Push qowsvpqmoukq #61

Merged
coissac merged 3 commits from push-qowsvpqmoukq into main 2026-07-08 18:05:43 +00:00
26 changed files with 822 additions and 631 deletions
+32 -16
View File
@@ -1,6 +1,6 @@
# Kmer entropy filter # Kmer entropy filter
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for two sources of bias: the small number of observations within a single kmer, and the unequal sizes of circular equivalence classes. Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for one source of bias: the small number of observations within a single kmer relative to the number of possible sub-words.
## Sub-word frequencies ## Sub-word frequencies
@@ -8,17 +8,15 @@ For a kmer of length k and a sub-word size ws (1 ≤ ws ≤ ws_max, typically ws
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$ $$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
Each sub-word is mapped to its **circular canonical form**: the lexicographic minimum among all cyclic rotations of the word **and all cyclic rotations of its reverse complement**. This extended equivalence relation ensures that entropy(K) = entropy(revcomp(K)) — the filter is strand-symmetric. Let $s_j$ be the size of equivalence class $j$ (number of distinct raw words mapping to canonical form $j$), and $f_j$ the count of canonical form $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$). Each sub-word is tallied under its own raw 2-bit-packed value — **no canonicalization**. Let $f_j$ be the count of raw word $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$), over the $4^{ws}$ possible raw words.
An earlier version of this filter first folded each sub-word into a circular+reverse-complement equivalence class, then "unfolded" the observed class frequency back onto its members to correct for unequal class sizes. That machinery bought nothing it was claimed for — see *Why no equivalence classes* below — while measurably weakening detection of the very sequences the filter exists to catch, so it was removed.
## Corrected Shannon entropy ## Corrected Shannon entropy
The circular equivalence classes have unequal sizes: under a uniform distribution over all $4^{ws}$ raw words, class $j$ is visited with probability $s_j / 4^{ws}$, not $1/n_a$. Computing entropy directly over canonical classes therefore underestimates the entropy of a random sequence. $$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j$$
The correction "unfolds" each canonical class back to its member raw words, redistributing each observation of class $j$ equally among its $s_j$ members: This is a plain Shannon entropy over the observed raw-word frequencies.
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j + \frac{1}{n_{\text{words}}} \sum_j f_j \log s_j$$
The last term is the correction for unequal class sizes. For a uniformly random sequence ($f_j \approx n_{\text{words}} \cdot s_j / 4^{ws}$), this gives $H_{\text{corr}} \approx \log(4^{ws}) = 2 \cdot ws \cdot \log 2$, the maximum entropy over raw words.
## Maximum entropy correction for small samples ## Maximum entropy correction for small samples
@@ -42,27 +40,45 @@ $$\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)$$
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc. A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
## Why no equivalence classes
A prior design folded each sub-word into the canonical form of its circular-rotation + reverse-complement equivalence class before tallying, on the reasoning that (a) it guarantees $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, and (b) collapsing phase-shifted repeats (e.g. `ATG``TGA``GAT`) into one class better reflects that they are "the same" low-complexity pattern.
Both properties already hold for the raw, unfolded entropy above, without any class machinery:
- **Reverse complement**: for any K of length n, window $j$ of $\text{revcomp}(K)$ equals $\text{revcomp}$ of window $(n{-}ws{-}j)$ of K. This is a bijection between the window sets under which each window maps to its own revcomp — and revcomp is itself a bijection (involution) on the space of raw ws-mers. So the multiset of raw-word frequencies for $\text{revcomp}(K)$ is exactly a relabeling of the multiset for K, and Shannon entropy — a function of the frequency multiset alone — is exactly invariant. No folding required, for any K.
- **Tandem repeats**: a period-p repeat sampled by a stride-1 sliding window naturally cycles through its own rotations as raw tokens (e.g. `ATGATGATG…` yields the raw words `ATG`, `TGA`, `GAT` in rotation as the window slides). The low diversity this represents (few distinct raw words out of $4^{ws}$ possible) is already visible in the raw frequency distribution — no folding needed to detect it.
What the fold-then-unfold step actually did was credit each observed class with the frequency of equivalence-class members that were **never observed on the read strand**, inflating $H_{\text{corr}}$ for genuine repeats. Worked example: k=31, ws=3, kmer = `ATG` repeated ($n_{\text{words}}=29$, all 29 windows fall into one class of size 6 under the old scheme — 3 rotations × forward/revcomp):
| | $H_{\text{corr}}$ | normalized |
|---|---|---|
| old (folded, class size 6) | $\log 6 \approx 1.79$ | $\approx 0.53$ |
| current (raw, unfolded) | $\log 3 \approx 1.10$ | $\approx 0.33$ |
The gap is not a rounding artifact: per sub-word order, the folded score for this same repeat swings from 0.53 (ws=3, aligned with the period) up to **1.03** (ws=5, misaligned with the period) — i.e. a period-3 repeat could score *above* the theoretical maximum for a random sequence, depending on which ws happens to divide the repeat's period. The raw formula stays flat at ≈0.330.40 across ws=2..6 regardless of alignment, which is the robustness the "minimum across ws" design was meant to provide in the first place.
## Interpretation as an effective number of classes ## Interpretation as an effective number of classes
$H_{\text{corr}}$ is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable classes that would yield the same entropy. $H_{\text{corr}}$ is a standard Shannon entropy over raw words, so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable raw words that would yield the same entropy.
For the normalised score $\hat{H}$, dividing by $H_{\text{max}}$ changes the logarithm base: For the normalised score $\hat{H}$, dividing by $H_{\max}$ changes the logarithm base:
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\text{max}}} = \log_{N_{\text{max}}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\text{max}}^{\,\hat{H}}$$ $$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\max}} = \log_{N_{\max}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\max}^{\,\hat{H}}$$
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\text{max}}$) of the effective number of equi-represented classes. The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\max}$) of the effective number of equi-represented raw words.
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\text{max}} \approx 4^{ws}$, giving: In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\max} \approx 4^{ws}$, giving:
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$ $$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective classes out of 16 are occupied. This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective words out of 16 are occupied.
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\text{max}} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\text{max}}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$. In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\max} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\max}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
## Properties ## Properties
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences: The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, guaranteed by the strand-symmetric canonical form. - **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$ — see *Why no equivalence classes* above for why this holds without any explicit strand-folding step.
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers. - **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
+7 -3
View File
@@ -3,10 +3,14 @@
## Code couvert ## Code couvert
- `obiskbuilder/src/entropy_table.rs` — filtre Shannon sur les kmers à basse complexité - `obikentropy/src/table.rs`, `obikentropy/src/tracker.rs` — formule d'entropie et tables de correction petits effectifs
- `obiskbuilder/src/lib.rs` — application du filtre lors du scatter (phase 1) - `obikentropy/src/kmer_entropy.rs` — entropie d'un kmer isolé (`KmerEntropy`)
- `obiskbuilder/src/rolling_stat.rs` — composition de `obikentropy::EntropyTracker` dans le suivi streaming (sélection de minimiseur + entropie)
- `obiskbuilder/src/iter.rs`, `obiskbuilder/src/stream_iter.rs` — application du filtre lors du scatter (phase 1)
## Notes ## Notes
Document théorique stable. Vérifier que les paramètres `theta` et `level_max` dans le CLI Le repli en classes d'équivalence circulaires + brin inverse (décrit dans une version antérieure de ce document) a été supprimé : voir la section « Why no equivalence classes » de `entropy.md` pour la justification théorique et numérique.
Vérifier que les paramètres `theta` et `level_max` dans le CLI
(`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit. (`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit.
+11 -1
View File
@@ -1682,6 +1682,13 @@ dependencies = [
"xxhash-rust", "xxhash-rust",
] ]
[[package]]
name = "obikentropy"
version = "0.1.0"
dependencies = [
"obikseq",
]
[[package]] [[package]]
name = "obikindex" name = "obikindex"
version = "0.1.0" version = "0.1.0"
@@ -1704,7 +1711,7 @@ dependencies = [
[[package]] [[package]]
name = "obikmer" name = "obikmer"
version = "1.1.38" version = "1.1.39"
dependencies = [ dependencies = [
"clap", "clap",
"csv", "csv",
@@ -1742,6 +1749,7 @@ dependencies = [
"niffler 3.0.0", "niffler 3.0.0",
"obicompactvec", "obicompactvec",
"obidebruinj", "obidebruinj",
"obikentropy",
"obikrope", "obikrope",
"obikseq", "obikseq",
"obilayeredmap", "obilayeredmap",
@@ -1824,7 +1832,9 @@ dependencies = [
name = "obiskbuilder" name = "obiskbuilder"
version = "0.1.0" version = "0.1.0"
dependencies = [ dependencies = [
"criterion2",
"lazy_static", "lazy_static",
"obikentropy",
"obikrope", "obikrope",
"obikseq", "obikseq",
"obiread", "obiread",
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace] [workspace]
resolver = "3" resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"] members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy"]
[profile.release] [profile.release]
debug = 1 debug = 1
+10
View File
@@ -0,0 +1,10 @@
[package]
name = "obikentropy"
version = "0.1.0"
edition = "2024"
[dependencies]
obikseq = { path = "../obikseq" }
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
@@ -4,57 +4,6 @@ use std::path::PathBuf;
const K_MAX: usize = 32; const K_MAX: usize = 32;
const WS_MAX: usize = 6; const WS_MAX: usize = 6;
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
for _ in 0..ws - 1 {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
}
canonical
}
fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
fn build_normalized_kmer(k: usize) -> Vec<u64> {
let n = 1usize << (k * 2);
let shift = 64 - k * 2;
let mut result = vec![0u64; n];
for i in 0..n {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
}
result
}
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
let n = norm.len();
let mut sizes = vec![0u32; n];
for &c in norm {
sizes[c as usize] += 1;
}
norm.iter()
.map(|&c| {
let s = sizes[c as usize];
if s > 0 { (s as f64).ln() } else { 0.0 }
})
.collect()
}
fn build_n_log_n() -> [f64; K_MAX + 1] { fn build_n_log_n() -> [f64; K_MAX + 1] {
let mut t = [0.0f64; K_MAX + 1]; let mut t = [0.0f64; K_MAX + 1];
for n in 1..=K_MAX { for n in 1..=K_MAX {
@@ -63,6 +12,9 @@ fn build_n_log_n() -> [f64; K_MAX + 1] {
t t
} }
/// Max achievable entropy over `4^ws` raw sub-words given only `nwords`
/// observations (most-uniform integer partition), per
/// `docmd/theory/entropy.md`.
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] { fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1]; let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
for k in 2..=K_MAX { for k in 2..=K_MAX {
@@ -125,13 +77,6 @@ fn main() {
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap()); let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
let mut out = String::new(); let mut out = String::new();
for k in 1..=6usize {
let n = 1usize << (k * 2);
let norm = build_normalized_kmer(k);
let ln_class = build_ln_class(&norm);
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
}
let n_log_n = build_n_log_n(); let n_log_n = build_n_log_n();
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n); emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
@@ -141,5 +86,5 @@ fn main() {
let log_nwords = build_log_nwords(); let log_nwords = build_log_nwords();
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords); emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap(); fs::write(out_dir.join("entropy_tables.rs"), out).unwrap();
} }
+41
View File
@@ -0,0 +1,41 @@
//! Normalized entropy of an isolated, already-built k-mer (e.g. one
//! reconstructed from an index's `unitigs.bin`, with no surrounding
//! sequence) — drives the window through [`EntropyTracker`] one base at a
//! time, exactly like the streaming path, so a `theta` threshold means the
//! same thing whether applied during index construction or after the fact
//! (e.g. `obikmer filter`).
use obikseq::CanonicalKmer;
use crate::tracker::EntropyTracker;
/// Extension trait: compute the normalized entropy of a single canonical
/// k-mer, independent of any surrounding sequence.
pub trait KmerEntropy {
/// Normalized entropy across sub-word orders `1..=level_max` (the
/// minimum is taken across orders). Lower means less complex; `theta`
/// in `index`/`filter` rejects k-mers with a score `< theta`.
fn entropy(&self, level_max: usize) -> f64;
}
impl KmerEntropy for CanonicalKmer {
fn entropy(&self, level_max: usize) -> f64 {
let raw = self.raw(); // left-aligned, 2 bits/base, MSB-first
let k = obikseq::params::k();
let mask = (!0u64) >> (64 - k * 2);
let mut tracker = EntropyTracker::new(k);
let mut rolling: u64 = 0;
for i in 0..k {
let shift = 64 - 2 * (i + 1);
let base = (raw >> shift) & 3;
rolling = ((rolling << 2) | base) & mask;
tracker.push(i + 1, rolling);
}
tracker.normalized_entropy(level_max)
}
}
#[cfg(test)]
#[path = "tests/kmer_entropy.rs"]
mod tests;
+17
View File
@@ -0,0 +1,17 @@
//! Normalized k-mer entropy: formulas, tables, and a streaming tracker.
//!
//! This crate holds every piece of the entropy computation described in
//! `docmd/theory/entropy.md`: the compile-time tables ([`table`], private),
//! the incremental accumulator ([`EntropyTracker`]) that callers compose
//! into their own streaming state, and the [`KmerEntropy`] convenience trait
//! for scoring a single, already-built k-mer.
#![deny(missing_docs)]
mod kmer_entropy;
mod ring;
mod table;
mod tracker;
pub use kmer_entropy::KmerEntropy;
pub use tracker::EntropyTracker;
+40
View File
@@ -0,0 +1,40 @@
//! Stack-allocated ring buffer backing the sliding sub-word windows.
/// Fixed-capacity ring buffer backed by a stack array.
/// N must be a power of two; operations are branchless via `% N`.
pub(crate) struct Ring<T: Copy + Default, const N: usize> {
buf: [T; N],
head: usize,
len: usize,
}
impl<T: Copy + Default, const N: usize> Ring<T, N> {
#[inline]
pub(crate) fn new() -> Self {
Self {
buf: [T::default(); N],
head: 0,
len: 0,
}
}
#[inline]
pub(crate) fn clear(&mut self) {
self.len = 0;
self.head = 0;
}
#[inline]
pub(crate) fn push_back(&mut self, val: T) {
self.buf[(self.head + self.len) % N] = val;
self.len += 1;
}
#[inline]
pub(crate) fn pop_front(&mut self) -> T {
let val = self.buf[self.head];
self.head = (self.head + 1) % N;
self.len -= 1;
val
}
}
+30
View File
@@ -0,0 +1,30 @@
//! Compile-time tables backing the normalized k-mer entropy formula: the
//! max-entropy correction for small samples. See `docmd/theory/entropy.md`.
//!
//! Entropy is computed directly on raw (non-canonicalized) sub-words — no
//! equivalence-class folding. Empirically (see the discussion that produced
//! this crate's history), folding sub-words into circular/revcomp classes
//! before unfolding them back buys nothing for the invariances it was meant
//! to guarantee (both hold for raw sub-word entropy already, by a direct
//! bijection argument for revcomp and by the sliding window's own dynamics
//! for tandem repeats), while it measurably *weakens* detection of the
//! low-complexity sequences the filter exists to catch.
include!(concat!(env!("OUT_DIR"), "/entropy_tables.rs"));
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
+52
View File
@@ -0,0 +1,52 @@
use super::*;
use obikseq::Sequence;
use obikseq::kmer::Kmer;
const K: usize = 21;
const LEVEL_MAX: usize = 6;
fn kmer_from_ascii(seq: &[u8]) -> CanonicalKmer {
obikseq::set_k(K);
Kmer::from_ascii(seq).expect("valid k-mer sequence").canonical()
}
#[test]
fn homopolymer_scores_lower_than_diverse_sequence() {
let homopolymer = kmer_from_ascii(b"AAAAAAAAAAAAAAAAAAAAA"); // 21 bases
let diverse = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT"); // 21 bases, same as used elsewhere in this workspace's tests
let e_homopolymer = homopolymer.entropy(LEVEL_MAX);
let e_diverse = diverse.entropy(LEVEL_MAX);
assert!(
e_homopolymer < e_diverse,
"homopolymer ({e_homopolymer}) should score lower than a diverse sequence ({e_diverse})"
);
// A pure homopolymer is the most degenerate case representable — its
// score should sit near the bottom of the range, not just "somewhat lower".
assert!(e_homopolymer < 0.3, "homopolymer entropy unexpectedly high: {e_homopolymer}");
}
#[test]
fn entropy_is_deterministic_for_the_same_kmer() {
let a = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
let b = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
assert_eq!(a.entropy(LEVEL_MAX), b.entropy(LEVEL_MAX));
}
#[test]
fn entropy_is_within_zero_one_range() {
let mut repeat = "AT".repeat(K / 2 + 1);
repeat.truncate(K);
for seq in [
"AAAAAAAAAAAAAAAAAAAAA".to_string(),
repeat,
"CATTAGCGTACCTGATCAGGT".to_string(),
] {
assert_eq!(seq.len(), K, "test sequence must be exactly K bases: {seq:?}");
let kmer = kmer_from_ascii(seq.as_bytes());
let e = kmer.entropy(LEVEL_MAX);
assert!((0.0..=1.0).contains(&e), "entropy {e} out of [0,1] for {seq:?}");
}
}
+255
View File
@@ -0,0 +1,255 @@
//! Incremental (streaming) normalized k-mer entropy.
//!
//! [`EntropyTracker`] maintains, over a sliding window of the last `k` bases,
//! the per-sub-word-size raw-word frequency statistics needed to evaluate
//! the corrected Shannon entropy described in `docmd/theory/entropy.md`,
//! updated in O(1) per base rather than recomputed from scratch. No
//! canonicalization is applied — each sub-word is tallied under its own raw
//! 2-bit-packed value; only the small-sample max-entropy correction departs
//! from a textbook Shannon entropy.
//!
//! It carries no notion of minimizers or superkmer segmentation — callers
//! that need both (e.g. `obiskbuilder::RollingStat`) compose an
//! `EntropyTracker` as a plain field alongside their own state, so the two
//! concerns update in the same streaming pass without being conflated in one
//! struct.
use crate::ring::Ring;
use crate::table::{WS_MAX, emax, log_nwords, n_log_n};
/// Incremental normalized-entropy accumulator over a sliding window of `k`
/// bases. Composed as a plain field by callers that also need other
/// per-base state (e.g. minimizer selection) in the same streaming pass.
pub struct EntropyTracker {
k: usize,
steady: bool,
// Sliding-window queues over the last `k` raw sub-words, one per word
// size — stack-allocated, capacity ≤ k ≤ 31.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
// Frequency count arrays, indexed by the raw sub-word value (2 bits per
// base). Max count per cell ≤ k ≤ 31 → u8 is sufficient.
k1c: [u8; 4],
k2c: [u8; 16],
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
}
impl EntropyTracker {
/// New tracker for a window of `k` bases (1..=31).
pub fn new(k: usize) -> Self {
Self {
k,
steady: false,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
k1c: [0; 4],
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
}
}
/// Clear all accumulated state, ready to track a new window from
/// scratch (`k` is unchanged).
pub fn reset(&mut self) {
self.steady = false;
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.sum_f_log_f = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], f: usize) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
}
#[inline]
fn update_sums_increment<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], g: usize) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
}
/// Advance the window by one base. `received` is the caller's running
/// count of bases pushed so far (1-based, i.e. after this base);
/// `rolling_kmer` is the current right-aligned, 2-bit-packed k-mer
/// window (same convention as `obiskbuilder::RollingStat::rolling_k`).
pub fn push(&mut self, received: usize, rolling_kmer: u64) {
let raw1 = rolling_kmer & 3;
let raw2 = rolling_kmer & 15;
let raw3 = rolling_kmer & 63;
let raw4 = rolling_kmer & 255;
let raw5 = rolling_kmer & 1023;
let raw6 = rolling_kmer & 4095;
if received > self.k {
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(&mut self.sum_f_log_f, f1);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(&mut self.sum_f_log_f, f2);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(&mut self.sum_f_log_f, f3);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(&mut self.sum_f_log_f, f4);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(&mut self.sum_f_log_f, f5);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(&mut self.sum_f_log_f, f6);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
} else {
self.push_warmup_increments(received, raw1, raw2, raw3, raw4, raw5, raw6);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
received: usize,
raw1: u64, raw2: u64, raw3: u64,
raw4: u64, raw5: u64, raw6: u64,
) {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
if received >= 2 {
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
if received >= 3 {
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
if received >= 4 {
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
if received >= 5 {
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
if received >= 6 {
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
self.steady = true;
}
}
}
}
}
}
/// Normalized entropy at sub-word size `order` (1..=6). The caller is
/// responsible for not calling this before the window is full (`k`
/// bases pushed) — an empty/partial window yields a meaningless value.
pub fn entropy(&self, order: usize) -> f64 {
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return 1.0;
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw - self.sum_f_log_f[order] / nw_f;
(h_corr / em).max(0.0)
}
/// Minimum of [`Self::entropy`] over sub-word sizes `1..=order_max`, same
/// caller responsibility re: window readiness as `entropy`.
pub fn normalized_entropy(&self, order_max: usize) -> f64 {
let min_e = (1..=order_max)
.map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
if min_e == f64::MAX { 1.0 } else { min_e }
}
}
+1 -1
View File
@@ -1,6 +1,6 @@
[package] [package]
name = "obikmer" name = "obikmer"
version = "1.1.38" version = "1.1.39"
edition = "2024" edition = "2024"
[[bin]] [[bin]]
+18 -3
View File
@@ -2,14 +2,14 @@ use std::path::PathBuf;
use clap::Args; use clap::Args;
use obikindex::{KmerIndex, MergeMode}; use obikindex::{KmerIndex, MergeMode};
use obikpartitionner::filter::{MaxTotalCount, MinTotalCount}; use obikpartitionner::filter::{MaxTotalCount, MinComplexity, MinTotalCount};
use obisys::Reporter; use obisys::Reporter;
use tracing::info; use tracing::info;
use super::predicate::FilterArgs as KmerFilterArgs; use super::predicate::FilterArgs as KmerFilterArgs;
#[derive(Args)] #[derive(Args)]
pub struct FilterArgs { pub struct FilterCmdArgs {
/// Source index directory /// Source index directory
pub source: PathBuf, pub source: PathBuf,
@@ -28,6 +28,18 @@ pub struct FilterArgs {
#[arg(long)] #[arg(long)]
pub max_total_count: Option<u32>, pub max_total_count: Option<u32>,
/// Minimum normalized entropy (complexity) to keep a k-mer — same metric
/// as `obikmer index`'s --theta, applied here to k-mers already committed
/// to the source index (reconstructed from unitigs.bin). K-mers scoring
/// below this are removed.
#[arg(long)]
pub min_complexity: Option<f64>,
/// Maximum sub-word size for the complexity computation (see `obikmer
/// index`'s --level-max). Only used when --min-complexity is set.
#[arg(long, default_value_t = 6)]
pub complexity_level_max: usize,
/// Output as presence/absence instead of counts /// Output as presence/absence instead of counts
#[arg(long)] #[arg(long)]
pub presence: bool, pub presence: bool,
@@ -37,7 +49,7 @@ pub struct FilterArgs {
pub force: bool, pub force: bool,
} }
pub fn run(args: FilterArgs) { pub fn run(args: FilterCmdArgs) {
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| { let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
eprintln!("error opening source index: {e}"); eprintln!("error opening source index: {e}");
std::process::exit(1); std::process::exit(1);
@@ -62,6 +74,9 @@ pub fn run(args: FilterArgs) {
if let Some(v) = args.max_total_count { if let Some(v) = args.max_total_count {
filters.push(Box::new(MaxTotalCount { total: v })); filters.push(Box::new(MaxTotalCount { total: v }));
} }
if let Some(theta) = args.min_complexity {
filters.push(Box::new(MinComplexity { level_max: args.complexity_level_max, theta }));
}
let mut rep = Reporter::new(); let mut rep = Reporter::new();
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep) KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
+1 -1
View File
@@ -21,7 +21,7 @@ enum Commands {
/// Merge multiple built indexes into one /// Merge multiple built indexes into one
Merge(cmd::merge::MergeArgs), Merge(cmd::merge::MergeArgs),
/// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates /// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates
Filter(cmd::filter::FilterArgs), Filter(cmd::filter::FilterCmdArgs),
/// Project and/or aggregate genome columns into a new or in-place index /// Project and/or aggregate genome columns into a new or in-place index
Select(cmd::select::SelectArgs), Select(cmd::select::SelectArgs),
/// Query an index with sequences and annotate matches /// Query an index with sequences and annotate matches
+2 -1
View File
@@ -6,7 +6,6 @@ edition = "2024"
[dev-dependencies] [dev-dependencies]
tempfile = "3" tempfile = "3"
obikseq = { path = "../obikseq", features = ["test-utils"] } obikseq = { path = "../obikseq", features = ["test-utils"] }
obiskbuilder = { path = "../obiskbuilder" }
obiread = { path = "../obiread" } obiread = { path = "../obiread" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
@@ -14,6 +13,8 @@ obikrope = { path = "../obikrope" }
niffler = "3.0.0" niffler = "3.0.0"
remove_dir_all = "0.8" remove_dir_all = "0.8"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikentropy = { path = "../obikentropy" }
obiskbuilder = { path = "../obiskbuilder" }
obiskio = { path = "../obiskio" } obiskio = { path = "../obiskio" }
obidebruinj = { path = "../obidebruinj" } obidebruinj = { path = "../obidebruinj" }
obilayeredmap = { path = "../obilayeredmap" } obilayeredmap = { path = "../obilayeredmap" }
+14 -12
View File
@@ -62,7 +62,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot); let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row); cont = cb(kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -75,7 +75,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect(); let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row); cont = cb(kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -83,18 +83,19 @@ impl KmerPartition {
} }
cont cont
} else { } else {
// No data matrix: implicit presence — all values are 1. // No data matrix: implicit presence — all values are 1. `row`
// The filter result is identical for every kmer, so evaluate once. // is identical for every kmer, but a filter can still depend
// on the kmer's own sequence (e.g. MinComplexity), so this
// cannot be evaluated once for the whole layer — filters must
// still be tested per kmer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into(); let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true; let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() { if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(kmer, all_present.clone()); cont = cb(kmer, all_present.clone());
if !cont { break; } if !cont { break; }
} }
} }
}
cont cont
}; };
@@ -140,7 +141,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot); let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row); cont = cb(part, layer, kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -153,7 +154,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect(); let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row); cont = cb(part, layer, kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -161,16 +162,17 @@ impl KmerPartition {
} }
cont cont
} else { } else {
// Same as iter_partition_kmers: row is constant but a filter
// may still depend on the kmer's own sequence, so this must
// be tested per kmer, not once for the whole layer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into(); let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true; let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() { if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(part, layer, kmer, all_present.clone()); cont = cb(part, layer, kmer, all_present.clone());
if !cont { break; } if !cont { break; }
} }
} }
}
cont cont
}; };
+49 -13
View File
@@ -1,17 +1,24 @@
use obicompactvec::FilterMask; use obicompactvec::FilterMask;
use obikseq::CanonicalKmer;
/// Trait for kmer row filters. /// Trait for kmer filters.
/// ///
/// `kmer` is the k-mer's own canonical sequence, reconstructed from the
/// source index's `unitigs.bin` (always present — see `rebuild_layer.rs`);
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data). /// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
/// `n_genomes` equals `row.len()`. /// `n_genomes` equals `row.len()`. Most filters only need `row` — `kmer` is
/// there for filters that reason about the k-mer's sequence itself (e.g.
/// [`MinComplexity`]).
pub trait KmerFilter: Send + Sync { pub trait KmerFilter: Send + Sync {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool; fn passes(&self, kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool;
/// Express this filter as a [`FilterMask`] column-operation expression. /// Express this filter as a [`FilterMask`] column-operation expression.
/// ///
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix /// Returns `Some(expr)` if the filter can be evaluated solely from matrix
/// column aggregates (no per-kmer row scan needed). Returns `None` if the /// column aggregates (no per-kmer row scan needed). Returns `None` if the
/// filter requires row-level inspection. /// filter requires row-level inspection — always the case for a filter
/// that needs the k-mer's sequence, since a `FilterMask` only expresses
/// per-genome column aggregates, never per-slot sequence data.
/// ///
/// `threshold` semantics in the returned mask use `>= threshold`, matching /// `threshold` semantics in the returned mask use `>= threshold`, matching
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any /// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
@@ -23,8 +30,13 @@ pub trait KmerFilter: Send + Sync {
/// True when `row` passes every filter in `filters`. /// True when `row` passes every filter in `filters`.
/// Returns `true` if `filters` is empty. /// Returns `true` if `filters` is empty.
pub fn passes_all(filters: &[Box<dyn KmerFilter>], row: &[u32], n_genomes: usize) -> bool { pub fn passes_all(
filters.iter().all(|f| f.passes(row, n_genomes)) filters: &[Box<dyn KmerFilter>],
kmer: CanonicalKmer,
row: &[u32],
n_genomes: usize,
) -> bool {
filters.iter().all(|f| f.passes(kmer, row, n_genomes))
} }
// ── Quorum filters ───────────────────────────────────────────────────────────── // ── Quorum filters ─────────────────────────────────────────────────────────────
@@ -40,7 +52,7 @@ pub struct MinGenomeFraction {
} }
impl KmerFilter for MinGenomeFraction { impl KmerFilter for MinGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold); let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 >= self.frac p as f64 / n_genomes as f64 >= self.frac
} }
@@ -63,7 +75,7 @@ pub struct MaxGenomeFraction {
} }
impl KmerFilter for MaxGenomeFraction { impl KmerFilter for MaxGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold); let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 <= self.frac p as f64 / n_genomes as f64 <= self.frac
} }
@@ -86,7 +98,7 @@ pub struct MinGenomeCount {
} }
impl KmerFilter for MinGenomeCount { impl KmerFilter for MinGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) >= self.count present_count(row, self.threshold) >= self.count
} }
@@ -107,7 +119,7 @@ pub struct MaxGenomeCount {
} }
impl KmerFilter for MaxGenomeCount { impl KmerFilter for MaxGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) <= self.count present_count(row, self.threshold) <= self.count
} }
@@ -129,7 +141,7 @@ pub struct MinTotalCount {
} }
impl KmerFilter for MinTotalCount { impl KmerFilter for MinTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() >= self.total row.iter().sum::<u32>() >= self.total
} }
@@ -147,7 +159,7 @@ pub struct MaxTotalCount {
} }
impl KmerFilter for MaxTotalCount { impl KmerFilter for MaxTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() <= self.total row.iter().sum::<u32>() <= self.total
} }
@@ -212,7 +224,7 @@ impl GroupQuorumFilter {
} }
impl KmerFilter for GroupQuorumFilter { impl KmerFilter for GroupQuorumFilter {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
if !self.ingroup_idx.is_empty() { if !self.ingroup_idx.is_empty() {
let n = self.ingroup_idx.iter() let n = self.ingroup_idx.iter()
.filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold) .filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold)
@@ -260,3 +272,27 @@ impl KmerFilter for GroupQuorumFilter {
Some(FilterMask::And(parts)) Some(FilterMask::And(parts))
} }
} }
// ── Complexity filter (post-hoc, sequence-based) ──────────────────────────────
/// Reject k-mers with normalized entropy below `theta` — the same complexity
/// metric `obikmer index`'s `--theta`/`--level-max` apply *during* superkmer
/// construction (see [`obikentropy::KmerEntropy`]), applied here after the
/// fact, to k-mers already committed to a built index.
///
/// Unlike every other filter in this module, this one needs the k-mer's own
/// sequence, not its per-genome row — `column_mask_expr` is never overridden
/// (stays `None`), so this filter always forces the row-level scan path in
/// `rebuild_layer.rs` (which reconstructs the sequence from `unitigs.bin`
/// regardless, so no extra I/O beyond what filtering already requires).
pub struct MinComplexity {
pub level_max: usize,
pub theta: f64,
}
impl KmerFilter for MinComplexity {
fn passes(&self, kmer: CanonicalKmer, _row: &[u32], _n_genomes: usize) -> bool {
use obikentropy::KmerEntropy;
kmer.entropy(self.level_max) >= self.theta
}
}
+2 -2
View File
@@ -126,7 +126,7 @@ fn iter_src_kmers_masked(
Some(m) => m.get(slot), Some(m) => m.get(slot),
None => { None => {
let row = src_data.fill_row_by_slot(slot, n_genomes); let row = src_data.fill_row_by_slot(slot, n_genomes);
filters.iter().all(|f| f.passes(&row, n_genomes)) filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
} }
}; };
if passes { cb(kmer); } if passes { cb(kmer); }
@@ -165,7 +165,7 @@ fn iter_src_layers(
cb(kmer, row.into_boxed_slice()); cb(kmer, row.into_boxed_slice());
} else { } else {
let row = src_data.fill_row_by_slot(slot, n_genomes); let row = src_data.fill_row_by_slot(slot, n_genomes);
if filters.iter().all(|f| f.passes(&row, n_genomes)) { if filters.iter().all(|f| f.passes(kmer, &row, n_genomes)) {
cb(kmer, row.into_boxed_slice()); cb(kmer, row.into_boxed_slice());
} }
} }
+6
View File
@@ -7,7 +7,13 @@ edition = "2024"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
obiread = { path = "../obiread" } obiread = { path = "../obiread" }
obikentropy = { path = "../obikentropy" }
lazy_static = "1.5.0" lazy_static = "1.5.0"
[dev-dependencies] [dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] } obikseq = { path = "../obikseq", features = ["test-utils"] }
criterion2 = { version = "3", features = ["cargo_bench_support"] }
[[bench]]
name = "superkmer_stream"
harness = false
@@ -0,0 +1,58 @@
//! Throughput of the streaming superkmer pipeline (`RollingStat`'s hot path:
//! minimizer selection + entropy tracking fused in a single pass).
//!
//! Reference point for the `obikentropy` extraction: the entropy bookkeeping
//! that used to live inline in `RollingStat` was pulled out into a composed
//! `EntropyTracker`. This benchmark is run before and after that change to
//! confirm no regression.
use criterion::{Criterion, Throughput, criterion_group, criterion_main};
use obikrope::Rope;
use obiskbuilder::SuperKmerIter;
const K: usize = 21;
const M: usize = 9;
const LEVEL_MAX: usize = 6;
const THETA: f64 = 0.7;
const SEQ_LEN: usize = 200_000;
/// Deterministic pseudo-random ACGT sequence — high enough complexity that
/// the entropy filter rarely rejects, so the bench stays on the steady-state
/// path rather than repeatedly resetting.
fn make_sequence(len: usize) -> Vec<u8> {
let mut state: u64 = 0x9E3779B97F4A7C15;
(0..len)
.map(|_| {
state ^= state << 13;
state ^= state >> 7;
state ^= state << 17;
b"ACGT"[(state % 4) as usize]
})
.collect()
}
fn make_rope(seq: &[u8]) -> Rope {
let mut rope = Rope::new(None);
rope.push(seq.to_vec());
rope
}
fn bench_build_superkmers(c: &mut Criterion) {
obikseq::set_k(K);
obikseq::set_m(M);
let seq = make_sequence(SEQ_LEN);
let rope = make_rope(&seq);
let mut group = c.benchmark_group("build_superkmers");
group.throughput(Throughput::Bytes(SEQ_LEN as u64));
group.bench_function("stream", |b| {
b.iter(|| {
SuperKmerIter::new(std::hint::black_box(&rope), K, LEVEL_MAX, THETA).count()
});
});
group.finish();
}
criterion_group!(benches, bench_build_superkmers);
criterion_main!(benches);
-108
View File
@@ -1,108 +0,0 @@
pub(crate) const NORMK1: [u64; 4] = build_normalized_kmer::<4>();
pub(crate) const NORMK2: [u64; 16] = build_normalized_kmer::<16>();
pub(crate) const NORMK3: [u64; 64] = build_normalized_kmer::<64>();
pub(crate) const NORMK4: [u64; 256] = build_normalized_kmer::<256>();
pub(crate) const NORMK5: [u64; 1024] = build_normalized_kmer::<1024>();
pub(crate) const NORMK6: [u64; 4096] = build_normalized_kmer::<4096>();
include!(concat!(env!("OUT_DIR"), "/ln_class_tables.rs"));
const fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
let mut i = 0;
while i < (ws - 1) {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
i += 1;
}
canonical
}
const fn build_normalized_kmer<const N: usize>() -> [u64; N] {
let mut result = [0u64; N];
let k = k_from_n::<N>();
let shift = 64 - k * 2;
let mut i = 0;
while i < N {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
i += 1;
}
result
}
const fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
const fn k_from_n<const N: usize>() -> usize {
match N {
4 => 1,
16 => 2,
64 => 3,
256 => 4,
1024 => 5,
4096 => 6,
_ => panic!("N must be a power of 4"),
}
}
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
#[inline(always)]
pub(crate) const fn entropy_norm_kmer<const LEFT: bool, const K: usize>(kmer: u64) -> u64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
const NORM: [&[u64]; 7] = [&[], &NORMK1, &NORMK2, &NORMK3, &NORMK4, &NORMK5, &NORMK6];
let shift = SHIFT[K];
let ra = if LEFT { kmer >> shift } else { kmer };
let canonical_ra = NORM[K][ra as usize];
if LEFT {
canonical_ra << shift
} else {
canonical_ra
}
}
#[inline(always)]
pub(crate) const fn ln_class_size<const LEFT: bool, const K: usize>(kmer: u64) -> f64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
let ra = if LEFT { kmer >> SHIFT[K] } else { kmer };
match K {
1 => LN_CLASS1[ra as usize],
2 => LN_CLASS2[ra as usize],
3 => LN_CLASS3[ra as usize],
4 => LN_CLASS4[ra as usize],
5 => LN_CLASS5[ra as usize],
6 => LN_CLASS6[ra as usize],
_ => panic!("k must be 1..=6"),
}
}
+2 -154
View File
@@ -149,157 +149,5 @@ impl Iterator for SuperKmerIter<'_> {
// ── tests ───────────────────────────────────────────────────────────────────── // ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/iter.rs"]
use super::*; mod tests;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}
}
-1
View File
@@ -10,7 +10,6 @@ pub mod stream_iter;
mod scratch; mod scratch;
pub(crate) mod encoding; pub(crate) mod encoding;
pub(crate) mod entropy_table;
pub(crate) mod rolling_stat; pub(crate) mod rolling_stat;
pub use iter::SuperKmerIter; pub use iter::SuperKmerIter;
+11 -249
View File
@@ -1,8 +1,8 @@
use obikentropy::EntropyTracker;
use obikseq::kmer::{Minimizer, hash_kmer}; use obikseq::kmer::{Minimizer, hash_kmer};
use obikseq::params; use obikseq::params;
use crate::encoding::encode_nuc; use crate::encoding::encode_nuc;
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
// ── Stack-allocated ring buffer ─────────────────────────────────────────────── // ── Stack-allocated ring buffer ───────────────────────────────────────────────
@@ -83,33 +83,19 @@ pub struct RollingStat {
entropy_max_k: usize, entropy_max_k: usize,
k: usize, k: usize,
m: usize, m: usize,
steady: bool,
rolling_k: u64, rolling_k: u64,
rolling_rck: u64, rolling_rck: u64,
k_mask: u64, k_mask: u64,
m_mask: u64, m_mask: u64,
received: usize, received: usize,
// Sliding-window queues — stack-allocated, capacity ≤ k ≤ 31. // Minimizer selection state.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
minimier: Ring<MmerItem, 32>, minimier: Ring<MmerItem, 32>,
// Frequency count arrays. // Entropy tracking, composed as a plain inline field so both concerns
// Max count per cell ≤ k ≤ 31 → u8 is sufficient. // update in the same streaming pass without being conflated in one
k1c: [u8; 4], // struct — see `obikentropy::EntropyTracker`.
k2c: [u8; 16], entropy: EntropyTracker,
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
sum_f_log_s: [f64; WS_MAX + 1],
} }
impl RollingStat { impl RollingStat {
@@ -120,27 +106,13 @@ impl RollingStat {
entropy_max_k, entropy_max_k,
k, k,
m, m,
steady: false,
rolling_k: 0, rolling_k: 0,
rolling_rck: 0, rolling_rck: 0,
k_mask: (!0u64) >> (64 - k * 2), k_mask: (!0u64) >> (64 - k * 2),
m_mask: (!0u64) >> (64 - m * 2), m_mask: (!0u64) >> (64 - m * 2),
received: 0, received: 0,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
minimier: Ring::new(), minimier: Ring::new(),
k1c: [0; 4], entropy: EntropyTracker::new(k),
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
sum_f_log_s: [0.0; WS_MAX + 1],
} }
} }
@@ -148,54 +120,9 @@ impl RollingStat {
self.rolling_k = 0; self.rolling_k = 0;
self.rolling_rck = 0; self.rolling_rck = 0;
self.received = 0; self.received = 0;
self.steady = false;
// for i in self.k1q.iter() { self.k1c[i as usize] = 0; }
// for i in self.k2q.iter() { self.k2c[i as usize] = 0; }
// for i in self.k3q.iter() { self.k3c[i as usize] = 0; }
// for i in self.k4q.iter() { self.k4c[i as usize] = 0; }
// for i in self.k5q.iter() { self.k5c[i as usize] = 0; }
// for i in self.k6q.iter() { self.k6c[i as usize] = 0; }
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.minimier.clear(); self.minimier.clear();
self.entropy.reset();
self.sum_f_log_f = [0.0; WS_MAX + 1];
self.sum_f_log_s = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
f: usize,
) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
sum_f_log_s[K] -= ln_class_size::<false, K>(canonical);
}
#[inline]
fn update_sums_increment<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
g: usize,
) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
sum_f_log_s[K] += ln_class_size::<false, K>(canonical);
} }
pub fn push(&mut self, nuc: u8) { pub fn push(&mut self, nuc: u8) {
@@ -209,13 +136,6 @@ impl RollingStat {
self.rolling_rck = self.rolling_rck =
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask; ((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
let canonical_k1 = entropy_norm_kmer::<false, 1>(self.rolling_k & 3);
let canonical_k2 = entropy_norm_kmer::<false, 2>(self.rolling_k & 15);
let canonical_k3 = entropy_norm_kmer::<false, 3>(self.rolling_k & 63);
let canonical_k4 = entropy_norm_kmer::<false, 4>(self.rolling_k & 255);
let canonical_k5 = entropy_norm_kmer::<false, 5>(self.rolling_k & 1023);
let canonical_k6 = entropy_norm_kmer::<false, 6>(self.rolling_k & 4095);
self.received += 1; self.received += 1;
if self.received >= m { if self.received >= m {
@@ -248,153 +168,7 @@ impl RollingStat {
} }
} }
if self.received > k { self.entropy.push(self.received, self.rolling_k);
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old1,
f1,
);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old2,
f2,
);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old3,
f3,
);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old4,
f4,
);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old5,
f5,
);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old6,
f6,
);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
} else {
self.push_warmup_increments(
canonical_k1, canonical_k2, canonical_k3,
canonical_k4, canonical_k5, canonical_k6,
);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
canonical_k1: u64, canonical_k2: u64, canonical_k3: u64,
canonical_k4: u64, canonical_k5: u64, canonical_k6: u64,
) {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
if self.received >= 2 {
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
if self.received >= 3 {
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
if self.received >= 4 {
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
if self.received >= 5 {
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
if self.received >= 6 {
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
self.steady = true;
}
}
}
}
}
} }
pub fn ready(&self) -> bool { pub fn ready(&self) -> bool {
@@ -426,25 +200,13 @@ impl RollingStat {
if !self.ready() { if !self.ready() {
return None; return None;
} }
let k = self.k; Some(self.entropy.entropy(order))
let em = emax(k, order);
if em <= 0.0 {
return Some(1.0);
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
Some((h_corr / em).max(0.0))
} }
pub fn normalized_entropy(&self) -> Option<f64> { pub fn normalized_entropy(&self) -> Option<f64> {
if !self.ready() { if !self.ready() {
return None; return None;
} }
let min_e = (1..=self.entropy_max_k) Some(self.entropy.normalized_entropy(self.entropy_max_k))
.filter_map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
Some(if min_e == f64::MAX { 1.0 } else { min_e })
} }
} }
+152
View File
@@ -0,0 +1,152 @@
use super::*;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}