Push zunrplorkwkt #70
No files matched your search
@@ -5,6 +5,70 @@ themselves not started; ownership split (below) still open. Preparatory
|
|||||||
encapsulation work (partition/layer path and metadata accessors on
|
encapsulation work (partition/layer path and metadata accessors on
|
||||||
`KmerPartition`) landed the same day — see "Preparatory work done" below.
|
`KmerPartition`) landed the same day — see "Preparatory work done" below.
|
||||||
|
|
||||||
|
## Type-to-concept mapping: Index / Partition / Layer
|
||||||
|
|
||||||
|
The conceptual nesting `Index { Partition { Layer { MPHF, Evidence, Matrix
|
||||||
|
} } } }` does **not** have one Rust type per level — worth stating
|
||||||
|
explicitly, since two of the names below are misleading.
|
||||||
|
|
||||||
|
- **Index** = `obikindex::KmerIndex` — `{ root_path, meta: IndexMeta,
|
||||||
|
partition: KmerPartition }`. The field is named `partition` (singular),
|
||||||
|
but it holds the *whole* multi-partition structure below — the name
|
||||||
|
suggests "one partition", the value is all of them.
|
||||||
|
- **Partition, the collection (not one partition)** =
|
||||||
|
`obikpartitionner::KmerPartition`. Despite the singular name, this owns
|
||||||
|
*every* partition of the index: `root_path`, `n_partitions`, and
|
||||||
|
per-partition accessors that all take an explicit index `i`
|
||||||
|
(`partition_dir(i)`, `index_dir(i)`, `layer_dir(i, l)`,
|
||||||
|
`partition_meta(i)`, `n_layers(i)`, `index_mode(i)` — see the
|
||||||
|
`part_dir`/`layer_dir` and `PartitionMeta`-encapsulation work above).
|
||||||
|
It never holds one partition's layers open in memory — no `Vec<Layer<D>>`
|
||||||
|
here, only path arithmetic and metadata reads. A more honest name would
|
||||||
|
be `KmerPartitionSet` or `KmerPartitioner`; renaming is out of scope for
|
||||||
|
now, just worth knowing it's not "a partition."
|
||||||
|
- **Partition, one of them** = **no dedicated type exists today**. The
|
||||||
|
structural equivalent of "one partition, its layers held open" is
|
||||||
|
`obilayeredmap::LayeredMap<D>` — `{ root, meta: PartitionMeta, layers:
|
||||||
|
Vec<Layer<D>> }` — but `LayeredMap` itself doesn't know it's playing that
|
||||||
|
role: it operates purely on whatever `root` path it's given and has no
|
||||||
|
notion of `KmerPartition`, `n_partitions`, or a partition index `i` (see
|
||||||
|
"Layering: who owns what" below — established independently while
|
||||||
|
fixing `open_data`/`layer_dir`). Every caller that wants "one partition,
|
||||||
|
opened" builds the path itself
|
||||||
|
(`kmer_partition.index_dir(i)`/`.layer_dir(i, l)`) and either passes it
|
||||||
|
to `LayeredMap::open` or — as `obikphylo::siblings::cache` does —
|
||||||
|
bypasses `LayeredMap` entirely and opens each `Layer<D>` directly.
|
||||||
|
- **Layer** = `obilayeredmap::Layer<D>` — `{ mphf: MphfLayer, data: D }`.
|
||||||
|
- **MPHF** = `MphfLayer.mphf: MemCase<MphfEps>` — kmer → slot.
|
||||||
|
- **Evidence** = `MphfLayer.ev: LayerEvidence` (`Exact`/`Approx`/
|
||||||
|
`Hybrid` — `evidence.bin`/`fingerprint.bin`; see `EvidenceKind`).
|
||||||
|
- **Matrix** = `Layer<D>.data: D` — `PersistentBitMatrix` /
|
||||||
|
`PersistentCompactIntMatrix` / `PersistentSparseBitMatrix` / `()`.
|
||||||
|
|
||||||
|
Today's actual nesting, in Rust terms:
|
||||||
|
|
||||||
|
```
|
||||||
|
KmerIndex
|
||||||
|
└─ partition: KmerPartition (all N partitions — paths + metadata only)
|
||||||
|
└─ (opened on demand, per i) LayeredMap<D> ← "one partition", unnamed as such
|
||||||
|
└─ layers: Vec<Layer<D>>
|
||||||
|
└─ Layer<D> { mphf: MphfLayer, data: D }
|
||||||
|
├─ mphf.mphf → MPHF
|
||||||
|
├─ mphf.ev → Evidence
|
||||||
|
└─ data → Matrix
|
||||||
|
```
|
||||||
|
|
||||||
|
`obikphylo::siblings::cache::PartitionCache` — the thing (2) is meant to
|
||||||
|
generalise — skips the middle of this nesting entirely: it doesn't build a
|
||||||
|
`Vec<LayeredMap<D>>`, it builds `mats: Vec<Vec<Mat>>` directly — outer
|
||||||
|
index = partition `i` (via `KmerPartition`), inner index = layer `l` (via
|
||||||
|
`Layer<D>`/`Mat`) — reconstructing "one partition, its layers open" as a
|
||||||
|
bare nested `Vec` because no owning type for that concept exists to reuse.
|
||||||
|
That gap is exactly what (2) needs to fill, and (1) is exactly what would
|
||||||
|
let a per-partition type hold layers of mixed `D` (today `LayeredMap<D>`
|
||||||
|
can't, being monomorphic — see "The gap in `obilayeredmap`'s existing
|
||||||
|
cache" below).
|
||||||
|
|
||||||
## The problem
|
## The problem
|
||||||
|
|
||||||
Reading a layer's data (MPHF + matrix) is not free: `MphfLayer::open` mmaps
|
Reading a layer's data (MPHF + matrix) is not free: `MphfLayer::open` mmaps
|
||||||
@@ -217,13 +281,18 @@ storage decisions, now a *third* copy of the same logic to keep in sync)
|
|||||||
about the code. Lesson: for a `pub enum` whose variant list matters,
|
about the code. Lesson: for a `pub enum` whose variant list matters,
|
||||||
read the definition unfiltered, don't grep for the variant names you
|
read the definition unfiltered, don't grep for the variant names you
|
||||||
expect to find.
|
expect to find.
|
||||||
- One real consequence of that same correction: `obikphylo::siblings::
|
- One real consequence of that same correction, **fixed (2026-08-20)**:
|
||||||
cache::Mat::SparsePresence(Layer<PersistentSparseBitMatrix>)` looks
|
`obikphylo::siblings::cache::Mat::SparsePresence(Layer<
|
||||||
redundant now — `Mat::Presence(Layer<PersistentBitMatrix>)` alone
|
PersistentSparseBitMatrix>)` was redundant — `Mat::Presence(Layer<
|
||||||
would already handle sparse layers transparently, since
|
PersistentBitMatrix>)` alone already handles sparse layers
|
||||||
`PersistentBitMatrix` absorbs `Sparse` internally. Likely `Mat` predates
|
transparently, since `PersistentBitMatrix` absorbs `Sparse` internally.
|
||||||
`PersistentBitMatrix` growing native sparse support. Signalled, not
|
Removed the variant, the `presence/is_multi.prsb` probe in `Mat::open`
|
||||||
removed — no mandate to touch `obikphylo` for this.
|
(now just opens `Layer::<PersistentBitMatrix>` unconditionally for the
|
||||||
|
non-count case — sparse-vs-dense is `PersistentBitMatrix::open`'s own
|
||||||
|
concern), and every now-single-armed match in `find_slot`/`index_batch`/
|
||||||
|
`iter_minorants_batch`/`n_cols`/`fill_sub_matrix_carries`. Full
|
||||||
|
workspace test suite green after, including the 27 `obikphylo::siblings`
|
||||||
|
tests that exercise `pack_matrices(true)`/sparse through `Mat`.
|
||||||
|
|
||||||
## Remaining instance of the PartitionMeta-encapsulation problem
|
## Remaining instance of the PartitionMeta-encapsulation problem
|
||||||
|
|
||||||
|
|||||||
+102
-40
@@ -2,7 +2,7 @@ use std::collections::BTreeMap;
|
|||||||
use std::fs;
|
use std::fs;
|
||||||
use std::path::{Path, PathBuf};
|
use std::path::{Path, PathBuf};
|
||||||
|
|
||||||
use obikpartitionner::{KmerPartition, KmerSpectrum, PARTITIONS_SUBDIR};
|
use obikpartitionner::{KmerPartitions, KmerSpectrum, PARTITIONS_SUBDIR};
|
||||||
use obisys::{Reporter, Stage, progress_bar};
|
use obisys::{Reporter, Stage, progress_bar};
|
||||||
use rayon::prelude::*;
|
use rayon::prelude::*;
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
@@ -16,7 +16,7 @@ use crate::state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCAT
|
|||||||
pub struct KmerIndex {
|
pub struct KmerIndex {
|
||||||
pub(crate) root_path: PathBuf,
|
pub(crate) root_path: PathBuf,
|
||||||
pub(crate) meta: IndexMeta,
|
pub(crate) meta: IndexMeta,
|
||||||
pub(crate) partition: KmerPartition,
|
pub(crate) partition: KmerPartitions,
|
||||||
}
|
}
|
||||||
|
|
||||||
impl KmerIndex {
|
impl KmerIndex {
|
||||||
@@ -31,7 +31,7 @@ impl KmerIndex {
|
|||||||
force: bool,
|
force: bool,
|
||||||
) -> OKIResult<Self> {
|
) -> OKIResult<Self> {
|
||||||
let root_path = path.as_ref().to_owned();
|
let root_path = path.as_ref().to_owned();
|
||||||
let partition = KmerPartition::create(
|
let partition = KmerPartitions::create(
|
||||||
&root_path,
|
&root_path,
|
||||||
config.n_bits,
|
config.n_bits,
|
||||||
config.kmer_size,
|
config.kmer_size,
|
||||||
@@ -45,7 +45,11 @@ impl KmerIndex {
|
|||||||
meta.genomes.push(info);
|
meta.genomes.push(info);
|
||||||
}
|
}
|
||||||
meta.write(&root_path)?;
|
meta.write(&root_path)?;
|
||||||
Ok(Self { root_path, meta, partition })
|
Ok(Self {
|
||||||
|
root_path,
|
||||||
|
meta,
|
||||||
|
partition,
|
||||||
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn open<P: AsRef<Path>>(path: P) -> OKIResult<Self> {
|
pub fn open<P: AsRef<Path>>(path: P) -> OKIResult<Self> {
|
||||||
@@ -53,13 +57,17 @@ impl KmerIndex {
|
|||||||
let meta = IndexMeta::read(&root_path).map_err(OKIError::Io)?;
|
let meta = IndexMeta::read(&root_path).map_err(OKIError::Io)?;
|
||||||
set_k(meta.config.kmer_size);
|
set_k(meta.config.kmer_size);
|
||||||
set_m(meta.config.minimizer_size);
|
set_m(meta.config.minimizer_size);
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
&root_path,
|
&root_path,
|
||||||
meta.config.kmer_size,
|
meta.config.kmer_size,
|
||||||
meta.config.minimizer_size,
|
meta.config.minimizer_size,
|
||||||
meta.config.n_bits,
|
meta.config.n_bits,
|
||||||
)?;
|
)?;
|
||||||
Ok(Self { root_path, meta, partition })
|
Ok(Self {
|
||||||
|
root_path,
|
||||||
|
meta,
|
||||||
|
partition,
|
||||||
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Return `true` if `path` contains an `index.meta` file.
|
/// Return `true` if `path` contains an `index.meta` file.
|
||||||
@@ -96,12 +104,12 @@ impl KmerIndex {
|
|||||||
pub(crate) fn create_skeleton<P: AsRef<Path>>(
|
pub(crate) fn create_skeleton<P: AsRef<Path>>(
|
||||||
output: P,
|
output: P,
|
||||||
meta: &IndexMeta,
|
meta: &IndexMeta,
|
||||||
) -> OKIResult<KmerPartition> {
|
) -> OKIResult<KmerPartitions> {
|
||||||
let output = output.as_ref();
|
let output = output.as_ref();
|
||||||
fs::create_dir_all(output).map_err(OKIError::Io)?;
|
fs::create_dir_all(output).map_err(OKIError::Io)?;
|
||||||
meta.write(output).map_err(OKIError::Io)?;
|
meta.write(output).map_err(OKIError::Io)?;
|
||||||
fs::create_dir_all(output.join(PARTITIONS_SUBDIR)).map_err(OKIError::Io)?;
|
fs::create_dir_all(output.join(PARTITIONS_SUBDIR)).map_err(OKIError::Io)?;
|
||||||
Ok(KmerPartition::open_with_config(
|
Ok(KmerPartitions::open_with_config(
|
||||||
output,
|
output,
|
||||||
meta.config.kmer_size,
|
meta.config.kmer_size,
|
||||||
meta.config.minimizer_size,
|
meta.config.minimizer_size,
|
||||||
@@ -134,12 +142,24 @@ impl KmerIndex {
|
|||||||
/// The index's root directory — needed by out-of-crate extension code
|
/// The index's root directory — needed by out-of-crate extension code
|
||||||
/// (e.g. `obikphylo`) that opens its own `KmerPartition` handle onto
|
/// (e.g. `obikphylo`) that opens its own `KmerPartition` handle onto
|
||||||
/// the same on-disk index.
|
/// the same on-disk index.
|
||||||
pub fn root_path(&self) -> &Path { &self.root_path }
|
pub fn root_path(&self) -> &Path {
|
||||||
pub fn meta(&self) -> &IndexMeta { &self.meta }
|
&self.root_path
|
||||||
pub fn meta_mut(&mut self) -> &mut IndexMeta { &mut self.meta }
|
}
|
||||||
pub fn kmer_size(&self) -> usize { self.meta.config.kmer_size }
|
pub fn meta(&self) -> &IndexMeta {
|
||||||
pub fn minimizer_size(&self) -> usize { self.meta.config.minimizer_size }
|
&self.meta
|
||||||
pub fn n_partitions(&self) -> usize { self.partition.n_partitions() }
|
}
|
||||||
|
pub fn meta_mut(&mut self) -> &mut IndexMeta {
|
||||||
|
&mut self.meta
|
||||||
|
}
|
||||||
|
pub fn kmer_size(&self) -> usize {
|
||||||
|
self.meta.config.kmer_size
|
||||||
|
}
|
||||||
|
pub fn minimizer_size(&self) -> usize {
|
||||||
|
self.meta.config.minimizer_size
|
||||||
|
}
|
||||||
|
pub fn n_partitions(&self) -> usize {
|
||||||
|
self.partition.n_partitions()
|
||||||
|
}
|
||||||
|
|
||||||
/// Number of layers per partition.
|
/// Number of layers per partition.
|
||||||
///
|
///
|
||||||
@@ -152,7 +172,7 @@ impl KmerIndex {
|
|||||||
|
|
||||||
/// Expose the inner partition so the caller can run scatter into it.
|
/// Expose the inner partition so the caller can run scatter into it.
|
||||||
/// Call `mark_scattered` once scatter is complete.
|
/// Call `mark_scattered` once scatter is complete.
|
||||||
pub fn partition_mut(&mut self) -> &mut KmerPartition {
|
pub fn partition_mut(&mut self) -> &mut KmerPartitions {
|
||||||
&mut self.partition
|
&mut self.partition
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -174,7 +194,11 @@ impl KmerIndex {
|
|||||||
///
|
///
|
||||||
/// Writes `spectrums/{label}.json` and touches `count.done` upon completion.
|
/// Writes `spectrums/{label}.json` and touches `count.done` upon completion.
|
||||||
/// Per-partition spectrum files are removed unless `keep_intermediate` is true.
|
/// Per-partition spectrum files are removed unless `keep_intermediate` is true.
|
||||||
pub fn dereplicate_and_count(&self, keep_intermediate: bool, rep: &mut Reporter) -> OKIResult<()> {
|
pub fn dereplicate_and_count(
|
||||||
|
&self,
|
||||||
|
keep_intermediate: bool,
|
||||||
|
rep: &mut Reporter,
|
||||||
|
) -> OKIResult<()> {
|
||||||
let t = Stage::start("dereplicate");
|
let t = Stage::start("dereplicate");
|
||||||
self.partition.dereplicate()?;
|
self.partition.dereplicate()?;
|
||||||
rep.push(t.stop());
|
rep.push(t.stop());
|
||||||
@@ -189,11 +213,17 @@ impl KmerIndex {
|
|||||||
}
|
}
|
||||||
|
|
||||||
fn write_spectrum(&self, sp: &KmerSpectrum) -> OKIResult<()> {
|
fn write_spectrum(&self, sp: &KmerSpectrum) -> OKIResult<()> {
|
||||||
let label = self.meta.genomes.first().map(|g| g.label.as_str()).unwrap_or("unknown");
|
let label = self
|
||||||
|
.meta
|
||||||
|
.genomes
|
||||||
|
.first()
|
||||||
|
.map(|g| g.label.as_str())
|
||||||
|
.unwrap_or("unknown");
|
||||||
let spectrums_dir = self.root_path.join("spectrums");
|
let spectrums_dir = self.root_path.join("spectrums");
|
||||||
fs::create_dir_all(&spectrums_dir)?;
|
fs::create_dir_all(&spectrums_dir)?;
|
||||||
let path = spectrums_dir.join(format!("{label}.json"));
|
let path = spectrums_dir.join(format!("{label}.json"));
|
||||||
let spectrum_map: BTreeMap<String, u64> = sp.counts
|
let spectrum_map: BTreeMap<String, u64> = sp
|
||||||
|
.counts
|
||||||
.iter()
|
.iter()
|
||||||
.map(|(&c, &f)| (format!("{c:010}"), f))
|
.map(|(&c, &f)| (format!("{c:010}"), f))
|
||||||
.collect();
|
.collect();
|
||||||
@@ -226,17 +256,28 @@ impl KmerIndex {
|
|||||||
|
|
||||||
let order: Vec<usize> = (0..n).collect();
|
let order: Vec<usize> = (0..n).collect();
|
||||||
let runner = crate::numa::PartitionRunner::new();
|
let runner = crate::numa::PartitionRunner::new();
|
||||||
runner.run(
|
runner
|
||||||
&order,
|
.run(
|
||||||
|i| self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits),
|
&order,
|
||||||
|i, n_kmers, _| {
|
|i| {
|
||||||
if n_kmers > 0 {
|
self.partition.build_index_layer(
|
||||||
total_kmers += n_kmers;
|
i,
|
||||||
pb.inc(1);
|
min_ab,
|
||||||
pb.set_message(format!("{i}: {n_kmers} kmers"));
|
max_ab,
|
||||||
}
|
with_counts,
|
||||||
},
|
&evidence,
|
||||||
).map_err(OKIError::Partition)?;
|
block_bits,
|
||||||
|
)
|
||||||
|
},
|
||||||
|
|i, n_kmers, _| {
|
||||||
|
if n_kmers > 0 {
|
||||||
|
total_kmers += n_kmers;
|
||||||
|
pb.inc(1);
|
||||||
|
pb.set_message(format!("{i}: {n_kmers} kmers"));
|
||||||
|
}
|
||||||
|
},
|
||||||
|
)
|
||||||
|
.map_err(OKIError::Partition)?;
|
||||||
|
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
info!("done — {} total kmers indexed", total_kmers);
|
info!("done — {} total kmers indexed", total_kmers);
|
||||||
@@ -253,7 +294,7 @@ impl KmerIndex {
|
|||||||
}
|
}
|
||||||
|
|
||||||
/// Borrow the inner partition for direct superkmer-level queries.
|
/// Borrow the inner partition for direct superkmer-level queries.
|
||||||
pub fn partition(&self) -> &KmerPartition {
|
pub fn partition(&self) -> &KmerPartitions {
|
||||||
&self.partition
|
&self.partition
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -282,12 +323,14 @@ impl KmerIndex {
|
|||||||
&order,
|
&order,
|
||||||
|i| -> OKIResult<()> {
|
|i| -> OKIResult<()> {
|
||||||
let index_dir = self.partition.index_dir(i);
|
let index_dir = self.partition.index_dir(i);
|
||||||
if !index_dir.exists() { return Ok(()); }
|
if !index_dir.exists() {
|
||||||
|
return Ok(());
|
||||||
|
}
|
||||||
let n_layers = self.partition.n_layers(i)?;
|
let n_layers = self.partition.n_layers(i)?;
|
||||||
for l in 0..n_layers {
|
for l in 0..n_layers {
|
||||||
let layer_dir = self.partition.layer_dir(i, l);
|
let layer_dir = self.partition.layer_dir(i, l);
|
||||||
let presence_dir = layer_dir.join("presence");
|
let presence_dir = layer_dir.join("presence");
|
||||||
let counts_dir = layer_dir.join("counts");
|
let counts_dir = layer_dir.join("counts");
|
||||||
if presence_dir.exists() {
|
if presence_dir.exists() {
|
||||||
if sparse {
|
if sparse {
|
||||||
pack_sparse_bit_matrix(&presence_dir).map_err(OKIError::Io)?;
|
pack_sparse_bit_matrix(&presence_dir).map_err(OKIError::Io)?;
|
||||||
@@ -295,11 +338,15 @@ impl KmerIndex {
|
|||||||
pack_bit_matrix(&presence_dir).map_err(OKIError::Io)?;
|
pack_bit_matrix(&presence_dir).map_err(OKIError::Io)?;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
if counts_dir.exists() { pack_compact_int_matrix(&counts_dir).map_err(OKIError::Io)?; }
|
if counts_dir.exists() {
|
||||||
|
pack_compact_int_matrix(&counts_dir).map_err(OKIError::Io)?;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
Ok(())
|
Ok(())
|
||||||
},
|
},
|
||||||
|_, _, _| { pb.inc(1); },
|
|_, _, _| {
|
||||||
|
pb.inc(1);
|
||||||
|
},
|
||||||
)?;
|
)?;
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
Ok(())
|
Ok(())
|
||||||
@@ -318,18 +365,27 @@ impl KmerIndex {
|
|||||||
.into_par_iter()
|
.into_par_iter()
|
||||||
.filter_map(|i| {
|
.filter_map(|i| {
|
||||||
let index_dir = self.partition.index_dir(i);
|
let index_dir = self.partition.index_dir(i);
|
||||||
if !index_dir.exists() { return None; }
|
if !index_dir.exists() {
|
||||||
|
return None;
|
||||||
|
}
|
||||||
let n_layers = match self.partition.n_layers(i) {
|
let n_layers = match self.partition.n_layers(i) {
|
||||||
Ok(n) => n,
|
Ok(n) => n,
|
||||||
Err(e) => return Some(OKIError::Io(std::io::Error::new(std::io::ErrorKind::Other, e.to_string()))),
|
Err(e) => {
|
||||||
|
return Some(OKIError::Io(std::io::Error::new(
|
||||||
|
std::io::ErrorKind::Other,
|
||||||
|
e.to_string(),
|
||||||
|
)));
|
||||||
|
}
|
||||||
};
|
};
|
||||||
for l in 0..n_layers {
|
for l in 0..n_layers {
|
||||||
let layer_dir = self.partition.layer_dir(i, l);
|
let layer_dir = self.partition.layer_dir(i, l);
|
||||||
let meta_path = layer_dir.join(LayerMeta::FILENAME);
|
let meta_path = layer_dir.join(LayerMeta::FILENAME);
|
||||||
if meta_path.exists() { continue; }
|
if meta_path.exists() {
|
||||||
|
continue;
|
||||||
|
}
|
||||||
let unitigs_path = layer_dir.join("unitigs.bin");
|
let unitigs_path = layer_dir.join("unitigs.bin");
|
||||||
let n_kmers = match UnitigFileReader::open_sequential(&unitigs_path) {
|
let n_kmers = match UnitigFileReader::open_sequential(&unitigs_path) {
|
||||||
Ok(r) => r.n_kmers(),
|
Ok(r) => r.n_kmers(),
|
||||||
Err(e) => return Some(OKIError::Partition(e)),
|
Err(e) => return Some(OKIError::Partition(e)),
|
||||||
};
|
};
|
||||||
if let Err(e) = LayerMeta::save(&layer_dir, n_kmers) {
|
if let Err(e) = LayerMeta::save(&layer_dir, n_kmers) {
|
||||||
@@ -340,7 +396,9 @@ impl KmerIndex {
|
|||||||
})
|
})
|
||||||
.collect();
|
.collect();
|
||||||
|
|
||||||
if let Some(e) = errors.into_iter().next() { return Err(e); }
|
if let Some(e) = errors.into_iter().next() {
|
||||||
|
return Err(e);
|
||||||
|
}
|
||||||
Ok(())
|
Ok(())
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -355,7 +413,11 @@ fn label_from_path(path: &Path) -> String {
|
|||||||
while let Some(pos) = s.rfind('.') {
|
while let Some(pos) = s.rfind('.') {
|
||||||
s.truncate(pos);
|
s.truncate(pos);
|
||||||
}
|
}
|
||||||
if s.is_empty() { "unknown".to_string() } else { s }
|
if s.is_empty() {
|
||||||
|
"unknown".to_string()
|
||||||
|
} else {
|
||||||
|
s
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
fn touch(path: &Path) -> Result<(), std::io::Error> {
|
fn touch(path: &Path) -> Result<(), std::io::Error> {
|
||||||
|
|||||||
+29
-14
@@ -193,7 +193,7 @@ impl KmerIndex {
|
|||||||
let block_bits = dst.meta.config.block_bits;
|
let block_bits = dst.meta.config.block_bits;
|
||||||
|
|
||||||
// Pre-build source list once (avoid rebuilding per partition)
|
// Pre-build source list once (avoid rebuilding per partition)
|
||||||
let srcs: Vec<(&obikpartitionner::KmerPartition, usize)> = remaining_sources
|
let srcs: Vec<(&obikpartitionner::KmerPartitions, usize)> = remaining_sources
|
||||||
.iter()
|
.iter()
|
||||||
.map(|s| (&s.partition, s.meta.genomes.len()))
|
.map(|s| (&s.partition, s.meta.genomes.len()))
|
||||||
.collect();
|
.collect();
|
||||||
@@ -221,19 +221,34 @@ impl KmerIndex {
|
|||||||
let runner = crate::numa::PartitionRunner::new();
|
let runner = crate::numa::PartitionRunner::new();
|
||||||
let mut part_stats: Vec<PartStat> = Vec::with_capacity(n_partitions);
|
let mut part_stats: Vec<PartStat> = Vec::with_capacity(n_partitions);
|
||||||
|
|
||||||
runner.run(
|
runner
|
||||||
&order,
|
.run(
|
||||||
|i| dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence),
|
&order,
|
||||||
|i, g_len, dur| {
|
|i| {
|
||||||
pb.inc(1);
|
dst_partition.merge_partition(
|
||||||
debug!(
|
i,
|
||||||
"partition {i}: done in {:.1}s — {} new kmers",
|
srcs,
|
||||||
dur.as_secs_f64(),
|
mode,
|
||||||
g_len,
|
n_dst_genomes,
|
||||||
);
|
block_bits,
|
||||||
part_stats.push(PartStat { id: i, unitig_bytes: partition_sizes[i], g_len });
|
evidence,
|
||||||
},
|
)
|
||||||
).map_err(OKIError::Partition)?;
|
},
|
||||||
|
|i, g_len, dur| {
|
||||||
|
pb.inc(1);
|
||||||
|
debug!(
|
||||||
|
"partition {i}: done in {:.1}s — {} new kmers",
|
||||||
|
dur.as_secs_f64(),
|
||||||
|
g_len,
|
||||||
|
);
|
||||||
|
part_stats.push(PartStat {
|
||||||
|
id: i,
|
||||||
|
unitig_bytes: partition_sizes[i],
|
||||||
|
g_len,
|
||||||
|
});
|
||||||
|
},
|
||||||
|
)
|
||||||
|
.map_err(OKIError::Partition)?;
|
||||||
|
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
|
|
||||||
|
|||||||
@@ -1,17 +1,17 @@
|
|||||||
use std::fs;
|
use obikpartitionner::KmerPartitions;
|
||||||
use std::path::Path;
|
|
||||||
use obikpartitionner::KmerPartition;
|
|
||||||
use obilayeredmap::{IndexMode, layer::Layer};
|
use obilayeredmap::{IndexMode, layer::Layer};
|
||||||
use obisys::{Reporter, Stage, progress_bar};
|
use obisys::{Reporter, Stage, progress_bar};
|
||||||
|
use std::fs;
|
||||||
|
use std::path::Path;
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
use crate::error::{OKIError, OKIResult};
|
use crate::error::{OKIError, OKIResult};
|
||||||
use crate::index::KmerIndex;
|
use crate::index::KmerIndex;
|
||||||
use crate::state::IndexState;
|
use crate::state::IndexState;
|
||||||
|
|
||||||
const EVIDENCE_FILE: &str = "evidence.bin";
|
const EVIDENCE_FILE: &str = "evidence.bin";
|
||||||
const FINGERPRINT_FILE: &str = "fingerprint.bin";
|
const FINGERPRINT_FILE: &str = "fingerprint.bin";
|
||||||
const UNITIG_IDX_FILE: &str = "unitigs.bin.idx";
|
const UNITIG_IDX_FILE: &str = "unitigs.bin.idx";
|
||||||
|
|
||||||
fn olm_to_oki(e: obilayeredmap::OLMError) -> OKIError {
|
fn olm_to_oki(e: obilayeredmap::OLMError) -> OKIError {
|
||||||
OKIError::InvalidInput(e.to_string())
|
OKIError::InvalidInput(e.to_string())
|
||||||
@@ -48,9 +48,13 @@ impl KmerIndex {
|
|||||||
let runner = crate::numa::PartitionRunner::new();
|
let runner = crate::numa::PartitionRunner::new();
|
||||||
runner.run(
|
runner.run(
|
||||||
&order,
|
&order,
|
||||||
|i| reindex_partition(&self.partition, i, &target, block_bits)
|
|i| {
|
||||||
.map_err(|e| OKIError::InvalidInput(format!("partition {i}: {e}"))),
|
reindex_partition(&self.partition, i, &target, block_bits)
|
||||||
|_, _, _| { pb.inc(1); },
|
.map_err(|e| OKIError::InvalidInput(format!("partition {i}: {e}")))
|
||||||
|
},
|
||||||
|
|_, _, _| {
|
||||||
|
pb.inc(1);
|
||||||
|
},
|
||||||
)?;
|
)?;
|
||||||
|
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
@@ -66,11 +70,18 @@ impl KmerIndex {
|
|||||||
}
|
}
|
||||||
|
|
||||||
/// Process all layers of one partition's index directory.
|
/// Process all layers of one partition's index directory.
|
||||||
fn reindex_partition(partition: &KmerPartition, i: usize, target: &IndexMode, block_bits: u8) -> OKIResult<()> {
|
fn reindex_partition(
|
||||||
|
partition: &KmerPartitions
|
||||||
|
, i: usize
|
||||||
|
, target: &IndexMode
|
||||||
|
, block_bits: u,
|
||||||
|
8) -> OKIResult<()> {
|
||||||
if !partition.index_dir(i).exists() {
|
if !partition.index_dir(i).exists() {
|
||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
let n_layers = partition.n_layers(i).map_err(|e| OKIError::InvalidInput(e.to_string()))?;
|
let n_layers = partition
|
||||||
|
.n_layers(i)
|
||||||
|
.map_err(|e| OKIError::InvalidInput(e.to_string()))?;
|
||||||
for layer_idx in 0..n_layers {
|
for layer_idx in 0..n_layers {
|
||||||
reindex_layer(&partition.layer_dir(i, layer_idx), target, block_bits)?;
|
reindex_layer(&partition.layer_dir(i, layer_idx), target, block_bits)?;
|
||||||
}
|
}
|
||||||
|
|||||||
+56
-22
@@ -1,6 +1,6 @@
|
|||||||
use std::path::Path;
|
use std::path::Path;
|
||||||
|
|
||||||
use obikpartitionner::{KmerPartition, OutputCol};
|
use obikpartitionner::{KmerPartitions, OutputCol};
|
||||||
use obisys::{Reporter, Stage, progress_bar};
|
use obisys::{Reporter, Stage, progress_bar};
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
@@ -35,31 +35,48 @@ impl KmerIndex {
|
|||||||
|
|
||||||
let mut meta = IndexMeta::new(src.meta.config.clone());
|
let mut meta = IndexMeta::new(src.meta.config.clone());
|
||||||
meta.config.with_counts = !output_presence;
|
meta.config.with_counts = !output_presence;
|
||||||
meta.genomes = specs.iter()
|
meta.genomes = specs
|
||||||
|
.iter()
|
||||||
.map(|s| GenomeInfo::new(s.label.clone()))
|
.map(|s| GenomeInfo::new(s.label.clone()))
|
||||||
.collect();
|
.collect();
|
||||||
|
|
||||||
let n_src_genomes = src.meta.genomes.len();
|
let n_src_genomes = src.meta.genomes.len();
|
||||||
let n_partitions = src.partition.n_partitions();
|
let n_partitions = src.partition.n_partitions();
|
||||||
|
|
||||||
let dst_partition = KmerIndex::create_skeleton(output, &meta)?;
|
let dst_partition = KmerIndex::create_skeleton(output, &meta)?;
|
||||||
|
|
||||||
info!(
|
info!(
|
||||||
"select: {} partition(s), {} source genome(s) → {} output column(s)",
|
"select: {} partition(s), {} source genome(s) → {} output column(s)",
|
||||||
n_partitions, n_src_genomes, specs.len(),
|
n_partitions,
|
||||||
|
n_src_genomes,
|
||||||
|
specs.len(),
|
||||||
);
|
);
|
||||||
|
|
||||||
let t = Stage::start("select");
|
let t = Stage::start("select");
|
||||||
let pb = progress_bar("select", n_partitions as u64, "partitions");
|
let pb = progress_bar("select", n_partitions as u64, "partitions");
|
||||||
let src_partition = &src.partition;
|
let src_partition = &src.partition;
|
||||||
|
|
||||||
let order: Vec<usize> = (0..n_partitions).collect();
|
let order: Vec<usize> = (0..n_partitions).collect();
|
||||||
let runner = crate::numa::PartitionRunner::new();
|
let runner = crate::numa::PartitionRunner::new();
|
||||||
runner.run(
|
runner
|
||||||
&order,
|
.run(
|
||||||
|i| dst_partition.select_partition(src_partition, i, specs, n_src_genomes, threshold, output_presence, false),
|
&order,
|
||||||
|_, _, _| { pb.inc(1); },
|
|i| {
|
||||||
).map_err(OKIError::Partition)?;
|
dst_partition.select_partition(
|
||||||
|
src_partition,
|
||||||
|
i,
|
||||||
|
specs,
|
||||||
|
n_src_genomes,
|
||||||
|
threshold,
|
||||||
|
output_presence,
|
||||||
|
false,
|
||||||
|
)
|
||||||
|
},
|
||||||
|
|_, _, _| {
|
||||||
|
pb.inc(1);
|
||||||
|
},
|
||||||
|
)
|
||||||
|
.map_err(OKIError::Partition)?;
|
||||||
|
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
rep.push(t.stop());
|
rep.push(t.stop());
|
||||||
@@ -82,9 +99,9 @@ impl KmerIndex {
|
|||||||
}
|
}
|
||||||
|
|
||||||
let n_src_genomes = self.meta.genomes.len();
|
let n_src_genomes = self.meta.genomes.len();
|
||||||
let n_partitions = self.partition.n_partitions();
|
let n_partitions = self.partition.n_partitions();
|
||||||
|
|
||||||
let src_partition = KmerPartition::open_with_config(
|
let src_partition = KmerPartitions::open_with_config(
|
||||||
&self.root_path,
|
&self.root_path,
|
||||||
self.meta.config.kmer_size,
|
self.meta.config.kmer_size,
|
||||||
self.meta.config.minimizer_size,
|
self.meta.config.minimizer_size,
|
||||||
@@ -93,26 +110,43 @@ impl KmerIndex {
|
|||||||
|
|
||||||
info!(
|
info!(
|
||||||
"select (in-place): {} partition(s), {} source genome(s) → {} output column(s)",
|
"select (in-place): {} partition(s), {} source genome(s) → {} output column(s)",
|
||||||
n_partitions, n_src_genomes, specs.len(),
|
n_partitions,
|
||||||
|
n_src_genomes,
|
||||||
|
specs.len(),
|
||||||
);
|
);
|
||||||
|
|
||||||
let t = Stage::start("select");
|
let t = Stage::start("select");
|
||||||
let pb = progress_bar("select", n_partitions as u64, "partitions");
|
let pb = progress_bar("select", n_partitions as u64, "partitions");
|
||||||
|
|
||||||
let partition = &self.partition;
|
let partition = &self.partition;
|
||||||
let order: Vec<usize> = (0..n_partitions).collect();
|
let order: Vec<usize> = (0..n_partitions).collect();
|
||||||
let runner = crate::numa::PartitionRunner::new();
|
let runner = crate::numa::PartitionRunner::new();
|
||||||
runner.run(
|
runner
|
||||||
&order,
|
.run(
|
||||||
|i| partition.select_partition(&src_partition, i, specs, n_src_genomes, threshold, output_presence, true),
|
&order,
|
||||||
|_, _, _| { pb.inc(1); },
|
|i| {
|
||||||
).map_err(OKIError::Partition)?;
|
partition.select_partition(
|
||||||
|
&src_partition,
|
||||||
|
i,
|
||||||
|
specs,
|
||||||
|
n_src_genomes,
|
||||||
|
threshold,
|
||||||
|
output_presence,
|
||||||
|
true,
|
||||||
|
)
|
||||||
|
},
|
||||||
|
|_, _, _| {
|
||||||
|
pb.inc(1);
|
||||||
|
},
|
||||||
|
)
|
||||||
|
.map_err(OKIError::Partition)?;
|
||||||
|
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
rep.push(t.stop());
|
rep.push(t.stop());
|
||||||
|
|
||||||
self.meta.config.with_counts = !output_presence;
|
self.meta.config.with_counts = !output_presence;
|
||||||
self.meta.genomes = specs.iter()
|
self.meta.genomes = specs
|
||||||
|
.iter()
|
||||||
.map(|s| GenomeInfo::new(s.label.clone()))
|
.map(|s| GenomeInfo::new(s.label.clone()))
|
||||||
.collect();
|
.collect();
|
||||||
self.meta.write(&self.root_path)?;
|
self.meta.write(&self.root_path)?;
|
||||||
|
|||||||
@@ -1,12 +1,12 @@
|
|||||||
use std::path::PathBuf;
|
use std::path::PathBuf;
|
||||||
use std::sync::atomic::{AtomicU32, AtomicU64, Ordering};
|
|
||||||
use std::sync::Arc;
|
use std::sync::Arc;
|
||||||
|
use std::sync::atomic::{AtomicU32, AtomicU64, Ordering};
|
||||||
use std::time::Instant;
|
use std::time::Instant;
|
||||||
|
|
||||||
use obisys::spinner;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obiread::NucPage;
|
|
||||||
use obikpartitionner::KmerPartition;
|
|
||||||
use obipipeline::{ThrottleGuard, Throttled, throttle};
|
use obipipeline::{ThrottleGuard, Throttled, throttle};
|
||||||
|
use obiread::NucPage;
|
||||||
|
use obisys::spinner;
|
||||||
use obisys::{Reporter, Stage};
|
use obisys::{Reporter, Stage};
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
@@ -15,8 +15,8 @@ use crate::cli::PipelineData;
|
|||||||
// ── Iterator that keeps the slot guard alive until the file is exhausted ──────
|
// ── Iterator that keeps the slot guard alive until the file is exhausted ──────
|
||||||
|
|
||||||
struct GuardedIter {
|
struct GuardedIter {
|
||||||
inner: Box<dyn Iterator<Item = NucPage> + Send>,
|
inner: Box<dyn Iterator<Item = NucPage> + Send>,
|
||||||
_guard: ThrottleGuard,
|
_guard: ThrottleGuard,
|
||||||
flat_active: Arc<AtomicU32>,
|
flat_active: Arc<AtomicU32>,
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -38,7 +38,7 @@ impl Drop for GuardedIter {
|
|||||||
/// Run scatter: normalise → build superkmers → route to partition → close.
|
/// Run scatter: normalise → build superkmers → route to partition → close.
|
||||||
/// Reports the "scatter" stage to `rep`.
|
/// Reports the "scatter" stage to `rep`.
|
||||||
pub fn scatter(
|
pub fn scatter(
|
||||||
kp: &mut KmerPartition,
|
kp: &mut KmerPartitions,
|
||||||
path_source: impl Iterator<Item = PathBuf> + Send + 'static,
|
path_source: impl Iterator<Item = PathBuf> + Send + 'static,
|
||||||
k: usize,
|
k: usize,
|
||||||
level_max: usize,
|
level_max: usize,
|
||||||
@@ -52,8 +52,8 @@ pub fn scatter(
|
|||||||
// Throttle in the source thread — never in a worker — to prevent deadlock.
|
// Throttle in the source thread — never in a worker — to prevent deadlock.
|
||||||
let throttled = throttle(path_source, max_open);
|
let throttled = throttle(path_source, max_open);
|
||||||
|
|
||||||
let file_count = Arc::new(AtomicU64::new(0));
|
let file_count = Arc::new(AtomicU64::new(0));
|
||||||
let flat_active = Arc::new(AtomicU32::new(0));
|
let flat_active = Arc::new(AtomicU32::new(0));
|
||||||
let transform_active = Arc::new(AtomicU32::new(0));
|
let transform_active = Arc::new(AtomicU32::new(0));
|
||||||
|
|
||||||
let t = Stage::start("scatter");
|
let t = Stage::start("scatter");
|
||||||
@@ -95,7 +95,8 @@ pub fn scatter(
|
|||||||
const ALPHA: f64 = 0.15;
|
const ALPHA: f64 = 0.15;
|
||||||
|
|
||||||
for batch in pipe.apply(throttled, n_workers, 1) {
|
for batch in pipe.apply(throttled, n_workers, 1) {
|
||||||
total_bases += batch.iter()
|
total_bases += batch
|
||||||
|
.iter()
|
||||||
.map(|sk| (sk.seql() as u64).saturating_sub(kmer_overlap))
|
.map(|sk| (sk.seql() as u64).saturating_sub(kmer_overlap))
|
||||||
.sum::<u64>();
|
.sum::<u64>();
|
||||||
let now = Instant::now();
|
let now = Instant::now();
|
||||||
@@ -107,14 +108,22 @@ pub fn scatter(
|
|||||||
last_bases = total_bases;
|
last_bases = total_bases;
|
||||||
let bp = total_bases as f64;
|
let bp = total_bases as f64;
|
||||||
let (count_str, rate_str) = if bp >= 1e9 {
|
let (count_str, rate_str) = if bp >= 1e9 {
|
||||||
(format!("{:.2} Gbp", bp / 1e9), format!("{:.0} Mbp/s", ema_rate / 1e6))
|
(
|
||||||
|
format!("{:.2} Gbp", bp / 1e9),
|
||||||
|
format!("{:.0} Mbp/s", ema_rate / 1e6),
|
||||||
|
)
|
||||||
} else {
|
} else {
|
||||||
(format!("{:.0} Mbp", bp / 1e6), format!("{:.0} Mbp/s", ema_rate / 1e6))
|
(
|
||||||
|
format!("{:.0} Mbp", bp / 1e6),
|
||||||
|
format!("{:.0} Mbp/s", ema_rate / 1e6),
|
||||||
|
)
|
||||||
};
|
};
|
||||||
let n_files = file_count.load(Ordering::Relaxed);
|
let n_files = file_count.load(Ordering::Relaxed);
|
||||||
let r = flat_active.load(Ordering::Relaxed);
|
let r = flat_active.load(Ordering::Relaxed);
|
||||||
let c = transform_active.load(Ordering::Relaxed);
|
let c = transform_active.load(Ordering::Relaxed);
|
||||||
pb.set_message(format!("{count_str} {rate_str} {n_files} files [R:{r} C:{c}]"));
|
pb.set_message(format!(
|
||||||
|
"{count_str} {rate_str} {n_files} files [R:{r} C:{c}]"
|
||||||
|
));
|
||||||
}
|
}
|
||||||
kp.write_batch(batch).unwrap_or_else(|e| {
|
kp.write_batch(batch).unwrap_or_else(|e| {
|
||||||
eprintln!("error: {e}");
|
eprintln!("error: {e}");
|
||||||
|
|||||||
@@ -1,11 +1,11 @@
|
|||||||
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
|
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
|
||||||
use obilayeredmap::{open_data, LayeredStore};
|
use obilayeredmap::{LayeredStore, open_data};
|
||||||
use obiskio::SKResult;
|
use obiskio::SKResult;
|
||||||
|
|
||||||
use crate::common::{load_meta, olm_to_sk};
|
use crate::common::{load_meta, olm_to_sk};
|
||||||
use crate::partition::KmerPartition;
|
use crate::partition::KmerPartitions;
|
||||||
|
|
||||||
impl KmerPartition {
|
impl KmerPartitions {
|
||||||
/// Open all count matrices for partition `part`, one per layer.
|
/// Open all count matrices for partition `part`, one per layer.
|
||||||
/// Layers without a `counts/` directory are skipped.
|
/// Layers without a `counts/` directory are skipped.
|
||||||
pub fn count_store(&self, part: usize) -> SKResult<LayeredStore<PersistentCompactIntMatrix>> {
|
pub fn count_store(&self, part: usize) -> SKResult<LayeredStore<PersistentCompactIntMatrix>> {
|
||||||
@@ -16,7 +16,9 @@ impl KmerPartition {
|
|||||||
let n_layers = load_meta(&index_dir, "distance")?.n_layers;
|
let n_layers = load_meta(&index_dir, "distance")?.n_layers;
|
||||||
let matrices = (0..n_layers)
|
let matrices = (0..n_layers)
|
||||||
.filter_map(|l| {
|
.filter_map(|l| {
|
||||||
self.layer_dir(part, l).join("counts").exists()
|
self.layer_dir(part, l)
|
||||||
|
.join("counts")
|
||||||
|
.exists()
|
||||||
.then(|| open_data(&index_dir, l).map_err(|e| olm_to_sk(e, "distance")))
|
.then(|| open_data(&index_dir, l).map_err(|e| olm_to_sk(e, "distance")))
|
||||||
})
|
})
|
||||||
.collect::<SKResult<Vec<_>>>()?;
|
.collect::<SKResult<Vec<_>>>()?;
|
||||||
@@ -33,7 +35,9 @@ impl KmerPartition {
|
|||||||
let n_layers = load_meta(&index_dir, "distance")?.n_layers;
|
let n_layers = load_meta(&index_dir, "distance")?.n_layers;
|
||||||
let matrices = (0..n_layers)
|
let matrices = (0..n_layers)
|
||||||
.filter_map(|l| {
|
.filter_map(|l| {
|
||||||
self.layer_dir(part, l).join("presence").exists()
|
self.layer_dir(part, l)
|
||||||
|
.join("presence")
|
||||||
|
.exists()
|
||||||
.then(|| open_data(&index_dir, l).map_err(|e| olm_to_sk(e, "distance")))
|
.then(|| open_data(&index_dir, l).map_err(|e| olm_to_sk(e, "distance")))
|
||||||
})
|
})
|
||||||
.collect::<SKResult<Vec<_>>>()?;
|
.collect::<SKResult<Vec<_>>>()?;
|
||||||
|
|||||||
@@ -1,19 +1,22 @@
|
|||||||
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
|
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
|
||||||
use obikseq::CanonicalKmer;
|
use obikseq::CanonicalKmer;
|
||||||
use obiskio::{SKError, SKResult, UnitigFileReader};
|
|
||||||
use obilayeredmap::{IndexMode, MphfLayer, OLMError};
|
use obilayeredmap::{IndexMode, MphfLayer, OLMError};
|
||||||
|
use obiskio::{SKError, SKResult, UnitigFileReader};
|
||||||
|
|
||||||
use crate::filter::{KmerFilter, passes_all};
|
use crate::filter::{KmerFilter, passes_all};
|
||||||
use crate::partition::KmerPartition;
|
use crate::partition::KmerPartitions;
|
||||||
|
|
||||||
fn olm_to_sk(e: OLMError) -> SKError {
|
fn olm_to_sk(e: OLMError) -> SKError {
|
||||||
match e {
|
match e {
|
||||||
OLMError::Io(e) => SKError::Io(e),
|
OLMError::Io(e) => SKError::Io(e),
|
||||||
other => SKError::InvalidData { context: "dump", detail: other.to_string() },
|
other => SKError::InvalidData {
|
||||||
|
context: "dump",
|
||||||
|
detail: other.to_string(),
|
||||||
|
},
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
impl KmerPartition {
|
impl KmerPartitions {
|
||||||
/// Iterate all indexed kmers in partition `part`, calling `cb(kmer, row)` for each
|
/// Iterate all indexed kmers in partition `part`, calling `cb(kmer, row)` for each
|
||||||
/// kmer that passes every filter in `filters`.
|
/// kmer that passes every filter in `filters`.
|
||||||
///
|
///
|
||||||
@@ -43,12 +46,14 @@ impl KmerPartition {
|
|||||||
let mut l = 0;
|
let mut l = 0;
|
||||||
loop {
|
loop {
|
||||||
let layer_dir = self.layer_dir(part, l);
|
let layer_dir = self.layer_dir(part, l);
|
||||||
if !layer_dir.exists() { break; }
|
if !layer_dir.exists() {
|
||||||
|
break;
|
||||||
|
}
|
||||||
l += 1;
|
l += 1;
|
||||||
let mphf = MphfLayer::open(&layer_dir, &index_mode).map_err(olm_to_sk)?;
|
let mphf = MphfLayer::open(&layer_dir, &index_mode).map_err(olm_to_sk)?;
|
||||||
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))?;
|
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))?;
|
||||||
|
|
||||||
let counts_dir = layer_dir.join("counts");
|
let counts_dir = layer_dir.join("counts");
|
||||||
let presence_dir = layer_dir.join("presence");
|
let presence_dir = layer_dir.join("presence");
|
||||||
|
|
||||||
let cont = if use_counts && counts_dir.exists() {
|
let cont = if use_counts && counts_dir.exists() {
|
||||||
@@ -59,7 +64,9 @@ impl KmerPartition {
|
|||||||
let row = mat.row(slot);
|
let row = mat.row(slot);
|
||||||
if passes_all(filters, kmer, &row, n_genomes) {
|
if passes_all(filters, kmer, &row, n_genomes) {
|
||||||
cont = cb(kmer, row);
|
cont = cb(kmer, row);
|
||||||
if !cont { break; }
|
if !cont {
|
||||||
|
break;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -72,7 +79,9 @@ impl KmerPartition {
|
|||||||
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
||||||
if passes_all(filters, kmer, &row, n_genomes) {
|
if passes_all(filters, kmer, &row, n_genomes) {
|
||||||
cont = cb(kmer, row);
|
cont = cb(kmer, row);
|
||||||
if !cont { break; }
|
if !cont {
|
||||||
|
break;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -86,15 +95,21 @@ impl KmerPartition {
|
|||||||
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
||||||
let mut cont = true;
|
let mut cont = true;
|
||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
|
if mphf.find(kmer).is_some()
|
||||||
|
&& passes_all(filters, kmer, &all_present, n_genomes)
|
||||||
|
{
|
||||||
cont = cb(kmer, all_present.clone());
|
cont = cb(kmer, all_present.clone());
|
||||||
if !cont { break; }
|
if !cont {
|
||||||
|
break;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
cont
|
cont
|
||||||
};
|
};
|
||||||
|
|
||||||
if !cont { return Ok(false); }
|
if !cont {
|
||||||
|
return Ok(false);
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
Ok(true)
|
Ok(true)
|
||||||
@@ -121,11 +136,13 @@ impl KmerPartition {
|
|||||||
let mut layer = 0;
|
let mut layer = 0;
|
||||||
loop {
|
loop {
|
||||||
let layer_dir = self.layer_dir(part, layer);
|
let layer_dir = self.layer_dir(part, layer);
|
||||||
if !layer_dir.exists() { break; }
|
if !layer_dir.exists() {
|
||||||
let mphf = MphfLayer::open(&layer_dir, &index_mode).map_err(olm_to_sk)?;
|
break;
|
||||||
|
}
|
||||||
|
let mphf = MphfLayer::open(&layer_dir, &index_mode).map_err(olm_to_sk)?;
|
||||||
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))?;
|
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))?;
|
||||||
|
|
||||||
let counts_dir = layer_dir.join("counts");
|
let counts_dir = layer_dir.join("counts");
|
||||||
let presence_dir = layer_dir.join("presence");
|
let presence_dir = layer_dir.join("presence");
|
||||||
|
|
||||||
let cont = if use_counts && counts_dir.exists() {
|
let cont = if use_counts && counts_dir.exists() {
|
||||||
@@ -136,7 +153,9 @@ impl KmerPartition {
|
|||||||
let row = mat.row(slot);
|
let row = mat.row(slot);
|
||||||
if passes_all(filters, kmer, &row, n_genomes) {
|
if passes_all(filters, kmer, &row, n_genomes) {
|
||||||
cont = cb(part, layer, kmer, row);
|
cont = cb(part, layer, kmer, row);
|
||||||
if !cont { break; }
|
if !cont {
|
||||||
|
break;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -149,7 +168,9 @@ impl KmerPartition {
|
|||||||
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
||||||
if passes_all(filters, kmer, &row, n_genomes) {
|
if passes_all(filters, kmer, &row, n_genomes) {
|
||||||
cont = cb(part, layer, kmer, row);
|
cont = cb(part, layer, kmer, row);
|
||||||
if !cont { break; }
|
if !cont {
|
||||||
|
break;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -161,15 +182,21 @@ impl KmerPartition {
|
|||||||
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
||||||
let mut cont = true;
|
let mut cont = true;
|
||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
|
if mphf.find(kmer).is_some()
|
||||||
|
&& passes_all(filters, kmer, &all_present, n_genomes)
|
||||||
|
{
|
||||||
cont = cb(part, layer, kmer, all_present.clone());
|
cont = cb(part, layer, kmer, all_present.clone());
|
||||||
if !cont { break; }
|
if !cont {
|
||||||
|
break;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
cont
|
cont
|
||||||
};
|
};
|
||||||
|
|
||||||
if !cont { return Ok(false); }
|
if !cont {
|
||||||
|
return Ok(false);
|
||||||
|
}
|
||||||
layer += 1;
|
layer += 1;
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -12,7 +12,7 @@ use ptr_hash::{PtrHash, bucket_fn::CubicEps, hash::Xx64};
|
|||||||
|
|
||||||
use crate::common::olm_to_sk;
|
use crate::common::olm_to_sk;
|
||||||
use crate::graph_pipeline::{materialize_layer, write_graph_as_unitigs};
|
use crate::graph_pipeline::{materialize_layer, write_graph_as_unitigs};
|
||||||
use crate::partition::KmerPartition;
|
use crate::partition::KmerPartitions;
|
||||||
|
|
||||||
type Mphf = PtrHash<u64, CubicEps, CachelineEfVec<Vec<CachelineEf>>, Xx64, Vec<u8>>;
|
type Mphf = PtrHash<u64, CubicEps, CachelineEfVec<Vec<CachelineEf>>, Xx64, Vec<u8>>;
|
||||||
|
|
||||||
@@ -24,7 +24,7 @@ fn remove_if_exists(path: &std::path::Path) {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
impl KmerPartition {
|
impl KmerPartitions {
|
||||||
/// Build the layered MPHF index for partition `i`.
|
/// Build the layered MPHF index for partition `i`.
|
||||||
///
|
///
|
||||||
/// Returns the number of canonical k-mers indexed, or 0 if the partition
|
/// Returns the number of canonical k-mers indexed, or 0 if the partition
|
||||||
@@ -93,22 +93,20 @@ impl KmerPartition {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
let n_kmers = if with_counts {
|
let n_kmers =
|
||||||
let n = write_graph_as_unitigs(g, &layer_dir)?;
|
if with_counts {
|
||||||
Layer::<PersistentCompactIntMatrix>::build(
|
let n = write_graph_as_unitigs(g, &layer_dir)?;
|
||||||
&layer_dir,
|
Layer::<PersistentCompactIntMatrix>::build(&layer_dir, block_bits, mode, |kmer| {
|
||||||
block_bits,
|
match (&mphf1_opt, &counts1_opt) {
|
||||||
mode,
|
(Some(mphf), Some(counts)) => counts.get(mphf.index(&kmer.raw())),
|
||||||
|kmer| match (&mphf1_opt, &counts1_opt) {
|
_ => 1,
|
||||||
(Some(mphf), Some(counts)) => counts.get(mphf.index(&kmer.raw())),
|
}
|
||||||
_ => 1,
|
})
|
||||||
},
|
.map_err(|e| olm_to_sk(e, "layer build"))?;
|
||||||
)
|
n
|
||||||
.map_err(|e| olm_to_sk(e, "layer build"))?;
|
} else {
|
||||||
n
|
materialize_layer(g, &layer_dir, block_bits, mode)?
|
||||||
} else {
|
};
|
||||||
materialize_layer(g, &layer_dir, block_bits, mode)?
|
|
||||||
};
|
|
||||||
|
|
||||||
let index_dir = layer_dir.parent().expect("layer_dir has a parent");
|
let index_dir = layer_dir.parent().expect("layer_dir has a parent");
|
||||||
PartitionMeta {
|
PartitionMeta {
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
pub mod filter;
|
|
||||||
mod common;
|
mod common;
|
||||||
mod distance;
|
mod distance;
|
||||||
mod dump_layer;
|
mod dump_layer;
|
||||||
|
pub mod filter;
|
||||||
mod graph_pipeline;
|
mod graph_pipeline;
|
||||||
mod index_layer;
|
mod index_layer;
|
||||||
mod kmer_sort;
|
mod kmer_sort;
|
||||||
@@ -13,6 +13,6 @@ mod select_layer;
|
|||||||
|
|
||||||
pub use filter::{GroupQuorumFilter, KmerFilter, passes_all};
|
pub use filter::{GroupQuorumFilter, KmerFilter, passes_all};
|
||||||
pub use merge_layer::MergeMode;
|
pub use merge_layer::MergeMode;
|
||||||
pub use partition::{KmerPartition, KmerSpectrum, PARTITIONS_SUBDIR};
|
pub use partition::{KmerPartitions, KmerSpectrum, PARTITIONS_SUBDIR};
|
||||||
pub use query_layer::{KmerDesc, QueryHit, QueryStats};
|
pub use query_layer::{KmerDesc, QueryHit, QueryStats};
|
||||||
pub use select_layer::{AggOp, OutputCol};
|
pub use select_layer::{AggOp, OutputCol};
|
||||||
@@ -12,21 +12,20 @@ use std::io;
|
|||||||
use std::path::{Path, PathBuf};
|
use std::path::{Path, PathBuf};
|
||||||
use std::sync::{Arc, Mutex};
|
use std::sync::{Arc, Mutex};
|
||||||
|
|
||||||
use tracing::debug;
|
|
||||||
use obipipeline::{
|
use obipipeline::{
|
||||||
Pipeline, PipelineError, PipelineSender, SharedFlatFn, Stage, WorkerPool,
|
Pipeline, PipelineError, PipelineSender, SharedFlatFn, Stage, ThrottleGuard, WorkerPool,
|
||||||
ThrottleGuard, throttle,
|
make_sink, make_source, make_transform, throttle,
|
||||||
make_sink, make_source, make_transform,
|
|
||||||
};
|
};
|
||||||
|
use tracing::debug;
|
||||||
|
|
||||||
use obicompactvec::{PersistentBitMatrixBuilder, PersistentCompactIntMatrixBuilder};
|
use obicompactvec::{PersistentBitMatrixBuilder, PersistentCompactIntMatrixBuilder};
|
||||||
use obikseq::CanonicalKmer;
|
use obikseq::CanonicalKmer;
|
||||||
use obilayeredmap::{layer_dir, IndexMode, Layer, LayeredMap, MphfOnly};
|
use obilayeredmap::{IndexMode, Layer, LayeredMap, MphfOnly, layer_dir};
|
||||||
use obiskio::{SKError, SKResult, UnitigFileReader};
|
use obiskio::{SKError, SKResult, UnitigFileReader};
|
||||||
|
|
||||||
use crate::common::{ColBuilder, load_meta, olm_to_sk};
|
use crate::common::{ColBuilder, load_meta, olm_to_sk};
|
||||||
use crate::graph_pipeline::{build_graph, materialize_layer};
|
use crate::graph_pipeline::{build_graph, materialize_layer};
|
||||||
use crate::partition::KmerPartition;
|
use crate::partition::KmerPartitions;
|
||||||
|
|
||||||
mod src_layer;
|
mod src_layer;
|
||||||
|
|
||||||
@@ -58,14 +57,14 @@ impl MatrixBuilder {
|
|||||||
fn new(mode: MergeMode, n: usize, dir: &Path) -> io::Result<Self> {
|
fn new(mode: MergeMode, n: usize, dir: &Path) -> io::Result<Self> {
|
||||||
Ok(match mode {
|
Ok(match mode {
|
||||||
MergeMode::Presence => MatrixBuilder::Bit(PersistentBitMatrixBuilder::new(n, dir)?),
|
MergeMode::Presence => MatrixBuilder::Bit(PersistentBitMatrixBuilder::new(n, dir)?),
|
||||||
MergeMode::Count => MatrixBuilder::Int(PersistentCompactIntMatrixBuilder::new(n, dir)?),
|
MergeMode::Count => MatrixBuilder::Int(PersistentCompactIntMatrixBuilder::new(n, dir)?),
|
||||||
})
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
fn resume(mode: MergeMode, dir: &Path) -> io::Result<Self> {
|
fn resume(mode: MergeMode, dir: &Path) -> io::Result<Self> {
|
||||||
Ok(match mode {
|
Ok(match mode {
|
||||||
MergeMode::Presence => MatrixBuilder::Bit(PersistentBitMatrixBuilder::resume(dir)?),
|
MergeMode::Presence => MatrixBuilder::Bit(PersistentBitMatrixBuilder::resume(dir)?),
|
||||||
MergeMode::Count => MatrixBuilder::Int(PersistentCompactIntMatrixBuilder::resume(dir)?),
|
MergeMode::Count => MatrixBuilder::Int(PersistentCompactIntMatrixBuilder::resume(dir)?),
|
||||||
})
|
})
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -117,7 +116,11 @@ mod matrix_builder_tests {
|
|||||||
// One source column, filled like pass 2 would.
|
// One source column, filled like pass 2 would.
|
||||||
let mut col = mb.add_col().unwrap();
|
let mut col = mb.add_col().unwrap();
|
||||||
match &mut col {
|
match &mut col {
|
||||||
ColBuilder::Bit(b) => { b.set(0, true); b.set(1, false); b.set(2, true); }
|
ColBuilder::Bit(b) => {
|
||||||
|
b.set(0, true);
|
||||||
|
b.set(1, false);
|
||||||
|
b.set(2, true);
|
||||||
|
}
|
||||||
ColBuilder::Int(_) => unreachable!(),
|
ColBuilder::Int(_) => unreachable!(),
|
||||||
}
|
}
|
||||||
col.close().unwrap();
|
col.close().unwrap();
|
||||||
@@ -140,7 +143,10 @@ mod matrix_builder_tests {
|
|||||||
|
|
||||||
let mut col = mb.add_col().unwrap();
|
let mut col = mb.add_col().unwrap();
|
||||||
match &mut col {
|
match &mut col {
|
||||||
ColBuilder::Int(b) => { b.set(0, 7); b.set(1, 42); }
|
ColBuilder::Int(b) => {
|
||||||
|
b.set(0, 7);
|
||||||
|
b.set(1, 42);
|
||||||
|
}
|
||||||
ColBuilder::Bit(_) => unreachable!(),
|
ColBuilder::Bit(_) => unreachable!(),
|
||||||
}
|
}
|
||||||
col.close().unwrap();
|
col.close().unwrap();
|
||||||
@@ -171,7 +177,11 @@ mod matrix_builder_tests {
|
|||||||
for vals in [[true, false, true], [false, true, false]] {
|
for vals in [[true, false, true], [false, true, false]] {
|
||||||
let mut col = mb.add_col().unwrap();
|
let mut col = mb.add_col().unwrap();
|
||||||
match &mut col {
|
match &mut col {
|
||||||
ColBuilder::Bit(b) => for (slot, v) in vals.into_iter().enumerate() { b.set(slot, v); },
|
ColBuilder::Bit(b) => {
|
||||||
|
for (slot, v) in vals.into_iter().enumerate() {
|
||||||
|
b.set(slot, v);
|
||||||
|
}
|
||||||
|
}
|
||||||
ColBuilder::Int(_) => unreachable!(),
|
ColBuilder::Int(_) => unreachable!(),
|
||||||
}
|
}
|
||||||
col.close().unwrap();
|
col.close().unwrap();
|
||||||
@@ -188,7 +198,7 @@ mod matrix_builder_tests {
|
|||||||
|
|
||||||
// ── KmerPartition::merge_partition ────────────────────────────────────────────
|
// ── KmerPartition::merge_partition ────────────────────────────────────────────
|
||||||
|
|
||||||
impl KmerPartition {
|
impl KmerPartitions {
|
||||||
/// Merge `sources` into destination partition `i`.
|
/// Merge `sources` into destination partition `i`.
|
||||||
///
|
///
|
||||||
/// Each entry in `sources` is `(partition, n_genomes)` where `n_genomes` is
|
/// Each entry in `sources` is `(partition, n_genomes)` where `n_genomes` is
|
||||||
@@ -201,7 +211,7 @@ impl KmerPartition {
|
|||||||
pub fn merge_partition(
|
pub fn merge_partition(
|
||||||
&self,
|
&self,
|
||||||
i: usize,
|
i: usize,
|
||||||
sources: &[(&KmerPartition, usize)],
|
sources: &[(&KmerPartitions, usize)],
|
||||||
mode: MergeMode,
|
mode: MergeMode,
|
||||||
n_dst_genomes: usize,
|
n_dst_genomes: usize,
|
||||||
block_bits: u8,
|
block_bits: u8,
|
||||||
@@ -213,7 +223,8 @@ impl KmerPartition {
|
|||||||
}
|
}
|
||||||
|
|
||||||
load_meta(&dst_index_dir, "merge")?; // ensure meta.json exists before LayeredMap::open
|
load_meta(&dst_index_dir, "merge")?; // ensure meta.json exists before LayeredMap::open
|
||||||
let dst_map = Arc::new(LayeredMap::<()>::open(&dst_index_dir).map_err(|e| olm_to_sk(e, "merge"))?);
|
let dst_map =
|
||||||
|
Arc::new(LayeredMap::<()>::open(&dst_index_dir).map_err(|e| olm_to_sk(e, "merge"))?);
|
||||||
let n_dst_layers = dst_map.n_layers();
|
let n_dst_layers = dst_map.n_layers();
|
||||||
let n_src_total: usize = sources.iter().map(|(_, n)| *n).sum();
|
let n_src_total: usize = sources.iter().map(|(_, n)| *n).sum();
|
||||||
|
|
||||||
@@ -221,8 +232,11 @@ impl KmerPartition {
|
|||||||
// (all slots true — every kmer in those layers belongs to genome_0).
|
// (all slots true — every kmer in those layers belongs to genome_0).
|
||||||
if n_dst_genomes == 1 && mode == MergeMode::Presence {
|
if n_dst_genomes == 1 && mode == MergeMode::Presence {
|
||||||
for l in 0..n_dst_layers {
|
for l in 0..n_dst_layers {
|
||||||
Layer::<()>::init_presence_matrix(&layer_dir(&dst_index_dir, l), dst_map.layer(l).n())
|
Layer::<()>::init_presence_matrix(
|
||||||
.map_err(|e| olm_to_sk(e, "merge"))?;
|
&layer_dir(&dst_index_dir, l),
|
||||||
|
dst_map.layer(l).n(),
|
||||||
|
)
|
||||||
|
.map_err(|e| olm_to_sk(e, "merge"))?;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -283,7 +297,10 @@ impl KmerPartition {
|
|||||||
)?;
|
)?;
|
||||||
|
|
||||||
let any_new = g.len() > 0;
|
let any_new = g.len() > 0;
|
||||||
debug!("partition {i}: de Bruijn graph done — {} new kmers", g.len());
|
debug!(
|
||||||
|
"partition {i}: de Bruijn graph done — {} new kmers",
|
||||||
|
g.len()
|
||||||
|
);
|
||||||
|
|
||||||
// Build new layer from de Bruijn graph if there are new kmers.
|
// Build new layer from de Bruijn graph if there are new kmers.
|
||||||
let new_layer_idx = n_dst_layers;
|
let new_layer_idx = n_dst_layers;
|
||||||
@@ -301,11 +318,16 @@ impl KmerPartition {
|
|||||||
|
|
||||||
let t_open = std::time::Instant::now();
|
let t_open = std::time::Instant::now();
|
||||||
let new_mphf: Option<Arc<MphfOnly>> = if any_new {
|
let new_mphf: Option<Arc<MphfOnly>> = if any_new {
|
||||||
Some(Arc::new(MphfOnly::open(&new_layer_dir).map_err(|e| olm_to_sk(e, "merge"))?))
|
Some(Arc::new(
|
||||||
|
MphfOnly::open(&new_layer_dir).map_err(|e| olm_to_sk(e, "merge"))?,
|
||||||
|
))
|
||||||
} else {
|
} else {
|
||||||
None
|
None
|
||||||
};
|
};
|
||||||
debug!("partition {i}: MPHF open in {:.3}s", t_open.elapsed().as_secs_f64());
|
debug!(
|
||||||
|
"partition {i}: MPHF open in {:.3}s",
|
||||||
|
t_open.elapsed().as_secs_f64()
|
||||||
|
);
|
||||||
|
|
||||||
// ── Prepare matrix directories for the new layer ──────────────────────
|
// ── Prepare matrix directories for the new layer ──────────────────────
|
||||||
// Absent columns (dst genomes) get an all-zero/false column. Source-genome
|
// Absent columns (dst genomes) get an all-zero/false column. Source-genome
|
||||||
@@ -351,7 +373,10 @@ impl KmerPartition {
|
|||||||
exist_builders.push(cols);
|
exist_builders.push(cols);
|
||||||
}
|
}
|
||||||
|
|
||||||
debug!("partition {i}: builders ready in {:.3}s", t_builders.elapsed().as_secs_f64());
|
debug!(
|
||||||
|
"partition {i}: builders ready in {:.3}s",
|
||||||
|
t_builders.elapsed().as_secs_f64()
|
||||||
|
);
|
||||||
|
|
||||||
// ── Pass 2: fill builders (pipeline) ─────────────────────────────────
|
// ── Pass 2: fill builders (pipeline) ─────────────────────────────────
|
||||||
let t_pass2 = std::time::Instant::now();
|
let t_pass2 = std::time::Instant::now();
|
||||||
@@ -391,35 +416,41 @@ impl KmerPartition {
|
|||||||
.into_iter()
|
.into_iter()
|
||||||
.map(|b| Arc::new(Mutex::new(b)))
|
.map(|b| Arc::new(Mutex::new(b)))
|
||||||
.collect();
|
.collect();
|
||||||
let exist_sink: Vec<Vec<Arc<Mutex<ColBuilder>>>> = exist_locked.iter()
|
let exist_sink: Vec<Vec<Arc<Mutex<ColBuilder>>>> = exist_locked
|
||||||
|
.iter()
|
||||||
.map(|layer| layer.iter().map(Arc::clone).collect())
|
.map(|layer| layer.iter().map(Arc::clone).collect())
|
||||||
.collect();
|
.collect();
|
||||||
let new_sink: Vec<Arc<Mutex<ColBuilder>>> = new_locked.iter().map(Arc::clone).collect();
|
let new_sink: Vec<Arc<Mutex<ColBuilder>>> = new_locked.iter().map(Arc::clone).collect();
|
||||||
let dst_map_t2 = Arc::clone(&dst_map);
|
let dst_map_t2 = Arc::clone(&dst_map);
|
||||||
let new_mphf_t2 = new_mphf.clone();
|
let new_mphf_t2 = new_mphf.clone();
|
||||||
let pass2_err: Arc<Mutex<Option<String>>> = Arc::new(Mutex::new(None));
|
let pass2_err: Arc<Mutex<Option<String>>> = Arc::new(Mutex::new(None));
|
||||||
let err_cap2 = Arc::clone(&pass2_err);
|
let err_cap2 = Arc::clone(&pass2_err);
|
||||||
|
|
||||||
let capacity = 2;
|
let capacity = 2;
|
||||||
let throttled_pass2 = throttle(pass2_items.into_iter(), max_open);
|
let throttled_pass2 = throttle(pass2_items.into_iter(), max_open);
|
||||||
|
|
||||||
let pipeline2 = Pipeline::new(
|
let pipeline2 = Pipeline::new(
|
||||||
make_source!(Pass2Data, throttled_pass2.map(|t| {
|
make_source!(
|
||||||
let (col_offset, src_n, src_layer_dir) = t.item;
|
Pass2Data,
|
||||||
(col_offset, src_n, src_layer_dir, t.guard)
|
throttled_pass2.map(|t| {
|
||||||
}), SrcLayer),
|
let (col_offset, src_n, src_layer_dir) = t.item;
|
||||||
|
(col_offset, src_n, src_layer_dir, t.guard)
|
||||||
|
}),
|
||||||
|
SrcLayer
|
||||||
|
),
|
||||||
vec![
|
vec![
|
||||||
Stage::Flat(Arc::new(
|
Stage::Flat(Arc::new(
|
||||||
move |data: Pass2Data,
|
move |data: Pass2Data,
|
||||||
push: &PipelineSender<Result<Pass2Data, PipelineError>>,
|
push: &PipelineSender<Result<Pass2Data, PipelineError>>,
|
||||||
delta: &PipelineSender<isize>|
|
delta: &PipelineSender<isize>| {
|
||||||
{
|
if let Pass2Data::SrcLayer((col_offset, src_n, src_layer_dir, _guard)) =
|
||||||
if let Pass2Data::SrcLayer((col_offset, src_n, src_layer_dir, _guard)) = data {
|
data
|
||||||
|
{
|
||||||
// _guard dropped at end of block, releasing the slot.
|
// _guard dropped at end of block, releasing the slot.
|
||||||
let reader = match UnitigFileReader::open_sequential(
|
let reader = match UnitigFileReader::open_sequential(
|
||||||
&src_layer_dir.join("unitigs.bin"),
|
&src_layer_dir.join("unitigs.bin"),
|
||||||
) {
|
) {
|
||||||
Ok(r) => r,
|
Ok(r) => r,
|
||||||
Err(e) => {
|
Err(e) => {
|
||||||
*err_cap2.lock().unwrap() = Some(e.to_string());
|
*err_cap2.lock().unwrap() = Some(e.to_string());
|
||||||
delta.send(-1).ok();
|
delta.send(-1).ok();
|
||||||
@@ -427,7 +458,7 @@ impl KmerPartition {
|
|||||||
}
|
}
|
||||||
};
|
};
|
||||||
let src_data = match SrcLayerData::open(&src_layer_dir, mode) {
|
let src_data = match SrcLayerData::open(&src_layer_dir, mode) {
|
||||||
Ok(d) => Arc::new(d),
|
Ok(d) => Arc::new(d),
|
||||||
Err(e) => {
|
Err(e) => {
|
||||||
*err_cap2.lock().unwrap() = Some(e.to_string());
|
*err_cap2.lock().unwrap() = Some(e.to_string());
|
||||||
delta.send(-1).ok();
|
delta.send(-1).ok();
|
||||||
@@ -440,66 +471,91 @@ impl KmerPartition {
|
|||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
batch.push(kmer);
|
batch.push(kmer);
|
||||||
if batch.len() == BATCH {
|
if batch.len() == BATCH {
|
||||||
let b = std::mem::replace(&mut batch, Vec::with_capacity(BATCH));
|
let b =
|
||||||
|
std::mem::replace(&mut batch, Vec::with_capacity(BATCH));
|
||||||
push.send(Ok(Pass2Data::RawBatch((
|
push.send(Ok(Pass2Data::RawBatch((
|
||||||
col_offset, src_n, Arc::clone(&src_data), b,
|
col_offset,
|
||||||
)))).ok();
|
src_n,
|
||||||
|
Arc::clone(&src_data),
|
||||||
|
b,
|
||||||
|
))))
|
||||||
|
.ok();
|
||||||
count += 1;
|
count += 1;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
if !batch.is_empty() {
|
if !batch.is_empty() {
|
||||||
push.send(Ok(Pass2Data::RawBatch((
|
push.send(Ok(Pass2Data::RawBatch((
|
||||||
col_offset, src_n, src_data, batch,
|
col_offset, src_n, src_data, batch,
|
||||||
)))).ok();
|
))))
|
||||||
|
.ok();
|
||||||
count += 1;
|
count += 1;
|
||||||
}
|
}
|
||||||
delta.send(count - 1).ok();
|
delta.send(count - 1).ok();
|
||||||
}
|
}
|
||||||
}
|
},
|
||||||
) as SharedFlatFn<Pass2Data>),
|
) as SharedFlatFn<Pass2Data>),
|
||||||
make_transform!(Pass2Data, {
|
make_transform!(
|
||||||
move |(col_offset, src_n, src_data, kmers): (usize, usize, Arc<SrcLayerData>, Vec<CanonicalKmer>)|
|
Pass2Data,
|
||||||
-> Vec<(Option<usize>, usize, usize, u32)>
|
|
||||||
{
|
{
|
||||||
let mut ops: Vec<(Option<usize>, usize, usize, u32)> = Vec::new();
|
move |(col_offset, src_n, src_data, kmers): (
|
||||||
for kmer in kmers {
|
usize,
|
||||||
let values = src_data.lookup(kmer, src_n);
|
usize,
|
||||||
if let Some((dst_layer, hit)) = dst_map_t2.query(kmer) {
|
Arc<SrcLayerData>,
|
||||||
for (g, val) in values.into_iter().enumerate() {
|
Vec<CanonicalKmer>,
|
||||||
ops.push((Some(dst_layer), col_offset + g, hit.slot, val));
|
)|
|
||||||
}
|
-> Vec<(Option<usize>, usize, usize, u32)> {
|
||||||
} else if let Some(ref mphf) = new_mphf_t2 {
|
let mut ops: Vec<(Option<usize>, usize, usize, u32)> = Vec::new();
|
||||||
let slot = mphf.index(kmer);
|
for kmer in kmers {
|
||||||
for (g, val) in values.into_iter().enumerate() {
|
let values = src_data.lookup(kmer, src_n);
|
||||||
ops.push((None, col_offset + g, slot, val));
|
if let Some((dst_layer, hit)) = dst_map_t2.query(kmer) {
|
||||||
|
for (g, val) in values.into_iter().enumerate() {
|
||||||
|
ops.push((Some(dst_layer), col_offset + g, hit.slot, val));
|
||||||
|
}
|
||||||
|
} else if let Some(ref mphf) = new_mphf_t2 {
|
||||||
|
let slot = mphf.index(kmer);
|
||||||
|
for (g, val) in values.into_iter().enumerate() {
|
||||||
|
ops.push((None, col_offset + g, slot, val));
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
ops
|
||||||
}
|
}
|
||||||
ops
|
},
|
||||||
}
|
RawBatch,
|
||||||
}, RawBatch, WriteBatch),
|
WriteBatch
|
||||||
|
),
|
||||||
],
|
],
|
||||||
make_sink!(Pass2Data, {
|
make_sink!(
|
||||||
move |ops: Vec<(Option<usize>, usize, usize, u32)>| {
|
Pass2Data,
|
||||||
for (layer_opt, col, slot, val) in ops {
|
{
|
||||||
match layer_opt {
|
move |ops: Vec<(Option<usize>, usize, usize, u32)>| {
|
||||||
Some(l) => exist_sink[l][col].lock().unwrap().set_val(slot, val),
|
for (layer_opt, col, slot, val) in ops {
|
||||||
None => new_sink[col].lock().unwrap().set_val(slot, val),
|
match layer_opt {
|
||||||
|
Some(l) => exist_sink[l][col].lock().unwrap().set_val(slot, val),
|
||||||
|
None => new_sink[col].lock().unwrap().set_val(slot, val),
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
},
|
||||||
}, WriteBatch),
|
WriteBatch
|
||||||
|
),
|
||||||
);
|
);
|
||||||
|
|
||||||
WorkerPool::new(pipeline2, n_workers, capacity).run();
|
WorkerPool::new(pipeline2, n_workers, capacity).run();
|
||||||
debug!("partition {i}: pass2 pipeline done in {:.3}s", t_pass2.elapsed().as_secs_f64());
|
debug!(
|
||||||
|
"partition {i}: pass2 pipeline done in {:.3}s",
|
||||||
|
t_pass2.elapsed().as_secs_f64()
|
||||||
|
);
|
||||||
|
|
||||||
if let Some(msg) = Arc::try_unwrap(pass2_err)
|
if let Some(msg) = Arc::try_unwrap(pass2_err)
|
||||||
.unwrap_or_else(|_| panic!("pass2: pass2_err not uniquely owned"))
|
.unwrap_or_else(|_| panic!("pass2: pass2_err not uniquely owned"))
|
||||||
.into_inner()
|
.into_inner()
|
||||||
.unwrap_or_else(|e| e.into_inner())
|
.unwrap_or_else(|e| e.into_inner())
|
||||||
{
|
{
|
||||||
return Err(SKError::InvalidData { context: "merge pass2", detail: msg });
|
return Err(SKError::InvalidData {
|
||||||
|
context: "merge pass2",
|
||||||
|
detail: msg,
|
||||||
|
});
|
||||||
}
|
}
|
||||||
|
|
||||||
let t_close = std::time::Instant::now();
|
let t_close = std::time::Instant::now();
|
||||||
@@ -527,10 +583,15 @@ impl KmerPartition {
|
|||||||
|
|
||||||
let mut part_meta = self.partition_meta(i)?;
|
let mut part_meta = self.partition_meta(i)?;
|
||||||
part_meta.n_layers = new_layer_idx + 1;
|
part_meta.n_layers = new_layer_idx + 1;
|
||||||
part_meta.save(&dst_index_dir).map_err(|e| olm_to_sk(e, "merge"))?;
|
part_meta
|
||||||
|
.save(&dst_index_dir)
|
||||||
|
.map_err(|e| olm_to_sk(e, "merge"))?;
|
||||||
}
|
}
|
||||||
|
|
||||||
debug!("partition {i}: builders closed in {:.3}s", t_close.elapsed().as_secs_f64());
|
debug!(
|
||||||
|
"partition {i}: builders closed in {:.3}s",
|
||||||
|
t_close.elapsed().as_secs_f64()
|
||||||
|
);
|
||||||
|
|
||||||
Ok(n_new)
|
Ok(n_new)
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -7,9 +7,9 @@ use std::time::Instant;
|
|||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikseq::RoutableSuperKmer;
|
use obikseq::RoutableSuperKmer;
|
||||||
use obiskio::SKResult;
|
|
||||||
use obilayeredmap::IndexMode;
|
use obilayeredmap::IndexMode;
|
||||||
use obilayeredmap::meta::PartitionMeta;
|
use obilayeredmap::meta::PartitionMeta;
|
||||||
|
use obiskio::SKResult;
|
||||||
use rayon::prelude::*;
|
use rayon::prelude::*;
|
||||||
use remove_dir_all::remove_dir_all;
|
use remove_dir_all::remove_dir_all;
|
||||||
use sysinfo::System;
|
use sysinfo::System;
|
||||||
@@ -33,12 +33,12 @@ use super::{PARTITIONS_SUBDIR, SK_EXT};
|
|||||||
const INDEX_SUBDIR: &str = "index";
|
const INDEX_SUBDIR: &str = "index";
|
||||||
|
|
||||||
pub struct KmerSpectrum {
|
pub struct KmerSpectrum {
|
||||||
pub f0: u64,
|
pub f0: u64,
|
||||||
pub f1: u64,
|
pub f1: u64,
|
||||||
pub counts: BTreeMap<u32, u64>,
|
pub counts: BTreeMap<u32, u64>,
|
||||||
}
|
}
|
||||||
|
|
||||||
pub struct KmerPartition {
|
pub struct KmerPartitions {
|
||||||
root_path: PathBuf,
|
root_path: PathBuf,
|
||||||
n_partitions: usize,
|
n_partitions: usize,
|
||||||
partitions_mask: u64,
|
partitions_mask: u64,
|
||||||
@@ -49,7 +49,7 @@ pub struct KmerPartition {
|
|||||||
closed: bool,
|
closed: bool,
|
||||||
}
|
}
|
||||||
|
|
||||||
impl KmerPartition {
|
impl KmerPartitions {
|
||||||
pub fn create<P: AsRef<Path>>(
|
pub fn create<P: AsRef<Path>>(
|
||||||
path: P,
|
path: P,
|
||||||
n_bits: usize,
|
n_bits: usize,
|
||||||
@@ -179,7 +179,9 @@ impl KmerPartition {
|
|||||||
|
|
||||||
/// Path of partition `i` directory.
|
/// Path of partition `i` directory.
|
||||||
pub fn partition_dir(&self, i: usize) -> PathBuf {
|
pub fn partition_dir(&self, i: usize) -> PathBuf {
|
||||||
self.root_path.join(PARTITIONS_SUBDIR).join(format!("part_{i:05}"))
|
self.root_path
|
||||||
|
.join(PARTITIONS_SUBDIR)
|
||||||
|
.join(format!("part_{i:05}"))
|
||||||
}
|
}
|
||||||
|
|
||||||
/// Path of partition `i`'s layered-index directory (`<partition>/index`).
|
/// Path of partition `i`'s layered-index directory (`<partition>/index`).
|
||||||
@@ -380,7 +382,7 @@ impl KmerPartition {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
impl Drop for KmerPartition {
|
impl Drop for KmerPartitions {
|
||||||
fn drop(&mut self) {
|
fn drop(&mut self) {
|
||||||
let _ = self.close();
|
let _ = self.close();
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -13,7 +13,7 @@ mod kmer_partition;
|
|||||||
#[cfg(test)]
|
#[cfg(test)]
|
||||||
mod tests;
|
mod tests;
|
||||||
|
|
||||||
pub use kmer_partition::{KmerPartition, KmerSpectrum};
|
pub use kmer_partition::{KmerPartitions, KmerSpectrum};
|
||||||
|
|
||||||
const SK_EXT: &str = "skmer.zst";
|
const SK_EXT: &str = "skmer.zst";
|
||||||
pub const PARTITIONS_SUBDIR: &str = "partitions";
|
pub const PARTITIONS_SUBDIR: &str = "partitions";
|
||||||
@@ -6,7 +6,7 @@ use obikseq::SuperKmer;
|
|||||||
use obiskbuilder::build_superkmers;
|
use obiskbuilder::build_superkmers;
|
||||||
|
|
||||||
use super::count::count_partition;
|
use super::count::count_partition;
|
||||||
use super::{KmerPartition, PARTITIONS_SUBDIR};
|
use super::{KmerPartitions, PARTITIONS_SUBDIR};
|
||||||
|
|
||||||
const K: usize = 11;
|
const K: usize = 11;
|
||||||
const M: usize = 5;
|
const M: usize = 5;
|
||||||
@@ -46,7 +46,7 @@ fn pipeline_counts(seqs: &[&[u8]]) -> (u64, u64) {
|
|||||||
let superkmers: Vec<_> = build_superkmers(rope, K, 1, 0.0);
|
let superkmers: Vec<_> = build_superkmers(rope, K, 1, 0.0);
|
||||||
|
|
||||||
let dir = tempfile::tempdir().unwrap();
|
let dir = tempfile::tempdir().unwrap();
|
||||||
let mut kp = KmerPartition::create(dir.path(), 0, K, M, true).unwrap();
|
let mut kp = KmerPartitions::create(dir.path(), 0, K, M, true).unwrap();
|
||||||
kp.write_batch(superkmers).unwrap();
|
kp.write_batch(superkmers).unwrap();
|
||||||
kp.close().unwrap();
|
kp.close().unwrap();
|
||||||
kp.dereplicate().unwrap();
|
kp.dereplicate().unwrap();
|
||||||
@@ -58,9 +58,9 @@ fn pipeline_counts(seqs: &[&[u8]]) -> (u64, u64) {
|
|||||||
}
|
}
|
||||||
count_partition(&part_dir, &dedup_path, 1 << 20).unwrap();
|
count_partition(&part_dir, &dedup_path, 1 << 20).unwrap();
|
||||||
|
|
||||||
let spec: serde_json::Value = serde_json::from_reader(
|
let spec: serde_json::Value =
|
||||||
fs::File::open(part_dir.join("kmer_spectrum_raw.json")).unwrap(),
|
serde_json::from_reader(fs::File::open(part_dir.join("kmer_spectrum_raw.json")).unwrap())
|
||||||
).unwrap();
|
.unwrap();
|
||||||
let f0 = spec["f0"].as_u64().unwrap_or(0);
|
let f0 = spec["f0"].as_u64().unwrap_or(0);
|
||||||
let f1 = spec["f1"].as_u64().unwrap_or(0);
|
let f1 = spec["f1"].as_u64().unwrap_or(0);
|
||||||
(f0, f1)
|
(f0, f1)
|
||||||
@@ -77,10 +77,7 @@ fn single_sequence_f0_f1_match() {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn two_sequences_f0_f1_match() {
|
fn two_sequences_f0_f1_match() {
|
||||||
let seqs: &[&[u8]] = &[
|
let seqs: &[&[u8]] = &[b"ACGTACGTACGTACGTACGT", b"TGCATGCATGCATGCATGCA"];
|
||||||
b"ACGTACGTACGTACGTACGT",
|
|
||||||
b"TGCATGCATGCATGCATGCA",
|
|
||||||
];
|
|
||||||
let (ef0, ef1) = direct_counts(seqs);
|
let (ef0, ef1) = direct_counts(seqs);
|
||||||
let (gf0, gf1) = pipeline_counts(seqs);
|
let (gf0, gf1) = pipeline_counts(seqs);
|
||||||
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
|
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
|
||||||
@@ -103,7 +100,11 @@ fn many_sequences_f0_f1_match() {
|
|||||||
// multiple minimizer boundaries per sequence.
|
// multiple minimizer boundaries per sequence.
|
||||||
let bases = b"ACGT";
|
let bases = b"ACGT";
|
||||||
let seqs: Vec<Vec<u8>> = (0..20u32)
|
let seqs: Vec<Vec<u8>> = (0..20u32)
|
||||||
.map(|i| (0..40).map(|j| bases[((i * 7 + j * 3) % 4) as usize]).collect())
|
.map(|i| {
|
||||||
|
(0..40)
|
||||||
|
.map(|j| bases[((i * 7 + j * 3) % 4) as usize])
|
||||||
|
.collect()
|
||||||
|
})
|
||||||
.collect();
|
.collect();
|
||||||
let seq_refs: Vec<&[u8]> = seqs.iter().map(|v| v.as_slice()).collect();
|
let seq_refs: Vec<&[u8]> = seqs.iter().map(|v| v.as_slice()).collect();
|
||||||
let (ef0, ef1) = direct_counts(&seq_refs);
|
let (ef0, ef1) = direct_counts(&seq_refs);
|
||||||
|
|||||||
@@ -3,15 +3,18 @@ use std::path::Path;
|
|||||||
|
|
||||||
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
|
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
|
||||||
use obikseq::CanonicalKmer;
|
use obikseq::CanonicalKmer;
|
||||||
use obiskio::{SKError, SKResult};
|
|
||||||
use obilayeredmap::{IndexMode, MphfLayer, OLMError};
|
use obilayeredmap::{IndexMode, MphfLayer, OLMError};
|
||||||
|
use obiskio::{SKError, SKResult};
|
||||||
|
|
||||||
use crate::partition::KmerPartition;
|
use crate::partition::KmerPartitions;
|
||||||
|
|
||||||
fn olm_to_sk(e: OLMError) -> SKError {
|
fn olm_to_sk(e: OLMError) -> SKError {
|
||||||
match e {
|
match e {
|
||||||
OLMError::Io(io_err) => SKError::Io(io_err),
|
OLMError::Io(io_err) => SKError::Io(io_err),
|
||||||
other => SKError::InvalidData { context: "query", detail: other.to_string() },
|
other => SKError::InvalidData {
|
||||||
|
context: "query",
|
||||||
|
detail: other.to_string(),
|
||||||
|
},
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -24,8 +27,8 @@ enum QueryLayer {
|
|||||||
|
|
||||||
impl QueryLayer {
|
impl QueryLayer {
|
||||||
fn open(layer_dir: &Path, with_counts: bool, mode: &IndexMode) -> SKResult<Self> {
|
fn open(layer_dir: &Path, with_counts: bool, mode: &IndexMode) -> SKResult<Self> {
|
||||||
let mphf = MphfLayer::open(layer_dir, mode).map_err(olm_to_sk)?;
|
let mphf = MphfLayer::open(layer_dir, mode).map_err(olm_to_sk)?;
|
||||||
let counts_dir = layer_dir.join("counts");
|
let counts_dir = layer_dir.join("counts");
|
||||||
let presence_dir = layer_dir.join("presence");
|
let presence_dir = layer_dir.join("presence");
|
||||||
|
|
||||||
if with_counts && counts_dir.exists() {
|
if with_counts && counts_dir.exists() {
|
||||||
@@ -70,7 +73,10 @@ impl QueryLayer {
|
|||||||
/// slot)` `col_value` point lookup, which this layer's `Sparse`
|
/// slot)` `col_value` point lookup, which this layer's `Sparse`
|
||||||
/// presence matrices paid for badly: each such lookup rebuilt the
|
/// presence matrices paid for badly: each such lookup rebuilt the
|
||||||
/// entire row just to return one cell.
|
/// entire row just to return one cell.
|
||||||
fn nonzero_iter<'a>(&'a self, slots: &'a [usize]) -> Box<dyn Iterator<Item = (usize, usize, u32)> + 'a> {
|
fn nonzero_iter<'a>(
|
||||||
|
&'a self,
|
||||||
|
slots: &'a [usize],
|
||||||
|
) -> Box<dyn Iterator<Item = (usize, usize, u32)> + 'a> {
|
||||||
match self {
|
match self {
|
||||||
QueryLayer::Presence(_, mat) => mat.nonzero_iter(slots),
|
QueryLayer::Presence(_, mat) => mat.nonzero_iter(slots),
|
||||||
QueryLayer::Count(_, mat) => Box::new(mat.nonzero_iter(slots)),
|
QueryLayer::Count(_, mat) => Box::new(mat.nonzero_iter(slots)),
|
||||||
@@ -137,7 +143,7 @@ pub enum QueryHit<'a> {
|
|||||||
|
|
||||||
// ── KmerPartition::query_partition_with ──────────────────────────────────────
|
// ── KmerPartition::query_partition_with ──────────────────────────────────────
|
||||||
|
|
||||||
impl KmerPartition {
|
impl KmerPartitions {
|
||||||
/// Query a single partition for a pre-deduplicated map of canonical
|
/// Query a single partition for a pre-deduplicated map of canonical
|
||||||
/// k-mers → their occurrences (`seq_idx`, `pos`) in the query batch.
|
/// k-mers → their occurrences (`seq_idx`, `pos`) in the query batch.
|
||||||
///
|
///
|
||||||
|
|||||||
@@ -1,27 +1,29 @@
|
|||||||
use std::path::Path;
|
use std::path::Path;
|
||||||
|
|
||||||
use obicompactvec::{
|
use obicompactvec::{
|
||||||
FilterMask, eval_filter_mask,
|
FilterMask, PersistentBitMatrixBuilder, PersistentBitVecBuilder,
|
||||||
PersistentBitMatrixBuilder, PersistentBitVecBuilder,
|
PersistentCompactIntMatrixBuilder, PersistentCompactIntVecBuilder, eval_filter_mask,
|
||||||
PersistentCompactIntMatrixBuilder, PersistentCompactIntVecBuilder,
|
|
||||||
};
|
};
|
||||||
use obidebruinj::GraphDeBruijn;
|
use obidebruinj::GraphDeBruijn;
|
||||||
use obikseq::CanonicalKmer;
|
use obikseq::CanonicalKmer;
|
||||||
use obilayeredmap::meta::PartitionMeta;
|
use obilayeredmap::meta::PartitionMeta;
|
||||||
use obilayeredmap::{layer_dir, IndexMode, MphfLayer};
|
use obilayeredmap::{IndexMode, MphfLayer, layer_dir};
|
||||||
use obiskio::{SKError, SKResult, UnitigFileReader};
|
use obiskio::{SKError, SKResult, UnitigFileReader};
|
||||||
|
|
||||||
use crate::common::{load_meta, olm_to_sk};
|
use crate::common::{load_meta, olm_to_sk};
|
||||||
use crate::filter::KmerFilter;
|
use crate::filter::KmerFilter;
|
||||||
use crate::graph_pipeline::materialize_layer;
|
use crate::graph_pipeline::materialize_layer;
|
||||||
use crate::merge_layer::{MergeMode, SrcLayerData};
|
use crate::merge_layer::{MergeMode, SrcLayerData};
|
||||||
use crate::partition::KmerPartition;
|
use crate::partition::KmerPartitions;
|
||||||
|
|
||||||
// ── Builders — pair matrix builder + column builders for one mode ─────────────
|
// ── Builders — pair matrix builder + column builders for one mode ─────────────
|
||||||
|
|
||||||
enum Builders {
|
enum Builders {
|
||||||
Presence(PersistentBitMatrixBuilder, Vec<PersistentBitVecBuilder>),
|
Presence(PersistentBitMatrixBuilder, Vec<PersistentBitVecBuilder>),
|
||||||
Count(PersistentCompactIntMatrixBuilder, Vec<PersistentCompactIntVecBuilder>),
|
Count(
|
||||||
|
PersistentCompactIntMatrixBuilder,
|
||||||
|
Vec<PersistentCompactIntVecBuilder>,
|
||||||
|
),
|
||||||
}
|
}
|
||||||
|
|
||||||
impl Builders {
|
impl Builders {
|
||||||
@@ -30,13 +32,18 @@ impl Builders {
|
|||||||
MergeMode::Presence => {
|
MergeMode::Presence => {
|
||||||
let mut mat = PersistentBitMatrixBuilder::new(n, dir).map_err(SKError::Io)?;
|
let mut mat = PersistentBitMatrixBuilder::new(n, dir).map_err(SKError::Io)?;
|
||||||
let mut cols = Vec::with_capacity(n_genomes);
|
let mut cols = Vec::with_capacity(n_genomes);
|
||||||
for _ in 0..n_genomes { cols.push(mat.add_col().map_err(SKError::Io)?); }
|
for _ in 0..n_genomes {
|
||||||
|
cols.push(mat.add_col().map_err(SKError::Io)?);
|
||||||
|
}
|
||||||
Ok(Builders::Presence(mat, cols))
|
Ok(Builders::Presence(mat, cols))
|
||||||
}
|
}
|
||||||
MergeMode::Count => {
|
MergeMode::Count => {
|
||||||
let mut mat = PersistentCompactIntMatrixBuilder::new(n, dir).map_err(SKError::Io)?;
|
let mut mat =
|
||||||
|
PersistentCompactIntMatrixBuilder::new(n, dir).map_err(SKError::Io)?;
|
||||||
let mut cols = Vec::with_capacity(n_genomes);
|
let mut cols = Vec::with_capacity(n_genomes);
|
||||||
for _ in 0..n_genomes { cols.push(mat.add_col().map_err(SKError::Io)?); }
|
for _ in 0..n_genomes {
|
||||||
|
cols.push(mat.add_col().map_err(SKError::Io)?);
|
||||||
|
}
|
||||||
Ok(Builders::Count(mat, cols))
|
Ok(Builders::Count(mat, cols))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -45,18 +52,22 @@ impl Builders {
|
|||||||
fn set_val(&mut self, col: usize, slot: usize, value: u32) {
|
fn set_val(&mut self, col: usize, slot: usize, value: u32) {
|
||||||
match self {
|
match self {
|
||||||
Builders::Presence(_, cols) => cols[col].set(slot, value > 0),
|
Builders::Presence(_, cols) => cols[col].set(slot, value > 0),
|
||||||
Builders::Count(_, cols) => cols[col].set(slot, value),
|
Builders::Count(_, cols) => cols[col].set(slot, value),
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
fn close(self) -> SKResult<()> {
|
fn close(self) -> SKResult<()> {
|
||||||
match self {
|
match self {
|
||||||
Builders::Presence(mat, cols) => {
|
Builders::Presence(mat, cols) => {
|
||||||
for b in cols { b.close().map_err(SKError::Io)?; }
|
for b in cols {
|
||||||
|
b.close().map_err(SKError::Io)?;
|
||||||
|
}
|
||||||
mat.close().map_err(SKError::Io)
|
mat.close().map_err(SKError::Io)
|
||||||
}
|
}
|
||||||
Builders::Count(mat, cols) => {
|
Builders::Count(mat, cols) => {
|
||||||
for b in cols { b.close().map_err(SKError::Io)?; }
|
for b in cols {
|
||||||
|
b.close().map_err(SKError::Io)?;
|
||||||
|
}
|
||||||
mat.close().map_err(SKError::Io)
|
mat.close().map_err(SKError::Io)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -112,7 +123,9 @@ fn iter_src_kmers_masked(
|
|||||||
for l in 0..src_meta.n_layers {
|
for l in 0..src_meta.n_layers {
|
||||||
let src_layer_dir = layer_dir(src_index_dir, l);
|
let src_layer_dir = layer_dir(src_index_dir, l);
|
||||||
let unitigs_path = src_layer_dir.join("unitigs.bin");
|
let unitigs_path = src_layer_dir.join("unitigs.bin");
|
||||||
if !unitigs_path.exists() { continue; }
|
if !unitigs_path.exists() {
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
|
||||||
let src_data = SrcLayerData::open(&src_layer_dir, mode)?;
|
let src_data = SrcLayerData::open(&src_layer_dir, mode)?;
|
||||||
let mask = try_compute_combined_mask(filters, &src_data, n_genomes)?;
|
let mask = try_compute_combined_mask(filters, &src_data, n_genomes)?;
|
||||||
@@ -127,7 +140,9 @@ fn iter_src_kmers_masked(
|
|||||||
filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
|
filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
|
||||||
}
|
}
|
||||||
};
|
};
|
||||||
if passes { cb(kmer); }
|
if passes {
|
||||||
|
cb(kmer);
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
Ok(())
|
Ok(())
|
||||||
@@ -149,7 +164,9 @@ fn iter_src_layers(
|
|||||||
for l in 0..src_meta.n_layers {
|
for l in 0..src_meta.n_layers {
|
||||||
let src_layer_dir = layer_dir(src_index_dir, l);
|
let src_layer_dir = layer_dir(src_index_dir, l);
|
||||||
let unitigs_path = src_layer_dir.join("unitigs.bin");
|
let unitigs_path = src_layer_dir.join("unitigs.bin");
|
||||||
if !unitigs_path.exists() { continue; }
|
if !unitigs_path.exists() {
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
|
||||||
let src_data = SrcLayerData::open(&src_layer_dir, mode)?;
|
let src_data = SrcLayerData::open(&src_layer_dir, mode)?;
|
||||||
let mask = try_compute_combined_mask(filters, &src_data, n_genomes)?;
|
let mask = try_compute_combined_mask(filters, &src_data, n_genomes)?;
|
||||||
@@ -158,7 +175,9 @@ fn iter_src_layers(
|
|||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
let slot = src_data.slot(kmer);
|
let slot = src_data.slot(kmer);
|
||||||
if let Some(ref m) = mask {
|
if let Some(ref m) = mask {
|
||||||
if !m.get(slot) { continue; }
|
if !m.get(slot) {
|
||||||
|
continue;
|
||||||
|
}
|
||||||
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
||||||
cb(kmer, row.into_boxed_slice());
|
cb(kmer, row.into_boxed_slice());
|
||||||
} else {
|
} else {
|
||||||
@@ -174,7 +193,7 @@ fn iter_src_layers(
|
|||||||
|
|
||||||
// ── KmerPartition::rebuild_partition ─────────────────────────────────────────
|
// ── KmerPartition::rebuild_partition ─────────────────────────────────────────
|
||||||
|
|
||||||
impl KmerPartition {
|
impl KmerPartitions {
|
||||||
/// Rebuild partition `i` from `src` into `self` (an empty destination partition).
|
/// Rebuild partition `i` from `src` into `self` (an empty destination partition).
|
||||||
///
|
///
|
||||||
/// Only k-mers whose per-genome row passes all `filters` are written.
|
/// Only k-mers whose per-genome row passes all `filters` are written.
|
||||||
@@ -184,7 +203,7 @@ impl KmerPartition {
|
|||||||
/// `n_genomes` is the number of genome columns in the source (and destination).
|
/// `n_genomes` is the number of genome columns in the source (and destination).
|
||||||
pub fn rebuild_partition(
|
pub fn rebuild_partition(
|
||||||
&self,
|
&self,
|
||||||
src: &KmerPartition,
|
src: &KmerPartitions,
|
||||||
i: usize,
|
i: usize,
|
||||||
filters: &[Box<dyn KmerFilter>],
|
filters: &[Box<dyn KmerFilter>],
|
||||||
mode: MergeMode,
|
mode: MergeMode,
|
||||||
@@ -222,7 +241,7 @@ impl KmerPartition {
|
|||||||
// ── Prepare matrix builders (one column per genome) ───────────────────
|
// ── Prepare matrix builders (one column per genome) ───────────────────
|
||||||
let data_dir = match mode {
|
let data_dir = match mode {
|
||||||
MergeMode::Presence => dst_layer_dir.join("presence"),
|
MergeMode::Presence => dst_layer_dir.join("presence"),
|
||||||
MergeMode::Count => dst_layer_dir.join("counts"),
|
MergeMode::Count => dst_layer_dir.join("counts"),
|
||||||
};
|
};
|
||||||
std::fs::create_dir_all(&data_dir)?;
|
std::fs::create_dir_all(&data_dir)?;
|
||||||
let mut builders = Builders::new(mode, n_new, &data_dir, n_genomes)?;
|
let mut builders = Builders::new(mode, n_new, &data_dir, n_genomes)?;
|
||||||
|
|||||||
@@ -3,14 +3,13 @@ use std::io;
|
|||||||
use std::path::{Path, PathBuf};
|
use std::path::{Path, PathBuf};
|
||||||
|
|
||||||
use obicompactvec::{
|
use obicompactvec::{
|
||||||
ColGroup, MatrixGroupOps,
|
ColGroup, MatrixGroupOps, PersistentBitMatrix, PersistentBitMatrixBuilder,
|
||||||
PersistentBitMatrix, PersistentBitMatrixBuilder,
|
|
||||||
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
|
||||||
};
|
};
|
||||||
use obilayeredmap::OLMError;
|
use obilayeredmap::OLMError;
|
||||||
use obiskio::{SKError, SKResult};
|
use obiskio::{SKError, SKResult};
|
||||||
|
|
||||||
use crate::partition::KmerPartition;
|
use crate::partition::KmerPartitions;
|
||||||
|
|
||||||
// ── AggOp ─────────────────────────────────────────────────────────────────────
|
// ── AggOp ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -33,9 +32,9 @@ impl AggOp {
|
|||||||
// ── OutputCol ─────────────────────────────────────────────────────────────────
|
// ── OutputCol ─────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
pub struct OutputCol {
|
pub struct OutputCol {
|
||||||
pub label: String,
|
pub label: String,
|
||||||
pub indices: Vec<usize>,
|
pub indices: Vec<usize>,
|
||||||
pub op: AggOp,
|
pub op: AggOp,
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Helpers ───────────────────────────────────────────────────────────────────
|
// ── Helpers ───────────────────────────────────────────────────────────────────
|
||||||
@@ -43,7 +42,10 @@ pub struct OutputCol {
|
|||||||
fn olm_to_sk(e: OLMError) -> SKError {
|
fn olm_to_sk(e: OLMError) -> SKError {
|
||||||
match e {
|
match e {
|
||||||
OLMError::Io(e) => SKError::Io(e),
|
OLMError::Io(e) => SKError::Io(e),
|
||||||
other => SKError::InvalidData { context: "select", detail: other.to_string() },
|
other => SKError::InvalidData {
|
||||||
|
context: "select",
|
||||||
|
detail: other.to_string(),
|
||||||
|
},
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -77,23 +79,43 @@ fn fill_builders(
|
|||||||
if output_presence {
|
if output_presence {
|
||||||
let b = dst_bit.as_deref_mut().unwrap();
|
let b = dst_bit.as_deref_mut().unwrap();
|
||||||
match spec.op {
|
match spec.op {
|
||||||
AggOp::Any => b.add_col_from (&mat.partial_group_any (&g, threshold).map_err(SKError::Io)?),
|
AggOp::Any => {
|
||||||
AggOp::All => b.add_col_from (&mat.partial_group_all (&g, threshold).map_err(SKError::Io)?),
|
b.add_col_from(&mat.partial_group_any(&g, threshold).map_err(SKError::Io)?)
|
||||||
AggOp::None => b.add_col_from (&mat.partial_group_none(&g, threshold).map_err(SKError::Io)?),
|
}
|
||||||
AggOp::Sum => b.add_col_from_int(&mat.partial_group_sum (&g).map_err(SKError::Io)?),
|
AggOp::All => {
|
||||||
AggOp::Min => b.add_col_from_int(&mat.partial_group_min (&g).map_err(SKError::Io)?),
|
b.add_col_from(&mat.partial_group_all(&g, threshold).map_err(SKError::Io)?)
|
||||||
AggOp::Max => b.add_col_from_int(&mat.partial_group_max (&g).map_err(SKError::Io)?),
|
}
|
||||||
}.map_err(SKError::Io)?;
|
AggOp::None => {
|
||||||
|
b.add_col_from(&mat.partial_group_none(&g, threshold).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
AggOp::Sum => {
|
||||||
|
b.add_col_from_int(&mat.partial_group_sum(&g).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
AggOp::Min => {
|
||||||
|
b.add_col_from_int(&mat.partial_group_min(&g).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
AggOp::Max => {
|
||||||
|
b.add_col_from_int(&mat.partial_group_max(&g).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
.map_err(SKError::Io)?;
|
||||||
} else {
|
} else {
|
||||||
let b = dst_int.as_deref_mut().unwrap();
|
let b = dst_int.as_deref_mut().unwrap();
|
||||||
match spec.op {
|
match spec.op {
|
||||||
AggOp::Sum => b.add_col_from (&mat.partial_group_sum (&g).map_err(SKError::Io)?),
|
AggOp::Sum => b.add_col_from(&mat.partial_group_sum(&g).map_err(SKError::Io)?),
|
||||||
AggOp::Min => b.add_col_from (&mat.partial_group_min (&g).map_err(SKError::Io)?),
|
AggOp::Min => b.add_col_from(&mat.partial_group_min(&g).map_err(SKError::Io)?),
|
||||||
AggOp::Max => b.add_col_from (&mat.partial_group_max (&g).map_err(SKError::Io)?),
|
AggOp::Max => b.add_col_from(&mat.partial_group_max(&g).map_err(SKError::Io)?),
|
||||||
AggOp::Any => b.add_col_from_bit(&mat.partial_group_any (&g, threshold).map_err(SKError::Io)?),
|
AggOp::Any => b.add_col_from_bit(
|
||||||
AggOp::All => b.add_col_from_bit(&mat.partial_group_all (&g, threshold).map_err(SKError::Io)?),
|
&mat.partial_group_any(&g, threshold).map_err(SKError::Io)?,
|
||||||
AggOp::None => b.add_col_from_bit(&mat.partial_group_none(&g, threshold).map_err(SKError::Io)?),
|
),
|
||||||
}.map_err(SKError::Io)?;
|
AggOp::All => b.add_col_from_bit(
|
||||||
|
&mat.partial_group_all(&g, threshold).map_err(SKError::Io)?,
|
||||||
|
),
|
||||||
|
AggOp::None => b.add_col_from_bit(
|
||||||
|
&mat.partial_group_none(&g, threshold).map_err(SKError::Io)?,
|
||||||
|
),
|
||||||
|
}
|
||||||
|
.map_err(SKError::Io)?;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
} else {
|
} else {
|
||||||
@@ -103,23 +125,43 @@ fn fill_builders(
|
|||||||
if output_presence {
|
if output_presence {
|
||||||
let b = dst_bit.as_deref_mut().unwrap();
|
let b = dst_bit.as_deref_mut().unwrap();
|
||||||
match spec.op {
|
match spec.op {
|
||||||
AggOp::Any => b.add_col_from (&mat.partial_group_any (&g, 1).map_err(SKError::Io)?),
|
AggOp::Any => {
|
||||||
AggOp::All => b.add_col_from (&mat.partial_group_all (&g, 1).map_err(SKError::Io)?),
|
b.add_col_from(&mat.partial_group_any(&g, 1).map_err(SKError::Io)?)
|
||||||
AggOp::None => b.add_col_from (&mat.partial_group_none(&g, 1).map_err(SKError::Io)?),
|
}
|
||||||
AggOp::Sum => b.add_col_from_int(&mat.partial_group_sum (&g).map_err(SKError::Io)?),
|
AggOp::All => {
|
||||||
AggOp::Min => b.add_col_from_int(&mat.partial_group_min (&g).map_err(SKError::Io)?),
|
b.add_col_from(&mat.partial_group_all(&g, 1).map_err(SKError::Io)?)
|
||||||
AggOp::Max => b.add_col_from_int(&mat.partial_group_max (&g).map_err(SKError::Io)?),
|
}
|
||||||
}.map_err(SKError::Io)?;
|
AggOp::None => {
|
||||||
|
b.add_col_from(&mat.partial_group_none(&g, 1).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
AggOp::Sum => {
|
||||||
|
b.add_col_from_int(&mat.partial_group_sum(&g).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
AggOp::Min => {
|
||||||
|
b.add_col_from_int(&mat.partial_group_min(&g).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
AggOp::Max => {
|
||||||
|
b.add_col_from_int(&mat.partial_group_max(&g).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
.map_err(SKError::Io)?;
|
||||||
} else {
|
} else {
|
||||||
let b = dst_int.as_deref_mut().unwrap();
|
let b = dst_int.as_deref_mut().unwrap();
|
||||||
match spec.op {
|
match spec.op {
|
||||||
AggOp::Sum => b.add_col_from (&mat.partial_group_sum (&g).map_err(SKError::Io)?),
|
AggOp::Sum => b.add_col_from(&mat.partial_group_sum(&g).map_err(SKError::Io)?),
|
||||||
AggOp::Min => b.add_col_from (&mat.partial_group_min (&g).map_err(SKError::Io)?),
|
AggOp::Min => b.add_col_from(&mat.partial_group_min(&g).map_err(SKError::Io)?),
|
||||||
AggOp::Max => b.add_col_from (&mat.partial_group_max (&g).map_err(SKError::Io)?),
|
AggOp::Max => b.add_col_from(&mat.partial_group_max(&g).map_err(SKError::Io)?),
|
||||||
AggOp::Any => b.add_col_from_bit(&mat.partial_group_any (&g, 1).map_err(SKError::Io)?),
|
AggOp::Any => {
|
||||||
AggOp::All => b.add_col_from_bit(&mat.partial_group_all (&g, 1).map_err(SKError::Io)?),
|
b.add_col_from_bit(&mat.partial_group_any(&g, 1).map_err(SKError::Io)?)
|
||||||
AggOp::None => b.add_col_from_bit(&mat.partial_group_none(&g, 1).map_err(SKError::Io)?),
|
}
|
||||||
}.map_err(SKError::Io)?;
|
AggOp::All => {
|
||||||
|
b.add_col_from_bit(&mat.partial_group_all(&g, 1).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
AggOp::None => {
|
||||||
|
b.add_col_from_bit(&mat.partial_group_none(&g, 1).map_err(SKError::Io)?)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
.map_err(SKError::Io)?;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -128,7 +170,7 @@ fn fill_builders(
|
|||||||
|
|
||||||
// ── KmerPartition::select_partition ──────────────────────────────────────────
|
// ── KmerPartition::select_partition ──────────────────────────────────────────
|
||||||
|
|
||||||
impl KmerPartition {
|
impl KmerPartitions {
|
||||||
/// Rewrite the data matrices of partition `i` in `src` into `self`.
|
/// Rewrite the data matrices of partition `i` in `src` into `self`.
|
||||||
///
|
///
|
||||||
/// `specs` defines the output columns (projection/aggregation).
|
/// `specs` defines the output columns (projection/aggregation).
|
||||||
@@ -136,7 +178,7 @@ impl KmerPartition {
|
|||||||
/// `in_place` — `self` and `src` share the same root; write to temp dirs then swap.
|
/// `in_place` — `self` and `src` share the same root; write to temp dirs then swap.
|
||||||
pub fn select_partition(
|
pub fn select_partition(
|
||||||
&self,
|
&self,
|
||||||
src: &KmerPartition,
|
src: &KmerPartitions,
|
||||||
i: usize,
|
i: usize,
|
||||||
specs: &[OutputCol],
|
specs: &[OutputCol],
|
||||||
_n_src_genomes: usize,
|
_n_src_genomes: usize,
|
||||||
@@ -159,23 +201,33 @@ impl KmerPartition {
|
|||||||
fs::create_dir_all(&dst_index_dir)?;
|
fs::create_dir_all(&dst_index_dir)?;
|
||||||
}
|
}
|
||||||
|
|
||||||
let data_subdir = if output_presence { "presence" } else { "counts" };
|
let data_subdir = if output_presence {
|
||||||
|
"presence"
|
||||||
|
} else {
|
||||||
|
"counts"
|
||||||
|
};
|
||||||
|
|
||||||
for l in 0..n_src_layers {
|
for l in 0..n_src_layers {
|
||||||
let src_layer_dir = src.layer_dir(i, l);
|
let src_layer_dir = src.layer_dir(i, l);
|
||||||
if !src_layer_dir.exists() { continue; }
|
if !src_layer_dir.exists() {
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
|
||||||
let dst_layer_dir = self.layer_dir(i, l);
|
let dst_layer_dir = self.layer_dir(i, l);
|
||||||
|
|
||||||
let counts_dir = src_layer_dir.join("counts");
|
let counts_dir = src_layer_dir.join("counts");
|
||||||
let presence_dir = src_layer_dir.join("presence");
|
let presence_dir = src_layer_dir.join("presence");
|
||||||
let src_is_count = counts_dir.exists() && !presence_dir.exists();
|
let src_is_count = counts_dir.exists() && !presence_dir.exists();
|
||||||
|
|
||||||
// Determine number of slots and detect implicit layers.
|
// Determine number of slots and detect implicit layers.
|
||||||
let n = if counts_dir.exists() {
|
let n = if counts_dir.exists() {
|
||||||
PersistentCompactIntMatrix::open(&src_layer_dir).map_err(SKError::Io)?.n()
|
PersistentCompactIntMatrix::open(&src_layer_dir)
|
||||||
|
.map_err(SKError::Io)?
|
||||||
|
.n()
|
||||||
} else if presence_dir.exists() {
|
} else if presence_dir.exists() {
|
||||||
PersistentBitMatrix::open(&src_layer_dir).map_err(SKError::Io)?.n()
|
PersistentBitMatrix::open(&src_layer_dir)
|
||||||
|
.map_err(SKError::Io)?
|
||||||
|
.n()
|
||||||
} else {
|
} else {
|
||||||
// Implicit single-genome layer: no data matrix needed in output either.
|
// Implicit single-genome layer: no data matrix needed in output either.
|
||||||
if !in_place {
|
if !in_place {
|
||||||
@@ -187,7 +239,7 @@ impl KmerPartition {
|
|||||||
|
|
||||||
// Choose the output data directory (temp name for in-place).
|
// Choose the output data directory (temp name for in-place).
|
||||||
let (dst_data_dir, final_data_dir): (PathBuf, PathBuf) = if in_place {
|
let (dst_data_dir, final_data_dir): (PathBuf, PathBuf) = if in_place {
|
||||||
let tmp = dst_layer_dir.join(format!("{data_subdir}_new"));
|
let tmp = dst_layer_dir.join(format!("{data_subdir}_new"));
|
||||||
let perm = dst_layer_dir.join(data_subdir);
|
let perm = dst_layer_dir.join(data_subdir);
|
||||||
(tmp, perm)
|
(tmp, perm)
|
||||||
} else {
|
} else {
|
||||||
@@ -202,14 +254,28 @@ impl KmerPartition {
|
|||||||
fs::create_dir_all(&dst_data_dir)?;
|
fs::create_dir_all(&dst_data_dir)?;
|
||||||
|
|
||||||
let (mut dst_bit, mut dst_int) = if output_presence {
|
let (mut dst_bit, mut dst_int) = if output_presence {
|
||||||
(Some(PersistentBitMatrixBuilder::new(n, &dst_data_dir).map_err(SKError::Io)?), None)
|
(
|
||||||
|
Some(PersistentBitMatrixBuilder::new(n, &dst_data_dir).map_err(SKError::Io)?),
|
||||||
|
None,
|
||||||
|
)
|
||||||
} else {
|
} else {
|
||||||
(None, Some(PersistentCompactIntMatrixBuilder::new(n, &dst_data_dir).map_err(SKError::Io)?))
|
(
|
||||||
|
None,
|
||||||
|
Some(
|
||||||
|
PersistentCompactIntMatrixBuilder::new(n, &dst_data_dir)
|
||||||
|
.map_err(SKError::Io)?,
|
||||||
|
),
|
||||||
|
)
|
||||||
};
|
};
|
||||||
|
|
||||||
fill_builders(
|
fill_builders(
|
||||||
specs, &src_layer_dir, src_is_count, threshold, output_presence,
|
specs,
|
||||||
dst_bit.as_mut(), dst_int.as_mut(),
|
&src_layer_dir,
|
||||||
|
src_is_count,
|
||||||
|
threshold,
|
||||||
|
output_presence,
|
||||||
|
dst_bit.as_mut(),
|
||||||
|
dst_int.as_mut(),
|
||||||
)?;
|
)?;
|
||||||
|
|
||||||
if output_presence {
|
if output_presence {
|
||||||
@@ -233,7 +299,9 @@ impl KmerPartition {
|
|||||||
}
|
}
|
||||||
|
|
||||||
if !in_place {
|
if !in_place {
|
||||||
src.partition_meta(i)?.save(&dst_index_dir).map_err(olm_to_sk)?;
|
src.partition_meta(i)?
|
||||||
|
.save(&dst_index_dir)
|
||||||
|
.map_err(olm_to_sk)?;
|
||||||
}
|
}
|
||||||
|
|
||||||
Ok(())
|
Ok(())
|
||||||
|
|||||||
@@ -44,8 +44,8 @@ fn query_stats_default_is_zero() {
|
|||||||
#[test]
|
#[test]
|
||||||
fn query_partition_with_missing_index_dir_returns_default_stats() {
|
fn query_partition_with_missing_index_dir_returns_default_stats() {
|
||||||
let tmp = tempfile::tempdir().expect("tempdir");
|
let tmp = tempfile::tempdir().expect("tempdir");
|
||||||
let partition = KmerPartition::create(tmp.path().join("idx"), 2, 21, 9, false)
|
let partition =
|
||||||
.expect("create partition");
|
KmerPartitions::create(tmp.path().join("idx"), 2, 21, 9, false.expect("create partition");
|
||||||
|
|
||||||
let mut kmers: HashMap<CanonicalKmer, Vec<KmerDesc>> = HashMap::new();
|
let mut kmers: HashMap<CanonicalKmer, Vec<KmerDesc>> = HashMap::new();
|
||||||
// Any well-formed canonical k-mer works here — the call must return
|
// Any well-formed canonical k-mer works here — the call must return
|
||||||
@@ -65,8 +65,8 @@ fn query_partition_with_missing_index_dir_returns_default_stats() {
|
|||||||
#[test]
|
#[test]
|
||||||
fn query_partition_with_empty_kmers_is_a_noop() {
|
fn query_partition_with_empty_kmers_is_a_noop() {
|
||||||
let tmp = tempfile::tempdir().expect("tempdir");
|
let tmp = tempfile::tempdir().expect("tempdir");
|
||||||
let partition = KmerPartition::create(tmp.path().join("idx"), 2, 21, 9, false)
|
let partition =
|
||||||
.expect("create partition");
|
KmerPartitions::create(tmp.path().join("idx"), 2, 21, 9, false.expect("create partition");
|
||||||
|
|
||||||
let kmers: HashMap<CanonicalKmer, Vec<KmerDesc>> = HashMap::new();
|
let kmers: HashMap<CanonicalKmer, Vec<KmerDesc>> = HashMap::new();
|
||||||
let stats = partition
|
let stats = partition
|
||||||
|
|||||||
@@ -1,13 +1,13 @@
|
|||||||
use std::sync::Arc;
|
use std::sync::Arc;
|
||||||
|
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikindex::{OKIError, OKIResult};
|
|
||||||
use obikindex::KmerIndex;
|
use obikindex::KmerIndex;
|
||||||
|
use obikindex::{OKIError, OKIResult};
|
||||||
|
|
||||||
use super::cache::PartitionCache;
|
use super::cache::PartitionCache;
|
||||||
use super::family_scan::{scan_layer_families, Selection};
|
use super::family_scan::{Selection, scan_layer_families};
|
||||||
use super::subsample::EntropyBias;
|
use super::subsample::EntropyBias;
|
||||||
|
|
||||||
/// IUPAC ambiguity code for a per-genome family presence mask (bit `b` set
|
/// IUPAC ambiguity code for a per-genome family presence mask (bit `b` set
|
||||||
@@ -70,18 +70,26 @@ pub trait SnpAlignmentExt {
|
|||||||
/// that sample (or, with `subsample = None`, filter the whole index)
|
/// that sample (or, with `subsample = None`, filter the whole index)
|
||||||
/// by a Gaussian kernel on each family's entropy — see
|
/// by a Gaussian kernel on each family's entropy — see
|
||||||
/// `DevDocMD/architecture/siblings.md`, "Entropy-biased selection".
|
/// `DevDocMD/architecture/siblings.md`, "Entropy-biased selection".
|
||||||
fn snp_pseudo_alignment(&self, subsample: Option<usize>, entropy_bias: Option<EntropyBias>) -> OKIResult<SnpAlignment>;
|
fn snp_pseudo_alignment(
|
||||||
|
&self,
|
||||||
|
subsample: Option<usize>,
|
||||||
|
entropy_bias: Option<EntropyBias>,
|
||||||
|
) -> OKIResult<SnpAlignment>;
|
||||||
}
|
}
|
||||||
|
|
||||||
impl SnpAlignmentExt for KmerIndex {
|
impl SnpAlignmentExt for KmerIndex {
|
||||||
fn snp_pseudo_alignment(&self, subsample: Option<usize>, entropy_bias: Option<EntropyBias>) -> OKIResult<SnpAlignment> {
|
fn snp_pseudo_alignment(
|
||||||
|
&self,
|
||||||
|
subsample: Option<usize>,
|
||||||
|
entropy_bias: Option<EntropyBias>,
|
||||||
|
) -> OKIResult<SnpAlignment> {
|
||||||
let n_parts = self.n_partitions();
|
let n_parts = self.n_partitions();
|
||||||
let n_genomes = self.meta().genomes.len();
|
let n_genomes = self.meta().genomes.len();
|
||||||
let with_counts = self.meta().config.with_counts;
|
let with_counts = self.meta().config.with_counts;
|
||||||
let k = self.kmer_size();
|
let k = self.kmer_size();
|
||||||
let n_bits = n_parts.trailing_zeros() as usize;
|
let n_bits = n_parts.trailing_zeros() as usize;
|
||||||
|
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
self.root_path(),
|
self.root_path(),
|
||||||
self.kmer_size(),
|
self.kmer_size(),
|
||||||
self.minimizer_size(),
|
self.minimizer_size(),
|
||||||
@@ -90,7 +98,8 @@ impl SnpAlignmentExt for KmerIndex {
|
|||||||
.map_err(OKIError::Partition)?;
|
.map_err(OKIError::Partition)?;
|
||||||
let cache = Arc::new(PartitionCache::build(&partition, n_parts, with_counts)?);
|
let cache = Arc::new(PartitionCache::build(&partition, n_parts, with_counts)?);
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(self)?;
|
let layer_dirs = super::family_scan::sibling_layer_dirs(self)?;
|
||||||
let selections = super::subsample::compute_selections(self, &layer_dirs, subsample, entropy_bias)?;
|
let selections =
|
||||||
|
super::subsample::compute_selections(self, &layer_dirs, subsample, entropy_bias)?;
|
||||||
|
|
||||||
let pb = progress_bar("snp_pseudo_alignment", layer_dirs.len() as u64, "layers");
|
let pb = progress_bar("snp_pseudo_alignment", layer_dirs.len() as u64, "layers");
|
||||||
// One layer at a time, not `par_iter()` over layers — same
|
// One layer at a time, not `par_iter()` over layers — same
|
||||||
@@ -109,14 +118,23 @@ impl SnpAlignmentExt for KmerIndex {
|
|||||||
None => Selection::All,
|
None => Selection::All,
|
||||||
Some(set) => Selection::Some(set),
|
Some(set) => Selection::Some(set),
|
||||||
};
|
};
|
||||||
scan_layer_families(layer_dir, n_parts, n_genomes, with_counts, k, &cache, &selection, |_family_idx, mask, genome_mask| {
|
scan_layer_families(
|
||||||
if mask.family_size() < 2 {
|
layer_dir,
|
||||||
return; // monomorphic family — no signal, skip
|
n_parts,
|
||||||
}
|
n_genomes,
|
||||||
for (g, &m) in genome_mask.iter().enumerate() {
|
with_counts,
|
||||||
sequences[g].push(iupac_code(m));
|
k,
|
||||||
}
|
&cache,
|
||||||
})?;
|
&selection,
|
||||||
|
|_family_idx, mask, genome_mask| {
|
||||||
|
if mask.family_size() < 2 {
|
||||||
|
return; // monomorphic family — no signal, skip
|
||||||
|
}
|
||||||
|
for (g, &m) in genome_mask.iter().enumerate() {
|
||||||
|
sequences[g].push(iupac_code(m));
|
||||||
|
}
|
||||||
|
},
|
||||||
|
)?;
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
}
|
}
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
|
|||||||
+225
-195
@@ -1,22 +1,22 @@
|
|||||||
use std::path::Path;
|
use std::path::Path;
|
||||||
use std::sync::atomic::Ordering;
|
|
||||||
use std::sync::Arc;
|
use std::sync::Arc;
|
||||||
|
use std::sync::atomic::Ordering;
|
||||||
|
|
||||||
use rayon::prelude::*;
|
use rayon::prelude::*;
|
||||||
|
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obipipeline::ThrottleGuard;
|
|
||||||
use obikseq::CanonicalKmer;
|
use obikseq::CanonicalKmer;
|
||||||
use obilayeredmap::MphfLayer;
|
use obilayeredmap::MphfLayer;
|
||||||
use obilayeredmap::meta::IndexMode;
|
use obilayeredmap::meta::IndexMode;
|
||||||
|
use obipipeline::ThrottleGuard;
|
||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikindex::{OKIError, OKIResult};
|
|
||||||
use obikindex::KmerIndex;
|
use obikindex::KmerIndex;
|
||||||
|
use obikindex::{OKIError, OKIResult};
|
||||||
|
|
||||||
use super::cache::PartitionCache;
|
use super::cache::PartitionCache;
|
||||||
use super::helpers::{central_base, is_minorant};
|
use super::helpers::{central_base, is_minorant};
|
||||||
use super::{olm_to_ok, FamilyMask, SiblingAnnexBuilder, ANNEX_FILE_NAME};
|
use super::{ANNEX_FILE_NAME, FamilyMask, SiblingAnnexBuilder, olm_to_ok};
|
||||||
|
|
||||||
// ── obipipeline data types ─────────────────────────────────────────────────
|
// ── obipipeline data types ─────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -78,7 +78,7 @@ impl SiblingAnnexBuildExt for KmerIndex {
|
|||||||
let n_parts = self.n_partitions();
|
let n_parts = self.n_partitions();
|
||||||
let n_bits = n_parts.trailing_zeros() as usize;
|
let n_bits = n_parts.trailing_zeros() as usize;
|
||||||
|
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
self.root_path(),
|
self.root_path(),
|
||||||
self.kmer_size(),
|
self.kmer_size(),
|
||||||
self.minimizer_size(),
|
self.minimizer_size(),
|
||||||
@@ -87,7 +87,11 @@ impl SiblingAnnexBuildExt for KmerIndex {
|
|||||||
.map_err(OKIError::Partition)?;
|
.map_err(OKIError::Partition)?;
|
||||||
|
|
||||||
tracing::info!("opening {n_parts} partition(s) for the sibling-annex sweep");
|
tracing::info!("opening {n_parts} partition(s) for the sibling-annex sweep");
|
||||||
let cache = Arc::new(PartitionCache::build(&partition, n_parts, self.meta().config.with_counts)?);
|
let cache = Arc::new(PartitionCache::build(
|
||||||
|
&partition,
|
||||||
|
n_parts,
|
||||||
|
self.meta().config.with_counts,
|
||||||
|
)?);
|
||||||
|
|
||||||
let pb = progress_bar("sibling_annex", n_parts as u64, "partitions");
|
let pb = progress_bar("sibling_annex", n_parts as u64, "partitions");
|
||||||
let mut total_slots: u64 = 0;
|
let mut total_slots: u64 = 0;
|
||||||
@@ -102,12 +106,19 @@ impl SiblingAnnexBuildExt for KmerIndex {
|
|||||||
let mut part_slots: u64 = 0;
|
let mut part_slots: u64 = 0;
|
||||||
for l in 0..meta.n_layers {
|
for l in 0..meta.n_layers {
|
||||||
part_slots += build_layer_sibling_annex(
|
part_slots += build_layer_sibling_annex(
|
||||||
self, &self.partition().layer_dir(part, l), &meta.mode, n_parts, l, &cache,
|
self,
|
||||||
|
&self.partition().layer_dir(part, l),
|
||||||
|
&meta.mode,
|
||||||
|
n_parts,
|
||||||
|
l,
|
||||||
|
&cache,
|
||||||
)?;
|
)?;
|
||||||
}
|
}
|
||||||
total_slots += part_slots;
|
total_slots += part_slots;
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
pb.set_message(format!("partition {part}: {part_slots} kmers ({total_slots} total)"));
|
pb.set_message(format!(
|
||||||
|
"partition {part}: {part_slots} kmers ({total_slots} total)"
|
||||||
|
));
|
||||||
}
|
}
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
tracing::info!("sibling annex built — {total_slots} kmers across {n_parts} partitions");
|
tracing::info!("sibling annex built — {total_slots} kmers across {n_parts} partitions");
|
||||||
@@ -139,213 +150,232 @@ fn build_layer_sibling_annex(
|
|||||||
// agree; see `PartitionCache::fast_mode`'s docs.
|
// agree; see `PartitionCache::fast_mode`'s docs.
|
||||||
let fast_mode = cache.fast_mode();
|
let fast_mode = cache.fast_mode();
|
||||||
|
|
||||||
// ── The annex file itself is the reconciliation state, indexed by
|
// ── The annex file itself is the reconciliation state, indexed by
|
||||||
// this layer's k-mer iteration order (the physical layout of
|
// this layer's k-mer iteration order (the physical layout of
|
||||||
// `unitigs.bin`), never by MPHF slot — this layer's own k-mers are
|
// `unitigs.bin`), never by MPHF slot — this layer's own k-mers are
|
||||||
// known members by construction, so no evidence check, no MPHF
|
// known members by construction, so no evidence check, no MPHF
|
||||||
// slot, and no slot -> k-mer reconstruction is needed or legitimate
|
// slot, and no slot -> k-mer reconstruction is needed or legitimate
|
||||||
// here (see `DevDocMD/architecture/siblings.md`: the MPHF is not
|
// here (see `DevDocMD/architecture/siblings.md`: the MPHF is not
|
||||||
// invertible, and evidence answers membership, not identity). No
|
// invertible, and evidence answers membership, not identity). No
|
||||||
// separate in-memory accumulator: every concurrent write goes
|
// separate in-memory accumulator: every concurrent write goes
|
||||||
// straight through `SiblingAnnexBuilder::atomic_slot` into the
|
// straight through `SiblingAnnexBuilder::atomic_slot` into the
|
||||||
// mmap — a layer can hold billions of k-mers, so a `Vec` shadowing
|
// mmap — a layer can hold billions of k-mers, so a `Vec` shadowing
|
||||||
// the whole file in RAM just to copy it out again at the end (the
|
// the whole file in RAM just to copy it out again at the end (the
|
||||||
// previous design) doubles memory for no benefit once the builder
|
// previous design) doubles memory for no benefit once the builder
|
||||||
// itself can be written concurrently.
|
// itself can be written concurrently.
|
||||||
//
|
//
|
||||||
// `Arc<SiblingAnnexBuilder>`, not a bare `SiblingAnnexBuilder` —
|
// `Arc<SiblingAnnexBuilder>`, not a bare `SiblingAnnexBuilder` —
|
||||||
// `Pipe::apply` requires its source iterator to be `Send + 'static`
|
// `Pipe::apply` requires its source iterator to be `Send + 'static`
|
||||||
// (its items are dispatched to worker threads that outlive this
|
// (its items are dispatched to worker threads that outlive this
|
||||||
// call), so the batch-generating closure below needs an owned
|
// call), so the batch-generating closure below needs an owned
|
||||||
// handle it can move in, not a borrow of a local. `atomic_slot`,
|
// handle it can move in, not a borrow of a local. `atomic_slot`,
|
||||||
// not `set`, for every concurrent write below: the gather phase
|
// not `set`, for every concurrent write below: the gather phase
|
||||||
// parallelises across destination partitions (independent
|
// parallelises across destination partitions (independent
|
||||||
// `cache.find` calls, safe to run concurrently) and their hits can
|
// `cache.find` calls, safe to run concurrently) and their hits can
|
||||||
// land on arbitrary, possibly-shared source entries — a lock-free
|
// land on arbitrary, possibly-shared source entries — a lock-free
|
||||||
// `fetch_or` avoids needing any synchronisation beyond that.
|
// `fetch_or` avoids needing any synchronisation beyond that.
|
||||||
// Reclaimed as a plain owned value (`Arc::try_unwrap`) once every
|
// Reclaimed as a plain owned value (`Arc::try_unwrap`) once every
|
||||||
// concurrent phase below is done, for the sequential finalisation
|
// concurrent phase below is done, for the sequential finalisation
|
||||||
// pass. ─────────────────────────────────────────────────────────
|
// pass. ─────────────────────────────────────────────────────────
|
||||||
let annex_path = layer_dir.join(ANNEX_FILE_NAME);
|
let annex_path = layer_dir.join(ANNEX_FILE_NAME);
|
||||||
let builder = Arc::new(SiblingAnnexBuilder::new(n, &annex_path)?);
|
let builder = Arc::new(SiblingAnnexBuilder::new(n, &annex_path)?);
|
||||||
|
|
||||||
// ── obipipeline: a *batch* transform, not a per-k-mer `Flat` one —
|
// ── obipipeline: a *batch* transform, not a per-k-mer `Flat` one —
|
||||||
// the actual cross-partition lookup reuses
|
// the actual cross-partition lookup reuses
|
||||||
// `KmerPartition::query_partition_with` (the same batching mechanism
|
// `KmerPartition::query_partition_with` (the same batching mechanism
|
||||||
// `obikmer query` already uses: open a partition's files once,
|
// `obikmer query` already uses: open a partition's files once,
|
||||||
// answer a whole batch of queries against it) instead of one lookup
|
// answer a whole batch of queries against it) instead of one lookup
|
||||||
// per pipeline item. A per-item lookup (tried first) reopened/
|
// per pipeline item. A per-item lookup (tried first) reopened/
|
||||||
// re-mmap'd every target partition's files on every single variant
|
// re-mmap'd every target partition's files on every single variant
|
||||||
// — fine at toy scale, but ~90% system time against a real index,
|
// — fine at toy scale, but ~90% system time against a real index,
|
||||||
// observed in practice. A *later* attempt still pushed one pipeline
|
// observed in practice. A *later* attempt still pushed one pipeline
|
||||||
// message per generated variant (a `Flat` stage, `SourceItem` =>
|
// message per generated variant (a `Flat` stage, `SourceItem` =>
|
||||||
// `VariantQuery`, one k-mer in => up to 3 variants out as separate
|
// `VariantQuery`, one k-mer in => up to 3 variants out as separate
|
||||||
// messages) — cheaper than reopening files, but sampling a real run
|
// messages) — cheaper than reopening files, but sampling a real run
|
||||||
// showed most wall-clock time going into per-message channel
|
// showed most wall-clock time going into per-message channel
|
||||||
// send/notify syscalls instead of the lookup itself: the pipeline's
|
// send/notify syscalls instead of the lookup itself: the pipeline's
|
||||||
// whole point is amortising synchronisation over a batch, and a
|
// whole point is amortising synchronisation over a batch, and a
|
||||||
// single k-mer's ≤3 variants is far too fine a granularity for
|
// single k-mer's ≤3 variants is far too fine a granularity for
|
||||||
// that. Batching `BATCH_SIZE` source k-mers into one pipeline item
|
// that. Batching `BATCH_SIZE` source k-mers into one pipeline item
|
||||||
// — a plain 1-to-1 (`|`, not `||`) transform, batch in, batch of
|
// — a plain 1-to-1 (`|`, not `||`) transform, batch in, batch of
|
||||||
// variants out, one message either way — keeps the per-message
|
// variants out, one message either way — keeps the per-message
|
||||||
// synchronisation cost amortised over thousands of lookups instead
|
// synchronisation cost amortised over thousands of lookups instead
|
||||||
// of one to three. `BATCH_SIZE` was originally tuned back when the
|
// of one to three. `BATCH_SIZE` was originally tuned back when the
|
||||||
// per-k-mer cost inside this stage (minimiser via `RollingStat`)
|
// per-k-mer cost inside this stage (minimiser via `RollingStat`)
|
||||||
// was ~3x higher than it is now (see `CanonicalKmerOf::minimizer`,
|
// was ~3x higher than it is now (see `CanonicalKmerOf::minimizer`,
|
||||||
// a direct O(k) bit-arithmetic replacement) — at the old per-k-mer
|
// a direct O(k) bit-arithmetic replacement) — at the old per-k-mer
|
||||||
// cost, dispatch overhead (the scheduler's single-threaded `Select`
|
// cost, dispatch overhead (the scheduler's single-threaded `Select`
|
||||||
// loop: one channel round-trip per batch) was negligible next to
|
// loop: one channel round-trip per batch) was negligible next to
|
||||||
// the work each batch represented; now that the work itself is
|
// the work each batch represented; now that the work itself is
|
||||||
// cheaper, that fixed per-batch overhead is proportionally larger,
|
// cheaper, that fixed per-batch overhead is proportionally larger,
|
||||||
// so a bigger batch amortises it over more k-mers again. ─────────
|
// so a bigger batch amortises it over more k-mers again. ─────────
|
||||||
const BATCH_SIZE: usize = 32768;
|
const BATCH_SIZE: usize = 32768;
|
||||||
let n_workers = obisys::effective_parallelism();
|
let n_workers = obisys::effective_parallelism();
|
||||||
let capacity = 256;
|
let capacity = 256;
|
||||||
|
|
||||||
// Throttling limits how many *batches* are in flight at once — the
|
// Throttling limits how many *batches* are in flight at once — the
|
||||||
// permit is acquired per batch (not per k-mer) in the source
|
// permit is acquired per batch (not per k-mer) in the source
|
||||||
// thread, and released once its `VariantBatch` has been read out of
|
// thread, and released once its `VariantBatch` has been read out of
|
||||||
// the pipeline by the accumulation loop below. See
|
// the pipeline by the accumulation loop below. See
|
||||||
// `obipipeline::throttle`'s docs for why this is required, not
|
// `obipipeline::throttle`'s docs for why this is required, not
|
||||||
// optional, once a `Flat`-style stage sits in the pipeline.
|
// optional, once a `Flat`-style stage sits in the pipeline.
|
||||||
//
|
//
|
||||||
// Batches stream straight from `unitigs.bin` via
|
// Batches stream straight from `unitigs.bin` via
|
||||||
// `enumerate_kmers_batch` — never a full-layer `Vec` collect (a
|
// `enumerate_kmers_batch` — never a full-layer `Vec` collect (a
|
||||||
// layer can hold billions of k-mers; see the "no full collect"
|
// layer can hold billions of k-mers; see the "no full collect"
|
||||||
// rule). Each k-mer's own base is seeded straight into the annex in
|
// rule). Each k-mer's own base is seeded straight into the annex in
|
||||||
// this same pass, since this is exactly the iteration order the
|
// this same pass, since this is exactly the iteration order the
|
||||||
// annex is keyed on — no separate seeding pass needed.
|
// annex is keyed on — no separate seeding pass needed.
|
||||||
let seed_builder = Arc::clone(&builder);
|
let seed_builder = Arc::clone(&builder);
|
||||||
let batches = mphf.enumerate_kmers_batch(BATCH_SIZE).map(move |(start, kmers)| {
|
let batches = mphf
|
||||||
|
.enumerate_kmers_batch(BATCH_SIZE)
|
||||||
|
.map(move |(start, kmers)| {
|
||||||
kmers
|
kmers
|
||||||
.into_iter()
|
.into_iter()
|
||||||
.enumerate()
|
.enumerate()
|
||||||
.map(|(i, kmer)| {
|
.map(|(i, kmer)| {
|
||||||
let base = central_base(kmer, k);
|
let base = central_base(kmer, k);
|
||||||
let bits = if fast_mode { FamilyMask::layer_bits(base, l) } else { FamilyMask::presence_bits(base) };
|
let bits = if fast_mode {
|
||||||
seed_builder.atomic_slot(start + i).fetch_or(bits, Ordering::Relaxed);
|
FamilyMask::layer_bits(base, l)
|
||||||
|
} else {
|
||||||
|
FamilyMask::presence_bits(base)
|
||||||
|
};
|
||||||
|
seed_builder
|
||||||
|
.atomic_slot(start + i)
|
||||||
|
.fetch_or(bits, Ordering::Relaxed);
|
||||||
(start + i, kmer)
|
(start + i, kmer)
|
||||||
})
|
})
|
||||||
.collect::<Vec<_>>()
|
.collect::<Vec<_>>()
|
||||||
});
|
});
|
||||||
|
|
||||||
// Diagnostic: count still-empty annex slots after seeding + cross-partition
|
// Diagnostic: count still-empty annex slots after seeding + cross-partition
|
||||||
// resolution. A non-zero count here means some k-mer's own base was never
|
// resolution. A non-zero count here means some k-mer's own base was never
|
||||||
// written (should be impossible after the batch_offset fix above).
|
// written (should be impossible after the batch_offset fix above).
|
||||||
let check_empty = |label: &str| {
|
let check_empty = |label: &str| {
|
||||||
let empty = (0..n).filter(|&slot| builder.get(slot).is_none()).count();
|
let empty = (0..n).filter(|&slot| builder.get(slot).is_none()).count();
|
||||||
if empty > 0 {
|
if empty > 0 {
|
||||||
tracing::warn!("{label}: {empty} mask slots still empty after resolution (layer {layer_dir:?})");
|
tracing::warn!(
|
||||||
}
|
"{label}: {empty} mask slots still empty after resolution (layer {layer_dir:?})"
|
||||||
};
|
);
|
||||||
let throttled = obipipeline::throttle(batches, n_workers).map(|t| SourceBatch {
|
}
|
||||||
items: t.item,
|
};
|
||||||
_permit: t.guard,
|
let throttled = obipipeline::throttle(batches, n_workers).map(|t| SourceBatch {
|
||||||
});
|
items: t.item,
|
||||||
|
_permit: t.guard,
|
||||||
|
});
|
||||||
|
|
||||||
let pipe = obipipeline::make_pipe! {
|
let pipe = obipipeline::make_pipe! {
|
||||||
SibData : SourceBatch => VariantBatch,
|
SibData : SourceBatch => VariantBatch,
|
||||||
| {
|
| {
|
||||||
move |batch: SourceBatch| -> VariantBatch {
|
move |batch: SourceBatch| -> VariantBatch {
|
||||||
let mut items = Vec::with_capacity(batch.items.len() * 3);
|
let mut items = Vec::with_capacity(batch.items.len() * 3);
|
||||||
for (order, kmer) in batch.items {
|
for (order, kmer) in batch.items {
|
||||||
for variant in kmer.central_canonical_neighbors() {
|
for variant in kmer.central_canonical_neighbors() {
|
||||||
if variant == kmer {
|
if variant == kmer {
|
||||||
continue;
|
continue;
|
||||||
}
|
|
||||||
items.push((
|
|
||||||
variant.partition(n_parts),
|
|
||||||
variant,
|
|
||||||
order,
|
|
||||||
central_base(variant, k),
|
|
||||||
));
|
|
||||||
}
|
}
|
||||||
|
items.push((
|
||||||
|
variant.partition(n_parts),
|
||||||
|
variant,
|
||||||
|
order,
|
||||||
|
central_base(variant, k),
|
||||||
|
));
|
||||||
}
|
}
|
||||||
VariantBatch { items, _permit: batch._permit }
|
|
||||||
}
|
}
|
||||||
} : Batch => Variants,
|
VariantBatch { items, _permit: batch._permit }
|
||||||
};
|
}
|
||||||
|
} : Batch => Variants,
|
||||||
|
};
|
||||||
|
|
||||||
// ── Group generated variants by destination partition. `cache`
|
// ── Group generated variants by destination partition. `cache`
|
||||||
// holds every partition already mmap'd (no more `open()` cost), but
|
// holds every partition already mmap'd (no more `open()` cost), but
|
||||||
// `mmap` pages are still loaded on demand and can be evicted — a
|
// `mmap` pages are still loaded on demand and can be evicted — a
|
||||||
// lookup is not free just because the file isn't reopened. Grouping
|
// lookup is not free just because the file isn't reopened. Grouping
|
||||||
// keeps one partition's pages hot while its whole batch is resolved,
|
// keeps one partition's pages hot while its whole batch is resolved,
|
||||||
// instead of faulting pages in and out as lookups jump between
|
// instead of faulting pages in and out as lookups jump between
|
||||||
// partitions in whatever order the pipeline happens to produce
|
// partitions in whatever order the pipeline happens to produce
|
||||||
// them. Each batch's throttle permit drops here, once accumulated.
|
// them. Each batch's throttle permit drops here, once accumulated.
|
||||||
let mut outgoing: Vec<Vec<(CanonicalKmer, usize, u8)>> = (0..n_parts).map(|_| Vec::new()).collect();
|
let mut outgoing: Vec<Vec<(CanonicalKmer, usize, u8)>> =
|
||||||
for vb in pipe.apply(throttled, n_workers, capacity) {
|
(0..n_parts).map(|_| Vec::new()).collect();
|
||||||
for (dest_partition, variant, source_order, base) in vb.items {
|
for vb in pipe.apply(throttled, n_workers, capacity) {
|
||||||
outgoing[dest_partition].push((variant, source_order, base));
|
for (dest_partition, variant, source_order, base) in vb.items {
|
||||||
|
outgoing[dest_partition].push((variant, source_order, base));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
check_empty("after_seeding");
|
||||||
|
|
||||||
|
// ── Resolve each partition's batch against the cache, parallelised
|
||||||
|
// over roughly equal-sized *chunks*, not over partitions — a plain
|
||||||
|
// `outgoing.par_iter()` over `n_parts` buckets gives one thread the
|
||||||
|
// whole of one partition's bucket, however large, and a lot of
|
||||||
|
// buckets are far from equal: a central-base substitution changes
|
||||||
|
// the minimiser (and thus routes to a different partition) only
|
||||||
|
// when the winning minimiser window overlaps the central position.
|
||||||
|
// For k=31/m=11 that is ~11 of the 21 possible windows — so *most*
|
||||||
|
// of the remaining ~10/21 send the variant right back to the
|
||||||
|
// partition already being built. That self-partition bucket ends up
|
||||||
|
// far larger than any other, so the naive per-partition split
|
||||||
|
// leaves one thread grinding through it alone long after every
|
||||||
|
// other partition's (tiny) bucket is done — confirmed by sampling a
|
||||||
|
// real run: one thread solely in `MphfLayer::find` while the rest
|
||||||
|
// of the pool sits idle. Splitting each non-empty bucket into
|
||||||
|
// `chunk_size`-sized pieces first keeps this pass's per-partition
|
||||||
|
// locality (each chunk is still contiguous within one partition,
|
||||||
|
// still resolved via `cache.find` grouped by that partition) while
|
||||||
|
// letting Rayon spread a single oversized bucket across several
|
||||||
|
// threads instead of pinning it to one. ──────────────────────────
|
||||||
|
let chunk_size = ((outgoing.iter().map(Vec::len).sum::<usize>() / n_workers).max(1)).min(4096);
|
||||||
|
let work: Vec<(usize, &[(CanonicalKmer, usize, u8)])> = outgoing
|
||||||
|
.iter()
|
||||||
|
.enumerate()
|
||||||
|
.filter(|(_, q)| !q.is_empty())
|
||||||
|
.flat_map(|(dest, q)| q.chunks(chunk_size).map(move |c| (dest, c)))
|
||||||
|
.collect();
|
||||||
|
work.par_iter().for_each(|&(dest, chunk)| {
|
||||||
|
for &(variant, source_order, base) in chunk {
|
||||||
|
if let Some(layer) = cache.find(dest, variant) {
|
||||||
|
let bits = if fast_mode {
|
||||||
|
FamilyMask::layer_bits(base, layer)
|
||||||
|
} else {
|
||||||
|
FamilyMask::presence_bits(base)
|
||||||
|
};
|
||||||
|
builder
|
||||||
|
.atomic_slot(source_order)
|
||||||
|
.fetch_or(bits, Ordering::Relaxed);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
});
|
||||||
|
|
||||||
check_empty("after_seeding");
|
check_empty("after_resolution");
|
||||||
|
|
||||||
// ── Resolve each partition's batch against the cache, parallelised
|
// ── Write the layer's annex file, indexed by iteration order — a
|
||||||
// over roughly equal-sized *chunks*, not over partitions — a plain
|
// second streamed pass over `unitigs.bin` (via `enumerate_kmers`),
|
||||||
// `outgoing.par_iter()` over `n_parts` buckets gives one thread the
|
// now that every entry's mask is final; never a `Vec` hold of the
|
||||||
// whole of one partition's bucket, however large, and a lot of
|
// whole layer. The minorant flag is computed here, not by every
|
||||||
// buckets are far from equal: a central-base substitution changes
|
// later reader: this is the one place the whole family's *final*
|
||||||
// the minimiser (and thus routes to a different partition) only
|
// mask and this entry's own k-mer (already in hand, no extra
|
||||||
// when the winning minimiser window overlaps the central position.
|
// lookup) are both available together. Every consumer that only
|
||||||
// For k=31/m=11 that is ~11 of the 21 possible windows — so *most*
|
// needs to know "is this k-mer the family's minorant" — the common
|
||||||
// of the remaining ~10/21 send the variant right back to the
|
// case, since a family is tallied once, at its minorant — reads
|
||||||
// partition already being built. That self-partition bucket ends up
|
// the bit straight back instead of re-deriving it (re-scanning
|
||||||
// far larger than any other, so the naive per-partition split
|
// `unitigs.bin` and re-hashing through the MPHF, the cost
|
||||||
// leaves one thread grinding through it alone long after every
|
// `is_minorant` was cheap to *compute* but expensive to *get the
|
||||||
// other partition's (tiny) bucket is done — confirmed by sampling a
|
// inputs for* every time).
|
||||||
// real run: one thread solely in `MphfLayer::find` while the rest
|
// Every concurrent phase above is done and its `Arc` clone (the
|
||||||
// of the pool sits idle. Splitting each non-empty bucket into
|
// seeding pass's `seed_builder`) has already been dropped along
|
||||||
// `chunk_size`-sized pieces first keeps this pass's per-partition
|
// with the now-fully-drained `batches` iterator — this is the only
|
||||||
// locality (each chunk is still contiguous within one partition,
|
// remaining strong reference, so reclaiming plain ownership for the
|
||||||
// still resolved via `cache.find` grouped by that partition) while
|
// sequential `set` calls below is guaranteed to succeed.
|
||||||
// letting Rayon spread a single oversized bucket across several
|
let mut builder = Arc::try_unwrap(builder).unwrap_or_else(|_| {
|
||||||
// threads instead of pinning it to one. ──────────────────────────
|
panic!("sibling-annex builder still shared after every concurrent phase completed")
|
||||||
let chunk_size = ((outgoing.iter().map(Vec::len).sum::<usize>() / n_workers).max(1)).min(4096);
|
});
|
||||||
let work: Vec<(usize, &[(CanonicalKmer, usize, u8)])> = outgoing
|
for (order, kmer) in mphf.enumerate_kmers() {
|
||||||
.iter()
|
let final_mask = builder.get(order).expect("seeded by construction");
|
||||||
.enumerate()
|
let minorant = is_minorant(kmer, final_mask, k);
|
||||||
.filter(|(_, q)| !q.is_empty())
|
builder.set(order, final_mask.with_minorant(minorant));
|
||||||
.flat_map(|(dest, q)| q.chunks(chunk_size).map(move |c| (dest, c)))
|
}
|
||||||
.collect();
|
builder.close()?;
|
||||||
work.par_iter().for_each(|&(dest, chunk)| {
|
|
||||||
for &(variant, source_order, base) in chunk {
|
|
||||||
if let Some(layer) = cache.find(dest, variant) {
|
|
||||||
let bits = if fast_mode { FamilyMask::layer_bits(base, layer) } else { FamilyMask::presence_bits(base) };
|
|
||||||
builder.atomic_slot(source_order).fetch_or(bits, Ordering::Relaxed);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
|
|
||||||
check_empty("after_resolution");
|
|
||||||
|
|
||||||
// ── Write the layer's annex file, indexed by iteration order — a
|
|
||||||
// second streamed pass over `unitigs.bin` (via `enumerate_kmers`),
|
|
||||||
// now that every entry's mask is final; never a `Vec` hold of the
|
|
||||||
// whole layer. The minorant flag is computed here, not by every
|
|
||||||
// later reader: this is the one place the whole family's *final*
|
|
||||||
// mask and this entry's own k-mer (already in hand, no extra
|
|
||||||
// lookup) are both available together. Every consumer that only
|
|
||||||
// needs to know "is this k-mer the family's minorant" — the common
|
|
||||||
// case, since a family is tallied once, at its minorant — reads
|
|
||||||
// the bit straight back instead of re-deriving it (re-scanning
|
|
||||||
// `unitigs.bin` and re-hashing through the MPHF, the cost
|
|
||||||
// `is_minorant` was cheap to *compute* but expensive to *get the
|
|
||||||
// inputs for* every time).
|
|
||||||
// Every concurrent phase above is done and its `Arc` clone (the
|
|
||||||
// seeding pass's `seed_builder`) has already been dropped along
|
|
||||||
// with the now-fully-drained `batches` iterator — this is the only
|
|
||||||
// remaining strong reference, so reclaiming plain ownership for the
|
|
||||||
// sequential `set` calls below is guaranteed to succeed.
|
|
||||||
let mut builder = Arc::try_unwrap(builder).unwrap_or_else(|_| panic!("sibling-annex builder still shared after every concurrent phase completed"));
|
|
||||||
for (order, kmer) in mphf.enumerate_kmers() {
|
|
||||||
let final_mask = builder.get(order).expect("seeded by construction");
|
|
||||||
let minorant = is_minorant(kmer, final_mask, k);
|
|
||||||
builder.set(order, final_mask.with_minorant(minorant));
|
|
||||||
}
|
|
||||||
builder.close()?;
|
|
||||||
|
|
||||||
Ok(n as u64)
|
Ok(n as u64)
|
||||||
}
|
}
|
||||||
@@ -2,17 +2,17 @@ use rayon::prelude::*;
|
|||||||
|
|
||||||
use std::path::Path;
|
use std::path::Path;
|
||||||
|
|
||||||
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix, PersistentSparseBitMatrix};
|
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obikseq::CanonicalKmer;
|
use obikseq::CanonicalKmer;
|
||||||
use obilayeredmap::{Layer, OLMResult};
|
|
||||||
use obilayeredmap::meta::IndexMode;
|
use obilayeredmap::meta::IndexMode;
|
||||||
|
use obilayeredmap::{Layer, OLMResult};
|
||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikindex::OKIResult;
|
use obikindex::OKIResult;
|
||||||
|
|
||||||
use super::iter::SiblingLayerExt;
|
|
||||||
use super::SiblingAnnex;
|
use super::SiblingAnnex;
|
||||||
|
use super::iter::SiblingLayerExt;
|
||||||
|
|
||||||
/// Every partition's already-open layers, built **once** for the whole
|
/// Every partition's already-open layers, built **once** for the whole
|
||||||
/// `build_sibling_annex` run and shared (read-only) across every lookup, in
|
/// `build_sibling_annex` run and shared (read-only) across every lookup, in
|
||||||
@@ -41,47 +41,40 @@ use super::SiblingAnnex;
|
|||||||
/// going back through the low-level pieces `Layer` already assembles.
|
/// going back through the low-level pieces `Layer` already assembles.
|
||||||
pub(super) enum Mat {
|
pub(super) enum Mat {
|
||||||
Count(Layer<PersistentCompactIntMatrix>),
|
Count(Layer<PersistentCompactIntMatrix>),
|
||||||
|
/// Dense *or* sparse (`pack --sparse`d) presence — `PersistentBitMatrix`
|
||||||
|
/// itself is a 4-way enum (`Columnar`/`Packed`/`Sparse`/`Implicit`) that
|
||||||
|
/// already auto-detects sparse storage in its own `open()` (checks
|
||||||
|
/// `presence/sparse_meta.json`) and dispatches every method
|
||||||
|
/// (`row`/`fill_row`/`nonzero_iter`/...) across all four internally —
|
||||||
|
/// see `DevDocMD/implementation/partition_layer_cache.md`. A separate
|
||||||
|
/// `SparsePresence(Layer<PersistentSparseBitMatrix>)` arm used to exist
|
||||||
|
/// here, opened via its own `presence/is_multi.prsb` check; it
|
||||||
|
/// predated `PersistentBitMatrix` growing native sparse support and
|
||||||
|
/// was pure duplication by the time it was removed — every method
|
||||||
|
/// below dispatched it identically to this arm.
|
||||||
Presence(Layer<PersistentBitMatrix>),
|
Presence(Layer<PersistentBitMatrix>),
|
||||||
/// Same role as `Presence`, over a layer packed by `pack --sparse`
|
|
||||||
/// (`PersistentSparseBitMatrix`) instead of the dense form — see
|
|
||||||
/// `DevDocMD/architecture/siblings.md`'s sparse-matrix section. Every
|
|
||||||
/// `Mat` method below dispatches to the same `Layer<D>` generic code
|
|
||||||
/// (`D: LayerData`) as `Presence`, so this arm is purely a storage
|
|
||||||
/// choice, not a behavioural difference.
|
|
||||||
SparsePresence(Layer<PersistentSparseBitMatrix>),
|
|
||||||
}
|
}
|
||||||
|
|
||||||
impl Mat {
|
impl Mat {
|
||||||
/// Open one layer's matrix, auto-detecting count vs. dense-presence vs.
|
/// Open one layer's matrix, auto-detecting count vs. presence from what
|
||||||
/// sparse-presence from what is actually on disk — the single source of
|
/// is actually on disk — the single source of truth for *every* caller
|
||||||
/// truth for *every* caller that opens a layer's own matrix (this
|
/// that opens a layer's own matrix (this module's cross-partition
|
||||||
/// module's cross-partition [`PartitionCache::build`] and
|
/// [`PartitionCache::build`] and `family_scan::scan_layer_families`'s
|
||||||
/// `family_scan::scan_layer_families`'s own-layer lookup alike), so the
|
/// own-layer lookup alike), so the two can never disagree. Sparse vs.
|
||||||
/// two can never disagree about which format a layer's `presence/` was
|
/// dense presence storage is `PersistentBitMatrix::open`'s own concern
|
||||||
/// packed to. Before this existed, `scan_layer_families` open-coded its
|
/// (see the [`Presence`](Mat::Presence) variant's docs), not decided
|
||||||
/// own (non-sparse-aware) copy of this decision: on a `pack --sparse`d
|
/// here.
|
||||||
/// layer, `presence/matrix.pbmx` no longer exists (removed by
|
|
||||||
/// `pack_sparse_bit_matrix`), so a caller that only checks for it and
|
|
||||||
/// otherwise unconditionally opens `PersistentBitMatrix` doesn't error —
|
|
||||||
/// `PersistentBitMatrix::open`'s own auto-detection falls all the way
|
|
||||||
/// through to the `Implicit` (mono-genome, all-present) case, silently
|
|
||||||
/// corrupting every read.
|
|
||||||
pub(super) fn open(layer_dir: &Path, mode: &IndexMode, with_counts: bool) -> OLMResult<Self> {
|
pub(super) fn open(layer_dir: &Path, mode: &IndexMode, with_counts: bool) -> OLMResult<Self> {
|
||||||
if with_counts && layer_dir.join("counts").exists() {
|
if with_counts && layer_dir.join("counts").exists() {
|
||||||
return Layer::<PersistentCompactIntMatrix>::open(layer_dir, mode).map(Mat::Count);
|
return Layer::<PersistentCompactIntMatrix>::open(layer_dir, mode).map(Mat::Count);
|
||||||
}
|
}
|
||||||
if layer_dir.join("presence").join("is_multi.prsb").exists() {
|
Layer::<PersistentBitMatrix>::open(layer_dir, mode).map(Mat::Presence)
|
||||||
Layer::<PersistentSparseBitMatrix>::open(layer_dir, mode).map(Mat::SparsePresence)
|
|
||||||
} else {
|
|
||||||
Layer::<PersistentBitMatrix>::open(layer_dir, mode).map(Mat::Presence)
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
fn find_slot(&self, kmer: CanonicalKmer) -> Option<usize> {
|
fn find_slot(&self, kmer: CanonicalKmer) -> Option<usize> {
|
||||||
match self {
|
match self {
|
||||||
Mat::Count(l) => l.find_slot(kmer),
|
Mat::Count(l) => l.find_slot(kmer),
|
||||||
Mat::Presence(l) => l.find_slot(kmer),
|
Mat::Presence(l) => l.find_slot(kmer),
|
||||||
Mat::SparsePresence(l) => l.find_slot(kmer),
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -95,7 +88,6 @@ impl Mat {
|
|||||||
match self {
|
match self {
|
||||||
Mat::Count(l) => l.index_batch(kmers),
|
Mat::Count(l) => l.index_batch(kmers),
|
||||||
Mat::Presence(l) => l.index_batch(kmers),
|
Mat::Presence(l) => l.index_batch(kmers),
|
||||||
Mat::SparsePresence(l) => l.index_batch(kmers),
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -110,7 +102,6 @@ impl Mat {
|
|||||||
match self {
|
match self {
|
||||||
Mat::Count(l) => l.iter_minorants_batch(annex, batch_size),
|
Mat::Count(l) => l.iter_minorants_batch(annex, batch_size),
|
||||||
Mat::Presence(l) => l.iter_minorants_batch(annex, batch_size),
|
Mat::Presence(l) => l.iter_minorants_batch(annex, batch_size),
|
||||||
Mat::SparsePresence(l) => l.iter_minorants_batch(annex, batch_size),
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -118,7 +109,6 @@ impl Mat {
|
|||||||
match self {
|
match self {
|
||||||
Mat::Count(l) => l.n_cols(),
|
Mat::Count(l) => l.n_cols(),
|
||||||
Mat::Presence(l) => l.n_cols(),
|
Mat::Presence(l) => l.n_cols(),
|
||||||
Mat::SparsePresence(l) => l.n_cols(),
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -138,7 +128,6 @@ impl Mat {
|
|||||||
pub(super) fn fill_sub_matrix_carries(&self, slots: &[usize], out: &mut [Vec<bool>]) {
|
pub(super) fn fill_sub_matrix_carries(&self, slots: &[usize], out: &mut [Vec<bool>]) {
|
||||||
match self {
|
match self {
|
||||||
Mat::Presence(l) => l.fill_sub_matrix(slots, out),
|
Mat::Presence(l) => l.fill_sub_matrix(slots, out),
|
||||||
Mat::SparsePresence(l) => l.fill_sub_matrix(slots, out),
|
|
||||||
Mat::Count(l) => {
|
Mat::Count(l) => {
|
||||||
let mut counts: Vec<Vec<u32>> = out.iter().map(|_| Vec::new()).collect();
|
let mut counts: Vec<Vec<u32>> = out.iter().map(|_| Vec::new()).collect();
|
||||||
l.fill_sub_matrix(slots, &mut counts);
|
l.fill_sub_matrix(slots, &mut counts);
|
||||||
@@ -169,7 +158,11 @@ pub(super) struct PartitionCache {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl PartitionCache {
|
impl PartitionCache {
|
||||||
pub(super) fn build(partition: &KmerPartition, n_parts: usize, with_counts: bool) -> OKIResult<Self> {
|
pub(super) fn build(
|
||||||
|
partition: &KmerPartitions,
|
||||||
|
n_parts: usize,
|
||||||
|
with_counts: bool,
|
||||||
|
) -> OKIResult<Self> {
|
||||||
let pb = progress_bar("open_partitions", n_parts as u64, "partitions");
|
let pb = progress_bar("open_partitions", n_parts as u64, "partitions");
|
||||||
let built: Vec<(Vec<Mat>, usize)> = (0..n_parts)
|
let built: Vec<(Vec<Mat>, usize)> = (0..n_parts)
|
||||||
.into_par_iter()
|
.into_par_iter()
|
||||||
@@ -182,7 +175,10 @@ impl PartitionCache {
|
|||||||
let meta = partition.partition_meta(part)?;
|
let meta = partition.partition_meta(part)?;
|
||||||
let mut mats = Vec::with_capacity(meta.n_layers);
|
let mut mats = Vec::with_capacity(meta.n_layers);
|
||||||
for l in 0..meta.n_layers {
|
for l in 0..meta.n_layers {
|
||||||
let Ok(mat) = Mat::open(&partition.layer_dir(part, l), &meta.mode, with_counts) else { continue };
|
let Ok(mat) = Mat::open(&partition.layer_dir(part, l), &meta.mode, with_counts)
|
||||||
|
else {
|
||||||
|
continue;
|
||||||
|
};
|
||||||
mats.push(mat);
|
mats.push(mat);
|
||||||
}
|
}
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
@@ -257,7 +253,9 @@ impl PartitionCache {
|
|||||||
n_genomes: usize,
|
n_genomes: usize,
|
||||||
mut on_hit: impl FnMut(usize, u8, usize),
|
mut on_hit: impl FnMut(usize, u8, usize),
|
||||||
) {
|
) {
|
||||||
let Some(mats) = self.mats.get(dest_partition) else { return };
|
let Some(mats) = self.mats.get(dest_partition) else {
|
||||||
|
return;
|
||||||
|
};
|
||||||
|
|
||||||
// First hit wins, same semantics as the old per-query loop (a
|
// First hit wins, same semantics as the old per-query loop (a
|
||||||
// variant present in an earlier layer shadows later ones).
|
// variant present in an earlier layer shadows later ones).
|
||||||
@@ -297,7 +295,9 @@ impl PartitionCache {
|
|||||||
n_genomes: usize,
|
n_genomes: usize,
|
||||||
mut on_hit: impl FnMut(usize, u8, usize),
|
mut on_hit: impl FnMut(usize, u8, usize),
|
||||||
) {
|
) {
|
||||||
let Some(mats) = self.mats.get(dest_partition) else { return };
|
let Some(mats) = self.mats.get(dest_partition) else {
|
||||||
|
return;
|
||||||
|
};
|
||||||
|
|
||||||
let mut by_layer: Vec<Vec<(CanonicalKmer, usize, u8)>> = vec![Vec::new(); mats.len()];
|
let mut by_layer: Vec<Vec<(CanonicalKmer, usize, u8)>> = vec![Vec::new(); mats.len()];
|
||||||
for &(variant, family_idx, base, layer) in queries {
|
for &(variant, family_idx, base, layer) in queries {
|
||||||
@@ -311,7 +311,8 @@ impl PartitionCache {
|
|||||||
continue;
|
continue;
|
||||||
}
|
}
|
||||||
let mat = &mats[li];
|
let mat = &mats[li];
|
||||||
let variants: Vec<CanonicalKmer> = entries.iter().map(|&(variant, _, _)| variant).collect();
|
let variants: Vec<CanonicalKmer> =
|
||||||
|
entries.iter().map(|&(variant, _, _)| variant).collect();
|
||||||
let slots = mat.index_batch(&variants);
|
let slots = mat.index_batch(&variants);
|
||||||
let hits: Vec<(usize, usize, u8)> = slots
|
let hits: Vec<(usize, usize, u8)> = slots
|
||||||
.into_iter()
|
.into_iter()
|
||||||
|
|||||||
@@ -2,15 +2,15 @@ use std::sync::Arc;
|
|||||||
|
|
||||||
use ndarray::Array2;
|
use ndarray::Array2;
|
||||||
|
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikindex::{OKIError, OKIResult};
|
|
||||||
use obikindex::KmerIndex;
|
use obikindex::KmerIndex;
|
||||||
|
use obikindex::{OKIError, OKIResult};
|
||||||
|
|
||||||
use super::cache::PartitionCache;
|
use super::cache::PartitionCache;
|
||||||
use super::distance::RawSnpDistanceOutput;
|
use super::distance::RawSnpDistanceOutput;
|
||||||
use super::family_scan::{scan_layer_families, Selection};
|
use super::family_scan::{Selection, scan_layer_families};
|
||||||
|
|
||||||
/// See [`KmerIndex::cardinality_tally`].
|
/// See [`KmerIndex::cardinality_tally`].
|
||||||
pub struct CardinalityTally {
|
pub struct CardinalityTally {
|
||||||
@@ -52,11 +52,19 @@ pub trait CardinalityExt {
|
|||||||
/// gets the matching restriction via `scan_family_pairs`'s new
|
/// gets the matching restriction via `scan_family_pairs`'s new
|
||||||
/// `variable` flag, rather than a `family_size()` check of its own (it
|
/// `variable` flag, rather than a `family_size()` check of its own (it
|
||||||
/// doesn't have direct access to the family's mask).
|
/// doesn't have direct access to the family's mask).
|
||||||
fn cardinality_tally(&self, raw: &RawSnpDistanceOutput, ratio_ceiling: f64) -> OKIResult<CardinalityTally>;
|
fn cardinality_tally(
|
||||||
|
&self,
|
||||||
|
raw: &RawSnpDistanceOutput,
|
||||||
|
ratio_ceiling: f64,
|
||||||
|
) -> OKIResult<CardinalityTally>;
|
||||||
}
|
}
|
||||||
|
|
||||||
impl CardinalityExt for KmerIndex {
|
impl CardinalityExt for KmerIndex {
|
||||||
fn cardinality_tally(&self, raw: &RawSnpDistanceOutput, ratio_ceiling: f64) -> OKIResult<CardinalityTally> {
|
fn cardinality_tally(
|
||||||
|
&self,
|
||||||
|
raw: &RawSnpDistanceOutput,
|
||||||
|
ratio_ceiling: f64,
|
||||||
|
) -> OKIResult<CardinalityTally> {
|
||||||
let n_parts = self.n_partitions();
|
let n_parts = self.n_partitions();
|
||||||
let n_genomes = self.meta().genomes.len();
|
let n_genomes = self.meta().genomes.len();
|
||||||
let with_counts = self.meta().config.with_counts;
|
let with_counts = self.meta().config.with_counts;
|
||||||
@@ -72,7 +80,7 @@ impl CardinalityExt for KmerIndex {
|
|||||||
total > 0 && (snp as f64 / total as f64) <= ratio_ceiling
|
total > 0 && (snp as f64 / total as f64) <= ratio_ceiling
|
||||||
});
|
});
|
||||||
|
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
self.root_path(),
|
self.root_path(),
|
||||||
self.kmer_size(),
|
self.kmer_size(),
|
||||||
self.minimizer_size(),
|
self.minimizer_size(),
|
||||||
@@ -89,33 +97,42 @@ impl CardinalityExt for KmerIndex {
|
|||||||
// family comes back — no per-layer buffer.
|
// family comes back — no per-layer buffer.
|
||||||
let mut total = [[0u64; 5]; 5];
|
let mut total = [[0u64; 5]; 5];
|
||||||
for layer_dir in &layer_dirs {
|
for layer_dir in &layer_dirs {
|
||||||
scan_layer_families(layer_dir, n_parts, n_genomes, with_counts, k, &cache, &Selection::All, |_family_idx, mask, genome_mask| {
|
scan_layer_families(
|
||||||
if mask.family_size() < 2 {
|
layer_dir,
|
||||||
// Fully invariant family (never varies anywhere in
|
n_parts,
|
||||||
// the index) — genome-wide background, not
|
n_genomes,
|
||||||
// SNP-adjacent signal; would otherwise swamp the
|
with_counts,
|
||||||
// diagonal (`c=1/c=1` etc.), which needs to reflect
|
k,
|
||||||
// the same variable-families-only population the
|
&cache,
|
||||||
// `+ASC`-corrected alignment/likelihood actually
|
&Selection::All,
|
||||||
// models. See `base_pair_tally`'s `variable` gate
|
|_family_idx, mask, genome_mask| {
|
||||||
// on its own `same` diagonal for the matching fix.
|
if mask.family_size() < 2 {
|
||||||
return;
|
// Fully invariant family (never varies anywhere in
|
||||||
}
|
// the index) — genome-wide background, not
|
||||||
|
// SNP-adjacent signal; would otherwise swamp the
|
||||||
|
// diagonal (`c=1/c=1` etc.), which needs to reflect
|
||||||
|
// the same variable-families-only population the
|
||||||
|
// `+ASC`-corrected alignment/likelihood actually
|
||||||
|
// models. See `base_pair_tally`'s `variable` gate
|
||||||
|
// on its own `same` diagonal for the matching fix.
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
|
||||||
for i in 0..n_genomes {
|
for i in 0..n_genomes {
|
||||||
let card_i = genome_mask[i].count_ones() as usize;
|
let card_i = genome_mask[i].count_ones() as usize;
|
||||||
for j in (i + 1)..n_genomes {
|
for j in (i + 1)..n_genomes {
|
||||||
if !included[[i, j]] {
|
if !included[[i, j]] {
|
||||||
continue;
|
continue;
|
||||||
}
|
}
|
||||||
let card_j = genome_mask[j].count_ones() as usize;
|
let card_j = genome_mask[j].count_ones() as usize;
|
||||||
total[card_i][card_j] += 1;
|
total[card_i][card_j] += 1;
|
||||||
if card_i != card_j {
|
if card_i != card_j {
|
||||||
total[card_j][card_i] += 1;
|
total[card_j][card_i] += 1;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
},
|
||||||
})?;
|
)?;
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
}
|
}
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
|
|||||||
@@ -2,14 +2,14 @@ use std::sync::Arc;
|
|||||||
|
|
||||||
use ndarray::Array2;
|
use ndarray::Array2;
|
||||||
|
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikindex::{OKIError, OKIResult};
|
|
||||||
use obikindex::KmerIndex;
|
use obikindex::KmerIndex;
|
||||||
|
use obikindex::{OKIError, OKIResult};
|
||||||
|
|
||||||
use super::cache::PartitionCache;
|
use super::cache::PartitionCache;
|
||||||
use super::family_scan::{scan_layer_families, Selection};
|
use super::family_scan::{Selection, scan_layer_families};
|
||||||
|
|
||||||
/// Raw p-distance restricted to loci that are single-copy in **both**
|
/// Raw p-distance restricted to loci that are single-copy in **both**
|
||||||
/// genomes of a pair — the "stringent / paralogy-aware" locus eligibility
|
/// genomes of a pair — the "stringent / paralogy-aware" locus eligibility
|
||||||
@@ -72,7 +72,7 @@ where
|
|||||||
let k = index.kmer_size();
|
let k = index.kmer_size();
|
||||||
let n_bits = n_parts.trailing_zeros() as usize;
|
let n_bits = n_parts.trailing_zeros() as usize;
|
||||||
|
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
index.root_path(),
|
index.root_path(),
|
||||||
index.kmer_size(),
|
index.kmer_size(),
|
||||||
index.minimizer_size(),
|
index.minimizer_size(),
|
||||||
@@ -82,15 +82,23 @@ where
|
|||||||
let cache = Arc::new(PartitionCache::build(&partition, n_parts, with_counts)?);
|
let cache = Arc::new(PartitionCache::build(&partition, n_parts, with_counts)?);
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(index)?;
|
let layer_dirs = super::family_scan::sibling_layer_dirs(index)?;
|
||||||
|
|
||||||
let pb = progress_bar(label, layer_dirs.len() as u64, "layers");
|
let pb = progress_bar(label, layer_dirs.len() as u64, "layers");
|
||||||
// One layer at a time — see `snp_pseudo_alignment`'s comment for why
|
// One layer at a time — see `snp_pseudo_alignment`'s comment for why
|
||||||
// `par_iter()` over layers would defeat `scan_layer_families`'s
|
// `par_iter()` over layers would defeat `scan_layer_families`'s
|
||||||
// partition-grouped locality.
|
// partition-grouped locality.
|
||||||
let mut total = zero();
|
let mut total = zero();
|
||||||
for layer_dir in &layer_dirs {
|
for layer_dir in &layer_dirs {
|
||||||
let mut acc = zero();
|
let mut acc = zero();
|
||||||
|
|
||||||
scan_layer_families(layer_dir, n_parts, n_genomes, with_counts, k, &cache, &Selection::All, |_family_idx, mask, genome_mask| {
|
scan_layer_families(
|
||||||
|
layer_dir,
|
||||||
|
n_parts,
|
||||||
|
n_genomes,
|
||||||
|
with_counts,
|
||||||
|
k,
|
||||||
|
&cache,
|
||||||
|
&Selection::All,
|
||||||
|
|_family_idx, mask, genome_mask| {
|
||||||
let variable = mask.family_size() >= 2;
|
let variable = mask.family_size() >= 2;
|
||||||
|
|
||||||
// Per genome: which single form (if exactly one) it
|
// Per genome: which single form (if exactly one) it
|
||||||
@@ -109,15 +117,16 @@ where
|
|||||||
on_pair(&mut acc, i, j, bi, bj, variable);
|
on_pair(&mut acc, i, j, bi, bj, variable);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
})?;
|
},
|
||||||
|
)?;
|
||||||
|
|
||||||
total = combine(total, acc);
|
total = combine(total, acc);
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
}
|
|
||||||
pb.finish_and_clear();
|
|
||||||
|
|
||||||
Ok(total)
|
|
||||||
}
|
}
|
||||||
|
pb.finish_and_clear();
|
||||||
|
|
||||||
|
Ok(total)
|
||||||
|
}
|
||||||
|
|
||||||
/// Adds [`raw_snp_distance`](Self::raw_snp_distance) and
|
/// Adds [`raw_snp_distance`](Self::raw_snp_distance) and
|
||||||
/// [`base_pair_tally`](Self::base_pair_tally) to `KmerIndex`.
|
/// [`base_pair_tally`](Self::base_pair_tally) to `KmerIndex`.
|
||||||
@@ -141,7 +150,11 @@ pub trait DistanceExt {
|
|||||||
/// keeps aggregate SNP/shared counts per genome pair, not which bases
|
/// keeps aggregate SNP/shared counts per genome pair, not which bases
|
||||||
/// were actually involved at each locus, and the ratio-ceiling filter
|
/// were actually involved at each locus, and the ratio-ceiling filter
|
||||||
/// can only be evaluated once the aggregate counts are known.
|
/// can only be evaluated once the aggregate counts are known.
|
||||||
fn base_pair_tally(&self, raw: &RawSnpDistanceOutput, ratio_ceiling: f64) -> OKIResult<BasePairTally>;
|
fn base_pair_tally(
|
||||||
|
&self,
|
||||||
|
raw: &RawSnpDistanceOutput,
|
||||||
|
ratio_ceiling: f64,
|
||||||
|
) -> OKIResult<BasePairTally>;
|
||||||
}
|
}
|
||||||
|
|
||||||
impl DistanceExt for KmerIndex {
|
impl DistanceExt for KmerIndex {
|
||||||
@@ -150,7 +163,12 @@ impl DistanceExt for KmerIndex {
|
|||||||
let (snp, shared) = scan_family_pairs(
|
let (snp, shared) = scan_family_pairs(
|
||||||
self,
|
self,
|
||||||
"raw_snp_distance",
|
"raw_snp_distance",
|
||||||
|| (Array2::<u64>::zeros((n_genomes, n_genomes)), Array2::<u64>::zeros((n_genomes, n_genomes))),
|
|| {
|
||||||
|
(
|
||||||
|
Array2::<u64>::zeros((n_genomes, n_genomes)),
|
||||||
|
Array2::<u64>::zeros((n_genomes, n_genomes)),
|
||||||
|
)
|
||||||
|
},
|
||||||
|(snp, shared), i, j, bi, bj, _variable| {
|
|(snp, shared), i, j, bi, bj, _variable| {
|
||||||
if bi == bj {
|
if bi == bj {
|
||||||
shared[[i, j]] += 1;
|
shared[[i, j]] += 1;
|
||||||
@@ -169,7 +187,11 @@ impl DistanceExt for KmerIndex {
|
|||||||
Ok(RawSnpDistanceOutput { snp, shared })
|
Ok(RawSnpDistanceOutput { snp, shared })
|
||||||
}
|
}
|
||||||
|
|
||||||
fn base_pair_tally(&self, raw: &RawSnpDistanceOutput, ratio_ceiling: f64) -> OKIResult<BasePairTally> {
|
fn base_pair_tally(
|
||||||
|
&self,
|
||||||
|
raw: &RawSnpDistanceOutput,
|
||||||
|
ratio_ceiling: f64,
|
||||||
|
) -> OKIResult<BasePairTally> {
|
||||||
let n_genomes = self.meta().genomes.len();
|
let n_genomes = self.meta().genomes.len();
|
||||||
let included = Array2::from_shape_fn((n_genomes, n_genomes), |(i, j)| {
|
let included = Array2::from_shape_fn((n_genomes, n_genomes), |(i, j)| {
|
||||||
if i == j {
|
if i == j {
|
||||||
|
|||||||
@@ -13,14 +13,14 @@ use std::io::{BufWriter, Write};
|
|||||||
use std::path::{Path, PathBuf};
|
use std::path::{Path, PathBuf};
|
||||||
use std::sync::Arc;
|
use std::sync::Arc;
|
||||||
|
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikindex::{OKIError, OKIResult};
|
|
||||||
use obikindex::KmerIndex;
|
use obikindex::KmerIndex;
|
||||||
|
use obikindex::{OKIError, OKIResult};
|
||||||
|
|
||||||
use super::cache::PartitionCache;
|
use super::cache::PartitionCache;
|
||||||
use super::entropy_annex::{EntropyAnnexBuilder, ENTROPY_ANNEX_FILE_NAME};
|
use super::entropy_annex::{ENTROPY_ANNEX_FILE_NAME, EntropyAnnexBuilder};
|
||||||
use super::family_scan::{Selection, scan_layer_families};
|
use super::family_scan::{Selection, scan_layer_families};
|
||||||
use super::subsample::EntropyBias;
|
use super::subsample::EntropyBias;
|
||||||
|
|
||||||
@@ -120,18 +120,28 @@ pub trait ShannonEntropyExt {
|
|||||||
/// `DevDocMD/architecture/siblings.md`, "Entropy-biased selection") —
|
/// `DevDocMD/architecture/siblings.md`, "Entropy-biased selection") —
|
||||||
/// useful here specifically to see the biased sample's own entropy
|
/// useful here specifically to see the biased sample's own entropy
|
||||||
/// distribution, not just to speed up a distance computation.
|
/// distribution, not just to speed up a distance computation.
|
||||||
fn shannon_entropy_csv(&self, path: &Path, subsample: Option<usize>, entropy_bias: Option<EntropyBias>) -> OKIResult<()>;
|
fn shannon_entropy_csv(
|
||||||
|
&self,
|
||||||
|
path: &Path,
|
||||||
|
subsample: Option<usize>,
|
||||||
|
entropy_bias: Option<EntropyBias>,
|
||||||
|
) -> OKIResult<()>;
|
||||||
}
|
}
|
||||||
|
|
||||||
impl ShannonEntropyExt for KmerIndex {
|
impl ShannonEntropyExt for KmerIndex {
|
||||||
fn shannon_entropy_csv(&self, path: &Path, subsample: Option<usize>, entropy_bias: Option<EntropyBias>) -> OKIResult<()> {
|
fn shannon_entropy_csv(
|
||||||
|
&self,
|
||||||
|
path: &Path,
|
||||||
|
subsample: Option<usize>,
|
||||||
|
entropy_bias: Option<EntropyBias>,
|
||||||
|
) -> OKIResult<()> {
|
||||||
let n_parts = self.n_partitions();
|
let n_parts = self.n_partitions();
|
||||||
let n_genomes = self.meta().genomes.len();
|
let n_genomes = self.meta().genomes.len();
|
||||||
let with_counts = self.meta().config.with_counts;
|
let with_counts = self.meta().config.with_counts;
|
||||||
let k = self.kmer_size();
|
let k = self.kmer_size();
|
||||||
let n_bits = n_parts.trailing_zeros() as usize;
|
let n_bits = n_parts.trailing_zeros() as usize;
|
||||||
|
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
self.root_path(),
|
self.root_path(),
|
||||||
self.kmer_size(),
|
self.kmer_size(),
|
||||||
self.minimizer_size(),
|
self.minimizer_size(),
|
||||||
@@ -140,31 +150,53 @@ impl ShannonEntropyExt for KmerIndex {
|
|||||||
.map_err(OKIError::Partition)?;
|
.map_err(OKIError::Partition)?;
|
||||||
let cache = Arc::new(PartitionCache::build(&partition, n_parts, with_counts)?);
|
let cache = Arc::new(PartitionCache::build(&partition, n_parts, with_counts)?);
|
||||||
let layer_dirs = super::family_scan::sibling_layer_dirs(self)?;
|
let layer_dirs = super::family_scan::sibling_layer_dirs(self)?;
|
||||||
let selections = super::subsample::compute_selections(self, &layer_dirs, subsample, entropy_bias)?;
|
let selections =
|
||||||
|
super::subsample::compute_selections(self, &layer_dirs, subsample, entropy_bias)?;
|
||||||
|
|
||||||
let mut f = BufWriter::new(std::fs::File::create(path).map_err(OKIError::Io)?);
|
let mut f = BufWriter::new(std::fs::File::create(path).map_err(OKIError::Io)?);
|
||||||
writeln!(f, "layer,family_idx,entropy15,entropy4,family_size,n_genomes_present").map_err(OKIError::Io)?;
|
writeln!(
|
||||||
|
f,
|
||||||
|
"layer,family_idx,entropy15,entropy4,family_size,n_genomes_present"
|
||||||
|
)
|
||||||
|
.map_err(OKIError::Io)?;
|
||||||
|
|
||||||
let pb = progress_bar("shannon_entropy", layer_dirs.len() as u64, "layers");
|
let pb = progress_bar("shannon_entropy", layer_dirs.len() as u64, "layers");
|
||||||
for (layer_ord, (layer_dir, layer_selection)) in layer_dirs.iter().zip(selections.iter()).enumerate() {
|
for (layer_ord, (layer_dir, layer_selection)) in
|
||||||
|
layer_dirs.iter().zip(selections.iter()).enumerate()
|
||||||
|
{
|
||||||
let selection = match layer_selection {
|
let selection = match layer_selection {
|
||||||
None => Selection::All,
|
None => Selection::All,
|
||||||
Some(set) => Selection::Some(set),
|
Some(set) => Selection::Some(set),
|
||||||
};
|
};
|
||||||
let mut write_err = None;
|
let mut write_err = None;
|
||||||
scan_layer_families(layer_dir, n_parts, n_genomes, with_counts, k, &cache, &selection, |family_idx, mask, genome_mask| {
|
scan_layer_families(
|
||||||
if write_err.is_some() {
|
layer_dir,
|
||||||
return;
|
n_parts,
|
||||||
}
|
n_genomes,
|
||||||
if mask.family_size() < 2 {
|
with_counts,
|
||||||
return; // monomorphic family — entropy trivially 0, no signal, skip
|
k,
|
||||||
}
|
&cache,
|
||||||
let Some((h15, n_present)) = family_entropy(genome_mask) else { return };
|
&selection,
|
||||||
let h4 = family_entropy_4(genome_mask).map_or(0.0, |(h, _)| h);
|
|family_idx, mask, genome_mask| {
|
||||||
if let Err(e) = writeln!(f, "{layer_ord},{family_idx},{h15:.6},{h4:.6},{},{n_present}", mask.family_size()) {
|
if write_err.is_some() {
|
||||||
write_err = Some(e);
|
return;
|
||||||
}
|
}
|
||||||
})?;
|
if mask.family_size() < 2 {
|
||||||
|
return; // monomorphic family — entropy trivially 0, no signal, skip
|
||||||
|
}
|
||||||
|
let Some((h15, n_present)) = family_entropy(genome_mask) else {
|
||||||
|
return;
|
||||||
|
};
|
||||||
|
let h4 = family_entropy_4(genome_mask).map_or(0.0, |(h, _)| h);
|
||||||
|
if let Err(e) = writeln!(
|
||||||
|
f,
|
||||||
|
"{layer_ord},{family_idx},{h15:.6},{h4:.6},{},{n_present}",
|
||||||
|
mask.family_size()
|
||||||
|
) {
|
||||||
|
write_err = Some(e);
|
||||||
|
}
|
||||||
|
},
|
||||||
|
)?;
|
||||||
if let Some(e) = write_err {
|
if let Some(e) = write_err {
|
||||||
return Err(OKIError::Io(e));
|
return Err(OKIError::Io(e));
|
||||||
}
|
}
|
||||||
@@ -194,7 +226,9 @@ impl ShannonEntropyExt for KmerIndex {
|
|||||||
/// `scan_layer_families`'s expensive per-genome resolution for the ~98%
|
/// `scan_layer_families`'s expensive per-genome resolution for the ~98%
|
||||||
/// of minorants that are monomorphic only to discard the result.
|
/// of minorants that are monomorphic only to discard the result.
|
||||||
pub(super) fn ensure_entropy_annexes(index: &KmerIndex, layer_dirs: &[PathBuf]) -> OKIResult<()> {
|
pub(super) fn ensure_entropy_annexes(index: &KmerIndex, layer_dirs: &[PathBuf]) -> OKIResult<()> {
|
||||||
let missing: Vec<usize> = layer_dirs.iter().enumerate()
|
let missing: Vec<usize> = layer_dirs
|
||||||
|
.iter()
|
||||||
|
.enumerate()
|
||||||
.filter(|(_, dir)| !dir.join(ENTROPY_ANNEX_FILE_NAME).exists())
|
.filter(|(_, dir)| !dir.join(ENTROPY_ANNEX_FILE_NAME).exists())
|
||||||
.map(|(i, _)| i)
|
.map(|(i, _)| i)
|
||||||
.collect();
|
.collect();
|
||||||
@@ -208,7 +242,7 @@ pub(super) fn ensure_entropy_annexes(index: &KmerIndex, layer_dirs: &[PathBuf])
|
|||||||
let k = index.kmer_size();
|
let k = index.kmer_size();
|
||||||
let n_bits = n_parts.trailing_zeros() as usize;
|
let n_bits = n_parts.trailing_zeros() as usize;
|
||||||
|
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
index.root_path(),
|
index.root_path(),
|
||||||
index.kmer_size(),
|
index.kmer_size(),
|
||||||
index.minimizer_size(),
|
index.minimizer_size(),
|
||||||
@@ -221,15 +255,30 @@ pub(super) fn ensure_entropy_annexes(index: &KmerIndex, layer_dirs: &[PathBuf])
|
|||||||
let pb = progress_bar("entropy_annex_build", missing.len() as u64, "layers");
|
let pb = progress_bar("entropy_annex_build", missing.len() as u64, "layers");
|
||||||
for &li in &missing {
|
for &li in &missing {
|
||||||
let layer_dir = &layer_dirs[li];
|
let layer_dir = &layer_dirs[li];
|
||||||
let mut builder = EntropyAnnexBuilder::new(minorant_counts[li] as usize, &layer_dir.join(ENTROPY_ANNEX_FILE_NAME))
|
let mut builder = EntropyAnnexBuilder::new(
|
||||||
.map_err(OKIError::Io)?;
|
minorant_counts[li] as usize,
|
||||||
|
&layer_dir.join(ENTROPY_ANNEX_FILE_NAME),
|
||||||
|
)
|
||||||
|
.map_err(OKIError::Io)?;
|
||||||
let eligible = super::subsample::non_monomorphic_selection_layer(layer_dir)?;
|
let eligible = super::subsample::non_monomorphic_selection_layer(layer_dir)?;
|
||||||
scan_layer_families(layer_dir, n_parts, n_genomes, with_counts, k, &cache, &Selection::Some(&eligible), |family_idx, mask, genome_mask| {
|
scan_layer_families(
|
||||||
debug_assert!(mask.family_size() >= 2, "Selection::Some(eligible) must only visit non-monomorphic minorants");
|
layer_dir,
|
||||||
if let Some((h15, _)) = family_entropy(genome_mask) {
|
n_parts,
|
||||||
builder.set(family_idx, h15 as f32);
|
n_genomes,
|
||||||
}
|
with_counts,
|
||||||
})?;
|
k,
|
||||||
|
&cache,
|
||||||
|
&Selection::Some(&eligible),
|
||||||
|
|family_idx, mask, genome_mask| {
|
||||||
|
debug_assert!(
|
||||||
|
mask.family_size() >= 2,
|
||||||
|
"Selection::Some(eligible) must only visit non-monomorphic minorants"
|
||||||
|
);
|
||||||
|
if let Some((h15, _)) = family_entropy(genome_mask) {
|
||||||
|
builder.set(family_idx, h15 as f32);
|
||||||
|
}
|
||||||
|
},
|
||||||
|
)?;
|
||||||
builder.close().map_err(OKIError::Io)?;
|
builder.close().map_err(OKIError::Io)?;
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -29,18 +29,18 @@ use std::sync::Arc;
|
|||||||
|
|
||||||
use ndarray::Array2;
|
use ndarray::Array2;
|
||||||
|
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikindex::{OKIError, OKIResult};
|
|
||||||
use obikindex::KmerIndex;
|
use obikindex::KmerIndex;
|
||||||
|
use obikindex::{OKIError, OKIResult};
|
||||||
|
|
||||||
use super::alignment::{iupac_code, SnpAlignment};
|
use super::alignment::{SnpAlignment, iupac_code};
|
||||||
use super::cache::PartitionCache;
|
use super::cache::PartitionCache;
|
||||||
use super::cardinality::CardinalityTally;
|
use super::cardinality::CardinalityTally;
|
||||||
use super::distance::{BasePairTally, RawSnpDistanceOutput};
|
use super::distance::{BasePairTally, RawSnpDistanceOutput};
|
||||||
use super::family_scan::{scan_layer_families, sibling_layer_dirs, Selection};
|
use super::family_scan::{Selection, scan_layer_families, sibling_layer_dirs};
|
||||||
use super::subsample::{compute_selections, EntropyBias};
|
use super::subsample::{EntropyBias, compute_selections};
|
||||||
|
|
||||||
/// Every output the `--sankoff`/`--tnt`/`--phyg`/`--iqtree` pipeline needs,
|
/// Every output the `--sankoff`/`--tnt`/`--phyg`/`--iqtree` pipeline needs,
|
||||||
/// computed together from one shared, possibly-subsampled/entropy-biased
|
/// computed together from one shared, possibly-subsampled/entropy-biased
|
||||||
@@ -85,7 +85,7 @@ impl SankoffBundleExt for KmerIndex {
|
|||||||
let k = self.kmer_size();
|
let k = self.kmer_size();
|
||||||
let n_bits = n_parts.trailing_zeros() as usize;
|
let n_bits = n_parts.trailing_zeros() as usize;
|
||||||
|
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
self.root_path(),
|
self.root_path(),
|
||||||
self.kmer_size(),
|
self.kmer_size(),
|
||||||
self.minimizer_size(),
|
self.minimizer_size(),
|
||||||
@@ -108,25 +108,34 @@ impl SankoffBundleExt for KmerIndex {
|
|||||||
None => Selection::All,
|
None => Selection::All,
|
||||||
Some(set) => Selection::Some(set),
|
Some(set) => Selection::Some(set),
|
||||||
};
|
};
|
||||||
scan_layer_families(layer_dir, n_parts, n_genomes, with_counts, k, &cache, &selection, |_family_idx, _mask, genome_mask| {
|
scan_layer_families(
|
||||||
let single_form = |g: usize| -> Option<u8> {
|
layer_dir,
|
||||||
let m = genome_mask[g];
|
n_parts,
|
||||||
(m.count_ones() == 1).then(|| m.trailing_zeros() as u8)
|
n_genomes,
|
||||||
};
|
with_counts,
|
||||||
for i in 0..n_genomes {
|
k,
|
||||||
let Some(bi) = single_form(i) else { continue };
|
&cache,
|
||||||
for j in (i + 1)..n_genomes {
|
&selection,
|
||||||
let Some(bj) = single_form(j) else { continue };
|
|_family_idx, _mask, genome_mask| {
|
||||||
if bi == bj {
|
let single_form = |g: usize| -> Option<u8> {
|
||||||
shared[[i, j]] += 1;
|
let m = genome_mask[g];
|
||||||
shared[[j, i]] += 1;
|
(m.count_ones() == 1).then(|| m.trailing_zeros() as u8)
|
||||||
} else {
|
};
|
||||||
snp[[i, j]] += 1;
|
for i in 0..n_genomes {
|
||||||
snp[[j, i]] += 1;
|
let Some(bi) = single_form(i) else { continue };
|
||||||
|
for j in (i + 1)..n_genomes {
|
||||||
|
let Some(bj) = single_form(j) else { continue };
|
||||||
|
if bi == bj {
|
||||||
|
shared[[i, j]] += 1;
|
||||||
|
shared[[j, i]] += 1;
|
||||||
|
} else {
|
||||||
|
snp[[i, j]] += 1;
|
||||||
|
snp[[j, i]] += 1;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
},
|
||||||
})?;
|
)?;
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
}
|
}
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
@@ -168,69 +177,83 @@ impl SankoffBundleExt for KmerIndex {
|
|||||||
None => Selection::All,
|
None => Selection::All,
|
||||||
Some(set) => Selection::Some(set),
|
Some(set) => Selection::Some(set),
|
||||||
};
|
};
|
||||||
scan_layer_families(layer_dir, n_parts, n_genomes, with_counts, k, &cache, &selection, |_family_idx, mask, genome_mask| {
|
scan_layer_families(
|
||||||
let variable = mask.family_size() >= 2;
|
layer_dir,
|
||||||
|
n_parts,
|
||||||
|
n_genomes,
|
||||||
|
with_counts,
|
||||||
|
k,
|
||||||
|
&cache,
|
||||||
|
&selection,
|
||||||
|
|_family_idx, mask, genome_mask| {
|
||||||
|
let variable = mask.family_size() >= 2;
|
||||||
|
|
||||||
// base-pair tally — same pairwise single-form resolution as pass A.
|
// base-pair tally — same pairwise single-form resolution as pass A.
|
||||||
let single_form = |g: usize| -> Option<u8> {
|
let single_form = |g: usize| -> Option<u8> {
|
||||||
let m = genome_mask[g];
|
let m = genome_mask[g];
|
||||||
(m.count_ones() == 1).then(|| m.trailing_zeros() as u8)
|
(m.count_ones() == 1).then(|| m.trailing_zeros() as u8)
|
||||||
};
|
};
|
||||||
for i in 0..n_genomes {
|
|
||||||
let Some(bi) = single_form(i) else { continue };
|
|
||||||
for j in (i + 1)..n_genomes {
|
|
||||||
let Some(bj) = single_form(j) else { continue };
|
|
||||||
if !included[[i, j]] {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
if bi != bj {
|
|
||||||
bp_counts[bi as usize][bj as usize] += 1;
|
|
||||||
bp_counts[bj as usize][bi as usize] += 1;
|
|
||||||
} else if variable {
|
|
||||||
bp_same[bi as usize] += 1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// cardinality tally — restricted to variable families, see
|
|
||||||
// `CardinalityExt::cardinality_tally`'s docs for why.
|
|
||||||
if variable {
|
|
||||||
for i in 0..n_genomes {
|
for i in 0..n_genomes {
|
||||||
let card_i = genome_mask[i].count_ones() as usize;
|
let Some(bi) = single_form(i) else { continue };
|
||||||
for j in (i + 1)..n_genomes {
|
for j in (i + 1)..n_genomes {
|
||||||
|
let Some(bj) = single_form(j) else { continue };
|
||||||
if !included[[i, j]] {
|
if !included[[i, j]] {
|
||||||
continue;
|
continue;
|
||||||
}
|
}
|
||||||
let card_j = genome_mask[j].count_ones() as usize;
|
if bi != bj {
|
||||||
card_counts[card_i][card_j] += 1;
|
bp_counts[bi as usize][bj as usize] += 1;
|
||||||
if card_i != card_j {
|
bp_counts[bj as usize][bi as usize] += 1;
|
||||||
card_counts[card_j][card_i] += 1;
|
} else if variable {
|
||||||
|
bp_same[bi as usize] += 1;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
|
||||||
|
|
||||||
// pseudo-alignment — same variable-family gate as
|
// cardinality tally — restricted to variable families, see
|
||||||
// `snp_pseudo_alignment`. Every family the shared selection
|
// `CardinalityExt::cardinality_tally`'s docs for why.
|
||||||
// actually visits already satisfies this when the
|
if variable {
|
||||||
// selection is `Selection::Some` (only non-monomorphic
|
for i in 0..n_genomes {
|
||||||
// minorants are ever selected), but the explicit check
|
let card_i = genome_mask[i].count_ones() as usize;
|
||||||
// still matters under `Selection::All` (no `--subsample`),
|
for j in (i + 1)..n_genomes {
|
||||||
// which visits monomorphic minorants too.
|
if !included[[i, j]] {
|
||||||
if variable {
|
continue;
|
||||||
for (g, &m) in genome_mask.iter().enumerate() {
|
}
|
||||||
sequences[g].push(iupac_code(m));
|
let card_j = genome_mask[j].count_ones() as usize;
|
||||||
|
card_counts[card_i][card_j] += 1;
|
||||||
|
if card_i != card_j {
|
||||||
|
card_counts[card_j][card_i] += 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
|
||||||
})?;
|
// pseudo-alignment — same variable-family gate as
|
||||||
|
// `snp_pseudo_alignment`. Every family the shared selection
|
||||||
|
// actually visits already satisfies this when the
|
||||||
|
// selection is `Selection::Some` (only non-monomorphic
|
||||||
|
// minorants are ever selected), but the explicit check
|
||||||
|
// still matters under `Selection::All` (no `--subsample`),
|
||||||
|
// which visits monomorphic minorants too.
|
||||||
|
if variable {
|
||||||
|
for (g, &m) in genome_mask.iter().enumerate() {
|
||||||
|
sequences[g].push(iupac_code(m));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
},
|
||||||
|
)?;
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
}
|
}
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
|
|
||||||
Ok(SankoffBundle {
|
Ok(SankoffBundle {
|
||||||
raw,
|
raw,
|
||||||
base_pair_tally: BasePairTally { counts: bp_counts, same: bp_same },
|
base_pair_tally: BasePairTally {
|
||||||
cardinality_tally: CardinalityTally { counts: card_counts },
|
counts: bp_counts,
|
||||||
|
same: bp_same,
|
||||||
|
},
|
||||||
|
cardinality_tally: CardinalityTally {
|
||||||
|
counts: card_counts,
|
||||||
|
},
|
||||||
alignment: SnpAlignment { sequences },
|
alignment: SnpAlignment { sequences },
|
||||||
})
|
})
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -2,16 +2,16 @@ use std::sync::Arc;
|
|||||||
|
|
||||||
use rayon::prelude::*;
|
use rayon::prelude::*;
|
||||||
|
|
||||||
use obikpartitionner::KmerPartition;
|
use obikpartitionner::KmerPartitions;
|
||||||
use obisys::progress_bar;
|
use obisys::progress_bar;
|
||||||
|
|
||||||
use obikindex::{OKIError, OKIResult};
|
|
||||||
use obikindex::KmerIndex;
|
use obikindex::KmerIndex;
|
||||||
|
use obikindex::{OKIError, OKIResult};
|
||||||
|
|
||||||
use super::ANNEX_FILE_NAME;
|
use super::ANNEX_FILE_NAME;
|
||||||
use super::SiblingAnnex;
|
use super::SiblingAnnex;
|
||||||
use super::cache::PartitionCache;
|
use super::cache::PartitionCache;
|
||||||
use super::family_scan::{scan_layer_families, Selection};
|
use super::family_scan::{Selection, scan_layer_families};
|
||||||
|
|
||||||
/// Distribution of family sizes (1-4), read back from an already-built
|
/// Distribution of family sizes (1-4), read back from an already-built
|
||||||
/// annex (see [`super::build::SiblingAnnexBuildExt::build_sibling_annex`])
|
/// annex (see [`super::build::SiblingAnnexBuildExt::build_sibling_annex`])
|
||||||
@@ -81,7 +81,9 @@ impl SiblingStatsExt for KmerIndex {
|
|||||||
|mut counts, layer_dir| -> OKIResult<[u64; 4]> {
|
|mut counts, layer_dir| -> OKIResult<[u64; 4]> {
|
||||||
let annex = SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME))?;
|
let annex = SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME))?;
|
||||||
for slot in 0..annex.len() {
|
for slot in 0..annex.len() {
|
||||||
let Some(mask) = annex.get(slot) else { continue };
|
let Some(mask) = annex.get(slot) else {
|
||||||
|
continue;
|
||||||
|
};
|
||||||
if !mask.is_minorant() {
|
if !mask.is_minorant() {
|
||||||
continue; // family tallied once, at its minorant
|
continue; // family tallied once, at its minorant
|
||||||
}
|
}
|
||||||
@@ -112,7 +114,7 @@ impl SiblingStatsExt for KmerIndex {
|
|||||||
// Same whole-run cache as `build_sibling_annex` — see its docs for
|
// Same whole-run cache as `build_sibling_annex` — see its docs for
|
||||||
// why re-opening per lookup (or per call to a batching helper) is
|
// why re-opening per lookup (or per call to a batching helper) is
|
||||||
// not good enough on a real index.
|
// not good enough on a real index.
|
||||||
let partition = KmerPartition::open_with_config(
|
let partition = KmerPartitions::open_with_config(
|
||||||
self.root_path(),
|
self.root_path(),
|
||||||
self.kmer_size(),
|
self.kmer_size(),
|
||||||
self.minimizer_size(),
|
self.minimizer_size(),
|
||||||
@@ -131,18 +133,27 @@ impl SiblingStatsExt for KmerIndex {
|
|||||||
..Default::default()
|
..Default::default()
|
||||||
};
|
};
|
||||||
for layer_dir in &layer_dirs {
|
for layer_dir in &layer_dirs {
|
||||||
scan_layer_families(layer_dir, n_parts, n_genomes, with_counts, k, &cache, &Selection::All, |_family_idx, mask, genome_mask| {
|
scan_layer_families(
|
||||||
// "Genome g represents this family" means g carries
|
layer_dir,
|
||||||
// *any* of its members, not just the minorant's own —
|
n_parts,
|
||||||
// `genome_mask[g] != 0` is exactly that.
|
n_genomes,
|
||||||
let s = mask.siblings() as usize;
|
with_counts,
|
||||||
stats.counts[s] += 1;
|
k,
|
||||||
for (g, &m) in genome_mask.iter().enumerate() {
|
&cache,
|
||||||
if m != 0 {
|
&Selection::All,
|
||||||
stats.per_genome[g][s] += 1;
|
|_family_idx, mask, genome_mask| {
|
||||||
|
// "Genome g represents this family" means g carries
|
||||||
|
// *any* of its members, not just the minorant's own —
|
||||||
|
// `genome_mask[g] != 0` is exactly that.
|
||||||
|
let s = mask.siblings() as usize;
|
||||||
|
stats.counts[s] += 1;
|
||||||
|
for (g, &m) in genome_mask.iter().enumerate() {
|
||||||
|
if m != 0 {
|
||||||
|
stats.per_genome[g][s] += 1;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
},
|
||||||
})?;
|
)?;
|
||||||
pb.inc(1);
|
pb.inc(1);
|
||||||
}
|
}
|
||||||
pb.finish_and_clear();
|
pb.finish_and_clear();
|
||||||
|
|||||||
Reference in new issue
Block a user