test-utils"] }
obiskbuilder = { path = "../obiskbuilder" }
obiread = { path = "../obiread" } obiread = { path = "../obiread" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
@@ -14,6 +13,8 @@ obikrope = { path = "../obikrope" }
niffler = "3.0.0" niffler = "3.0.0"
remove_dir_all = "0.8" remove_dir_all = "0.8"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikentropy = { path = "../obikentropy" }
obiskbuilder = { path = "../obiskbuilder" }
obiskio = { path = "../obiskio" } obiskio = { path = "../obiskio" }
obidebruinj = { path = "../obidebruinj" } obidebruinj = { path = "../obidebruinj" }
obilayeredmap = { path = "../obilayeredmap" } obilayeredmap = { path = "../obilayeredmap" }
+14 -12
View File
@@ -62,7 +62,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot); let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row); cont = cb(kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -75,7 +75,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect(); let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row); cont = cb(kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -83,18 +83,19 @@ impl KmerPartition {
} }
cont cont
} else { } else {
// No data matrix: implicit presence — all values are 1. // No data matrix: implicit presence — all values are 1. `row`
// The filter result is identical for every kmer, so evaluate once. // is identical for every kmer, but a filter can still depend
// on the kmer's own sequence (e.g. MinComplexity), so this
// cannot be evaluated once for the whole layer — filters must
// still be tested per kmer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into(); let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true; let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() { if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(kmer, all_present.clone()); cont = cb(kmer, all_present.clone());
if !cont { break; } if !cont { break; }
} }
} }
}
cont cont
}; };
@@ -140,7 +141,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot); let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row); cont = cb(part, layer, kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -153,7 +154,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect(); let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row); cont = cb(part, layer, kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -161,16 +162,17 @@ impl KmerPartition {
} }
cont cont
} else { } else {
// Same as iter_partition_kmers: row is constant but a filter
// may still depend on the kmer's own sequence, so this must
// be tested per kmer, not once for the whole layer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into(); let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true; let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() { if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(part, layer, kmer, all_present.clone()); cont = cb(part, layer, kmer, all_present.clone());
if !cont { break; } if !cont { break; }
} }
} }
}
cont cont
}; };
+49 -13
View File
@@ -1,17 +1,24 @@
use obicompactvec::FilterMask; use obicompactvec::FilterMask;
use obikseq::CanonicalKmer;
/// Trait for kmer row filters. /// Trait for kmer filters.
/// ///
/// `kmer` is the k-mer's own canonical sequence, reconstructed from the
/// source index's `unitigs.bin` (always present — see `rebuild_layer.rs`);
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data). /// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
/// `n_genomes` equals `row.len()`. /// `n_genomes` equals `row.len()`. Most filters only need `row` — `kmer` is
/// there for filters that reason about the k-mer's sequence itself (e.g.
/// [`MinComplexity`]).
pub trait KmerFilter: Send + Sync { pub trait KmerFilter: Send + Sync {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool; fn passes(&self, kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool;
/// Express this filter as a [`FilterMask`] column-operation expression. /// Express this filter as a [`FilterMask`] column-operation expression.
/// ///
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix /// Returns `Some(expr)` if the filter can be evaluated solely from matrix
/// column aggregates (no per-kmer row scan needed). Returns `None` if the /// column aggregates (no per-kmer row scan needed). Returns `None` if the
/// filter requires row-level inspection. /// filter requires row-level inspection — always the case for a filter
/// that needs the k-mer's sequence, since a `FilterMask` only expresses
/// per-genome column aggregates, never per-slot sequence data.
/// ///
/// `threshold` semantics in the returned mask use `>= threshold`, matching /// `threshold` semantics in the returned mask use `>= threshold`, matching
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any /// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
@@ -23,8 +30,13 @@ pub trait KmerFilter: Send + Sync {
/// True when `row` passes every filter in `filters`. /// True when `row` passes every filter in `filters`.
/// Returns `true` if `filters` is empty. /// Returns `true` if `filters` is empty.
pub fn passes_all(filters: &[Box<dyn KmerFilter>], row: &[u32], n_genomes: usize) -> bool { pub fn passes_all(
filters.iter().all(|f| f.passes(row, n_genomes)) filters: &[Box<dyn KmerFilter>],
kmer: CanonicalKmer,
row: &[u32],
n_genomes: usize,
) -> bool {
filters.iter().all(|f| f.passes(kmer, row, n_genomes))
} }
// ── Quorum filters ───────────────────────────────────────────────────────────── // ── Quorum filters ─────────────────────────────────────────────────────────────
@@ -40,7 +52,7 @@ pub struct MinGenomeFraction {
} }
impl KmerFilter for MinGenomeFraction { impl KmerFilter for MinGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold); let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 >= self.frac p as f64 / n_genomes as f64 >= self.frac
} }
@@ -63,7 +75,7 @@ pub struct MaxGenomeFraction {
} }
impl KmerFilter for MaxGenomeFraction { impl KmerFilter for MaxGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold); let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 <= self.frac p as f64 / n_genomes as f64 <= self.frac
} }
@@ -86,7 +98,7 @@ pub struct MinGenomeCount {
} }
impl KmerFilter for MinGenomeCount { impl KmerFilter for MinGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) >= self.count present_count(row, self.threshold) >= self.count
} }
@@ -107,7 +119,7 @@ pub struct MaxGenomeCount {
} }
impl KmerFilter for MaxGenomeCount { impl KmerFilter for MaxGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) <= self.count present_count(row, self.threshold) <= self.count
} }
@@ -129,7 +141,7 @@ pub struct MinTotalCount {
} }
impl KmerFilter for MinTotalCount { impl KmerFilter for MinTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() >= self.total row.iter().sum::<u32>() >= self.total
} }
@@ -147,7 +159,7 @@ pub struct MaxTotalCount {
} }
impl KmerFilter for MaxTotalCount { impl KmerFilter for MaxTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() <= self.total row.iter().sum::<u32>() <= self.total
} }
@@ -212,7 +224,7 @@ impl GroupQuorumFilter {
} }
impl KmerFilter for GroupQuorumFilter { impl KmerFilter for GroupQuorumFilter {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
if !self.ingroup_idx.is_empty() { if !self.ingroup_idx.is_empty() {
let n = self.ingroup_idx.iter() let n = self.ingroup_idx.iter()
.filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold) .filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold)
@@ -260,3 +272,27 @@ impl KmerFilter for GroupQuorumFilter {
Some(FilterMask::And(parts)) Some(FilterMask::And(parts))
} }
} }
// ── Complexity filter (post-hoc, sequence-based) ──────────────────────────────
/// Reject k-mers with normalized entropy below `theta` — the same complexity
/// metric `obikmer index`'s `--theta`/`--level-max` apply *during* superkmer
/// construction (see [`obikentropy::KmerEntropy`]), applied here after the
/// fact, to k-mers already committed to a built index.
///
/// Unlike every other filter in this module, this one needs the k-mer's own
/// sequence, not its per-genome row — `column_mask_expr` is never overridden
/// (stays `None`), so this filter always forces the row-level scan path in
/// `rebuild_layer.rs` (which reconstructs the sequence from `unitigs.bin`
/// regardless, so no extra I/O beyond what filtering already requires).
pub struct MinComplexity {
pub level_max: usize,
pub theta: f64,
}
impl KmerFilter for MinComplexity {
fn passes(&self, kmer: CanonicalKmer, _row: &[u32], _n_genomes: usize) -> bool {
use obikentropy::KmerEntropy;
kmer.entropy(self.level_max) >= self.theta
}
}
+2 -2
View File
@@ -126,7 +126,7 @@ fn iter_src_kmers_masked(
Some(m) => m.get(slot), Some(m) => m.get(slot),
None => { None => {
let row = src_data.fill_row_by_slot(slot, n_genomes); let row = src_data.fill_row_by_slot(slot, n_genomes);
filters.iter().all(|f| f.passes(&row, n_genomes)) filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
} }
}; };
if passes { cb(kmer); } if passes { cb(kmer); }
@@ -165,7 +165,7 @@ fn iter_src_layers(
cb(kmer, row.into_boxed_slice()); cb(kmer, row.into_boxed_slice());
} else { } else {
let row = src_data.fill_row_by_slot(slot, n_genomes); let row = src_data.fill_row_by_slot(slot, n_genomes);
if filters.iter().all(|f| f.passes(&row, n_genomes)) { if filters.iter().all(|f| f.passes(kmer, &row, n_genomes)) {
cb(kmer, row.into_boxed_slice()); cb(kmer, row.into_boxed_slice());
} }
} }
+6
View File
@@ -7,7 +7,13 @@ edition = "2024"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
obiread = { path = "../obiread" } obiread = { path = "../obiread" }
obikentropy = { path = "../obikentropy" }
lazy_static = "1.5.0" lazy_static = "1.5.0"
[dev-dependencies] [dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] } obikseq = { path = "../obikseq", features = ["test-utils"] }
criterion2 = { version = "3", features = ["cargo_bench_support"] }
[[bench]]
name = "superkmer_stream"
harness = false
@@ -0,0 +1,58 @@
//! Throughput of the streaming superkmer pipeline (`RollingStat`'s hot path:
//! minimizer selection + entropy tracking fused in a single pass).
//!
//! Reference point for the `obikentropy` extraction: the entropy bookkeeping
//! that used to live inline in `RollingStat` was pulled out into a composed
//! `EntropyTracker`. This benchmark is run before and after that change to
//! confirm no regression.
use criterion::{Criterion, Throughput, criterion_group, criterion_main};
use obikrope::Rope;
use obiskbuilder::SuperKmerIter;
const K: usize = 21;
const M: usize = 9;
const LEVEL_MAX: usize = 6;
const THETA: f64 = 0.7;
const SEQ_LEN: usize = 200_000;
/// Deterministic pseudo-random ACGT sequence — high enough complexity that
/// the entropy filter rarely rejects, so the bench stays on the steady-state
/// path rather than repeatedly resetting.
fn make_sequence(len: usize) -> Vec<u8> {
let mut state: u64 = 0x9E3779B97F4A7C15;
(0..len)
.map(|_| {
state ^= state << 13;
state ^= state >> 7;
state ^= state << 17;
b"ACGT"[(state % 4) as usize]
})
.collect()
}
fn make_rope(seq: &[u8]) -> Rope {
let mut rope = Rope::new(None);
rope.push(seq.to_vec());
rope
}
fn bench_build_superkmers(c: &mut Criterion) {
obikseq::set_k(K);
obikseq::set_m(M);
let seq = make_sequence(SEQ_LEN);
let rope = make_rope(&seq);
let mut group = c.benchmark_group("build_superkmers");
group.throughput(Throughput::Bytes(SEQ_LEN as u64));
group.bench_function("stream", |b| {
b.iter(|| {
SuperKmerIter::new(std::hint::black_box(&rope), K, LEVEL_MAX, THETA).count()
});
});
group.finish();
}
criterion_group!(benches, bench_build_superkmers);
criterion_main!(benches);
-108
View File
@@ -1,108 +0,0 @@
pub(crate) const NORMK1: [u64; 4] = build_normalized_kmer::<4>();
pub(crate) const NORMK2: [u64; 16] = build_normalized_kmer::<16>();
pub(crate) const NORMK3: [u64; 64] = build_normalized_kmer::<64>();
pub(crate) const NORMK4: [u64; 256] = build_normalized_kmer::<256>();
pub(crate) const NORMK5: [u64; 1024] = build_normalized_kmer::<1024>();
pub(crate) const NORMK6: [u64; 4096] = build_normalized_kmer::<4096>();
include!(concat!(env!("OUT_DIR"), "/ln_class_tables.rs"));
const fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
let mut i = 0;
while i < (ws - 1) {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
i += 1;
}
canonical
}
const fn build_normalized_kmer<const N: usize>() -> [u64; N] {
let mut result = [0u64; N];
let k = k_from_n::<N>();
let shift = 64 - k * 2;
let mut i = 0;
while i < N {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
i += 1;
}
result
}
const fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
const fn k_from_n<const N: usize>() -> usize {
match N {
4 => 1,
16 => 2,
64 => 3,
256 => 4,
1024 => 5,
4096 => 6,
_ => panic!("N must be a power of 4"),
}
}
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
#[inline(always)]
pub(crate) const fn entropy_norm_kmer<const LEFT: bool, const K: usize>(kmer: u64) -> u64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
const NORM: [&[u64]; 7] = [&[], &NORMK1, &NORMK2, &NORMK3, &NORMK4, &NORMK5, &NORMK6];
let shift = SHIFT[K];
let ra = if LEFT { kmer >> shift } else { kmer };
let canonical_ra = NORM[K][ra as usize];
if LEFT {
canonical_ra << shift
} else {
canonical_ra
}
}
#[inline(always)]
pub(crate) const fn ln_class_size<const LEFT: bool, const K: usize>(kmer: u64) -> f64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
let ra = if LEFT { kmer >> SHIFT[K] } else { kmer };
match K {
1 => LN_CLASS1[ra as usize],
2 => LN_CLASS2[ra as usize],
3 => LN_CLASS3[ra as usize],
4 => LN_CLASS4[ra as usize],
5 => LN_CLASS5[ra as usize],
6 => LN_CLASS6[ra as usize],
_ => panic!("k must be 1..=6"),
}
}
+2 -154
View File
@@ -149,157 +149,5 @@ impl Iterator for SuperKmerIter<'_> {
// ── tests ───────────────────────────────────────────────────────────────────── // ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/iter.rs"]
use super::*; mod tests;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}
}
-1
View File
@@ -10,7 +10,6 @@ pub mod stream_iter;
mod scratch; mod scratch;
pub(crate) mod encoding; pub(crate) mod encoding;
pub(crate) mod entropy_table;
pub(crate) mod rolling_stat; pub(crate) mod rolling_stat;
pub use iter::SuperKmerIter; pub use iter::SuperKmerIter;
+11 -249
View File
@@ -1,8 +1,8 @@
use obikentropy::EntropyTracker;
use obikseq::kmer::{Minimizer, hash_kmer}; use obikseq::kmer::{Minimizer, hash_kmer};
use obikseq::params; use obikseq::params;
use crate::encoding::encode_nuc; use crate::encoding::encode_nuc;
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
// ── Stack-allocated ring buffer ─────────────────────────────────────────────── // ── Stack-allocated ring buffer ───────────────────────────────────────────────
@@ -83,33 +83,19 @@ pub struct RollingStat {
entropy_max_k: usize, entropy_max_k: usize,
k: usize, k: usize,
m: usize, m: usize,
steady: bool,
rolling_k: u64, rolling_k: u64,
rolling_rck: u64, rolling_rck: u64,
k_mask: u64, k_mask: u64,
m_mask: u64, m_mask: u64,
received: usize, received: usize,
// Sliding-window queues — stack-allocated, capacity ≤ k ≤ 31. // Minimizer selection state.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
minimier: Ring<MmerItem, 32>, minimier: Ring<MmerItem, 32>,
// Frequency count arrays. // Entropy tracking, composed as a plain inline field so both concerns
// Max count per cell ≤ k ≤ 31 → u8 is sufficient. // update in the same streaming pass without being conflated in one
k1c: [u8; 4], // struct — see `obikentropy::EntropyTracker`.
k2c: [u8; 16], entropy: EntropyTracker,
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
sum_f_log_s: [f64; WS_MAX + 1],
} }
impl RollingStat { impl RollingStat {
@@ -120,27 +106,13 @@ impl RollingStat {
entropy_max_k, entropy_max_k,
k, k,
m, m,
steady: false,
rolling_k: 0, rolling_k: 0,
rolling_rck: 0, rolling_rck: 0,
k_mask: (!0u64) >> (64 - k * 2), k_mask: (!0u64) >> (64 - k * 2),
m_mask: (!0u64) >> (64 - m * 2), m_mask: (!0u64) >> (64 - m * 2),
received: 0, received: 0,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
minimier: Ring::new(), minimier: Ring::new(),
k1c: [0; 4], entropy: EntropyTracker::new(k),
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
sum_f_log_s: [0.0; WS_MAX + 1],
} }
} }
@@ -148,54 +120,9 @@ impl RollingStat {
self.rolling_k = 0; self.rolling_k = 0;
self.rolling_rck = 0; self.rolling_rck = 0;
self.received = 0; self.received = 0;
self.steady = false;
// for i in self.k1q.iter() { self.k1c[i as usize] = 0; }
// for i in self.k2q.iter() { self.k2c[i as usize] = 0; }
// for i in self.k3q.iter() { self.k3c[i as usize] = 0; }
// for i in self.k4q.iter() { self.k4c[i as usize] = 0; }
// for i in self.k5q.iter() { self.k5c[i as usize] = 0; }
// for i in self.k6q.iter() { self.k6c[i as usize] = 0; }
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.minimier.clear(); self.minimier.clear();
self.entropy.reset();
self.sum_f_log_f = [0.0; WS_MAX + 1];
self.sum_f_log_s = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
f: usize,
) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
sum_f_log_s[K] -= ln_class_size::<false, K>(canonical);
}
#[inline]
fn update_sums_increment<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
g: usize,
) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
sum_f_log_s[K] += ln_class_size::<false, K>(canonical);
} }
pub fn push(&mut self, nuc: u8) { pub fn push(&mut self, nuc: u8) {
@@ -209,13 +136,6 @@ impl RollingStat {
self.rolling_rck = self.rolling_rck =
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask; ((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
let canonical_k1 = entropy_norm_kmer::<false, 1>(self.rolling_k & 3);
let canonical_k2 = entropy_norm_kmer::<false, 2>(self.rolling_k & 15);
let canonical_k3 = entropy_norm_kmer::<false, 3>(self.rolling_k & 63);
let canonical_k4 = entropy_norm_kmer::<false, 4>(self.rolling_k & 255);
let canonical_k5 = entropy_norm_kmer::<false, 5>(self.rolling_k & 1023);
let canonical_k6 = entropy_norm_kmer::<false, 6>(self.rolling_k & 4095);
self.received += 1; self.received += 1;
if self.received >= m { if self.received >= m {
@@ -248,153 +168,7 @@ impl RollingStat {
} }
} }
if self.received > k { self.entropy.push(self.received, self.rolling_k);
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old1,
f1,
);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old2,
f2,
);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old3,
f3,
);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old4,
f4,
);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old5,
f5,
);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old6,
f6,
);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
} else {
self.push_warmup_increments(
canonical_k1, canonical_k2, canonical_k3,
canonical_k4, canonical_k5, canonical_k6,
);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
canonical_k1: u64, canonical_k2: u64, canonical_k3: u64,
canonical_k4: u64, canonical_k5: u64, canonical_k6: u64,
) {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
if self.received >= 2 {
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
if self.received >= 3 {
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
if self.received >= 4 {
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
if self.received >= 5 {
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
if self.received >= 6 {
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
self.steady = true;
}
}
}
}
}
} }
pub fn ready(&self) -> bool { pub fn ready(&self) -> bool {
@@ -426,25 +200,13 @@ impl RollingStat {
if !self.ready() { if !self.ready() {
return None; return None;
} }
let k = self.k; Some(self.entropy.entropy(order))
let em = emax(k, order);
if em <= 0.0 {
return Some(1.0);
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
Some((h_corr / em).max(0.0))
} }
pub fn normalized_entropy(&self) -> Option<f64> { pub fn normalized_entropy(&self) -> Option<f64> {
if !self.ready() { if !self.ready() {
return None; return None;
} }
let min_e = (1..=self.entropy_max_k) Some(self.entropy.normalized_entropy(self.entropy_max_k))
.filter_map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
Some(if min_e == f64::MAX { 1.0 } else { min_e })
} }
} }
+152
View File
@@ -0,0 +1,152 @@
use super::*;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}