Push zunrplorkwkt #70
No files matched your search
@@ -1,4 +1,5 @@
|
|||||||
.venv/
|
.venv/
|
||||||
|
.DS_Store
|
||||||
src/target
|
src/target
|
||||||
data-stress
|
data-stress
|
||||||
*.fasta
|
*.fasta
|
||||||
|
|||||||
@@ -1,43 +0,0 @@
|
|||||||
Voici la version corrigée :
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
**Bug** : dans `base_pair_tally`, toutes les transitions/comptes depuis/vers A valent 0 dans `_sankoff_params.yaml`, alors que C/G/T sont corrects.
|
|
||||||
|
|
||||||
**Contexte** : obikmer, pipeline phylogénétique `--sankoff`. L’index est construit sur 20 génomes bactériens. Même symptôme sur un jeu de 100 génomes de plantes : A est toujours à 0.
|
|
||||||
|
|
||||||
**Fichier clé** : `src/obikphylo/src/siblings/sankoff_bundle.rs` (Pass A + Pass B).
|
|
||||||
|
|
||||||
**Ce qui a été vérifié** :
|
|
||||||
- Le fichier de sortie `_sankoff_params.yaml` montre bien `composition_transitions` avec A à 0 partout.
|
|
||||||
- L’index contient bien des familles avec A (`mask.has(0) == true`), et même des familles où A co-existe avec d’autres bases (`mask == 0b0011` par ex.).
|
|
||||||
- Un k-mer propriétaire de famille avec `mask == 0b0001` (A seul) a été identifié : forward `GAACAAGAGATCTCGATCTTGTCTACAAGGA`, revcomp `TCCTTGTAGACAAGATCGAGATCTCTTGTTC`.
|
|
||||||
- Le diagnostic CLI sur l’index réel donne :
|
|
||||||
- Pass A : `a_pairs=623342 a_snp=623342 a_shared=0 a_both_a=0`
|
|
||||||
- Pass B : `families_with_a=22965521 a_single_form_genomes=22913238 a_included_pairs=0 a_same_incremented=0 bp_same=[0, 96389, 222720, 277909] bp_counts[0]=[0, 0, 0, 0]`
|
|
||||||
|
|
||||||
**Interprétation** : A est fréquemment en `single_form` (mask == 1) chez certains génomes, mais **jamais simultanément** chez deux génomes différents dans la même famille. Donc toutes les paires “avec A” sont 100% SNP → ratio = 1.0 > `ratio_ceiling=0.5` → toutes exclues par le filtre `included`. C’est pourquoi `bp_same[0]` et `bp_counts[0][*]` restent à 0.
|
|
||||||
|
|
||||||
**Point crucial** : le bug n’apparaît **que sur l’index compacté sparse**. Sur le même index avant compaction (matrice dense `matrix.pbmx`), `--sankoff` produit des tallies corrects pour A. Dès qu’on compacte avec `pack --sparse`, A disparaît.
|
|
||||||
|
|
||||||
**Vérifications supplémentaires (diagnostic sparse)** :
|
|
||||||
- La compaction `pack --sparse` produit une matrice `PersistentSparseBitMatrix` dont le contenu est **strictement identique** à la matrice dense d'origine : vérification exhaustive coordonnée par coordonnée sur **1 804 774 880 cellules** (512 partitions × 2 layers), **zéro différence**.
|
|
||||||
- `fill_row` et `fill_sub_matrix` (les deux chemins de lecture utilisés par le pipeline phylogénétique) restituent les mêmes bits sur dense et sparse.
|
|
||||||
- **Conclusion** : le bug n'est **pas** dans la compaction sparse elle-même, ni dans les chemins de lecture individuels. La structure stocke correctement A, C, G, T.
|
|
||||||
|
|
||||||
**Conséquence logique** :
|
|
||||||
Si les matrices sont identiques mais que le résultat final diffère, le bug se situe dans l'**intersection** des informations — c'est-à-dire dans le code qui **combine** les lectures des deux matrices (ou qui transforme les résultats bruts en tallies). Deux endroits possibles :
|
|
||||||
1. **Le scan `sankoff_bundle`** (`family_scan.rs` + `sankoff_bundle.rs`) : la boucle qui lit les matrices, construit `genome_mask`, et accumule `bp_counts` / `same`. C'est l'étape d'intersection proprement dite.
|
|
||||||
2. **La conversion des tallies en YAML** (`obikmer/src/cmd/phylo/sankoff.rs`) : moins probable, mais possible si quelque chose sélectionne/filtre les transitions avant écriture.
|
|
||||||
|
|
||||||
**Hypothèse la plus probable** : bug dans la résolution cross-partition lors de la construction de l'annex sibling (`build_sibling_annex`). A (bit 0) serait systématiquement manquant ou mal résolu quand on interroge les variants d'une famille depuis une partition différente. À vérifier dans `src/obikphylo/src/siblings/build.rs` et `src/obikphylo/src/siblings/cache.rs` (`PartitionCache::find` / `find_presence_batch`).
|
|
||||||
|
|
||||||
**Prochaine étape logique** :
|
|
||||||
1. Inspecter `build_sibling_annex` pour voir si les variants avec base A sont bien générés et bien recherchés dans `cache.find`.
|
|
||||||
2. Vérifier `PartitionCache::find` et `resolve_layer_hits` pour un éventuel biais contre le bit 0.
|
|
||||||
3. Si besoin, ajouter un diagnostic ciblé (compteurs par base) **uniquement** dans `cache.rs` ou `build.rs`, pas dans `sankoff_bundle.rs` qui est déjà propre.
|
|
||||||
|
|
||||||
**Contraintes** :
|
|
||||||
- Ne pas modifier `sankoff_bundle.rs` davantage.
|
|
||||||
- Ne pas toucher à git.
|
|
||||||
- Faire des diagnostics minimaux et ciblés.
|
|
||||||
@@ -1,167 +0,0 @@
|
|||||||
ratio_ceiling: 0.5
|
|
||||||
cardinality_transitions:
|
|
||||||
- from: 0
|
|
||||||
to: 0
|
|
||||||
count: 115955295
|
|
||||||
probability: 0.8297007290571883
|
|
||||||
- from: 0
|
|
||||||
to: 1
|
|
||||||
count: 12901663
|
|
||||||
probability: 0.0923159153460836
|
|
||||||
- from: 0
|
|
||||||
to: 2
|
|
||||||
count: 10519367
|
|
||||||
probability: 0.07526975347801175
|
|
||||||
- from: 0
|
|
||||||
to: 3
|
|
||||||
count: 339782
|
|
||||||
probability: 0.0024312591600108434
|
|
||||||
- from: 0
|
|
||||||
to: 4
|
|
||||||
count: 39459
|
|
||||||
probability: 0.00028234295870548727
|
|
||||||
- from: 1
|
|
||||||
to: 0
|
|
||||||
count: 12901663
|
|
||||||
probability: 0.9007741539906029
|
|
||||||
- from: 1
|
|
||||||
to: 1
|
|
||||||
count: 973491
|
|
||||||
probability: 0.0679676357956696
|
|
||||||
- from: 1
|
|
||||||
to: 2
|
|
||||||
count: 444884
|
|
||||||
probability: 0.031061112720426456
|
|
||||||
- from: 1
|
|
||||||
to: 3
|
|
||||||
count: 2739
|
|
||||||
probability: 0.00019123274323474897
|
|
||||||
- from: 1
|
|
||||||
to: 4
|
|
||||||
count: 84
|
|
||||||
probability: 5.864750066344985e-6
|
|
||||||
- from: 2
|
|
||||||
to: 0
|
|
||||||
count: 10519367
|
|
||||||
probability: 0.9590597257562327
|
|
||||||
- from: 2
|
|
||||||
to: 1
|
|
||||||
count: 444884
|
|
||||||
probability: 0.04056045644508228
|
|
||||||
- from: 2
|
|
||||||
to: 2
|
|
||||||
count: 3796
|
|
||||||
probability: 0.00034608458084699006
|
|
||||||
- from: 2
|
|
||||||
to: 3
|
|
||||||
count: 327
|
|
||||||
probability: 0.000029812870900149037
|
|
||||||
- from: 2
|
|
||||||
to: 4
|
|
||||||
count: 43
|
|
||||||
probability: 3.920346937940087e-6
|
|
||||||
- from: 3
|
|
||||||
to: 0
|
|
||||||
count: 339782
|
|
||||||
probability: 0.9908029486551426
|
|
||||||
- from: 3
|
|
||||||
to: 1
|
|
||||||
count: 2739
|
|
||||||
probability: 0.007986913010007698
|
|
||||||
- from: 3
|
|
||||||
to: 2
|
|
||||||
count: 327
|
|
||||||
probability: 0.0009535306879417734
|
|
||||||
- from: 3
|
|
||||||
to: 3
|
|
||||||
count: 58
|
|
||||||
probability: 0.00016912776728019222
|
|
||||||
- from: 3
|
|
||||||
to: 4
|
|
||||||
count: 30
|
|
||||||
probability: 0.00008747987962768563
|
|
||||||
- from: 4
|
|
||||||
to: 0
|
|
||||||
count: 39459
|
|
||||||
probability: 0.9957604663487016
|
|
||||||
- from: 4
|
|
||||||
to: 1
|
|
||||||
count: 84
|
|
||||||
probability: 0.0021197668256491787
|
|
||||||
- from: 4
|
|
||||||
to: 2
|
|
||||||
count: 43
|
|
||||||
probability: 0.0010851187321775557
|
|
||||||
- from: 4
|
|
||||||
to: 3
|
|
||||||
count: 30
|
|
||||||
probability: 0.0007570595805889924
|
|
||||||
- from: 4
|
|
||||||
to: 4
|
|
||||||
count: 11
|
|
||||||
probability: 0.0002775885128826305
|
|
||||||
composition_transitions:
|
|
||||||
- from: 'A'
|
|
||||||
to: 'A'
|
|
||||||
count: 169043
|
|
||||||
probability: 0.49442957633191476
|
|
||||||
- from: 'A'
|
|
||||||
to: 'C'
|
|
||||||
count: 27672
|
|
||||||
probability: 0.08093712982055894
|
|
||||||
- from: 'A'
|
|
||||||
to: 'G'
|
|
||||||
count: 124160
|
|
||||||
probability: 0.36315242983957063
|
|
||||||
- from: 'A'
|
|
||||||
to: 'T'
|
|
||||||
count: 21020
|
|
||||||
probability: 0.06148086400795566
|
|
||||||
- from: 'C'
|
|
||||||
to: 'A'
|
|
||||||
count: 27672
|
|
||||||
probability: 0.08651690662664728
|
|
||||||
- from: 'C'
|
|
||||||
to: 'C'
|
|
||||||
count: 145183
|
|
||||||
probability: 0.4539167409213838
|
|
||||||
- from: 'C'
|
|
||||||
to: 'G'
|
|
||||||
count: 23425
|
|
||||||
probability: 0.07323859994684925
|
|
||||||
- from: 'C'
|
|
||||||
to: 'T'
|
|
||||||
count: 123565
|
|
||||||
probability: 0.3863277525051197
|
|
||||||
- from: 'G'
|
|
||||||
to: 'A'
|
|
||||||
count: 124160
|
|
||||||
probability: 0.3846082361177367
|
|
||||||
- from: 'G'
|
|
||||||
to: 'C'
|
|
||||||
count: 23425
|
|
||||||
probability: 0.07256320820761906
|
|
||||||
- from: 'G'
|
|
||||||
to: 'G'
|
|
||||||
count: 148125
|
|
||||||
probability: 0.4588441927749658
|
|
||||||
- from: 'G'
|
|
||||||
to: 'T'
|
|
||||||
count: 27112
|
|
||||||
probability: 0.08398436289967846
|
|
||||||
- from: 'T'
|
|
||||||
to: 'A'
|
|
||||||
count: 21020
|
|
||||||
probability: 0.06258131551760583
|
|
||||||
- from: 'T'
|
|
||||||
to: 'C'
|
|
||||||
count: 123565
|
|
||||||
probability: 0.3678810776371534
|
|
||||||
- from: 'T'
|
|
||||||
to: 'G'
|
|
||||||
count: 27112
|
|
||||||
probability: 0.08071858355439246
|
|
||||||
- from: 'T'
|
|
||||||
to: 'T'
|
|
||||||
count: 164186
|
|
||||||
probability: 0.4888190232908483
|
|
||||||
@@ -1,18 +0,0 @@
|
|||||||
#!/usr/bin/awk -f
|
|
||||||
|
|
||||||
/^>/ {
|
|
||||||
print
|
|
||||||
next
|
|
||||||
}
|
|
||||||
|
|
||||||
{
|
|
||||||
gsub(/[Aa]/, "a")
|
|
||||||
gsub(/[Gg]/, "A")
|
|
||||||
gsub(/a/, "G")
|
|
||||||
|
|
||||||
gsub(/[Cc]/, "c")
|
|
||||||
gsub(/[Tt]/, "C")
|
|
||||||
gsub(/c/, "T")
|
|
||||||
|
|
||||||
print
|
|
||||||
}
|
|
||||||
Generated
+1
-10
@@ -493,16 +493,6 @@ dependencies = [
|
|||||||
"impl-tools",
|
"impl-tools",
|
||||||
]
|
]
|
||||||
|
|
||||||
[[package]]
|
|
||||||
name = "compare_sparse"
|
|
||||||
version = "0.1.0"
|
|
||||||
dependencies = [
|
|
||||||
"anyhow",
|
|
||||||
"fastrand",
|
|
||||||
"obicompactvec",
|
|
||||||
"obikindex",
|
|
||||||
]
|
|
||||||
|
|
||||||
[[package]]
|
[[package]]
|
||||||
name = "console"
|
name = "console"
|
||||||
version = "0.15.11"
|
version = "0.15.11"
|
||||||
@@ -1771,6 +1761,7 @@ dependencies = [
|
|||||||
name = "obikindex"
|
name = "obikindex"
|
||||||
version = "0.1.0"
|
version = "0.1.0"
|
||||||
dependencies = [
|
dependencies = [
|
||||||
|
"anyhow",
|
||||||
"crossbeam-channel",
|
"crossbeam-channel",
|
||||||
"hwlocality",
|
"hwlocality",
|
||||||
"indicatif 0.17.11",
|
"indicatif 0.17.11",
|
||||||
|
|||||||
+1
-1
@@ -1,5 +1,5 @@
|
|||||||
[workspace]
|
[workspace]
|
||||||
resolver = "3"
|
resolver = "3"
|
||||||
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy", "obikphylo", "compare_sparse"]
|
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy", "obikphylo"]
|
||||||
[profile.release]
|
[profile.release]
|
||||||
debug = 1
|
debug = 1
|
||||||
@@ -1,130 +0,0 @@
|
|||||||
use std::path::PathBuf;
|
|
||||||
|
|
||||||
use obicompactvec::{BinaryMatrix, PersistentBitMatrix, PersistentSparseBitMatrix};
|
|
||||||
use obikindex::KmerIndex;
|
|
||||||
|
|
||||||
fn main() -> anyhow::Result<()> {
|
|
||||||
let orig_root = std::env::args().nth(1).expect("usage: compare_sparse <orig_dense> <sparse>");
|
|
||||||
let sparse_root = std::env::args().nth(2).expect("usage: compare_sparse <orig_dense> <sparse>");
|
|
||||||
|
|
||||||
let orig = KmerIndex::open(&orig_root)?;
|
|
||||||
let sparse = KmerIndex::open(&sparse_root)?;
|
|
||||||
|
|
||||||
let n_parts = orig.n_partitions();
|
|
||||||
let n_layers = orig.n_layers_per_partition()?;
|
|
||||||
let n_genomes = orig.meta().genomes.len();
|
|
||||||
|
|
||||||
println!("index orig: {} partitions, {} layers, {} genomes", n_parts, n_layers, n_genomes);
|
|
||||||
println!("index sparse:{} partitions, {} layers, {} genomes", sparse.n_partitions(), sparse.n_layers_per_partition()?, sparse.meta().genomes.len());
|
|
||||||
|
|
||||||
let mut total_layers = 0usize;
|
|
||||||
let mut mismatches = 0usize;
|
|
||||||
let mut slot_checked = 0usize;
|
|
||||||
|
|
||||||
for part in 0..n_parts {
|
|
||||||
let part_dir_orig = orig.partition().part_dir(part);
|
|
||||||
let part_dir_sparse = sparse.partition().part_dir(part);
|
|
||||||
|
|
||||||
if !part_dir_orig.join("index").exists() || !part_dir_sparse.join("index").exists() {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
|
|
||||||
for layer in 0..n_layers {
|
|
||||||
let layer_dir_orig = part_dir_orig.join("index").join(format!("layer_{layer}"));
|
|
||||||
let layer_dir_sparse = part_dir_sparse.join("index").join(format!("layer_{layer}"));
|
|
||||||
|
|
||||||
if !layer_dir_orig.exists() || !layer_dir_sparse.exists() {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
|
|
||||||
let presence_orig = layer_dir_orig.join("presence");
|
|
||||||
let presence_sparse = layer_dir_sparse.join("presence");
|
|
||||||
|
|
||||||
if !presence_orig.exists() || !presence_sparse.exists() {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
|
|
||||||
// Ouvrir la matrice dense (PackedBitMatrix) depuis l'original
|
|
||||||
let dense = match PersistentBitMatrix::open(&presence_orig) {
|
|
||||||
Ok(m) => m,
|
|
||||||
Err(e) => {
|
|
||||||
eprintln!("ERREUR ouverture dense part={part} layer={layer}: {e}");
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
// Ouvrir la matrice sparse
|
|
||||||
let sp = match PersistentSparseBitMatrix::open(&presence_sparse) {
|
|
||||||
Ok(m) => m,
|
|
||||||
Err(e) => {
|
|
||||||
eprintln!("ERREUR ouverture sparse part={part} layer={layer}: {e}");
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
if dense.n_cols() != sp.n_cols() {
|
|
||||||
eprintln!("ERREUR n_cols différent part={part} layer={layer}: dense={} sparse={}", dense.n_cols(), sp.n_cols());
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
|
|
||||||
let n = dense.n();
|
|
||||||
if n != sp.n() {
|
|
||||||
eprintln!("ERREUR n différent part={part} layer={layer}: dense={} sparse={}", n, sp.n());
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
|
|
||||||
if n == 0 {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
|
|
||||||
// Échantillon de 100 slots aléatoires par layer
|
|
||||||
let mut rng = fastrand::Rng::with_seed(part as u64 * 1000 + layer as u64);
|
|
||||||
let sample_size = 100.min(n);
|
|
||||||
let mut checked_any = false;
|
|
||||||
|
|
||||||
for _ in 0..sample_size {
|
|
||||||
let slot = rng.usize(0..n);
|
|
||||||
let mut dense_row = vec![0u32; dense.n_cols()];
|
|
||||||
let mut sparse_row = vec![0u32; sp.n_cols()];
|
|
||||||
|
|
||||||
dense.fill_row(slot, &mut dense_row);
|
|
||||||
sp.fill_row(slot, &mut sparse_row);
|
|
||||||
|
|
||||||
if dense_row != sparse_row {
|
|
||||||
// Premier mismatch pour ce layer : diagnostiquer la colonne A
|
|
||||||
if !checked_any {
|
|
||||||
let a_col = 0; // A est la colonne 0
|
|
||||||
let mut a_dense = 0u32;
|
|
||||||
let mut a_sparse = 0u32;
|
|
||||||
// scanner tous les slots pour compter les différences sur la colonne A
|
|
||||||
let mut diff_a = 0usize;
|
|
||||||
for s in 0..n {
|
|
||||||
let mut d = vec![0u32; dense.n_cols()];
|
|
||||||
let mut s2 = vec![0u32; sp.n_cols()];
|
|
||||||
dense.fill_row(s, &mut d);
|
|
||||||
sp.fill_row(s, &mut s2);
|
|
||||||
if d[a_col] != s2[a_col] {
|
|
||||||
diff_a += 1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
eprintln!("MISMATCH part={part} layer={layer} slot={slot}: colonne A différente sur {diff_a}/{n} slots");
|
|
||||||
mismatches += 1;
|
|
||||||
checked_any = true;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
slot_checked += 1;
|
|
||||||
}
|
|
||||||
|
|
||||||
total_layers += 1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
println!("Vérifié {} layers, {} slots échantillonnés", total_layers, slot_checked);
|
|
||||||
if mismatches == 0 {
|
|
||||||
println!("OK : aucune différence détectée.");
|
|
||||||
} else {
|
|
||||||
println!("MISMATCHES détectés dans {} layers", mismatches);
|
|
||||||
}
|
|
||||||
|
|
||||||
Ok(())
|
|
||||||
}
|
|
||||||
@@ -1,14 +0,0 @@
|
|||||||
[package]
|
|
||||||
name = "compare_sparse"
|
|
||||||
version = "0.1.0"
|
|
||||||
edition = "2021"
|
|
||||||
|
|
||||||
[[bin]]
|
|
||||||
name = "compare_sparse"
|
|
||||||
path = "src/main.rs"
|
|
||||||
|
|
||||||
[dependencies]
|
|
||||||
obikindex = { path = "../obikindex", default-features = false }
|
|
||||||
obicompactvec = { path = "../obicompactvec" }
|
|
||||||
anyhow = "1"
|
|
||||||
fastrand = "2"
|
|
||||||
@@ -24,6 +24,7 @@ hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], option
|
|||||||
obiread = { path = "../obiread" }
|
obiread = { path = "../obiread" }
|
||||||
tempfile = "3"
|
tempfile = "3"
|
||||||
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
|
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
|
||||||
|
anyhow = "1"
|
||||||
|
|
||||||
[features]
|
[features]
|
||||||
default = ["numa"]
|
default = ["numa"]
|
||||||
|
|||||||
@@ -1,9 +1,14 @@
|
|||||||
|
//! Diagnostic tool: verify that a sparse-packed presence index (`pack --sparse`)
|
||||||
|
//! is bit-for-bit identical to the dense index it was compacted from.
|
||||||
|
//!
|
||||||
|
//! Usage: cargo run --example compare_sparse -p obikindex -- <sparse_root> <dense_root>
|
||||||
|
|
||||||
use obicompactvec::{PersistentBitMatrix, PersistentSparseBitMatrix};
|
use obicompactvec::{PersistentBitMatrix, PersistentSparseBitMatrix};
|
||||||
use obikindex::KmerIndex;
|
use obikindex::KmerIndex;
|
||||||
|
|
||||||
fn main() -> anyhow::Result<()> {
|
fn main() -> anyhow::Result<()> {
|
||||||
let sparse_root = std::env::args().nth(1).expect("usage: compare_full <sparse> <orig_dense>");
|
let sparse_root = std::env::args().nth(1).expect("usage: compare_sparse <sparse_root> <dense_root>");
|
||||||
let dense_root = std::env::args().nth(2).expect("usage: compare_full <sparse> <orig_dense>");
|
let dense_root = std::env::args().nth(2).expect("usage: compare_sparse <sparse_root> <dense_root>");
|
||||||
|
|
||||||
let sparse = KmerIndex::open(&sparse_root)?;
|
let sparse = KmerIndex::open(&sparse_root)?;
|
||||||
let dense = KmerIndex::open(&dense_root)?;
|
let dense = KmerIndex::open(&dense_root)?;
|
||||||
@@ -15,7 +15,7 @@ use super::cardinality::CardinalityExt;
|
|||||||
use super::distance::DistanceExt;
|
use super::distance::DistanceExt;
|
||||||
use super::entropy::ShannonEntropyExt;
|
use super::entropy::ShannonEntropyExt;
|
||||||
use super::entropy_annex::{EntropyAnnex, ENTROPY_ANNEX_FILE_NAME};
|
use super::entropy_annex::{EntropyAnnex, ENTROPY_ANNEX_FILE_NAME};
|
||||||
use super::helpers::{central_base, is_minorant};
|
use super::helpers::is_minorant;
|
||||||
use super::sankoff_bundle::SankoffBundleExt;
|
use super::sankoff_bundle::SankoffBundleExt;
|
||||||
use super::stats::SiblingStatsExt;
|
use super::stats::SiblingStatsExt;
|
||||||
use super::subsample::EntropyBias;
|
use super::subsample::EntropyBias;
|
||||||
@@ -550,634 +550,3 @@ fn entropy_annex_builds_on_demand_and_biases_selection() {
|
|||||||
assert!(find_layer(&selections_far).is_none(), "mu far from the true entropy must never select it, in any layer");
|
assert!(find_layer(&selections_far).is_none(), "mu far from the true entropy must never select it, in any layer");
|
||||||
}
|
}
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn diag_real_index_layer_distribution() {
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/Sync/travail/__MOI__/obikmer/benchmark/global_index_presence")
|
|
||||||
.expect("open real index");
|
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(&idx).expect("layer dirs");
|
|
||||||
let counts = super::subsample::non_monomorphic_counts(&layer_dirs).expect("counts");
|
|
||||||
let total: u64 = counts.iter().sum();
|
|
||||||
let n_zero = counts.iter().filter(|&&c| c == 0).count();
|
|
||||||
let max = counts.iter().max().unwrap();
|
|
||||||
let min_nonzero = counts.iter().filter(|&&c| c > 0).min().unwrap_or(&0);
|
|
||||||
println!("n_layers={} total={} n_zero_layers={} max={} min_nonzero={}",
|
|
||||||
counts.len(), total, n_zero, max, min_nonzero);
|
|
||||||
let n = 100_000usize;
|
|
||||||
let selections = super::subsample::compute_selections(&idx, &layer_dirs, Some(n), None).expect("selections");
|
|
||||||
let selected_total: usize = selections.iter().map(|s| match s {
|
|
||||||
None => 0, // shouldn't happen when total_count > n
|
|
||||||
Some(set) => set.len(),
|
|
||||||
}).sum();
|
|
||||||
println!("requested={n} selected_total={selected_total}");
|
|
||||||
let mut sorted_counts = counts.clone();
|
|
||||||
sorted_counts.sort_unstable_by(|a, b| b.cmp(a));
|
|
||||||
println!("top10 counts: {:?}", &sorted_counts[..10.min(sorted_counts.len())]);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn diag_real_index_base_a_representation() {
|
|
||||||
// Diagnostic for a user-reported observation, reproduced on two
|
|
||||||
// unrelated real datasets (a plant and this bacterial index):
|
|
||||||
// `composition_transitions`'s row/column for base 'A' is entirely
|
|
||||||
// zero, even though 'A' appears at real (~6-22%) frequency in the
|
|
||||||
// pseudo-alignment itself. A minimal synthetic reproduction
|
|
||||||
// (`base_pair_tally_accumulates_base_a_diagnostic`) showed the
|
|
||||||
// pairwise tally mechanism itself works correctly for base A in
|
|
||||||
// isolation — so this checks one level lower, purely structural
|
|
||||||
// (annex bits only, no cross-partition/genome-level resolution): does
|
|
||||||
// base A even show up as *present* in minorant families' own
|
|
||||||
// `FamilyMask`s at all, at a rate proportional to the other 3 bases?
|
|
||||||
// If yes, the anomaly is specific to the pairwise/`single_form`
|
|
||||||
// resolution stage; if `has_base[0]` is itself near-zero here, the
|
|
||||||
// anomaly originates earlier, in `build_sibling_annex`/`central_base`.
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/Sync/travail/__MOI__/obikmer/benchmark/global_index_presence")
|
|
||||||
.expect("open real index");
|
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(&idx).expect("layer dirs");
|
|
||||||
let mut has_base = [0u64; 4];
|
|
||||||
let mut minorant_total = 0u64;
|
|
||||||
let mut minorant_central_a = 0u64;
|
|
||||||
for layer_dir in &layer_dirs {
|
|
||||||
let annex = SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME)).unwrap();
|
|
||||||
for slot in 0..annex.len() {
|
|
||||||
let Some(mask) = annex.get(slot) else { continue };
|
|
||||||
if !mask.is_minorant() {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
minorant_total += 1;
|
|
||||||
for b in 0..4u8 {
|
|
||||||
if mask.has(b) {
|
|
||||||
has_base[b as usize] += 1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
// Cross-check: for a sample of this layer's minorants, is the
|
|
||||||
// slot's *own* central base ever actually 'A' (bit 0)? — reads
|
|
||||||
// the real k-mer via the layer's MPHF, not just the mask.
|
|
||||||
let meta = PartitionMeta::load(layer_dir.parent().unwrap()).unwrap();
|
|
||||||
let mphf = MphfLayer::open(layer_dir, &meta.mode).unwrap();
|
|
||||||
for (order, kmer) in mphf.enumerate_kmers().take(2_000_000) {
|
|
||||||
let Some(mask) = annex.get(order) else { continue };
|
|
||||||
if mask.is_minorant() && central_base(kmer, idx.kmer_size()) == 0 {
|
|
||||||
minorant_central_a += 1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
println!(
|
|
||||||
"minorant_total={minorant_total} has_base(A,C,G,T)={has_base:?} minorant_central_a_sampled={minorant_central_a}"
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn diag_real_index_sankoff_bundle_base_a() {
|
|
||||||
// Structural check (`diag_real_index_base_a_representation`) shows
|
|
||||||
// base A fully, proportionally represented at the family level (~23M
|
|
||||||
// minorants, the *highest* of the four bases) — so the anomaly must
|
|
||||||
// be downstream, in `sankoff_bundle`'s actual pairwise resolution.
|
|
||||||
// Reproduces through the real cross-partition code path (not the
|
|
||||||
// minimal synthetic fixture, which showed the mechanism working in
|
|
||||||
// isolation), bounded by `--subsample` to stay fast.
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/Sync/travail/__MOI__/obikmer/benchmark/global_index_presence")
|
|
||||||
.expect("open real index");
|
|
||||||
let n_genomes = idx.meta().genomes.len();
|
|
||||||
let exclude_mask = vec![false; n_genomes];
|
|
||||||
let bundle = idx.sankoff_bundle(Some(1_000_000), None, 0.5, &exclude_mask).expect("sankoff_bundle");
|
|
||||||
println!("base_pair_tally.same={:?}", bundle.base_pair_tally.same);
|
|
||||||
println!("base_pair_tally.counts={:?}", bundle.base_pair_tally.counts);
|
|
||||||
let alignment_a_count: usize = bundle.alignment.sequences.iter()
|
|
||||||
.map(|seq| seq.iter().filter(|&&b| b == b'A').count())
|
|
||||||
.sum();
|
|
||||||
println!("alignment raw 'A' byte count={alignment_a_count}");
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn diag_real_index_genome_mask_for_base_a_families() {
|
|
||||||
// Directly inspects the raw `genome_mask` array `sankoff_bundle`'s
|
|
||||||
// closures see, for the first few variable families where base A is
|
|
||||||
// present — to check whether A ever co-occurs as `single_form` in two
|
|
||||||
// *different* genomes at the same family at all (the precondition for
|
|
||||||
// `bp_same`/`bp_counts` to ever increment for base A), rather than
|
|
||||||
// reasoning about it further.
|
|
||||||
use std::sync::Arc;
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/Sync/travail/__MOI__/obikmer/benchmark/global_index_presence")
|
|
||||||
.expect("open real index");
|
|
||||||
let n_parts = idx.n_partitions();
|
|
||||||
let n_genomes = idx.meta().genomes.len();
|
|
||||||
let with_counts = idx.meta().config.with_counts;
|
|
||||||
let k = idx.kmer_size();
|
|
||||||
let n_bits = n_parts.trailing_zeros() as usize;
|
|
||||||
let partition = obikpartitionner::KmerPartition::open_with_config(
|
|
||||||
idx.root_path(), idx.kmer_size(), idx.minimizer_size(), n_bits,
|
|
||||||
).unwrap();
|
|
||||||
let cache = Arc::new(super::cache::PartitionCache::build(&partition, n_parts, with_counts).unwrap());
|
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(&idx).unwrap();
|
|
||||||
|
|
||||||
let mut printed = 0usize;
|
|
||||||
for layer_dir in &layer_dirs {
|
|
||||||
super::family_scan::scan_layer_families(
|
|
||||||
layer_dir, n_parts, n_genomes, with_counts, k, &cache, &super::family_scan::Selection::All,
|
|
||||||
|_family_idx, mask, genome_mask| {
|
|
||||||
if printed >= 15 || !mask.has(0) || mask.family_size() < 2 {
|
|
||||||
return;
|
|
||||||
}
|
|
||||||
let single_a: Vec<usize> = (0..n_genomes).filter(|&g| genome_mask[g] == 1).collect();
|
|
||||||
let others: Vec<(usize, u8)> = (0..n_genomes)
|
|
||||||
.filter(|&g| genome_mask[g] != 0 && genome_mask[g] != 1)
|
|
||||||
.map(|g| (g, genome_mask[g]))
|
|
||||||
.collect();
|
|
||||||
println!(
|
|
||||||
"family bits={:#06b} size={} single_A_genomes={:?} other_nonzero_genomes={:?}",
|
|
||||||
mask.bits(), mask.family_size(), single_a, others,
|
|
||||||
);
|
|
||||||
printed += 1;
|
|
||||||
},
|
|
||||||
).unwrap();
|
|
||||||
if printed >= 15 {
|
|
||||||
break;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn diag_plant_index_presence_matrix_sparsity() {
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/travail/obiskim/data/phyloalps/phyloskims_sal_vac")
|
|
||||||
.expect("open real plant index");
|
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(&idx).expect("layer dirs");
|
|
||||||
println!("n_layers={}", layer_dirs.len());
|
|
||||||
|
|
||||||
// Sample a spread of layers rather than just the first few (partition
|
|
||||||
// order, not necessarily representative) — every 37th layer, capped at 20.
|
|
||||||
let sample: Vec<&std::path::PathBuf> = layer_dirs.iter().step_by(37).take(20).collect();
|
|
||||||
|
|
||||||
let mut total_ones: u64 = 0;
|
|
||||||
let mut total_cells: u64 = 0;
|
|
||||||
for layer_dir in &sample {
|
|
||||||
let mat = obicompactvec::PersistentBitMatrix::open(layer_dir).expect("open presence matrix");
|
|
||||||
let n = mat.n() as u64;
|
|
||||||
let n_cols = mat.n_cols() as u64;
|
|
||||||
let ones: u64 = mat.count_ones().iter().sum();
|
|
||||||
let cells = n * n_cols;
|
|
||||||
let density = ones as f64 / cells as f64;
|
|
||||||
println!(
|
|
||||||
"{}: n_slots={n} n_cols={n_cols} ones={ones} cells={cells} density={:.6} sparsity={:.6}",
|
|
||||||
layer_dir.display(), density, 1.0 - density,
|
|
||||||
);
|
|
||||||
total_ones += ones;
|
|
||||||
total_cells += cells;
|
|
||||||
}
|
|
||||||
let overall_density = total_ones as f64 / total_cells as f64;
|
|
||||||
println!(
|
|
||||||
"OVERALL sampled_layers={} total_ones={total_ones} total_cells={total_cells} density={:.6} sparsity={:.6}",
|
|
||||||
sample.len(), overall_density, 1.0 - overall_density,
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn diag_plant_index_multigenome_set_duplication() {
|
|
||||||
use std::collections::HashMap;
|
|
||||||
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/travail/obiskim/data/phyloalps/phyloskims_sal_vac")
|
|
||||||
.expect("open real plant index");
|
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(&idx).expect("layer dirs");
|
|
||||||
|
|
||||||
// Same spread-sampling strategy as the sparsity diagnostic — every
|
|
||||||
// 37th layer, capped at 8 (this one is heavier per layer: builds a
|
|
||||||
// hash map of every distinct multi-genome set).
|
|
||||||
let sample: Vec<&std::path::PathBuf> = layer_dirs.iter().step_by(37).take(8).collect();
|
|
||||||
|
|
||||||
let mut total_rows: u64 = 0;
|
|
||||||
let mut total_multi_rows: u64 = 0;
|
|
||||||
let mut total_distinct_multi_sets: u64 = 0;
|
|
||||||
let mut total_singleton_rows: u64 = 0;
|
|
||||||
|
|
||||||
for layer_dir in &sample {
|
|
||||||
let mat = obicompactvec::PersistentBitMatrix::open(layer_dir).expect("open presence matrix");
|
|
||||||
let n = mat.n();
|
|
||||||
let n_cols = mat.n_cols();
|
|
||||||
let mut seen: HashMap<Vec<u32>, u32> = HashMap::new();
|
|
||||||
let mut singleton = 0u64;
|
|
||||||
let mut multi = 0u64;
|
|
||||||
let mut buf = vec![0u32; n_cols];
|
|
||||||
for slot in 0..n {
|
|
||||||
mat.fill_row(slot, &mut buf);
|
|
||||||
let set: Vec<u32> = (0..n_cols).filter(|&c| buf[c] != 0).map(|c| c as u32).collect();
|
|
||||||
match set.len() {
|
|
||||||
0 => {}
|
|
||||||
1 => singleton += 1,
|
|
||||||
_ => {
|
|
||||||
multi += 1;
|
|
||||||
*seen.entry(set).or_insert(0) += 1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
let distinct = seen.len() as u64;
|
|
||||||
println!(
|
|
||||||
"{}: n_slots={n} n_cols={n_cols} singleton_rows={singleton} multi_rows={multi} distinct_multi_sets={distinct} dedup_ratio={:.4}",
|
|
||||||
layer_dir.display(),
|
|
||||||
if multi > 0 { distinct as f64 / multi as f64 } else { 0.0 },
|
|
||||||
);
|
|
||||||
total_rows += n as u64;
|
|
||||||
total_singleton_rows += singleton;
|
|
||||||
total_multi_rows += multi;
|
|
||||||
total_distinct_multi_sets += distinct;
|
|
||||||
}
|
|
||||||
|
|
||||||
println!(
|
|
||||||
"OVERALL sampled_layers={} total_rows={total_rows} singleton_rows={total_singleton_rows} multi_rows={total_multi_rows} distinct_multi_sets={total_distinct_multi_sets} dedup_ratio={:.4}",
|
|
||||||
sample.len(),
|
|
||||||
if total_multi_rows > 0 { total_distinct_multi_sets as f64 / total_multi_rows as f64 } else { 0.0 },
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn diag_plant_index_cardinality_distribution() {
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/travail/obiskim/data/phyloalps/phyloskims_sal_vac")
|
|
||||||
.expect("open real plant index");
|
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(&idx).expect("layer dirs");
|
|
||||||
let sample: Vec<&std::path::PathBuf> = layer_dirs.iter().step_by(37).take(8).collect();
|
|
||||||
|
|
||||||
let mut hist: Vec<u64> = Vec::new(); // hist[k] = number of rows with cardinality k
|
|
||||||
let mut total_rows: u64 = 0;
|
|
||||||
|
|
||||||
for layer_dir in &sample {
|
|
||||||
let mat = obicompactvec::PersistentBitMatrix::open(layer_dir).expect("open presence matrix");
|
|
||||||
let n = mat.n();
|
|
||||||
let n_cols = mat.n_cols();
|
|
||||||
if hist.len() < n_cols + 1 {
|
|
||||||
hist.resize(n_cols + 1, 0);
|
|
||||||
}
|
|
||||||
let mut buf = vec![0u32; n_cols];
|
|
||||||
for slot in 0..n {
|
|
||||||
mat.fill_row(slot, &mut buf);
|
|
||||||
let card = buf.iter().filter(|&&v| v != 0).count();
|
|
||||||
hist[card] += 1;
|
|
||||||
}
|
|
||||||
total_rows += n as u64;
|
|
||||||
}
|
|
||||||
|
|
||||||
println!("total_rows={total_rows}");
|
|
||||||
let mut cum: u64 = 0;
|
|
||||||
for (card, &count) in hist.iter().enumerate() {
|
|
||||||
if count == 0 { continue; }
|
|
||||||
cum += count;
|
|
||||||
println!(
|
|
||||||
"cardinality={card:3} count={count:10} frac={:.6} cumulative_frac={:.6}",
|
|
||||||
count as f64 / total_rows as f64,
|
|
||||||
cum as f64 / total_rows as f64,
|
|
||||||
);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn bench_sparse_matrix_inmemory_construction_ram() {
|
|
||||||
use std::collections::HashMap;
|
|
||||||
use std::time::Instant;
|
|
||||||
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/travail/obiskim/data/phyloalps/phyloskims_sal_vac")
|
|
||||||
.expect("open real plant index");
|
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(&idx).expect("layer dirs");
|
|
||||||
// A `layer_1` (the larger, merged layer) — pick the one already
|
|
||||||
// profiled: part_00018/index/layer_1, ~30.2M rows.
|
|
||||||
let layer_dir = layer_dirs.iter()
|
|
||||||
.find(|p| p.to_string_lossy().contains("part_00018") && p.to_string_lossy().contains("layer_1"))
|
|
||||||
.expect("expected layer not found — layer_dirs order may have changed");
|
|
||||||
|
|
||||||
let mat = obicompactvec::PersistentBitMatrix::open(layer_dir).expect("open presence matrix");
|
|
||||||
let n = mat.n();
|
|
||||||
let n_cols = mat.n_cols();
|
|
||||||
println!("layer={} n_slots={n} n_cols={n_cols}", layer_dir.display());
|
|
||||||
|
|
||||||
let rss_before = obisys::peak_rss_bytes();
|
|
||||||
let t0 = Instant::now();
|
|
||||||
|
|
||||||
// Plan design: is_multi flag (1 bit/row) + two SEPARATE arrays
|
|
||||||
// (singleton-only, multi-only), each sized to its own value range —
|
|
||||||
// not one array covering the whole dict_id space. In-memory prototype
|
|
||||||
// (u32 per entry, not yet bit-packed — the fixed-width primitive
|
|
||||||
// isn't built yet); this benchmark measures RAM + the split's real
|
|
||||||
// final size, not the construction-time representation's size.
|
|
||||||
let mut is_multi: Vec<bool> = Vec::with_capacity(n);
|
|
||||||
let mut singleton_array: Vec<u32> = Vec::new();
|
|
||||||
let mut multi_array: Vec<u32> = Vec::new();
|
|
||||||
let mut dedup: HashMap<Vec<u32>, u32> = HashMap::new();
|
|
||||||
let mut next_dict_id: u32 = 0;
|
|
||||||
let mut dict_values_bytes: u64 = 0; // running varint-encoded size estimate
|
|
||||||
let mut buf = vec![0u32; n_cols];
|
|
||||||
|
|
||||||
for slot in 0..n {
|
|
||||||
mat.fill_row(slot, &mut buf);
|
|
||||||
let set: Vec<u32> = (0..n_cols).filter(|&c| buf[c] != 0).map(|c| c as u32).collect();
|
|
||||||
match set.len() {
|
|
||||||
0 => { is_multi.push(false); singleton_array.push(0); } // shouldn't happen on a real built index; placeholder
|
|
||||||
1 => {
|
|
||||||
is_multi.push(false);
|
|
||||||
singleton_array.push(set[0]);
|
|
||||||
}
|
|
||||||
_ => {
|
|
||||||
is_multi.push(true);
|
|
||||||
let id = if let Some(&id) = dedup.get(&set) {
|
|
||||||
id
|
|
||||||
} else {
|
|
||||||
let id = next_dict_id;
|
|
||||||
next_dict_id += 1;
|
|
||||||
// varint size estimate: 1 byte per index < 128 (always
|
|
||||||
// true here, n_cols=91), matching the plan's encoding.
|
|
||||||
dict_values_bytes += set.iter().map(|&v| if v < 128 { 1 } else { 2 }).sum::<u64>();
|
|
||||||
dedup.insert(set, id);
|
|
||||||
id
|
|
||||||
};
|
|
||||||
multi_array.push(id);
|
|
||||||
}
|
|
||||||
};
|
|
||||||
}
|
|
||||||
|
|
||||||
let elapsed = t0.elapsed();
|
|
||||||
let rss_after = obisys::peak_rss_bytes();
|
|
||||||
|
|
||||||
let n_distinct_multi = dedup.len() as u64;
|
|
||||||
let n_singleton = singleton_array.len() as u64;
|
|
||||||
let n_multi = multi_array.len() as u64;
|
|
||||||
|
|
||||||
let is_multi_bytes = (n as u64).div_ceil(8);
|
|
||||||
let singleton_width_bits = (32 - (n_cols as u32).max(1).leading_zeros()).max(1);
|
|
||||||
let multi_width_bits = (32 - (n_distinct_multi as u32).max(1).leading_zeros()).max(1);
|
|
||||||
let singleton_array_bytes = (n_singleton * singleton_width_bits as u64).div_ceil(8);
|
|
||||||
let multi_array_bytes = (n_multi * multi_width_bits as u64).div_ceil(8);
|
|
||||||
|
|
||||||
let split_total = is_multi_bytes + singleton_array_bytes + multi_array_bytes + dict_values_bytes;
|
|
||||||
let dense_bytes = (n as u64 * n_cols as u64).div_ceil(8);
|
|
||||||
|
|
||||||
println!(
|
|
||||||
"elapsed={:?} rss_before={} rss_after={} rss_delta={}",
|
|
||||||
elapsed, fmt_mb(rss_before), fmt_mb(rss_after), fmt_mb(rss_after.saturating_sub(rss_before)),
|
|
||||||
);
|
|
||||||
println!(
|
|
||||||
"n_singleton={n_singleton} n_multi={n_multi} n_distinct_multi={n_distinct_multi} \
|
|
||||||
singleton_width_bits={singleton_width_bits} multi_width_bits={multi_width_bits}",
|
|
||||||
);
|
|
||||||
println!(
|
|
||||||
"is_multi_bytes={} singleton_array_bytes={} multi_array_bytes={} dict_values_bytes={} \
|
|
||||||
split_total_bytes={} ({:.1}x vs dense) dense_bytes={}",
|
|
||||||
fmt_mb(is_multi_bytes), fmt_mb(singleton_array_bytes), fmt_mb(multi_array_bytes),
|
|
||||||
fmt_mb(dict_values_bytes), fmt_mb(split_total),
|
|
||||||
dense_bytes as f64 / split_total as f64,
|
|
||||||
fmt_mb(dense_bytes),
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
fn fmt_mb(bytes: u64) -> String {
|
|
||||||
format!("{:.1}MB", bytes as f64 / (1024.0 * 1024.0))
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn bench_real_persistent_sparse_bit_matrix_on_disk_size() {
|
|
||||||
use std::time::Instant;
|
|
||||||
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/travail/obiskim/data/phyloalps/phyloskims_sal_vac")
|
|
||||||
.expect("open real plant index");
|
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(&idx).expect("layer dirs");
|
|
||||||
let layer_dir = layer_dirs.iter()
|
|
||||||
.find(|p| p.to_string_lossy().contains("part_00018") && p.to_string_lossy().contains("layer_1"))
|
|
||||||
.expect("expected layer not found — layer_dirs order may have changed");
|
|
||||||
|
|
||||||
let dense = obicompactvec::PersistentBitMatrix::open(layer_dir).expect("open presence matrix");
|
|
||||||
let n = dense.n();
|
|
||||||
let n_cols = dense.n_cols();
|
|
||||||
println!("layer={} n_slots={n} n_cols={n_cols}", layer_dir.display());
|
|
||||||
|
|
||||||
let out_dir = std::env::temp_dir().join(format!("sparse_bench_{}", std::process::id()));
|
|
||||||
let _ = std::fs::remove_dir_all(&out_dir);
|
|
||||||
|
|
||||||
let rss_before = obisys::peak_rss_bytes();
|
|
||||||
let t0 = Instant::now();
|
|
||||||
|
|
||||||
let sparse = obicompactvec::PersistentSparseBitMatrixBuilder::build_from_dense(&dense, &out_dir)
|
|
||||||
.expect("build_from_dense")
|
|
||||||
.finish()
|
|
||||||
.expect("finish");
|
|
||||||
|
|
||||||
let elapsed = t0.elapsed();
|
|
||||||
let rss_after = obisys::peak_rss_bytes();
|
|
||||||
|
|
||||||
// Real on-disk size: sum of every file actually written under out_dir.
|
|
||||||
let mut sparse_bytes: u64 = 0;
|
|
||||||
for entry in std::fs::read_dir(&out_dir).unwrap() {
|
|
||||||
let entry = entry.unwrap();
|
|
||||||
let size = entry.metadata().unwrap().len();
|
|
||||||
println!(" {}: {}", entry.file_name().to_string_lossy(), fmt_mb(size));
|
|
||||||
sparse_bytes += size;
|
|
||||||
}
|
|
||||||
|
|
||||||
let dense_bytes = (n as u64 * n_cols as u64).div_ceil(8);
|
|
||||||
|
|
||||||
println!(
|
|
||||||
"elapsed={:?} rss_before={} rss_after={} rss_delta={}",
|
|
||||||
elapsed, fmt_mb(rss_before), fmt_mb(rss_after), fmt_mb(rss_after.saturating_sub(rss_before)),
|
|
||||||
);
|
|
||||||
println!(
|
|
||||||
"REAL on-disk: sparse_total={} dense={} ({:.1}x)",
|
|
||||||
fmt_mb(sparse_bytes), fmt_mb(dense_bytes), dense_bytes as f64 / sparse_bytes as f64,
|
|
||||||
);
|
|
||||||
|
|
||||||
// Sanity: reopen from disk (fresh mmap, not the just-built handle) and
|
|
||||||
// spot-check a handful of rows against the dense original.
|
|
||||||
drop(sparse);
|
|
||||||
let reopened = obicompactvec::PersistentSparseBitMatrix::open(&out_dir).expect("reopen");
|
|
||||||
let mut dense_buf = vec![0u32; n_cols];
|
|
||||||
for &slot in &[0usize, 1, 1000, n / 2, n - 1] {
|
|
||||||
dense.fill_row(slot, &mut dense_buf);
|
|
||||||
let sparse_row = reopened.row(slot);
|
|
||||||
for c in 0..n_cols {
|
|
||||||
assert_eq!(sparse_row[c], dense_buf[c] != 0, "slot {slot}, col {c}");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
println!("spot-check rows: OK");
|
|
||||||
|
|
||||||
// ── Access-time comparison ──────────────────────────────────────────
|
|
||||||
// Both patterns matter in practice: sequential (a full-layer scan, the
|
|
||||||
// existing `scan_layer_families` shape) and random (a single-family
|
|
||||||
// cross-partition lookup, the entropy/`--shannon` shape). Same slot
|
|
||||||
// sequence used against both structures for a fair comparison.
|
|
||||||
const N_ACCESS: usize = 2_000_000;
|
|
||||||
|
|
||||||
// Deterministic xorshift, no extra dependency — fine for a benchmark's
|
|
||||||
// access pattern, not for anything security- or correctness-sensitive.
|
|
||||||
let mut rng_state: u64 = 0x9E3779B97F4A7C15;
|
|
||||||
let mut next_rand = move || {
|
|
||||||
rng_state ^= rng_state << 13;
|
|
||||||
rng_state ^= rng_state >> 7;
|
|
||||||
rng_state ^= rng_state << 17;
|
|
||||||
rng_state
|
|
||||||
};
|
|
||||||
let random_slots: Vec<usize> = (0..N_ACCESS).map(|_| (next_rand() as usize) % n).collect();
|
|
||||||
let sequential_slots: Vec<usize> = (0..N_ACCESS).map(|i| i % n).collect();
|
|
||||||
|
|
||||||
let mut buf = vec![0u32; n_cols];
|
|
||||||
|
|
||||||
let t = Instant::now();
|
|
||||||
for &slot in &sequential_slots {
|
|
||||||
dense.fill_row(slot, &mut buf);
|
|
||||||
}
|
|
||||||
let dense_seq = t.elapsed();
|
|
||||||
|
|
||||||
let t = Instant::now();
|
|
||||||
for &slot in &sequential_slots {
|
|
||||||
reopened.fill_row(slot, &mut buf);
|
|
||||||
}
|
|
||||||
let sparse_seq = t.elapsed();
|
|
||||||
|
|
||||||
let t = Instant::now();
|
|
||||||
for &slot in &random_slots {
|
|
||||||
dense.fill_row(slot, &mut buf);
|
|
||||||
}
|
|
||||||
let dense_rand = t.elapsed();
|
|
||||||
|
|
||||||
let t = Instant::now();
|
|
||||||
for &slot in &random_slots {
|
|
||||||
reopened.fill_row(slot, &mut buf);
|
|
||||||
}
|
|
||||||
let sparse_rand = t.elapsed();
|
|
||||||
|
|
||||||
println!(
|
|
||||||
"ACCESS ({N_ACCESS} rows) sequential: dense={:?} ({:.0}ns/row) sparse={:?} ({:.0}ns/row) — {:.2}x",
|
|
||||||
dense_seq, dense_seq.as_nanos() as f64 / N_ACCESS as f64,
|
|
||||||
sparse_seq, sparse_seq.as_nanos() as f64 / N_ACCESS as f64,
|
|
||||||
sparse_seq.as_secs_f64() / dense_seq.as_secs_f64(),
|
|
||||||
);
|
|
||||||
println!(
|
|
||||||
"ACCESS ({N_ACCESS} rows) random: dense={:?} ({:.0}ns/row) sparse={:?} ({:.0}ns/row) — {:.2}x",
|
|
||||||
dense_rand, dense_rand.as_nanos() as f64 / N_ACCESS as f64,
|
|
||||||
sparse_rand, sparse_rand.as_nanos() as f64 / N_ACCESS as f64,
|
|
||||||
sparse_rand.as_secs_f64() / dense_rand.as_secs_f64(),
|
|
||||||
);
|
|
||||||
|
|
||||||
// ── Column-major access, "just for fun" ─────────────────────────────
|
|
||||||
// The whole point of `DevDocMD/architecture/siblings.md`'s "Explicitly
|
|
||||||
// deferred" section: dense is genome-major (native, contiguous column
|
|
||||||
// access), sparse is k-mer-major (no column method at all — reading
|
|
||||||
// one column means decoding every row and keeping one bit each time).
|
|
||||||
// Extract one full column (all n rows) both ways.
|
|
||||||
let col = n_cols / 2;
|
|
||||||
|
|
||||||
let t = Instant::now();
|
|
||||||
let dense_col_view = dense.col_view(col);
|
|
||||||
let dense_col_ones: u64 = (0..n).filter(|&s| dense_col_view.get(s)).count() as u64;
|
|
||||||
let dense_col_time = t.elapsed();
|
|
||||||
|
|
||||||
let t = Instant::now();
|
|
||||||
let mut buf2 = vec![0u32; n_cols];
|
|
||||||
let sparse_col_ones: u64 = (0..n)
|
|
||||||
.filter(|&s| { reopened.fill_row(s, &mut buf2); buf2[col] != 0 })
|
|
||||||
.count() as u64;
|
|
||||||
let sparse_col_time = t.elapsed();
|
|
||||||
|
|
||||||
assert_eq!(dense_col_ones, sparse_col_ones, "column {col} popcount disagrees");
|
|
||||||
println!(
|
|
||||||
"COLUMN-MAJOR (col {col}, {n} rows) dense={:?} ({:.0}ns/row) sparse={:?} ({:.0}ns/row) — {:.1}x SLOWER on sparse",
|
|
||||||
dense_col_time, dense_col_time.as_nanos() as f64 / n as f64,
|
|
||||||
sparse_col_time, sparse_col_time.as_nanos() as f64 / n as f64,
|
|
||||||
sparse_col_time.as_secs_f64() / dense_col_time.as_secs_f64(),
|
|
||||||
);
|
|
||||||
|
|
||||||
let _ = std::fs::remove_dir_all(&out_dir);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
#[ignore]
|
|
||||||
fn diag_real_index_verify_kmer_resolution() {
|
|
||||||
use std::sync::Arc;
|
|
||||||
let idx = KmerIndex::open("/Users/coissac/Sync/travail/__MOI__/obikmer/benchmark/global_index_presence")
|
|
||||||
.expect("open real index");
|
|
||||||
let n_parts = idx.n_partitions();
|
|
||||||
let n_genomes = idx.meta().genomes.len();
|
|
||||||
let with_counts = idx.meta().config.with_counts;
|
|
||||||
let k = idx.kmer_size();
|
|
||||||
let n_bits = n_parts.trailing_zeros() as usize;
|
|
||||||
let partition = obikpartitionner::KmerPartition::open_with_config(
|
|
||||||
idx.root_path(), idx.kmer_size(), idx.minimizer_size(), n_bits,
|
|
||||||
).unwrap();
|
|
||||||
let cache = Arc::new(super::cache::PartitionCache::build(&partition, n_parts, with_counts).unwrap());
|
|
||||||
|
|
||||||
// The k-mer with A+other (mask 0b0011 = A+C)
|
|
||||||
let kmer_str = "AGCTAGCTATTGAGCCTGGTCCGTATGAAAC";
|
|
||||||
let kmer = canonical(kmer_str.as_bytes());
|
|
||||||
let rc_str = kmer_revcomp_to_string(&kmer, k);
|
|
||||||
|
|
||||||
println!("kmer_forward={} kmer_revcomp={}", kmer_str, rc_str);
|
|
||||||
println!("kmer partition={}", kmer.partition(n_parts));
|
|
||||||
|
|
||||||
// Check if this k-mer is found in its own partition
|
|
||||||
let dest_part = kmer.partition(n_parts);
|
|
||||||
if let Some(layer) = cache.find(dest_part, kmer) {
|
|
||||||
println!("FOUND in partition {} layer {}", dest_part, layer);
|
|
||||||
} else {
|
|
||||||
println!("NOT FOUND in partition {}", dest_part);
|
|
||||||
}
|
|
||||||
|
|
||||||
// Now check the variant with A at central position
|
|
||||||
// The mask is 0b0011 = A+C, so there should be a variant with A
|
|
||||||
// Let's generate the canonical neighbors and check which one has A
|
|
||||||
let mut found_variants = Vec::new();
|
|
||||||
for variant in kmer.central_canonical_neighbors() {
|
|
||||||
if variant == kmer {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
let base = central_base(variant, k);
|
|
||||||
if base == 0 { // A
|
|
||||||
let v_part = variant.partition(n_parts);
|
|
||||||
println!("variant with A: partition={} found={}", v_part, cache.find(v_part, variant).is_some());
|
|
||||||
found_variants.push(variant);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Also check the C variant
|
|
||||||
for variant in kmer.central_canonical_neighbors() {
|
|
||||||
if variant == kmer {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
let base = central_base(variant, k);
|
|
||||||
if base == 1 { // C
|
|
||||||
let v_part = variant.partition(n_parts);
|
|
||||||
println!("variant with C: partition={} found={}", v_part, cache.find(v_part, variant).is_some());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
fn kmer_to_string(kmer: &CanonicalKmer, k: usize) -> String {
|
|
||||||
let mut s = String::with_capacity(k);
|
|
||||||
for i in 0..k {
|
|
||||||
let n = kmer.nucleotide(i);
|
|
||||||
s.push(match n {
|
|
||||||
0 => 'A',
|
|
||||||
1 => 'C',
|
|
||||||
2 => 'G',
|
|
||||||
3 => 'T',
|
|
||||||
_ => unreachable!(),
|
|
||||||
});
|
|
||||||
}
|
|
||||||
s
|
|
||||||
}
|
|
||||||
|
|
||||||
fn kmer_revcomp_to_string(kmer: &CanonicalKmer, k: usize) -> String {
|
|
||||||
let rc = kmer.revcomp();
|
|
||||||
let mut s = String::with_capacity(k);
|
|
||||||
for i in 0..k {
|
|
||||||
let n = rc.nucleotide(i);
|
|
||||||
s.push(match n {
|
|
||||||
0 => 'A',
|
|
||||||
1 => 'C',
|
|
||||||
2 => 'G',
|
|
||||||
3 => 'T',
|
|
||||||
_ => unreachable!(),
|
|
||||||
});
|
|
||||||
}
|
|
||||||
s
|
|
||||||
}
|
|
||||||
@@ -1,167 +0,0 @@
|
|||||||
ratio_ceiling: 0.5
|
|
||||||
cardinality_transitions:
|
|
||||||
- from: 0
|
|
||||||
to: 0
|
|
||||||
count: 122014779
|
|
||||||
probability: 0.870049812090934
|
|
||||||
- from: 0
|
|
||||||
to: 1
|
|
||||||
count: 17966272
|
|
||||||
probability: 0.12811195254940888
|
|
||||||
- from: 0
|
|
||||||
to: 2
|
|
||||||
count: 233683
|
|
||||||
probability: 0.001666321505518981
|
|
||||||
- from: 0
|
|
||||||
to: 3
|
|
||||||
count: 24109
|
|
||||||
probability: 0.00017191385413811494
|
|
||||||
- from: 0
|
|
||||||
to: 4
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 1
|
|
||||||
to: 0
|
|
||||||
count: 17966272
|
|
||||||
probability: 0.967023782579572
|
|
||||||
- from: 1
|
|
||||||
to: 1
|
|
||||||
count: 602798
|
|
||||||
probability: 0.03244523972983381
|
|
||||||
- from: 1
|
|
||||||
to: 2
|
|
||||||
count: 9562
|
|
||||||
probability: 0.0005146688978673966
|
|
||||||
- from: 1
|
|
||||||
to: 3
|
|
||||||
count: 303
|
|
||||||
probability: 0.00001630879272681669
|
|
||||||
- from: 1
|
|
||||||
to: 4
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 2
|
|
||||||
to: 0
|
|
||||||
count: 233683
|
|
||||||
probability: 0.9585500516842502
|
|
||||||
- from: 2
|
|
||||||
to: 1
|
|
||||||
count: 9562
|
|
||||||
probability: 0.039222603245442765
|
|
||||||
- from: 2
|
|
||||||
to: 2
|
|
||||||
count: 438
|
|
||||||
probability: 0.0017966429848885097
|
|
||||||
- from: 2
|
|
||||||
to: 3
|
|
||||||
count: 105
|
|
||||||
probability: 0.00043070208541847837
|
|
||||||
- from: 2
|
|
||||||
to: 4
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 3
|
|
||||||
to: 0
|
|
||||||
count: 24109
|
|
||||||
probability: 0.9827171564831044
|
|
||||||
- from: 3
|
|
||||||
to: 1
|
|
||||||
count: 303
|
|
||||||
probability: 0.012350711286838137
|
|
||||||
- from: 3
|
|
||||||
to: 2
|
|
||||||
count: 105
|
|
||||||
probability: 0.004279949455834998
|
|
||||||
- from: 3
|
|
||||||
to: 3
|
|
||||||
count: 16
|
|
||||||
probability: 0.0006521827742224758
|
|
||||||
- from: 3
|
|
||||||
to: 4
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 4
|
|
||||||
to: 0
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 4
|
|
||||||
to: 1
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 4
|
|
||||||
to: 2
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 4
|
|
||||||
to: 3
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 4
|
|
||||||
to: 4
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
composition_transitions:
|
|
||||||
- from: 'A'
|
|
||||||
to: 'A'
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 'A'
|
|
||||||
to: 'C'
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 'A'
|
|
||||||
to: 'G'
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 'A'
|
|
||||||
to: 'T'
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 'C'
|
|
||||||
to: 'A'
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 'C'
|
|
||||||
to: 'C'
|
|
||||||
count: 96389
|
|
||||||
probability: 0.9663832688335907
|
|
||||||
- from: 'C'
|
|
||||||
to: 'G'
|
|
||||||
count: 1290
|
|
||||||
probability: 0.012933368089671353
|
|
||||||
- from: 'C'
|
|
||||||
to: 'T'
|
|
||||||
count: 2063
|
|
||||||
probability: 0.020683363076737984
|
|
||||||
- from: 'G'
|
|
||||||
to: 'A'
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 'G'
|
|
||||||
to: 'C'
|
|
||||||
count: 1290
|
|
||||||
probability: 0.005696948820201646
|
|
||||||
- from: 'G'
|
|
||||||
to: 'G'
|
|
||||||
count: 222720
|
|
||||||
probability: 0.9835848381669073
|
|
||||||
- from: 'G'
|
|
||||||
to: 'T'
|
|
||||||
count: 2427
|
|
||||||
probability: 0.010718213012891003
|
|
||||||
- from: 'T'
|
|
||||||
to: 'A'
|
|
||||||
count: 0
|
|
||||||
probability: 0.0
|
|
||||||
- from: 'T'
|
|
||||||
to: 'C'
|
|
||||||
count: 2063
|
|
||||||
probability: 0.007305266661709142
|
|
||||||
- from: 'T'
|
|
||||||
to: 'G'
|
|
||||||
count: 2427
|
|
||||||
probability: 0.008594223067362136
|
|
||||||
- from: 'T'
|
|
||||||
to: 'T'
|
|
||||||
count: 277909
|
|
||||||
probability: 0.9841005102709287
|
|
||||||
Reference in new issue
Block a user