First commit - second part

Former-commit-id: 202296404e6a70f8ae96db99faffb456104c57e9
Former-commit-id: 118417735d2055683607df9809c9b721cc1b1bab
This commit is contained in:
2015-10-02 21:12:35 +02:00
parent f44f0d8179
commit d298385685
316 changed files with 122579 additions and 0 deletions
+51
View File
@@ -0,0 +1,51 @@
#
# ------------------------------------------
# ORG.Annot - Organelle Annotator
# version 1.0.0 - Sept 2015
# ------------------------------------------
#
# -------------------------
# -1- Installation
# -------------------------
#
# First check if binaries have been already compiled for your port
#
# $ scripts/check_port
#
# if it prints :
#
# + port <PORTNAME> is correctly installed
#
# then everything is fine
#
# if it prints :
#
# ! port <PORTNAME> not installed
# ! Please read README.txt for proper installation
#
# then, you should first compile binaries for your port
# please consult: src/README.txt for details
#
#
# -------------------------
# -2- Distribution organisation
# -------------------------
#
# config : config file for (re)compiling tools
# data : internal data files (e.g. ChloroDB)
# detectors : features specific detector scripts
# ports : binaries for various ports
# scripts : main scripts directory
# src : sources for (re)compiling tools
#
# -------------------------
# -3- Usage
# -------------------------
#
# note: all scripts are located in scripts, so you may add
# this directory in your path
# e.g. using csh
# set path = ($path <ROOTDIR>/scripts)
#
# @TODO : scripts description
#
BIN
View File
Binary file not shown.
+51
View File
@@ -0,0 +1,51 @@
$Id: README.txt 1825 2013-02-26 09:39:47Z viari $
This directory contains Makefile machine specific configuration files
(and default targets to help you writing Makefile's)
These headers should be used with GNU make or compatible
#
# portname
#
To check your port, issue :
./guess_port
if output is 'unknown <mach>:<sys>:<rel>' then you should :
- add a port entry in guess_port for <mach>:<sys>:<rel>
- create a ports/<port>.conf configuration file
(the best is to start from another port file,
choose whatever looks closest)
#
# configuration flags
#
auto.conf : the main configuration file :
- determine the machine port thru 'guess_port' shell
- include 'default.conf' file
- include the machine specific 'ports/<port>.conf' file
default.conf : default configuration (included by 'auto.conf')
ports/<port>.conf : machine specific configuration (included by 'auto.conf')
#
# utility targets
#
targets/help.targ : target for standard help
targets/propagate.targ : target for propagating targets to subdirectories
targets/package.targ : default targets for standard package with 'configure'
targets/empty.targ : default empty targets (defined as double colon rules)
targets/lxbin.targ : default make targets for standard lx binary (without libraries)
targets/debug.targ : target to print debug information (for dev.)
+54
View File
@@ -0,0 +1,54 @@
#
# $Id: auto.conf 1825 2013-02-26 09:39:47Z viari $
#
# auto.conf
# auto configuration file using guess_port
#
# this file is included in Makefile
#
#
# default shell for gnu-make
#
SHELL = /bin/sh
#
# CFGDIR : location of config files = this file directory location
#
# CFGPRT : port name (as returned by guess_port)
#
# because builtin 'lastword' is missing in gnu-make 3.80
lastword = $(word $(words $1), $1)
CFGDIR := $(dir $(call lastword, $(MAKEFILE_LIST)))
CFGPRT := $(shell $(CFGDIR)guess_port)
# check if port is correctly defined
ifneq (1, $(words $(CFGPRT)))
entry := $(call lastword, $(CFGPRT))
$(error port is undefined - add entry for "$(entry)" in configuration file -)
endif
#
# PORTNAME : port name to use : default is CFGPRT but may be futher modified
# by machine specific configuration
PORTNAME = $(CFGPRT)
#
# default configuration
# may be overriden by machine dependant definitions below
#
include $(CFGDIR)default.conf
#
# machine dependant definitions
#
include $(CFGDIR)ports/$(CFGPRT).conf
+124
View File
@@ -0,0 +1,124 @@
#
# $Id: default.conf 2007 2013-12-03 14:21:39Z viari $
#
# default.conf
# default configuration flags
# maybe further redefined by machine specific configuration
#
# this file is included by auto.conf
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF =
#
# CC : (ansi C) compiler command to use
# you may add some machine specific flags (like -arch ...)
# in the <machine>.conf configuration file
#
CC = gcc
#
# default compiler optimizer flag
#
OPTIM = -O
#
# CC_LIBS : additionnal machine specific $(CC) libraries
# like '-lC' on some machines
#
CC_LIBS =
#
# MALLOC_LIBS : machine specific malloc librairies
# like '-lmalloc' on SGI
#
MALLOC_LIBS =
#
# MATH_LIBS : machine specific math librairies
# like '-lm' on Solaris
#
MATH_LIBS =
#
# LINT : looks like LINT command does not exist anymore
# here is a rough replacement
#
LINT = gcc -S -Wall -Wno-format-y2k -W -Wstrict-prototypes \
-Wmissing-prototypes -Wpointer-arith -Wreturn-type \
-Wcast-qual -Wwrite-strings -Wswitch -Wshadow \
-Wcast-align -Wbad-function-cast -Wchar-subscripts \
-Winline -Wnested-externs -Wredundant-decls
# ------------------------------------
# General system commands
# ------------------------------------
#
# AR : AR archive command
# ARFLAGS : $(AR) archiving flags
# ARXFLAGS : $(AR) extraction flags
#
AR = ar
ARFLAGS = rcv
ARXFLAGS = xv
#
# RANLIB : ranlib command
#
RANLIB = ranlib
#
# DIFF : diff command
#
DIFF = diff
#
# TAR : tar command
#
TAR = tar
# ------------------------------------
# Default locations
# ------------------------------------
#
# PRTDIR : port dependent files location (libraries and binaries)
# BINDIR : port binaries
# LIBDIR : port libraries
#
PRTDIR = $(CFGDIR)../ports/$(PORTNAME)
BINDIR = $(PRTDIR)/bin
LIBDIR = $(PRTDIR)/lib
# ------------------------------------
# default gmake variable in implicit rules
# ------------------------------------
CFLAGS = $(OPTIM) $(MACHDEF) -I$(INCDIR)
LDFLAGS = -L$(LIBDIR) -L.
LDLIBS = $(LIBS) $(MALLOC_LIBS) $(MATH_LIBS) $(CC_LIBS)
LINTFLAGS = $(MACHDEF) -I$(INCDIR)
+33
View File
@@ -0,0 +1,33 @@
#! /bin/sh
#
# $Id: guess_port 1825 2013-02-26 09:39:47Z viari $
#
# @file: guess_port
# @desc: attempt to guess the portname
# @usage: guess_port
#
# @history:
# @+ <Gloup> Nov. 2000 first draft adapted from GNU config.guess
# @+ <Gloup> Feb. 2010 moved to sh
#
mach=`uname -m`
syst=`uname -s`
rels=`uname -r`
case ${mach}:${syst}:${rels} in
alpha:OSF1:* ) echo alpha-osf1;;
sun4*:SunOS:5.* ) echo sparc-solaris;;
i86pc:SunOS:5.* ) echo i386-solaris;;
sun4*:SunOS:* ) echo sparc-sunos;;
Power*:Darwin:* ) echo ppc-darwin;;
i*86:Linux:* ) echo i386-linux;;
x*86*:Linux:* ) echo i386-linux;;
i*86:Darwin:* ) echo i386-darwin;;
IP*:IRIX*:* ) echo mips-irix;;
i*86:MINGW32*:* ) echo x86-mingw32;;
*) echo unknown ${mach}:${syst}:${rels}; exit 1;;
esac
exit 0
+26
View File
@@ -0,0 +1,26 @@
#
# $Id: i386-darwin.conf 1825 2013-02-26 09:39:47Z viari $
#
# i386-darwin.conf
# configuration file for MacOS-X/Intel-Based/Darwin 1.2 with gcc compiler
# this file is included in Makefile
#
# system (uname -srp) : Darwin 8.7.1 i386
# compiler (cc --version) : i686-apple-darwin8-gcc-4.0.1
#
# check tags
# @uname:uname -srp:Darwin 8.7.1 i386
# @cc:cc --version:i686-apple-darwin8-gcc-4.0.1
#
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF = -DLX_TARGET_MACINTEL -DLITTLE_ENDIAN -DMACOSX
+32
View File
@@ -0,0 +1,32 @@
#
# $Id: i386-linux.conf 1825 2013-02-26 09:39:47Z viari $
#
# i386-linux.conf
# configuration file for linux ix86 with GNU gcc compiler
# this file is included in Makefile
#
# system (uname -srp) : Linux 2.2.14-5.0 unknown
# compiler (gcc --version) : egcs-2.91.66
#
# check tags
# @uname:uname -srp:Linux 2.2.14-5.0 unknown
# @cc:cc --version:egcs-2.91.66
#
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF = -DLX_TARGET_LINUX -DLITTLE_ENDIAN
#
# MATH_LIBS : machine specific math librairies
#
MATH_LIBS = -lm
+32
View File
@@ -0,0 +1,32 @@
#
# $Id: ppc-darwin.conf 1825 2013-02-26 09:39:47Z viari $
#
# ppc-darwin.conf
# configuration file for MacOS-X/Darwin 1.2 with native cc compiler
# this file is included in Makefile
#
# system (uname -srp) : Darwin 1.2 powerpc
# compiler (cc --version) : 2.7.2.1
#
# check tags
# @uname:uname -srp:Darwin 1.2 powerpc
# @cc:cc --version:2.7.2.1
#
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF = -DLX_TARGET_MACPPC -DBIG_ENDIAN
#
# CC : name of (ansi C) compiler to use
#
CC = cc -arch ppc
+31
View File
@@ -0,0 +1,31 @@
#
# $Id: sparc-solaris.conf 1825 2013-02-26 09:39:47Z viari $
#
# sparc-solaris.conf
# configuration file for sparc solaris with GNU gcc compiler
# this file is included in Makefile
#
# system (uname -srp) : SunOS 5.8 sparc
# compiler (gcc --version) : 2.95.2
#
# check tags
# @uname:uname -srp:SunOS 5.8 sparc
# @cc:cc --version:2.95.2
#
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF = -DLX_TARGET_SOLARIS -DBIG_ENDIAN
#
# MATH_LIBS : machine specific math librairies
#
MATH_LIBS = -lm
+54
View File
@@ -0,0 +1,54 @@
#
# $Id: x86-mingw32.conf 1825 2013-02-26 09:39:47Z viari $
#
# x86-mingw32
# configuration file for MinGW with GNU gcc compiler.
#
# this file is included in Makefile
#
#
#
# rename PORTNAME safely since MinGW produce pure win32 executables
# without dll's
#
PORTNAME = x86-win32
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# CC_LIBS : additionnal machine specific $(CC) libraries
#
# libiberty is needed for some system extensions (like mkstemps)
#
CC_LIBS = -liberty
#
# MACHDEF : define machine and OS specific flags
#
# -DDLMALLOC : use dlmalloc instead of malloc (which does not have mallinfo)
# -posix is a new replacement for several MinGW32 flags, including:
# -D__USE_MINGW_ANSI_STDIO : mingw gcc flag to recognize the C99 "%zu" format
#
MACHDEF = -posix -DLX_TARGET_WIN32 -DWIN_MINGW -DDLMALLOC -DLITTLE_ENDIAN
#
# MATH_LIBS : machine specific math librairies
#
MATH_LIBS = -lm
# ------------------------------------
# General system commands
# ------------------------------------
#
# DIFF : diff command / should ignore cr on windows
#
DIFF = diff --strip-trailing-cr
+25
View File
@@ -0,0 +1,25 @@
#
# $Id: help.targ 1825 2013-02-26 09:39:47Z viari $
#
# debug.targ
#
# target to print debug information (dev. only)
#
# it defines the following targets:
#
# debug :
# print debug
#
# it requires auto.conf
#
.PHONY: debug
debug::
@echo "+ PORTNAME: $(PORTNAME)"
@echo "+ CFGPRT: $(CFGPRT)"
@echo "+ CFGDIR: $(CFGDIR)"
@echo "+ PRTDIR: $(PRTDIR)"
@echo "+ MACHDEF: $(MACHDEF)"
+24
View File
@@ -0,0 +1,24 @@
#
# $Id: $
#
# epty.targ
#
# default empty targets (defined as double colon rules)
#
#
#
# Rules
#
.PHONY: all test clean portclean help
all::
test::
clean::
portclean:: clean
test::
+23
View File
@@ -0,0 +1,23 @@
#
# $Id: help.targ 1825 2013-02-26 09:39:47Z viari $
#
# help.targ
#
# default target to print help
#
# it defines the following targets:
#
# help :
# print help
#
.PHONY: help
help::
@ echo "basic usage: make [<action>+]"
@ echo "valid <action> :"
@ echo " all : compile everything for current port [default target]"
@ echo " clean : local cleanup"
@ echo " portclean : cleanup distribution for current port"
@ echo " test : run tests on current port"
@ echo " help : print this help"
+51
View File
@@ -0,0 +1,51 @@
#
# $Id: $
#
# lxbin.targ
#
# default make targets for standard lx binary
#
# you should define the 'PROGS' and 'OSRC' variables
# and optionnaly 'LIBS' if binaries have to be linked with libraries
#
# note: if main source code for binary PROG is PROG.c, there is nothing to do,
# else (e.g. if it involves several sources files) you should also add local
# file dependencies. e.g under the form:
#
# mymain: $(OBJ) mymain_base.c mymain_help.c
# $(CC) $(CFLAGS) -o $@ $^ $(LDFLAGS) $(LDLIBS)
#
#
# 'auto.conf' should have been included
#
OBJ = $(OSRC:.c=.o)
INCDIR = ../include
#
# Rules
#
.PHONY: all prelib install test clean portclean
all:: prelib $(PROGS) install
@echo "+++++++++++ binaries $(PROGS) done"
prelib::
test -d $(PRTDIR) || mkdir $(PRTDIR) # because some linker may complain
test -d $(LIBDIR) || mkdir $(LIBDIR) # if -L$(LIBDIR) does not exist
install::
test -d $(PRTDIR) || mkdir $(PRTDIR)
test -d $(BINDIR) || mkdir $(BINDIR)
-for f in $(PROGS) ; do \cp -f $$f $(BINDIR) ; done
test::
clean::
-\rm -f *.o cvstatic* *% *.bak so_loc*
-\rm -f $(PROGS)
portclean:: clean
-(! test -d $(BINDIR)) || (cd $(BINDIR) && \rm -f $(PROGS))
+43
View File
@@ -0,0 +1,43 @@
#
# $Id: $
#
# lxlib.targ
#
# default make targets for standard lx library
#
# you should define the 'LOCLIB' and 'OSRC' variables
#
# 'auto.conf' should have been included
#
OBJ = $(OSRC:.c=.o)
INCDIR = ../include
#
# Rules
#
.PHONY: all lib install test clean portclean
all:: lib install
@echo "+++++++++++ library $(LOCLIB) done"
lib:: $(OBJ)
$(AR) $(ARFLAGS) $(LOCLIB) $(OBJ)
$(RANLIB) $(LOCLIB)
install::
test -d $(PRTDIR) || mkdir $(PRTDIR)
test -d $(LIBDIR) || mkdir $(LIBDIR)
\cp -f $(LOCLIB) $(LIBDIR)
$(RANLIB) $(LIBDIR)/$(LOCLIB)
test::
clean::
-\rm -f *.o cvstatic* *% *.bak so_loc*
-\rm -f $(LOCLIB)
portclean:: clean
-(! test -d $(LIBDIR)) || (cd $(LIBDIR) && \rm -f $(LOCLIB))
+48
View File
@@ -0,0 +1,48 @@
#
# $Id: package.targ 1825 2013-02-26 09:39:47Z viari $
#
# package.targ
#
# default make targets for standard package with configure
#
# you should define the 'PKG' variable
# (and optionaly 'PKGTAR', 'PKGDIR')
#
PKGTAR ?= $(PKG).tgz
PKGDIR ?= build.$(PORTNAME)
PRTPATH = $(abspath $(PRTDIR))
#
# Rules
#
.PHONY: all clean test portclean pkg pkg.expand pkg.make pkg.install
all:: pkg
pkg.expand::
test -d $(PKGDIR) || mkdir $(PKGDIR)
test -f $(PKGDIR)/configure || $(TAR) zxf $(PKGTAR) -C $(PKGDIR) --strip-components 1
pkg.make:: pkg.expand
test -f $(PKGDIR)/Makefile || (cd $(PKGDIR) && ./configure --prefix=$(PRTPATH))
$(MAKE) -C $(PKGDIR)
pkg.install:: pkg.make
$(MAKE) -C $(PKGDIR) install
pkg:: pkg.install
@echo "+++++++++++ package $(PKG) done"
test::
(! test -d $(PKGDIR)) || $(MAKE) -C $(PKGDIR) test
clean::
(! test -d $(PKGDIR)) || $(MAKE) -C $(PKGDIR) clean
portclean::
(! test -d $(PKGDIR)) || $(MAKE) -C $(PKGDIR) distclean
(! test -d $(PKGDIR)) || \rm -r $(PKGDIR)
+30
View File
@@ -0,0 +1,30 @@
#
# $Id: propagate.targ 1825 2013-02-26 09:39:47Z viari $
#
# propagate.targ
#
# default make targets for library containers
#
# you should define the 'DIRS' variable
#
# It will propagate 'MAKE <target>' to all
# directories listed in DIRS
#
#
# Rules
#
.PHONY: all _action $(DIRS)
.DEFAULT:
$(MAKE) ACTION=$@ _action
all::
$(MAKE) ACTION=all _action
_action: $(DIRS)
@echo "$(ACTION) done"
$(DIRS):
$(MAKE) -C $@ $(ACTION)
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+381
View File
@@ -0,0 +1,381 @@
CLUSTAL W (1.7) multiple sequence alignment
NC_000932_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_001320_LCS taaggtagcggcgagacgagccg-------------------------------------
NC_004677_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_008115_LCS gaaggtcacggcgagacgagctg-------------------------------------
NC_006290_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_007942_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_026134_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_011828_LCS gaaggtcacggcgagactagccg-------------------------------------
NC_009618_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_002693_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_005086_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_009259_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_024021_LCS --aggtcatggcgagacgagccg-------------------------------------
NC_008335_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_026295_LCS --aggtcacggcgagacgagccg-------------------------------------
NC_016708_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_008796_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_010442_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_021425_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_007407_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_015891_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_016064_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_001631_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_005087_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_021449_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_023119_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_023090_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_015621_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_009271_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_003119_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_007144_LCS gaaggtcacggcgagatgagccg-------------------------------------
NC_009766_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_025744_LCS -aaggtcacggcgagactagccg-------------------------------------
NC_001568_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_009765_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_017006_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_008829_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_014676_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_025236_LCS taaggtagcggcgagacgagccg-------------------------------------
NC_023533_LCS taaggtagcggcgagacgagccg-------------------------------------
NC_014062_LCS taaggtagcggcgagacgagccg-------------------------------------
NC_020321_LCS taaggtcaaggcgagacgagcct-------------------------------------
NC_012818_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_022137_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_014348_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_024158_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_014699_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_010109_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_014592_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_014675_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_024291_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_019628_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_020146_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_015402_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_004766_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_012052_LCS taaggtcacggcaagacgagccg-------------------------------------
NC_001319_LCS taaggtcacggcaagactagccg-------------------------------------
NC_004543_LCS taaggtcacggcaagatgagccg-------------------------------------
NC_020259_LCS taaggtcacggcaagatgagccg-------------------------------------
NC_025659_LCS taaggtcacggcgagacgagcca-------------------------------------
NC_026775_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_026773_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_025305_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_011954_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_026301_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_010654_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_026778_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_021936_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_026776_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_014056_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_026449_LCS taaggtcacggcgagacgagccg-------------------------------------
NC_024945_LCS taaggtcacggcgagatgagccg-------------------------------------
NC_026785_LCS taaggtcacggctagacgagccg-------------------------------------
NC_023805_LCS taaggtcacggtgagactagccg-------------------------------------
NC_024827_LCS taaggtcacggtgagactagccg-------------------------------------
NC_020365_LCS taaggtcacgtcgagacgagccg-------------------------------------
NC_010548_LCS taaggtcatggcgagacgagccg-------------------------------------
NC_013086_LCS tgaggtcacggcaagatgagccg-------------------------------------
NC_006861_LCS -aaggtcacggcaagacgagccg-------------------------------------
NC_003386_LCS -aaggtcacggcaagacgagccg-------------------------------------
NC_016471_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_010359_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_020372_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_014582_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_024421_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_018114_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_026847_LCS -aaggtcacggcgagacgagccg-------------------------------------
NC_023120_LCS -aaggtcacggtgagactagccg-------------------------------------
NC_014874_LCS -aaggtcacggttagacgagccg-------------------------------------
NC_011942_LCS -------------agacgagccg-------------------------------------
NC_016065_LCS agaggtcttggcgagactagcca-------------------------------------
NC_022136_LCS caaggtcacggcgagacgagccg-------------------------------------
NC_014063_LCS caaggtcacggcgagacgagccg-------------------------------------
NC_023121_LCS -caggtcacggcgagacgagccg-------------------------------------
NC_021110_LCS cgaggtcacggcgagacgagccg-------------------------------------
NC_016063_LCS cgaggtcacggcgagacgagccg-------------------------------------
NC_025642_LCS gaaggtcacggcgagacgagcca-------------------------------------
NC_026202_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_009266_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_002202_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_025554_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_021111_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_023359_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_010776_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_024635_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_025907_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_008336_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_022457_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_023259_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_025909_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_024038_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_014057_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_002694_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_010433_LCS_CMP gaaggtcacggcgagacgagccg-------------------------------------
NC_001666_LCS_CMP taaggtagcggcgagacgagccg-------------------------------------
NC_013991_LCS_CMP taaggtcacggcgagacgagccg-------------------------------------
NC_024168_LCS_CMP --aggtcacggcaagacgagccg-------------------------------------
NC_023356_LCS_CMP taaggtcacggcgagacgagccg-------------------------------------
NC_013707_LCS_CMP gaaggtcacggcgagacgagccg-------------------------------------
NC_021372_LCS taaggtagcggcgagacgagccg-------------------------------------
NC_007578_LCS gaaggtcacggcgagacgagccg-------------------------------------
NC_008454_LCS gaaggtcacggcgagacgagccg------------------tttatcatattactcaatt
NC_014569_LCS gaaggtcacggcgagacgagccgtttgttttagagtgtcaaagtcttgagaattcaggcg
NC_026448_LCS taaggtcgcggcgagatgatccg-------------------------------------
NC_000932_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_001320_LCS ----------ttta----------aataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_004677_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_008115_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_006290_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_007942_LCS ----------tttctaatt--aatgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_026134_LCS ----------tttatcatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_011828_LCS ----------tttttcatt--aacgataggtgtcaagtggaagtgcagtaatgtatg-ca
NC_009618_LCS ----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_002693_LCS ----------tttatcatt---atgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_005086_LCS ----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_009259_LCS ----------tttctaatt--aatgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_024021_LCS ----------ttag--------gtgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_008335_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_026295_LCS ----------ttag--------gtgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_016708_LCS ----------tttctcatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_008796_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_010442_LCS ----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_021425_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_007407_LCS ----------tttatcatt---acgataggtgccaagtggaagtgcagtgatgtatg-ca
NC_015891_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_016064_LCS ----------tttatcatt---acgataggtgtcaagtggaagtacagtgatgtatg-ca
NC_001631_LCS ----------tttataatt---atgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_005087_LCS ----------tttatcatc---acgataggtgccaagtggaagtgcagtaatgtatg-ca
NC_021449_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_023119_LCS ----------tttttcatt---ccgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_023090_LCS ----------tttctcatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_015621_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_009271_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_003119_LCS ----------tttttcatt--aacgataggtgtcaagtggaagtgcagtaatgtatg-ca
NC_007144_LCS ----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_009766_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_025744_LCS -----------ttttcatt--aacgataggtgtcaagtggaagtgcagtaatgtatg-ca
NC_001568_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_009765_LCS ----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_017006_LCS ----------tttatcacc---acgataggtgccaagtggaagtgcagtaatgtatg-ca
NC_008829_LCS ----------tttatcact---acgataggtgccaagtggaagtgcagtaatgtatg-ca
NC_014676_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_025236_LCS ----------ttta----------aataggtgtcaagtggaagtacagtgatgtatg-ca
NC_023533_LCS ----------ttta----------aataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_014062_LCS ----------ttta----------aataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_020321_LCS ----------tttatcaa----acgataggtatcaagtggaagtgcagtgatgtacg-ca
NC_012818_LCS ----------tttatcacc---acgataggtgccaagtggaggtgcagtaatgtatg-ca
NC_022137_LCS ----------tttatcacc---acgataggtgccaagtggaggtgcagtgatgcatg-ca
NC_014348_LCS ----------tttatcact---acgataggtgctaagtggaggtgcagtaatgtatg-ca
NC_024158_LCS ----------tttatcatc---acgataggtgccaggtggaagtgcagtaatgtatg-ca
NC_014699_LCS ----------tttatcatt---acgataggtgccaggtggaagtgcagtaatgtatg-ca
NC_010109_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_014592_LCS ----------tttatcgcc---acaataggtgctaagtggaggtgcagtaatgtatg-ca
NC_014675_LCS ----------tttatcgtc---acgataggtgccaagtggaagtgcagtaatgcatg-ca
NC_024291_LCS ----------tttatgatc---acgataggtgccaagtggaagtgcagtaatgtatg-ca
NC_019628_LCS ----------tttatgatc---acgataggtgccaagtggaagtgcagtaatgtatg-ta
NC_020146_LCS ----------tttatgatt---acgataggtgccaggtggaagtgcagtaatgtatg-ca
NC_015402_LCS ----------tttattata---acgataggtgccaagtggaagtgcagtaatgtatg-ta
NC_004766_LCS ----------tttctcact---acgataggtgctaagtggaagtgcagtaatgtatg-ca
NC_012052_LCS ----------tttgttatt---acgataggtgccaagtggaagtgcagtaatgtatg-ca
NC_001319_LCS ----------tttattttt---acgataggtgccaagtggaagtgcagtaatgtatg-ta
NC_004543_LCS ----------tttatcata---acaataggtgccaagtagaagtgcagtaatgtatg-ca
NC_020259_LCS ----------tttatcata---acaataggtgccaagtggaagtgcagtaatgtatg-ca
NC_025659_LCS ----------tttctcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_026775_LCS ----------cttatcatt---acgataggtgccaagtggaagtgcagtgatgtatg-ca
NC_026773_LCS ----------cttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_025305_LCS --------------ttatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_011954_LCS ----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_026301_LCS ----------tttatcatc---acgataggtgtcaagtggagatgcagtaatgtatg-ca
NC_010654_LCS ----------tttatcatc---acgataggtgtcaagtggagatgcagtgatgtatg-ca
NC_026778_LCS ----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_021936_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_026776_LCS ----------tttatcatt---atgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_014056_LCS ----------tttctcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_026449_LCS ----------tgtatcaac---attataggtgccgagtgtaagtgcggcgatgcatg-ca
NC_024945_LCS ----------tttatcag----acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_026785_LCS ----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_023805_LCS ----------tttacgact---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_024827_LCS ----------tttacgact---acgataggtgtcaagtggaagtgcagtgatgtatg-ta
NC_020365_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagcgatgtatg-ca
NC_010548_LCS ----------tttattag----acgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_013086_LCS ----------tttatcata---acgataggtgccaggtggaagtgcagtcatgtacg-ca
NC_006861_LCS ----------tttatcatc---acgataggtgccaagtggaaatacagtaatgtatg-ca
NC_003386_LCS ----------tttattatc---acgataggtgccaagtggaagtgcagtaatgtacg-ca
NC_016471_LCS ----------tttataatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_010359_LCS ----------tttatcatc---acgataggtgccaggtggaagtgcagtgatgtatg-ta
NC_020372_LCS ----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_014582_LCS ----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_024421_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagcgatgtatg-ca
NC_018114_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_026847_LCS ----------tttatcatt---ccaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_023120_LCS ----------tttacgact---acgataggtgtcaagtggaagtgcagtgatgtatg-ta
NC_014874_LCS ----------tttattatt---atgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_011942_LCS ----------tttatcatc---acgataggtgtcaagtggagatgcagtaatgtatg-ca
NC_016065_LCS ----------gcgattag----acgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_022136_LCS ----------tttctcatc---acgataggtgccaagtggaagtgcagtaatgtatg-ca
NC_014063_LCS ----------tttttcatt--aacgataggtgtcaagtggaagtgcagtaatgtatg-ca
NC_023121_LCS ----------ttag--------gtgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_021110_LCS ----------tttatcag----acgataggtgttaagtgaaagtacagtgatgtatg-ca
NC_016063_LCS ----------tttatcag----acgataggtgttaagtgaaagtgcagtgatgtatg-ca
NC_025642_LCS ----------tttatcatt---acgataggtgtcaagtgtaagtgcagtgatgtatg-ca
NC_026202_LCS ----------tttataatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_009266_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgcatg-ca
NC_002202_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_025554_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgtagtgatgtatg-ca
NC_021111_LCS ----------tttatcatt---acgataggtgtcaagtgtaagtgcagtgatgtatg-ca
NC_023359_LCS ----------tttatcatt---acgataggtgtcaagtgtaagtgcagtgatgtatg-ca
NC_010776_LCS ----------tttatcatt---acgataggtgtcaggtggaagtgcagtgatgtatg-ca
NC_024635_LCS ----------tttatcatt---ataataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_025907_LCS ----------tttatcatt---ccaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_008336_LCS ----------tttattatt---acgataggtgtcaagtggaagtgcagcgatgtatg-ca
NC_022457_LCS ----------tttattatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_023259_LCS ----------tttattatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_025909_LCS ----------tttctaatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_024038_LCS ----------tttctaatt--aacgataggtgtcaggtggaagtgcagtaatgtacg-ca
NC_014057_LCS ----------tttttcatt--aacgataggtgtcaagtggaagtacagtaatgtatg-ca
NC_002694_LCS ----------tttttcatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_010433_LCS_CMP ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_001666_LCS_CMP ----------ttta----------aataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_013991_LCS_CMP ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_024168_LCS_CMP ----------tttt---ag---acaataggtgccaggtggaagcgcagtaatgtgtg-ca
NC_023356_LCS_CMP ----------tttatcatt---atgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_013707_LCS_CMP ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_021372_LCS ----------ttt----------aaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_007578_LCS ----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_008454_LCS gatcattacgtttatcatt---acgataggtgttaagtggaagtgcagtgatgtatg-ca
NC_014569_LCS cggcccgtcctttagagcaaaacaaataggtgtcaagtggaagtgcagtgatgtatg-ca
NC_026448_LCS ----------ttgatagtgactatgataggtactaagtgtaaatgcagcgatgtatgtta
NC_000932_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_001320_LCS gctgaggcatcctaac-gaacgaacgatttgaac-
NC_004677_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_008115_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_006290_LCS gctgaggcatcctaacagaccgatagacttgaac-
NC_007942_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_026134_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_011828_LCS gctgaggcatcctaacagaccgatagacttgaac-
NC_009618_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_002693_LCS gctgagacatcctaacagaccgctagacttgaac-
NC_005086_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_009259_LCS gctgaggcatcctaacagaccgttagacttgaac-
NC_024021_LCS gccgaggcatactaaaagaccgaaagatttgaac-
NC_008335_LCS gctgaggcatcctaacagaccga------------
NC_026295_LCS gccgaggcatactaaaagaccgaaagatttgaac-
NC_016708_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_008796_LCS gctgaggcatcctaacagaccaatagacttgaac-
NC_010442_LCS gctgaggcatcctaacagaccgatagacttgaac-
NC_021425_LCS gctgaggcatcctaacagaccgttagacttgaac-
NC_007407_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_015891_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_016064_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_001631_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_005087_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_021449_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_023119_LCS gctgaggcatcctaacagaccgaaagatttgaac-
NC_023090_LCS gcggaggcatcctaacagaccggtagacttgaac-
NC_015621_LCS gctgaggcatcctaacagaccggtagact------
NC_009271_LCS gctgaggcatcctaacagaccggtagacttgaa--
NC_003119_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_007144_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_009766_LCS gctgaggcatcctaatagaccggtagacttgaac-
NC_025744_LCS gctgaggcatcctaacagaccgatagacttgaac-
NC_001568_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_009765_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_017006_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_008829_LCS gctgaggcatcctaacagaccgagaggtttgaac-
NC_014676_LCS gctgaggcatcctaacagaccggcagacttgaac-
NC_025236_LCS gctgaggcatcctaac-gaacgaacgatttgaac-
NC_023533_LCS gctgaggcatcctaaccaa-cgaacgatttgaac-
NC_014062_LCS gctgaggcatcctaat-gaacgaacgatttgaac-
NC_020321_LCS gctgaggcatcctaacagaccgaaagattttaac-
NC_012818_LCS gctgaggcatcctaacagaccgagaggtttgaac-
NC_022137_LCS gctgaggcatcctaacagaccgagaggtttgaac-
NC_014348_LCS gctgaggcatcctaacagaccgagaggtttgaac-
NC_024158_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_014699_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_010109_LCS gctgagacatcctaacagaccgagagatttgaac-
NC_014592_LCS gctgaggcatcctaacagaccgagaggtttgaac-
NC_014675_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_024291_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_019628_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_020146_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_015402_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_004766_LCS gctgaggcatcctaacagaccgagaggtttgaac-
NC_012052_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_001319_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_004543_LCS gctgaggcattctaacagaccgagagatttgaac-
NC_020259_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_025659_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_026775_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_026773_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_025305_LCS gctgaggcatcctaacagaccgaaagatttgaac-
NC_011954_LCS gctgagacatcctaacagaccgagagatttgaac-
NC_026301_LCS gctgaggcatcctaaaagaccgagagatttgaac-
NC_010654_LCS gctgaggcatcctaaaagaccgagagatttgaac-
NC_026778_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_021936_LCS gctgaggcattctaacagaccgagagatttgaac-
NC_026776_LCS gctgaggcatcctaatagaccgagagatttgaac-
NC_014056_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_026449_LCS gctgaggcatactaaaagaccgatatattttaac-
NC_024945_LCS gctgaggcatcctaacagactaaaagatttgaac-
NC_026785_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_023805_LCS gctaaggcatcctaatagaccgaaagatttgaac-
NC_024827_LCS gctaaggcatcctaacagaccgaaagatttgaac-
NC_020365_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_010548_LCS gccgaggcatcctaagagaccggaagatttgaac-
NC_013086_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_006861_LCS gctgaggcatcctaacagaccaagagatttgaacc
NC_003386_LCS gctgaggcatcctaacagaccgatggctttgaacc
NC_016471_LCS gctgaggcatcctaacagaccaagagatttgaac-
NC_010359_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_020372_LCS gctgaggcatcctaacagaccgatagatttgaac-
NC_014582_LCS gctgaggcatcctaacagaccagtagacttgaac-
NC_024421_LCS gctgaggcatcctaacagaccgagagatttgaac-
NC_018114_LCS gctgaggcatcctaacagaccgagagatttgaacc
NC_026847_LCS gctgaggcatcctaacagaccgcaagacttga---
NC_023120_LCS gctaaggcatcctaacagaccgaaagatttgaac-
NC_014874_LCS gctgaggcatactaacagaccgagagattttaacc
NC_011942_LCS gctgaggcatcctaaaagaccgagagatttgaac-
NC_016065_LCS gccgagacatcctaagagaccaaaagatttgaac-
NC_022136_LCS gctgaggcatcctaacagaccggaagatttgaac-
NC_014063_LCS gctgagtcatcctaacagaccgatagacttgaac-
NC_023121_LCS gccgaggcatactaaaagaccgaaagatttgaac-
NC_021110_LCS gccaaggcatcctaacagaccga-agatttgaacc
NC_016063_LCS gccaaggcatcctaacagaccga-agatttgaacc
NC_025642_LCS gctgagacatcctaacagaccggtagacttgaac-
NC_026202_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_009266_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_002202_LCS gctgaggcatcctaacagacccacagacttgaac-
NC_025554_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_021111_LCS gctgagacatcctaacagaccggtagacttgaac-
NC_023359_LCS gctgaggcatcctaacagaccgatagacttgaac-
NC_010776_LCS gctgaggcatcctaacagaccgatagacttgaac-
NC_024635_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_025907_LCS gctgaggcatcctaacagaccacaagacttgaac-
NC_008336_LCS gctgaggcatcctaacagaccgacagacttgaac-
NC_022457_LCS gctgaggcatcctaacagaccgccagacttgaac-
NC_023259_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_025909_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_024038_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_014057_LCS gctgaggcatcctaacagaccgatagacttgaac-
NC_002694_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_010433_LCS_CMP gctgaggcatcctaacagaccggtagacttgaac-
NC_001666_LCS_CMP gctgaggcatcctaac-gaacgaacgatttgaac-
NC_013991_LCS_CMP gctgaggcatcctaacagaccgagagatttgaac-
NC_024168_LCS_CMP gccgaggcatcctaacagaccgagaggtttgaac-
NC_023356_LCS_CMP gctgaggcatcctaacagaccgatagatttgaac-
NC_013707_LCS_CMP gctgaggcatcctaacagaccggtagacttgaa--
NC_021372_LCS gctgaggcatcctaacgaac-gaacgatttgaac-
NC_007578_LCS gctgaggcatcctaacagaccggtagacttgaacc
NC_008454_LCS gctgaggcatcctaacagaccgttagacttgaac-
NC_014569_LCS gctgaggcatcctaacagaccggtagacttgaac-
NC_026448_LCS gcttaggtatcctaaaagaccgatttatttgaac-
+496
View File
@@ -0,0 +1,496 @@
>NC_000932_LCS count=162; cluster_center=True; seq_length=103; cluster=NC_000932_LCS; cluster_score=1.0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_001320_LCS count=84; cluster_center=False; seq_length=95; cluster=NC_000932_LCS; cluster_score=0.847619; cluster_weight=559;
taaggtagcggcgagacgagccg-------------------------------------
----------ttta----------aataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaac-gaacgaacgatttgaac-
>NC_004677_LCS count=72; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.961538; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_008115_LCS count=39; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagctg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_006290_LCS count=17; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgatagacttgaac-
>NC_007942_LCS count=10; cluster_center=False; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.961538; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttctaatt--aatgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_026134_LCS count=6; cluster_center=False; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.990385; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_011828_LCS count=6; cluster_center=False; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.951923; cluster_weight=559;
gaaggtcacggcgagactagccg-------------------------------------
----------tttttcatt--aacgataggtgtcaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgatagacttgaac-
>NC_009618_LCS count=5; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgcatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_002693_LCS count=5; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.970874; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---atgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgagacatcctaacagaccgctagacttgaac-
>NC_005086_LCS count=5; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_009259_LCS count=4; cluster_center=False; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttctaatt--aatgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgttagacttgaac-
>NC_024021_LCS count=4; cluster_center=False; seq_length=96; cluster=NC_000932_LCS; cluster_score=0.834951; Strand=1; cluster_weight=559;
--aggtcatggcgagacgagccg-------------------------------------
----------ttag--------gtgataggtgtcaagtggaagtgcagtgatgcatg-ca
gccgaggcatactaaaagaccgaaagatttgaac-
>NC_008335_LCS count=4; cluster_center=False; seq_length=91; cluster=NC_000932_LCS; cluster_score=0.883495; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccga------------
>NC_026295_LCS count=4; cluster_center=False; seq_length=96; cluster=NC_000932_LCS; cluster_score=0.84466; Strand=1; cluster_weight=559;
--aggtcacggcgagacgagccg-------------------------------------
----------ttag--------gtgataggtgtcaagtggaagtgcagtgatgcatg-ca
gccgaggcatactaaaagaccgaaagatttgaac-
>NC_016708_LCS count=4; cluster_center=False; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.980769; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttctcatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_008796_LCS count=3; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.980583; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccaatagacttgaac-
>NC_010442_LCS count=3; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.980583; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgatagacttgaac-
>NC_021425_LCS count=3; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgttagacttgaac-
>NC_007407_LCS count=3; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgccaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_015891_LCS count=3; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_016064_LCS count=3; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951923; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtacagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_001631_LCS count=3; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=1; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttataatt---atgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_005087_LCS count=3; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.923077; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcatc---acgataggtgccaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_021449_LCS count=3; cluster_center=False; seq_length=105; cluster=NC_000932_LCS; cluster_score=0.980952; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_023119_LCS count=2; cluster_center=False; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.941748; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttttcatt---ccgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgaaagatttgaac-
>NC_023090_LCS count=2; cluster_center=False; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.971154; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttctcatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
gcggaggcatcctaacagaccggtagacttgaac-
>NC_015621_LCS count=2; cluster_center=False; seq_length=98; cluster=NC_000932_LCS; cluster_score=0.951456; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagact------
>NC_009271_LCS count=2; cluster_center=False; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaa--
>NC_003119_LCS count=2; cluster_center=False; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.971154; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttttcatt--aacgataggtgtcaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_007144_LCS count=2; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.980583; Strand=0; cluster_weight=559;
gaaggtcacggcgagatgagccg-------------------------------------
----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_009766_LCS count=2; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaatagaccggtagacttgaac-
>NC_025744_LCS count=2; cluster_center=False; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=1; cluster_weight=559;
-aaggtcacggcgagactagccg-------------------------------------
-----------ttttcatt--aacgataggtgtcaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgatagacttgaac-
>NC_001568_LCS count=2; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_009765_LCS count=2; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_017006_LCS count=2; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.913462; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcacc---acgataggtgccaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_008829_LCS count=2; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.913462; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcact---acgataggtgccaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagaggtttgaac-
>NC_014676_LCS count=2; cluster_center=False; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggcagacttgaac-
>NC_025236_LCS count=1; cluster_center=False; cut=117439..117533; seq_length=95; cluster=NC_000932_LCS; cluster_score=0.838095; Strand=0; cluster_weight=559;
taaggtagcggcgagacgagccg-------------------------------------
----------ttta----------aataggtgtcaagtggaagtacagtgatgtatg-ca
gctgaggcatcctaac-gaacgaacgatttgaac-
>NC_023533_LCS count=1; cluster_center=False; cut=117008..117102; seq_length=95; cluster=NC_000932_LCS; cluster_score=0.839623; Strand=0; cluster_weight=559;
taaggtagcggcgagacgagccg-------------------------------------
----------ttta----------aataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaaccaa-cgaacgatttgaac-
>NC_014062_LCS count=1; cluster_center=False; cut=121161..121255; seq_length=95; cluster=NC_000932_LCS; cluster_score=0.838095; Strand=0; cluster_weight=559;
taaggtagcggcgagacgagccg-------------------------------------
----------ttta----------aataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaat-gaacgaacgatttgaac-
>NC_020321_LCS count=1; cluster_center=False; cut=101414..101515; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.893204; Strand=1; cluster_weight=559;
taaggtcaaggcgagacgagcct-------------------------------------
----------tttatcaa----acgataggtatcaagtggaagtgcagtgatgtacg-ca
gctgaggcatcctaacagaccgaaagattttaac-
>NC_012818_LCS count=1; cluster_center=False; cut=152550..152652; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.894231; Strand=1; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcacc---acgataggtgccaagtggaggtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagaggtttgaac-
>NC_022137_LCS count=1; cluster_center=False; cut=150383..150485; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.894231; Strand=1; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcacc---acgataggtgccaagtggaggtgcagtgatgcatg-ca
gctgaggcatcctaacagaccgagaggtttgaac-
>NC_014348_LCS count=1; cluster_center=False; cut=148751..148853; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.895238; Strand=1; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcact---acgataggtgctaagtggaggtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagaggtttgaac-
>NC_024158_LCS count=1; cluster_center=False; cut=138359..138461; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.913462; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcatc---acgataggtgccaggtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_014699_LCS count=1; cluster_center=False; cut=125720..125822; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.923077; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcatt---acgataggtgccaggtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_010109_LCS count=1; cluster_center=False; cut=142992..143094; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgagacatcctaacagaccgagagatttgaac-
>NC_014592_LCS count=1; cluster_center=False; cut=152146..152248; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.866667; Strand=1; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcgcc---acaataggtgctaagtggaggtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagaggtttgaac-
>NC_014675_LCS count=1; cluster_center=False; cut=134461..134563; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.903846; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatcgtc---acgataggtgccaagtggaagtgcagtaatgcatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_024291_LCS count=1; cluster_center=False; cut=119572..119674; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.913462; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatgatc---acgataggtgccaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_019628_LCS count=1; cluster_center=False; cut=113128..113230; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.903846; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatgatc---acgataggtgccaagtggaagtgcagtaatgtatg-ta
gctgaggcatcctaacagaccgagagatttgaac-
>NC_020146_LCS count=1; cluster_center=False; cut=124175..124277; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.913462; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttatgatt---acgataggtgccaggtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_015402_LCS count=1; cluster_center=False; cut=111547..111649; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.903846; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttattata---acgataggtgccaagtggaagtgcagtaatgtatg-ta
gctgaggcatcctaacagaccgagagatttgaac-
>NC_004766_LCS count=1; cluster_center=False; cut=146832..146934; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.895238; Strand=1; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttctcact---acgataggtgctaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagaggtttgaac-
>NC_012052_LCS count=1; cluster_center=False; cut=114432..114534; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.913462; Strand=0; cluster_weight=559;
taaggtcacggcaagacgagccg-------------------------------------
----------tttgttatt---acgataggtgccaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_001319_LCS count=1; cluster_center=False; cut=113188..113290; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.894231; Strand=0; cluster_weight=559;
taaggtcacggcaagactagccg-------------------------------------
----------tttattttt---acgataggtgccaagtggaagtgcagtaatgtatg-ta
gctgaggcatcctaacagaccgagagatttgaac-
>NC_004543_LCS count=1; cluster_center=False; cut=147535..147637; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.884615; Strand=0; cluster_weight=559;
taaggtcacggcaagatgagccg-------------------------------------
----------tttatcata---acaataggtgccaagtagaagtgcagtaatgtatg-ca
gctgaggcattctaacagaccgagagatttgaac-
>NC_020259_LCS count=1; cluster_center=False; cut=144766..144868; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.903846; Strand=0; cluster_weight=559;
taaggtcacggcaagatgagccg-------------------------------------
----------tttatcata---acaataggtgccaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_025659_LCS count=1; cluster_center=False; cut=124686..124788; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagcca-------------------------------------
----------tttctcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_026775_LCS count=1; cluster_center=False; cut=130118..130220; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------cttatcatt---acgataggtgccaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_026773_LCS count=1; cluster_center=False; cut=131757..131859; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------cttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_025305_LCS count=1; cluster_center=False; cut=135472..135570; seq_length=99; cluster=NC_000932_LCS; cluster_score=0.92233; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
--------------ttatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgaaagatttgaac-
>NC_011954_LCS count=1; cluster_center=False; cut=93045..93147; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.932692; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgcatg-ca
gctgagacatcctaacagaccgagagatttgaac-
>NC_026301_LCS count=1; cluster_center=False; cut=97098..97200; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.914286; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatc---acgataggtgtcaagtggagatgcagtaatgtatg-ca
gctgaggcatcctaaaagaccgagagatttgaac-
>NC_010654_LCS count=1; cluster_center=False; cut=101596..101698; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.92381; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatc---acgataggtgtcaagtggagatgcagtgatgtatg-ca
gctgaggcatcctaaaagaccgagagatttgaac-
>NC_026778_LCS count=1; cluster_center=False; cut=126845..126947; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_021936_LCS count=1; cluster_center=False; cut=132851..132953; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcattctaacagaccgagagatttgaac-
>NC_026776_LCS count=1; cluster_center=False; cut=134622..134724; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---atgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaatagaccgagagatttgaac-
>NC_014056_LCS count=1; cluster_center=False; cut=122521..122623; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tttctcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_026449_LCS count=1; cluster_center=False; cut=19564..19668; seq_length=105; cluster=NC_000932_LCS; cluster_score=0.813084; Strand=0; cluster_weight=559;
taaggtcacggcgagacgagccg-------------------------------------
----------tgtatcaac---attataggtgccgagtgtaagtgcggcgatgcatg-ca
gctgaggcatactaaaagaccgatatattttaac-
>NC_024945_LCS count=1; cluster_center=False; cut=109064..109165; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.896226; Strand=1; cluster_weight=559;
taaggtcacggcgagatgagccg-------------------------------------
----------tttatcag----acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagactaaaagatttgaac-
>NC_026785_LCS count=1; cluster_center=False; cut=132320..132422; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
taaggtcacggctagacgagccg-------------------------------------
----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_023805_LCS count=1; cluster_center=False; cut=98463..98565; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.894231; Strand=0; cluster_weight=559;
taaggtcacggtgagactagccg-------------------------------------
----------tttacgact---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctaaggcatcctaatagaccgaaagatttgaac-
>NC_024827_LCS count=1; cluster_center=False; cut=111970..112072; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.894231; Strand=1; cluster_weight=559;
taaggtcacggtgagactagccg-------------------------------------
----------tttacgact---acgataggtgtcaagtggaagtgcagtgatgtatg-ta
gctaaggcatcctaacagaccgaaagatttgaac-
>NC_020365_LCS count=1; cluster_center=False; cut=133176..133278; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
taaggtcacgtcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagcgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_010548_LCS count=1; cluster_center=False; cut=100631..100732; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.902913; Strand=0; cluster_weight=559;
taaggtcatggcgagacgagccg-------------------------------------
----------tttattag----acgataggtgtcaagtggaagtgcagtgatgcatg-ca
gccgaggcatcctaagagaccggaagatttgaac-
>NC_013086_LCS count=1; cluster_center=False; cut=137008..137110; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.885714; Strand=0; cluster_weight=559;
tgaggtcacggcaagatgagccg-------------------------------------
----------tttatcata---acgataggtgccaggtggaagtgcagtcatgtacg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_006861_LCS count=1; cluster_center=False; cut=143527..143629; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.885714; Strand=0; cluster_weight=559;
-aaggtcacggcaagacgagccg-------------------------------------
----------tttatcatc---acgataggtgccaagtggaaatacagtaatgtatg-ca
gctgaggcatcctaacagaccaagagatttgaacc
>NC_003386_LCS count=1; cluster_center=False; cut=125420..125522; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.885714; Strand=0; cluster_weight=559;
-aaggtcacggcaagacgagccg-------------------------------------
----------tttattatc---acgataggtgccaagtggaagtgcagtaatgtacg-ca
gctgaggcatcctaacagaccgatggctttgaacc
>NC_016471_LCS count=1; cluster_center=False; cut=70088..70189; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttataatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccaagagatttgaac-
>NC_010359_LCS count=1; cluster_center=False; cut=100778..100879; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.923077; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttatcatc---acgataggtgccaggtggaagtgcagtgatgtatg-ta
gctgaggcatcctaacagaccgagagatttgaac-
>NC_020372_LCS count=1; cluster_center=False; cut=142338..142439; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.961165; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttatcatc---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgatagatttgaac-
>NC_014582_LCS count=1; cluster_center=False; cut=127077..127178; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.970874; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccagtagacttgaac-
>NC_024421_LCS count=1; cluster_center=False; cut=132893..132994; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagcgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac-
>NC_018114_LCS count=1; cluster_center=False; cut=120740..120842; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.952381; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaacc
>NC_026847_LCS count=1; cluster_center=False; cut=142523..142622; seq_length=100; cluster=NC_000932_LCS; cluster_score=0.932039; Strand=0; cluster_weight=559;
-aaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---ccaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgcaagacttga---
>NC_023120_LCS count=1; cluster_center=False; cut=107871..107972; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.894231; Strand=0; cluster_weight=559;
-aaggtcacggtgagactagccg-------------------------------------
----------tttacgact---acgataggtgtcaagtggaagtgcagtgatgtatg-ta
gctaaggcatcctaacagaccgaaagatttgaac-
>NC_014874_LCS count=1; cluster_center=False; cut=41650..41752; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.885714; Strand=0; cluster_weight=559;
-aaggtcacggttagacgagccg-------------------------------------
----------tttattatt---atgataggtgtcaagtggaagtgcagtgatgcatg-ca
gctgaggcatactaacagaccgagagattttaacc
>NC_011942_LCS count=1; cluster_center=False; cut=39883..39972; seq_length=90; cluster=NC_000932_LCS; cluster_score=0.8; Strand=0; cluster_weight=559;
-------------agacgagccg-------------------------------------
----------tttatcatc---acgataggtgtcaagtggagatgcagtaatgtatg-ca
gctgaggcatcctaaaagaccgagagatttgaac-
>NC_016065_LCS count=1; cluster_center=False; cut=58742..58843; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.803738; Strand=0; cluster_weight=559;
agaggtcttggcgagactagcca-------------------------------------
----------gcgattag----acgataggtgtcaagtggaagtgcagtgatgcatg-ca
gccgagacatcctaagagaccaaaagatttgaac-
>NC_022136_LCS count=1; cluster_center=False; cut=152638..152740; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.932039; Strand=1; cluster_weight=559;
caaggtcacggcgagacgagccg-------------------------------------
----------tttctcatc---acgataggtgccaagtggaagtgcagtaatgtatg-ca
gctgaggcatcctaacagaccggaagatttgaac-
>NC_014063_LCS count=1; cluster_center=False; cut=89893..89996; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=0; cluster_weight=559;
caaggtcacggcgagacgagccg-------------------------------------
----------tttttcatt--aacgataggtgtcaagtggaagtgcagtaatgtatg-ca
gctgagtcatcctaacagaccgatagacttgaac-
>NC_023121_LCS count=1; cluster_center=False; cut=57558..57654; seq_length=97; cluster=NC_000932_LCS; cluster_score=0.84466; Strand=0; cluster_weight=559;
-caggtcacggcgagacgagccg-------------------------------------
----------ttag--------gtgataggtgtcaagtggaagtgcagtgatgcatg-ca
gccgaggcatactaaaagaccgaaagatttgaac-
>NC_021110_LCS count=1; cluster_center=False; cut=105447..105548; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.87619; Strand=0; cluster_weight=559;
cgaggtcacggcgagacgagccg-------------------------------------
----------tttatcag----acgataggtgttaagtgaaagtacagtgatgtatg-ca
gccaaggcatcctaacagaccga-agatttgaacc
>NC_016063_LCS count=1; cluster_center=False; cut=106726..106827; seq_length=102; cluster=NC_000932_LCS; cluster_score=0.885714; Strand=0; cluster_weight=559;
cgaggtcacggcgagacgagccg-------------------------------------
----------tttatcag----acgataggtgttaagtgaaagtgcagtgatgtatg-ca
gccaaggcatcctaacagaccga-agatttgaacc
>NC_025642_LCS count=1; cluster_center=False; cut=69137..69239; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.970874; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagcca-------------------------------------
----------tttatcatt---acgataggtgtcaagtgtaagtgcagtgatgtatg-ca
gctgagacatcctaacagaccggtagacttgaac-
>NC_026202_LCS count=1; cluster_center=False; cut=129378..129480; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttataatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_009266_LCS count=1; cluster_center=False; cut=130502..130604; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgcatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_002202_LCS count=1; cluster_center=False; cut=128763..128865; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.970874; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagacccacagacttgaac-
>NC_025554_LCS count=1; cluster_center=False; cut=135213..135315; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgtagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_021111_LCS count=1; cluster_center=False; cut=32758..32860; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.980583; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtgtaagtgcagtgatgtatg-ca
gctgagacatcctaacagaccggtagacttgaac-
>NC_023359_LCS count=1; cluster_center=False; cut=127655..127757; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.980583; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtgtaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgatagacttgaac-
>NC_010776_LCS count=1; cluster_center=False; cut=136579..136681; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.980583; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaggtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgatagacttgaac-
>NC_024635_LCS count=1; cluster_center=False; cut=108314..108416; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.980583; Strand=1; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---ataataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_025907_LCS count=1; cluster_center=False; cut=127320..127422; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.951456; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---ccaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccacaagacttgaac-
>NC_008336_LCS count=1; cluster_center=False; cut=133098..133200; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.961165; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttattatt---acgataggtgtcaagtggaagtgcagcgatgtatg-ca
gctgaggcatcctaacagaccgacagacttgaac-
>NC_022457_LCS count=1; cluster_center=False; cut=131133..131235; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.970874; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttattatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgccagacttgaac-
>NC_023259_LCS count=1; cluster_center=False; cut=137002..137104; seq_length=103; cluster=NC_000932_LCS; cluster_score=0.990291; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttattatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_025909_LCS count=1; cluster_center=False; cut=127251..127354; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.971154; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttctaatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_024038_LCS count=1; cluster_center=False; cut=106484..106587; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.942308; Strand=1; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttctaatt--aacgataggtgtcaggtggaagtgcagtaatgtacg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_014057_LCS count=1; cluster_center=False; cut=42962..43065; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.951923; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttttcatt--aacgataggtgtcaagtggaagtacagtaatgtatg-ca
gctgaggcatcctaacagaccgatagacttgaac-
>NC_002694_LCS count=1; cluster_center=False; cut=127517..127620; seq_length=104; cluster=NC_000932_LCS; cluster_score=0.980769; Strand=0; cluster_weight=559;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttttcatt--aacgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac-
>NC_010433_LCS_CMP complemented=True; count=19; cluster_center=True; seq_length=103; cluster=NC_010433_LCS; cluster_score=1.0; cluster_weight=28;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac
>NC_001666_LCS_CMP complemented=True; count=4; cluster_center=False; seq_length=95; cluster=NC_010433_LCS; cluster_score=0.847619; cluster_weight=28;
taaggtagcggcgagacgagccg-------------------------------------
----------ttta----------aataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaac-gaacgaacgatttgaac
>NC_013991_LCS_CMP complemented=True; count=2; cluster_center=False; seq_length=103; cluster=NC_010433_LCS; cluster_score=0.961538; cluster_weight=28;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgagagatttgaac
>NC_024168_LCS_CMP complemented=True; count=1; cluster_center=False; cut=129161..129258; seq_length=98; cluster=NC_010433_LCS; cluster_score=0.826923; Strand=1; cluster_weight=28;
--aggtcacggcaagacgagccg-------------------------------------
----------tttt---ag---acaataggtgccaggtggaagcgcagtaatgtgtg-ca
gccgaggcatcctaacagaccgagaggtttgaac
>NC_023356_LCS_CMP complemented=True; count=1; cluster_center=False; cut=79931..80033; seq_length=103; cluster=NC_010433_LCS; cluster_score=0.961165; Strand=0; cluster_weight=28;
taaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---atgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgatagatttgaac
>NC_013707_LCS_CMP complemented=True; count=1; cluster_center=False; cut=132910..133011; seq_length=102; cluster=NC_010433_LCS; cluster_score=0.990291; Strand=1; cluster_weight=28;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaa-
>NC_021372_LCS count=3; cluster_center=True; seq_length=104; cluster=NC_021372_LCS; cluster_score=1.0; Strand=0; cluster_weight=3;
taaggtagcggcgagacgagccg-------------------------------------
----------ttt----------aaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacgaac-gaacgatttgaac
>NC_007578_LCS count=1; cluster_center=True; cut=129597..129859; seq_length=263; cluster=NC_007578_LCS; cluster_score=1.0; Strand=0; cluster_weight=1;
gaaggtcacggcgagacgagccg-------------------------------------
----------tttatcatt---acgataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaacc
>NC_008454_LCS count=1; cluster_center=True; cut=197495..197626; seq_length=132; cluster=NC_008454_LCS; cluster_score=1.0; Strand=1; cluster_weight=1;
gaaggtcacggcgagacgagccg------------------tttatcatattactcaatt
gatcattacgtttatcatt---acgataggtgttaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccgttagacttgaac
>NC_014569_LCS count=1; cluster_center=True; cut=102326..102478; seq_length=153; cluster=NC_014569_LCS; cluster_score=1.0; Strand=0; cluster_weight=1;
gaaggtcacggcgagacgagccgtttgttttagagtgtcaaagtcttgagaattcaggcg
cggcccgtcctttagagcaaaacaaataggtgtcaagtggaagtgcagtgatgtatg-ca
gctgaggcatcctaacagaccggtagacttgaac
>NC_026448_LCS count=1; cluster_center=True; cut=12936..13042; seq_length=107; cluster=NC_026448_LCS; cluster_score=1.0; Strand=0; cluster_weight=1;
taaggtcgcggcgagatgatccg-------------------------------------
----------ttgatagtgactatgataggtactaagtgtaaatgcagcgatgtatgtta
gcttaggtatcctaaaagaccgatttatttgaac
BIN
View File
Binary file not shown.
+50
View File
@@ -0,0 +1,50 @@
#!/bin/bash
#
awk 'function printfasta(seq) { \
seqlen=length(seq); \
for (i=1; i <= seqlen; i+=60) \
print substr(seq,i,60); \
} \
function comp(seq) { \
"echo "seq" | tr acgtACGT tgcaTGCA " | getline res; \
close("echo "seq" | tr acgtACGT tgcaTGCA "); \
return res; \
} \
function rev(seq) { \
"echo "seq" | rev " | getline res; \
close("echo "seq" | rev "); \
return res; \
} \
function revcomp(seq) { \
res=rev(comp(seq)); \
return res; \
} \
\
/^LOCUS / {AC=$2; sequence=""; seqon=0; FROM="";TO=""} \
/^ rRNA / {LOCUS=$2; STRAND=1} \
/^ rRNA / && /complement/ {STRAND=0; \
sub("complement\\(","",LOCUS); \
sub("\\)","",LOCUS); \
} \
/16S/ {split(LOCUS,POS,"."); \
FROM=POS[1]; \
TO=POS[3]; \
LENGTH=TO-FROM+1 \
} \
/^ORIGIN/ {seqon=1} \
/^ *[1-9][0-9]* [a-z ]+$/ && seqon {seq=$2 $3 $4 $5 $6 $7; \
gsub("[^acgt]","n",seq);\
sequence=sequence seq \
} \
/^\/\// && FROM \
{print ">"AC"_16S Strand="STRAND";", \
"cut="FROM".."TO";", \
"seq_length="LENGTH";"; \
SS=substr(sequence,FROM,LENGTH); \
if (! STRAND) \
SS=revcomp(SS); \
printfasta(SS); \
} \
' $*
+50
View File
@@ -0,0 +1,50 @@
#!/bin/bash
#
awk 'function printfasta(seq) { \
seqlen=length(seq); \
for (i=1; i <= seqlen; i+=60) \
print substr(seq,i,60); \
} \
function comp(seq) { \
"echo "seq" | tr acgtACGT tgcaTGCA " | getline res; \
close("echo "seq" | tr acgtACGT tgcaTGCA "); \
return res; \
} \
function rev(seq) { \
"echo "seq" | rev " | getline res; \
close("echo "seq" | rev "); \
return res; \
} \
function revcomp(seq) { \
res=rev(comp(seq)); \
return res; \
} \
\
/^LOCUS / {AC=$2; sequence=""; seqon=0; FROM="";TO=""} \
/^ rRNA / {LOCUS=$2; STRAND=1} \
/^ rRNA / && /complement/ {STRAND=0; \
sub("complement\\(","",LOCUS); \
sub("\\)","",LOCUS); \
} \
/4.5S/ {split(LOCUS,POS,"."); \
FROM=POS[1]; \
TO=POS[3]; \
LENGTH=TO-FROM+1 \
} \
/^ORIGIN/ {seqon=1} \
/^ *[1-9][0-9]* [a-z ]+$/ && seqon {seq=$2 $3 $4 $5 $6 $7; \
gsub("[^acgt]","n",seq);\
sequence=sequence seq \
} \
/^\/\// && FROM \
{print ">"AC"_4.5S Strand="STRAND";", \
"cut="FROM".."TO";", \
"seq_length="LENGTH";"; \
SS=substr(sequence,FROM,LENGTH); \
if (! STRAND) \
SS=revcomp(SS); \
printfasta(SS); \
} \
' $*
BIN
View File
Binary file not shown.
+20
View File
@@ -0,0 +1,20 @@
#!/bin/csh
#
# check if port is installed
#
set ORG_HOME = `dirname $0`/..
set PORTNAME = `$ORG_HOME/config/guess_port`
if (-f $ORG_HOME/ports/$PORTNAME/bin/exonerate) then
echo "+ port $PORTNAME is correctly installed"
exit 0
endif
echo "! port $PORTNAME not installed"
echo "! Please read README.txt for proper installation"
exit 1
+19
View File
@@ -0,0 +1,19 @@
#!/bin/csh
#
# a sample script to show how to retrieve proper path for port
#
set ORG_HOME = `dirname $0`/..
set PORTNAME = `$ORG_HOME/config/guess_port`
set path = ($path $ORG_HOME/ports/$PORTNAME/bin)
#
which aragorn
exit 0
Executable
+33
View File
@@ -0,0 +1,33 @@
# ---------------------------------------------------------------
# $Id: Makefile 1825 2013-02-26 09:39:47Z viari $
# ---------------------------------------------------------------
# @file: Makefile
# @desc: makefile for src
#
# @history:
# @+ <Gloup> : Mar 92 : first draft
# @+ <Gloup> : Jul 93 : revised version
# @+ <Gloup> : Feb 01 : Adapted to LXware
#
# @note: should be processed with gnu compatible make
# @note: helixware_compatible
#
# @end:
# ---------------------------------------------------------------
#
include ../config/auto.conf
DIRS = exonerate \
kimono \
prokov \
sequtils \
aragorn \
ncbiblast
include ../config/targets/propagate.targ
include ../config/targets/help.targ
portclean::
$(MAKE) ACTION=$@ _action
(! test -d $(PRTDIR)) || \rm -r $(PRTDIR)
+70
View File
@@ -0,0 +1,70 @@
#
# ------------------------------------------
# ORG.Annot - Organelle Annotator
# version 1.0.0 - Sept 2015
# ------------------------------------------
#
# this directory contains sources for tools used by ORG.Annot
# this is only useful if you need to recompile binaries
#
# -------------------------
# -0- Requirements
# -------------------------
#
# gnu tar : version >= 1.15
# gnu make : version >= 3.81
# gcc and g++ : version >= 3.4.6
#
# note: valid versions of gnu tar and make are in _unix_tools_
#
#
# -------------------------
# -1- Checking configuration files
# -------------------------
#
# issue:
# $ config/guess_port
#
# if output is 'unknown <mach>:<sys>:<rel>'
# then you should :
# - add a port entry in guess_port for <mach>:<sys>:<rel>
# - create a ports/<port>.conf configuration file
# (the best is to start from another port file,
# choose whatever looks closest)
#
# if output is something else (e.g. i386-darwin)
# then the configuration files are already defined for your port
#
# -------------------------
# -2- Compiling
# -------------------------
#
# just run make from 'src':
#
# $ cd src
# $ make
#
#
# if everything runs fine, you may then issue:
#
# $ make clean
#
# to cleanup unecessary files
#
# at this point all binaries should be located in ports/<PORTNAME>/bin
#
# -------------------------
# -3- Recompiling a port
# -------------------------
#
# if you need to fully recompile a port
#
# $ cd src
# $ make portclean
# $ make
# $ make clean
#
Binary file not shown.
Binary file not shown.
+29
View File
@@ -0,0 +1,29 @@
# ---------------------------------------------------------------
# $Id: $
# ---------------------------------------------------------------
# @file: Makefile
# @desc: makefile for aragorn
#
# @history:
# @history:
# @+ <Gloup> : Sep 12: Created
#
# @note: should be processed with gnu compatible make
# @note: helixware_compatible
#
# @end:
# ---------------------------------------------------------------
#
include ../../config/auto.conf
OSRC = aragorn1.2.36.c
PROGS = aragorn
include ../../config/targets/lxbin.targ
include ../../config/targets/help.targ
INCDIR = .
aragorn: $(OBJ)
$(CC) -o $@ $^ $(LDFLAGS) $(LDLIBS)
+390
View File
@@ -0,0 +1,390 @@
'\" t
.\" Title: aragorn
.\" Author: [see the "AUTHORS" section]
.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
.\" Date: 02/24/2013
.\" Manual: \ \&
.\" Source: \ \&
.\" Language: English
.\"
.TH "ARAGORN" "1" "02/24/2013" "\ \&" "\ \&"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
.\" http://bugs.debian.org/507673
.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
.ie \n(.g .ds Aq \(aq
.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
.\" disable hyphenation
.nh
.\" disable justification (adjust text to left margin only)
.ad l
.\" -----------------------------------------------------------------
.\" * MAIN CONTENT STARTS HERE *
.\" -----------------------------------------------------------------
.SH "NAME"
aragorn \- detect tRNA genes in nucleotide sequences
.SH "SYNOPSIS"
.sp
\fBaragorn\fR [\fIOPTION\fR]\&... \fIFILE\fR
.SH "OPTIONS"
.PP
\fB\-m\fR
.RS 4
Search for tmRNA genes\&.
.RE
.PP
\fB\-t\fR
.RS 4
Search for tRNA genes\&. By default, all are detected\&. If one of
\fB\-m\fR
or
\fB\-t\fR
is specified, then the other is not detected unless specified as well\&.
.RE
.PP
\fB\-mt\fR
.RS 4
Search for Metazoan mitochondrial tRNA genes\&. tRNA genes with introns not detected\&.
\fB\-i\fR,
\fB\-sr\fR
switchs ignored\&. Composite Metazoan mitochondrial genetic code used\&.
.RE
.PP
\fB\-mtmam\fR
.RS 4
Search for Mammalian mitochondrial tRNA genes\&.
\fB\-i\fR,
\fB\-sr\fR
switchs ignored\&.
\fB\-tv\fR
switch set\&. Mammalian mitochondrial genetic code used\&.
.RE
.PP
\fB\-mtx\fR
.RS 4
Same as
\fB\-mt\fR
but low scoring tRNA genes are not reported\&.
.RE
.PP
\fB\-mtd\fR
.RS 4
Overlapping metazoan mitochondrial tRNA genes on opposite strands are reported\&.
.RE
.PP
\fB\-gc\fR[\fInum\fR]
.RS 4
Use the GenBank transl_table = [\fInum\fR] genetic code\&. Individual modifications can be appended using
\fI,BBB\fR=<aa> B = A,C,G, or T\&. <aa> is the three letter code for an amino\-acid\&. More than one modification can be specified\&. eg
\fB\-gcvert\fR,aga=Trp,agg=Trp uses the Vertebrate Mitochondrial code and the codons AGA and AGG changed to Tryptophan\&.
.RE
.PP
\fB\-gcstd\fR
.RS 4
Use standard genetic code\&.
.RE
.PP
\fB\-gcmet\fR
.RS 4
Use composite Metazoan mitochondrial genetic code\&.
.RE
.PP
\fB\-gcvert\fR
.RS 4
Use Vertebrate mitochondrial genetic code\&.
.RE
.PP
\fB\-gcinvert\fR
.RS 4
Use Invertebrate mitochondrial genetic code\&.
.RE
.PP
\fB\-gcyeast\fR
.RS 4
Use Yeast mitochondrial genetic code\&.
.RE
.PP
\fB\-gcprot\fR
.RS 4
Use Mold/Protozoan/Coelenterate mitochondrial genetic code\&.
.RE
.PP
\fB\-gcciliate\fR
.RS 4
Use Ciliate genetic code\&.
.RE
.PP
\fB\-gcflatworm\fR
.RS 4
Use Echinoderm/Flatworm mitochondrial genetic code
.RE
.PP
\fB\-gceuplot\fR
.RS 4
Use Euplotid genetic code\&.
.RE
.PP
\fB\-gcbact\fR
.RS 4
Use Bacterial/Plant Chloroplast genetic code\&.
.RE
.PP
\fB\-gcaltyeast\fR
.RS 4
Use alternative Yeast genetic code\&.
.RE
.PP
\fB\-gcascid\fR
.RS 4
Use Ascidian Mitochondrial genetic code\&.
.RE
.PP
\fB\-gcaltflat\fR
.RS 4
Use alternative Flatworm Mitochondrial genetic code\&.
.RE
.PP
\fB\-gcblep\fR
.RS 4
Use Blepharisma genetic code\&.
.RE
.PP
\fB\-gcchloroph\fR
.RS 4
Use Chlorophycean Mitochondrial genetic code\&.
.RE
.PP
\fB\-gctrem\fR
.RS 4
Use Trematode Mitochondrial genetic code\&.
.RE
.PP
\fB\-gcscen\fR
.RS 4
Use Scenedesmus obliquus Mitochondrial genetic code\&.
.RE
.PP
\fB\-gcthraust\fR
.RS 4
Use Thraustochytrium Mitochondrial genetic code\&.
.RE
.PP
\fB\-tv\fR
.RS 4
Do not search for mitochondrial TV replacement loop tRNA genes\&. Only relevant if
\fB\-mt\fR
used\&.
.RE
.PP
\fB\-c7\fR
.RS 4
Search for tRNA genes with 7 base C\-loops only\&.
.RE
.PP
\fB\-i\fR
.RS 4
Search for tRNA genes with introns in anticodon loop with maximum length 3000 bases\&. Minimum intron length is 0 bases\&. Ignored if
\fB\-m\fR
is specified\&.
.RE
.PP
\fB\-i\fR[\fImax\fR]
.RS 4
Search for tRNA genes with introns in anticodon loop with maximum length [\fImax\fR] bases\&. Minimum intron length is 0 bases\&. Ignored if
\fB\-m\fR
is specified\&.
.RE
.PP
\fB\-i\fR[\fImin\fR],[\fImax\fR]
.RS 4
Search for tRNA genes with introns in anticodon loop with maximum length [\fImax\fR] bases, and minimum length [\fImin\fR] bases\&. Ignored if
\fB\-m\fR
is specified\&.
.RE
.PP
\fB\-io\fR
.RS 4
Same as
\fB\-i\fR, but allow tRNA genes with long introns to overlap shorter tRNA genes\&.
.RE
.PP
\fB\-if\fR
.RS 4
Same as
\fB\-i\fR, but fix intron between positions 37 and 38 on C\-loop (one base after anticodon)\&.
.RE
.PP
\fB\-ifo\fR
.RS 4
Same as
\fB\-if\fR
and
\fB\-io\fR
combined\&.
.RE
.PP
\fB\-ir\fR
.RS 4
Same as
\fB\-i\fR, but report tRNA genes with minimum length [\fImin\fR] bases rather than search for tRNA genes with minimum length [\fImin\fR] bases\&. With this switch, [\fImin\fR] acts as an output filter, minimum intron length for searching is still 0 bases\&.
.RE
.PP
\fB\-c\fR
.RS 4
Assume that each sequence has a circular topology\&. Search wraps around each end\&. Default setting\&.
.RE
.PP
\fB\-l\fR
.RS 4
Assume that each sequence has a linear topology\&. Search does not wrap\&.
.RE
.PP
\fB\-d\fR
.RS 4
Double\&. Search both strands of each sequence\&. Default setting\&.
.RE
.PP
\fB\-s\fR or \fB\-s+\fR
.RS 4
Single\&. Do not search the complementary (antisense) strand of each sequence\&.
.RE
.PP
\fB\-sc\fR or \fB\-s\-\fR
.RS 4
Single complementary\&. Do not search the sense strand of each sequence\&.
.RE
.PP
\fB\-ps\fR
.RS 4
Lower scoring thresholds to 95% of default levels\&.
.RE
.PP
\fB\-ps\fR[\fInum\fR]
.RS 4
Change scoring thresholds to [\fInum\fR] percent of default levels\&.
.RE
.PP
\fB\-rp\fR
.RS 4
Flag possible pseudogenes (score < 100 or tRNA anticodon loop <> 7 bases long)\&. Note that genes with score < 100 will not be detected or flagged if scoring thresholds are not also changed to below 100% (see \-ps switch)\&.
.RE
.PP
\fB\-seq\fR
.RS 4
Print out primary sequence\&.
.RE
.PP
\fB\-br\fR
.RS 4
Show secondary structure of tRNA gene primary sequence using round brackets\&.
.RE
.PP
\fB\-fasta\fR
.RS 4
Print out primary sequence in fasta format\&.
.RE
.PP
\fB\-fo\fR
.RS 4
Print out primary sequence in fasta format only (no secondary structure)\&.
.RE
.PP
\fB\-fon\fR
.RS 4
Same as
\fB\-fo\fR, with sequence and gene numbering in header\&.
.RE
.PP
\fB\-fos\fR
.RS 4
Same as
\fB\-fo\fR, with no spaces in header\&.
.RE
.PP
\fB\-fons\fR
.RS 4
Same as
\fB\-fo\fR, with sequence and gene numbering, but no spaces\&.
.RE
.PP
\fB\-w\fR
.RS 4
Print out in Batch mode\&.
.RE
.PP
\fB\-ss\fR
.RS 4
Use the stricter canonical 1\-2 bp spacer1 and 1 bp spacer2\&. Ignored if
\fB\-mt\fR
set\&. Default is to allow 3 bp spacer1 and 0\-2 bp spacer2, which may degrade selectivity\&.
.RE
.PP
\fB\-v\fR
.RS 4
Verbose\&. Prints out information during search to STDERR\&.
.RE
.PP
\fB\-a\fR
.RS 4
Print out tRNA domain for tmRNA genes\&.
.RE
.PP
\fB\-a7\fR
.RS 4
Restrict tRNA astem length to a maximum of 7 bases
.RE
.PP
\fB\-aa\fR
.RS 4
Display message if predicted iso\-acceptor species does not match species in sequence name (if present)\&.
.RE
.PP
\fB\-j\fR
.RS 4
Display 4\-base sequence on 3\*(Aq end of astem regardless of predicted amino\-acyl acceptor length\&.
.RE
.PP
\fB\-jr\fR
.RS 4
Allow some divergence of 3\*(Aq amino\-acyl acceptor sequence from NCCA\&.
.RE
.PP
\fB\-jr4\fR
.RS 4
Allow some divergence of 3\*(Aq amino\-acyl acceptor sequence from NCCA, and display 4 bases\&.
.RE
.PP
\fB\-q\fR
.RS 4
Dont print configuration line (which switchs and files were used)\&.
.RE
.PP
\fB\-rn\fR
.RS 4
Repeat sequence name before summary information\&.
.RE
.PP
\fB\-O\fR [\fIoutfile\fR]
.RS 4
Print output to
\fI\&. If [\*(Aqoutfile\fR] already exists, it is overwritten\&. By default all output goes to stdout\&.
.RE
.SH "DESCRIPTION"
.sp
aragorn detects tRNA, mtRNA, and tmRNA genes\&. A minimum requirement is at least a 32 bit compiler architecture (variable types int and unsigned int are at least 4 bytes long)\&.
.sp
[\fIFILE\fR] is assumed to contain one or more sequences in FASTA format\&. Results of the search are printed to STDOUT\&. All switches are optional and case\-insensitive\&. Unless \-i is specified, tRNA genes containing introns are not detected\&.
.SH "AUTHORS"
.sp
Bjorn Canback <bcanback@acgt\&.se>, Dean Laslett <gaiaquark@gmail\&.com>
.SH "REFERENCES"
.sp
Laslett, D\&. and Canback, B\&. (2004) ARAGORN, a program for the detection of transfer RNA and transfer\-messenger RNA genes in nucleotide sequences Nucleic Acids Research, 32;11\-16
.sp
Laslett, D\&. and Canback, B\&. (2008) ARWEN: a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences Bioinformatics, 24(2); 172\-175\&.
File diff suppressed because it is too large Load Diff
Executable
+14
View File
@@ -0,0 +1,14 @@
#!/bin/csh -f
set cfg = `find . -type d -name config -print | grep -v ncbi`
foreach cf ($cfg)
echo $cf
\rm -r $cf
cp -r ../config $cf
end
exit 0
BIN
View File
Binary file not shown.
+24
View File
@@ -0,0 +1,24 @@
# ---------------------------------------------------------------
# $Id: $
# ---------------------------------------------------------------
# @file: Makefile
# @desc: makefile for package exonerate
#
# @history:
# @+ <Gloup> : Sept 15 : Adapted to ORG.Annot
#
# @note: should be processed with gnu compatible make
# @note: helixware_compatible
#
# @end:
# ---------------------------------------------------------------
#
include ../../config/auto.conf
PKG = exonerate-2.2.0
include $(CFGDIR)targets/package.targ
include $(CFGDIR)targets/help.targ
Binary file not shown.
Binary file not shown.
+33
View File
@@ -0,0 +1,33 @@
# ---------------------------------------------------------------
# $Id: $
# ---------------------------------------------------------------
# @file: Makefile
# @desc: makefile for lxpack
#
# @history:
# @history:
# @+ <Gloup> : Apr 97 : Created
# @+ <Gloup> : Mar 02 : Updated for LXxware
#
# @note: should be processed with gnu compatible make
# @note: helixware_compatible
#
# @end:
# ---------------------------------------------------------------
#
include ../../config/auto.conf
DIRS = lxpack
include ../../config/targets/propagate.targ
include ../../config/targets/help.targ
all::
$(MAKE) ACTION=$@ _action
test -d $(PRTDIR) || mkdir $(PRTDIR)
test -d $(BINDIR) || mkdir $(BINDIR)
\cp -f lxpack/ports/$(PORTNAME)/bin/* $(BINDIR)
clean::
$(MAKE) -C lxpack portclean
+29
View File
@@ -0,0 +1,29 @@
# ---------------------------------------------------------------
# $Id: $
# ---------------------------------------------------------------
# @file: Makefile
# @desc: makefile for kimono
#
# @history:
# @history:
# @+ <Gloup> : Apr 97 : Created
# @+ <Gloup> : Mar 02 : Updated for LXxware
#
# @note: should be processed with gnu compatible make
# @note: helixware_compatible
#
# @end:
# ---------------------------------------------------------------
#
include ./config/auto.conf
DIRS = src \
tests
include ./config/targets/propagate.targ
include ./config/targets/help.targ
portclean::
$(MAKE) ACTION=$@ _action
(! test -d $(PRTDIR)) || \rm -r $(PRTDIR)
+51
View File
@@ -0,0 +1,51 @@
$Id: README.txt 1825 2013-02-26 09:39:47Z viari $
This directory contains Makefile machine specific configuration files
(and default targets to help you writing Makefile's)
These headers should be used with GNU make or compatible
#
# portname
#
To check your port, issue :
./guess_port
if output is 'unknown <mach>:<sys>:<rel>' then you should :
- add a port entry in guess_port for <mach>:<sys>:<rel>
- create a ports/<port>.conf configuration file
(the best is to start from another port file,
choose whatever looks closest)
#
# configuration flags
#
auto.conf : the main configuration file :
- determine the machine port thru 'guess_port' shell
- include 'default.conf' file
- include the machine specific 'ports/<port>.conf' file
default.conf : default configuration (included by 'auto.conf')
ports/<port>.conf : machine specific configuration (included by 'auto.conf')
#
# utility targets
#
targets/help.targ : target for standard help
targets/propagate.targ : target for propagating targets to subdirectories
targets/package.targ : default targets for standard package with 'configure'
targets/empty.targ : default empty targets (defined as double colon rules)
targets/lxbin.targ : default make targets for standard lx binary (without libraries)
targets/debug.targ : target to print debug information (for dev.)
+54
View File
@@ -0,0 +1,54 @@
#
# $Id: auto.conf 1825 2013-02-26 09:39:47Z viari $
#
# auto.conf
# auto configuration file using guess_port
#
# this file is included in Makefile
#
#
# default shell for gnu-make
#
SHELL = /bin/sh
#
# CFGDIR : location of config files = this file directory location
#
# CFGPRT : port name (as returned by guess_port)
#
# because builtin 'lastword' is missing in gnu-make 3.80
lastword = $(word $(words $1), $1)
CFGDIR := $(dir $(call lastword, $(MAKEFILE_LIST)))
CFGPRT := $(shell $(CFGDIR)guess_port)
# check if port is correctly defined
ifneq (1, $(words $(CFGPRT)))
entry := $(call lastword, $(CFGPRT))
$(error port is undefined - add entry for "$(entry)" in configuration file -)
endif
#
# PORTNAME : port name to use : default is CFGPRT but may be futher modified
# by machine specific configuration
PORTNAME = $(CFGPRT)
#
# default configuration
# may be overriden by machine dependant definitions below
#
include $(CFGDIR)default.conf
#
# machine dependant definitions
#
include $(CFGDIR)ports/$(CFGPRT).conf
+124
View File
@@ -0,0 +1,124 @@
#
# $Id: default.conf 2007 2013-12-03 14:21:39Z viari $
#
# default.conf
# default configuration flags
# maybe further redefined by machine specific configuration
#
# this file is included by auto.conf
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF =
#
# CC : (ansi C) compiler command to use
# you may add some machine specific flags (like -arch ...)
# in the <machine>.conf configuration file
#
CC = gcc
#
# default compiler optimizer flag
#
OPTIM = -O
#
# CC_LIBS : additionnal machine specific $(CC) libraries
# like '-lC' on some machines
#
CC_LIBS =
#
# MALLOC_LIBS : machine specific malloc librairies
# like '-lmalloc' on SGI
#
MALLOC_LIBS =
#
# MATH_LIBS : machine specific math librairies
# like '-lm' on Solaris
#
MATH_LIBS =
#
# LINT : looks like LINT command does not exist anymore
# here is a rough replacement
#
LINT = gcc -S -Wall -Wno-format-y2k -W -Wstrict-prototypes \
-Wmissing-prototypes -Wpointer-arith -Wreturn-type \
-Wcast-qual -Wwrite-strings -Wswitch -Wshadow \
-Wcast-align -Wbad-function-cast -Wchar-subscripts \
-Winline -Wnested-externs -Wredundant-decls
# ------------------------------------
# General system commands
# ------------------------------------
#
# AR : AR archive command
# ARFLAGS : $(AR) archiving flags
# ARXFLAGS : $(AR) extraction flags
#
AR = ar
ARFLAGS = rcv
ARXFLAGS = xv
#
# RANLIB : ranlib command
#
RANLIB = ranlib
#
# DIFF : diff command
#
DIFF = diff
#
# TAR : tar command
#
TAR = tar
# ------------------------------------
# Default locations
# ------------------------------------
#
# PRTDIR : port dependent files location (libraries and binaries)
# BINDIR : port binaries
# LIBDIR : port libraries
#
PRTDIR = $(CFGDIR)../ports/$(PORTNAME)
BINDIR = $(PRTDIR)/bin
LIBDIR = $(PRTDIR)/lib
# ------------------------------------
# default gmake variable in implicit rules
# ------------------------------------
CFLAGS = $(OPTIM) $(MACHDEF) -I$(INCDIR)
LDFLAGS = -L$(LIBDIR) -L.
LDLIBS = $(LIBS) $(MALLOC_LIBS) $(MATH_LIBS) $(CC_LIBS)
LINTFLAGS = $(MACHDEF) -I$(INCDIR)
+33
View File
@@ -0,0 +1,33 @@
#! /bin/sh
#
# $Id: guess_port 1825 2013-02-26 09:39:47Z viari $
#
# @file: guess_port
# @desc: attempt to guess the portname
# @usage: guess_port
#
# @history:
# @+ <Gloup> Nov. 2000 first draft adapted from GNU config.guess
# @+ <Gloup> Feb. 2010 moved to sh
#
mach=`uname -m`
syst=`uname -s`
rels=`uname -r`
case ${mach}:${syst}:${rels} in
alpha:OSF1:* ) echo alpha-osf1;;
sun4*:SunOS:5.* ) echo sparc-solaris;;
i86pc:SunOS:5.* ) echo i386-solaris;;
sun4*:SunOS:* ) echo sparc-sunos;;
Power*:Darwin:* ) echo ppc-darwin;;
i*86:Linux:* ) echo i386-linux;;
x*86*:Linux:* ) echo i386-linux;;
i*86:Darwin:* ) echo i386-darwin;;
IP*:IRIX*:* ) echo mips-irix;;
i*86:MINGW32*:* ) echo x86-mingw32;;
*) echo unknown ${mach}:${syst}:${rels}; exit 1;;
esac
exit 0
@@ -0,0 +1,26 @@
#
# $Id: i386-darwin.conf 1825 2013-02-26 09:39:47Z viari $
#
# i386-darwin.conf
# configuration file for MacOS-X/Intel-Based/Darwin 1.2 with gcc compiler
# this file is included in Makefile
#
# system (uname -srp) : Darwin 8.7.1 i386
# compiler (cc --version) : i686-apple-darwin8-gcc-4.0.1
#
# check tags
# @uname:uname -srp:Darwin 8.7.1 i386
# @cc:cc --version:i686-apple-darwin8-gcc-4.0.1
#
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF = -DLX_TARGET_MACINTEL -DLITTLE_ENDIAN -DMACOSX
+32
View File
@@ -0,0 +1,32 @@
#
# $Id: i386-linux.conf 1825 2013-02-26 09:39:47Z viari $
#
# i386-linux.conf
# configuration file for linux ix86 with GNU gcc compiler
# this file is included in Makefile
#
# system (uname -srp) : Linux 2.2.14-5.0 unknown
# compiler (gcc --version) : egcs-2.91.66
#
# check tags
# @uname:uname -srp:Linux 2.2.14-5.0 unknown
# @cc:cc --version:egcs-2.91.66
#
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF = -DLX_TARGET_LINUX -DLITTLE_ENDIAN
#
# MATH_LIBS : machine specific math librairies
#
MATH_LIBS = -lm
+32
View File
@@ -0,0 +1,32 @@
#
# $Id: ppc-darwin.conf 1825 2013-02-26 09:39:47Z viari $
#
# ppc-darwin.conf
# configuration file for MacOS-X/Darwin 1.2 with native cc compiler
# this file is included in Makefile
#
# system (uname -srp) : Darwin 1.2 powerpc
# compiler (cc --version) : 2.7.2.1
#
# check tags
# @uname:uname -srp:Darwin 1.2 powerpc
# @cc:cc --version:2.7.2.1
#
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF = -DLX_TARGET_MACPPC -DBIG_ENDIAN
#
# CC : name of (ansi C) compiler to use
#
CC = cc -arch ppc
+31
View File
@@ -0,0 +1,31 @@
#
# $Id: sparc-solaris.conf 1825 2013-02-26 09:39:47Z viari $
#
# sparc-solaris.conf
# configuration file for sparc solaris with GNU gcc compiler
# this file is included in Makefile
#
# system (uname -srp) : SunOS 5.8 sparc
# compiler (gcc --version) : 2.95.2
#
# check tags
# @uname:uname -srp:SunOS 5.8 sparc
# @cc:cc --version:2.95.2
#
#
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# MACHDEF : define machine and OS specific flags
#
MACHDEF = -DLX_TARGET_SOLARIS -DBIG_ENDIAN
#
# MATH_LIBS : machine specific math librairies
#
MATH_LIBS = -lm
@@ -0,0 +1,54 @@
#
# $Id: x86-mingw32.conf 1825 2013-02-26 09:39:47Z viari $
#
# x86-mingw32
# configuration file for MinGW with GNU gcc compiler.
#
# this file is included in Makefile
#
#
#
# rename PORTNAME safely since MinGW produce pure win32 executables
# without dll's
#
PORTNAME = x86-win32
# ------------------------------------
# General compilation flags
# ------------------------------------
#
# CC_LIBS : additionnal machine specific $(CC) libraries
#
# libiberty is needed for some system extensions (like mkstemps)
#
CC_LIBS = -liberty
#
# MACHDEF : define machine and OS specific flags
#
# -DDLMALLOC : use dlmalloc instead of malloc (which does not have mallinfo)
# -posix is a new replacement for several MinGW32 flags, including:
# -D__USE_MINGW_ANSI_STDIO : mingw gcc flag to recognize the C99 "%zu" format
#
MACHDEF = -posix -DLX_TARGET_WIN32 -DWIN_MINGW -DDLMALLOC -DLITTLE_ENDIAN
#
# MATH_LIBS : machine specific math librairies
#
MATH_LIBS = -lm
# ------------------------------------
# General system commands
# ------------------------------------
#
# DIFF : diff command / should ignore cr on windows
#
DIFF = diff --strip-trailing-cr
@@ -0,0 +1,25 @@
#
# $Id: help.targ 1825 2013-02-26 09:39:47Z viari $
#
# debug.targ
#
# target to print debug information (dev. only)
#
# it defines the following targets:
#
# debug :
# print debug
#
# it requires auto.conf
#
.PHONY: debug
debug::
@echo "+ PORTNAME: $(PORTNAME)"
@echo "+ CFGPRT: $(CFGPRT)"
@echo "+ CFGDIR: $(CFGDIR)"
@echo "+ PRTDIR: $(PRTDIR)"
@echo "+ MACHDEF: $(MACHDEF)"
@@ -0,0 +1,24 @@
#
# $Id: $
#
# epty.targ
#
# default empty targets (defined as double colon rules)
#
#
#
# Rules
#
.PHONY: all test clean portclean help
all::
test::
clean::
portclean:: clean
test::
@@ -0,0 +1,23 @@
#
# $Id: help.targ 1825 2013-02-26 09:39:47Z viari $
#
# help.targ
#
# default target to print help
#
# it defines the following targets:
#
# help :
# print help
#
.PHONY: help
help::
@ echo "basic usage: make [<action>+]"
@ echo "valid <action> :"
@ echo " all : compile everything for current port [default target]"
@ echo " clean : local cleanup"
@ echo " portclean : cleanup distribution for current port"
@ echo " test : run tests on current port"
@ echo " help : print this help"
@@ -0,0 +1,51 @@
#
# $Id: $
#
# lxbin.targ
#
# default make targets for standard lx binary
#
# you should define the 'PROGS' and 'OSRC' variables
# and optionnaly 'LIBS' if binaries have to be linked with libraries
#
# note: if main source code for binary PROG is PROG.c, there is nothing to do,
# else (e.g. if it involves several sources files) you should also add local
# file dependencies. e.g under the form:
#
# mymain: $(OBJ) mymain_base.c mymain_help.c
# $(CC) $(CFLAGS) -o $@ $^ $(LDFLAGS) $(LDLIBS)
#
#
# 'auto.conf' should have been included
#
OBJ = $(OSRC:.c=.o)
INCDIR = ../include
#
# Rules
#
.PHONY: all prelib install test clean portclean
all:: prelib $(PROGS) install
@echo "+++++++++++ binaries $(PROGS) done"
prelib::
test -d $(PRTDIR) || mkdir $(PRTDIR) # because some linker may complain
test -d $(LIBDIR) || mkdir $(LIBDIR) # if -L$(LIBDIR) does not exist
install::
test -d $(PRTDIR) || mkdir $(PRTDIR)
test -d $(BINDIR) || mkdir $(BINDIR)
-for f in $(PROGS) ; do \cp -f $$f $(BINDIR) ; done
test::
clean::
-\rm -f *.o cvstatic* *% *.bak so_loc*
-\rm -f $(PROGS)
portclean:: clean
-(! test -d $(BINDIR)) || (cd $(BINDIR) && \rm -f $(PROGS))
@@ -0,0 +1,43 @@
#
# $Id: $
#
# lxlib.targ
#
# default make targets for standard lx library
#
# you should define the 'LOCLIB' and 'OSRC' variables
#
# 'auto.conf' should have been included
#
OBJ = $(OSRC:.c=.o)
INCDIR = ../include
#
# Rules
#
.PHONY: all lib install test clean portclean
all:: lib install
@echo "+++++++++++ library $(LOCLIB) done"
lib:: $(OBJ)
$(AR) $(ARFLAGS) $(LOCLIB) $(OBJ)
$(RANLIB) $(LOCLIB)
install::
test -d $(PRTDIR) || mkdir $(PRTDIR)
test -d $(LIBDIR) || mkdir $(LIBDIR)
\cp -f $(LOCLIB) $(LIBDIR)
$(RANLIB) $(LIBDIR)/$(LOCLIB)
test::
clean::
-\rm -f *.o cvstatic* *% *.bak so_loc*
-\rm -f $(LOCLIB)
portclean:: clean
-(! test -d $(LIBDIR)) || (cd $(LIBDIR) && \rm -f $(LOCLIB))
@@ -0,0 +1,48 @@
#
# $Id: package.targ 1825 2013-02-26 09:39:47Z viari $
#
# package.targ
#
# default make targets for standard package with configure
#
# you should define the 'PKG' variable
# (and optionaly 'PKGTAR', 'PKGDIR')
#
PKGTAR ?= $(PKG).tgz
PKGDIR ?= build.$(PORTNAME)
PRTPATH = $(abspath $(PRTDIR))
#
# Rules
#
.PHONY: all clean test portclean pkg pkg.expand pkg.make pkg.install
all:: pkg
pkg.expand::
test -d $(PKGDIR) || mkdir $(PKGDIR)
test -f $(PKGDIR)/configure || $(TAR) zxf $(PKGTAR) -C $(PKGDIR) --strip-components 1
pkg.make:: pkg.expand
test -f $(PKGDIR)/Makefile || (cd $(PKGDIR) && ./configure --prefix=$(PRTPATH))
$(MAKE) -C $(PKGDIR)
pkg.install:: pkg.make
$(MAKE) -C $(PKGDIR) install
pkg:: pkg.install
@echo "+++++++++++ package $(PKG) done"
test::
(! test -d $(PKGDIR)) || $(MAKE) -C $(PKGDIR) test
clean::
(! test -d $(PKGDIR)) || $(MAKE) -C $(PKGDIR) clean
portclean::
(! test -d $(PKGDIR)) || $(MAKE) -C $(PKGDIR) distclean
(! test -d $(PKGDIR)) || \rm -r $(PKGDIR)
@@ -0,0 +1,30 @@
#
# $Id: propagate.targ 1825 2013-02-26 09:39:47Z viari $
#
# propagate.targ
#
# default make targets for library containers
#
# you should define the 'DIRS' variable
#
# It will propagate 'MAKE <target>' to all
# directories listed in DIRS
#
#
# Rules
#
.PHONY: all _action $(DIRS)
.DEFAULT:
$(MAKE) ACTION=$@ _action
all::
$(MAKE) ACTION=all _action
_action: $(DIRS)
@echo "$(ACTION) done"
$(DIRS):
$(MAKE) -C $@ $(ACTION)
+187
View File
@@ -0,0 +1,187 @@
/* ---------------------------------------------------------------- */
/* Copyright (c) Atelier de BioInformatique */
/* @file: Genetic.h */
/* @desc: Genetic codes / include file */
/* */
/* @history: */
/* @+ <Gloup> : Jan 96 : first draft for PWG from acnuc */
/* ---------------------------------------------------------------- */
#ifndef _H_Genetic
#define _H_Genetic
/* ==================================================== */
/* Constants */
/* ==================================================== */
#define DNA_ALPHA "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz"
#define C_DNA_ALPHA "TVGHEFCDIJMLKNOPQYSAABWXRZtvghefcdijmlknopqysaabwxrz"
#define GEN_NUC_ALPHA "AaCcGgTtUu"
#define GEN_PRO_ALPHA "RLSTPAGVKNQHEDYCFIMW*X"
#define GEN_MAX_CODES 9
#define GEN_CODE_UNIVL 0 /* Universal */
#define GEN_CODE_MYEAS 1 /* mito yeast */
#define GEN_CODE_MVERT 2 /* mito vertebrate */
#define GEN_CODE_FUNGI 3 /* filamentous fungi */
#define GEN_CODE_MINSE 4 /* mito insects & platyhelminthes */
#define GEN_CODE_CANDI 5 /* Candida cylindracea */
#define GEN_CODE_CILIA 6 /* Ciliata */
#define GEN_CODE_EUPLO 7 /* Euplotes */
#define GEN_CODE_MECHI 8 /* mito echinoderms */
/* ==================================================== */
/* Data Structures */
/* ==================================================== */
typedef struct GeneticCode {
char title[256]; /* nom du code */
char info[256]; /* informations */
int code[65]; /* 64 codons + Error */
} GeneticCode;
/* ==================================================== */
/* Data Instanciation */
/* ==================================================== */
#ifdef GENETIC_CODE_INSTANCE
GeneticCode theGeneticCode[GEN_MAX_CODES] = { /* Begin of codes */
{ /* 0: UNIVERSAL */
{"Universal"},
{""},
{ 8, 9, 8, 9, 3, 3, 3, 3,
0, 2, 0, 2, 17, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 1, 1, 1, 1,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
20, 14, 20, 14, 2, 2, 2, 2,
20, 15, 19, 15, 1, 16, 1, 16,
21}
},
{ /* 1: MITOCHONDRIAL YEAST */
{"Mitochondrial Yeast"},
{"CUN=T AUA=M UGA=W"},
{ 8, 9, 8, 9, 3, 3, 3, 3,
0, 2, 0, 2, 18, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 3, 3, 3, 3,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
20, 14, 20, 14, 2, 2, 2, 2,
19, 15, 19, 15, 1, 16, 1, 16,
21}
},
{ /* 2: MITOCHONDRIAL VERTEBRATES */
{"Mitochondrial Vertebrates"},
{"AGR=* AUA=M UGA=W"},
{ 8, 9, 8, 9, 3, 3, 3, 3,
20, 2, 20, 2, 18, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 1, 1, 1, 1,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
20, 14, 20, 14, 2, 2, 2, 2,
19, 15, 19, 15, 1, 16, 1, 16,
21}
},
{ /* 3: MITOCHONDRIAL FILAMENTOUS FUNGI */
{"Mitochondrial Filamentous Fungi"},
{"UGA=W"},
{ 8, 9, 8, 9, 3, 3, 3, 3,
0, 2, 0, 2, 17, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 1, 1, 1, 1,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
20, 14, 20, 14, 2, 2, 2, 2,
19, 15, 19, 15, 1, 16, 1, 16,
21}
},
{ /* 4: MITOCHONDRIAL CODE OF INSECT AND PLATYHELMINTHES */
{"Mitochondrial Insects and Platyhelminthes"},
{"AUA=M UGA=W AGR=S"},
{ 8, 9, 8, 9, 3, 3, 3, 3,
2, 2, 2, 2, 18, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 1, 1, 1, 1,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
20, 14, 20, 14, 2, 2, 2, 2,
19, 15, 19, 15, 1, 16, 1, 16,
21}
},
{ /* 5: CANDIDA CYLINDRACEA (see nature 341:164) */
{"Candida cylindracea"},
{"CUG=S CUA=?"},
{ 8, 9, 8, 9, 3, 3, 3, 3,
0, 2, 0, 2, 17, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 21, 1, 2, 1,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
20, 14, 20, 14, 2, 2, 2, 2,
20, 15, 19, 15, 1, 16, 1, 16,
21}
},
{ /* 6: CILIATA */
{"Ciliata"},
{"UAR=Q"},
{ 8, 9, 8, 9, 3, 3, 3, 3,
0, 2, 0, 2, 17, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 1, 1, 1, 1,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
10, 14, 10, 14, 2, 2, 2, 2,
20, 15, 19, 15, 1, 16, 1, 16,
21}
},
{ /* 7: EUPLOTES */
{"Euplotes"},
{"UGA=C"},
{ 8, 9, 8, 9, 3, 3, 3, 3,
0, 2, 0, 2, 17, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 1, 1, 1, 1,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
20, 14, 20, 14, 2, 2, 2, 2,
15, 15, 19, 15, 1, 16, 1, 16,
21}
},
{ /* 8: MITOCHONDRIAL ECHINODERMS */
{"Mitochondrial Echinoderms"},
{"UGA=W AGR=S AAA=N"},
{ 9, 9, 8, 9, 3, 3, 3, 3,
2, 2, 2, 2, 17, 17, 18, 17,
10, 11, 10, 11, 4, 4, 4, 4,
0, 0, 0, 0, 1, 1, 1, 1,
12, 13, 12, 13, 5, 5, 5, 5,
6, 6, 6, 6, 7, 7, 7, 7,
20, 14, 20, 14, 2, 2, 2, 2,
19, 15, 19, 15, 1, 16, 1, 16,
21}
}
/* end of codes */ };
#else
extern GeneticCode theGeneticCode[GEN_MAX_CODES];
#endif
#endif
+64
View File
@@ -0,0 +1,64 @@
/* ---------------------------------------------------------------- */
/* Copyright (c) Atelier de BioInformatique */
/* @file: fasta_io.h */
/* @desc: sequence IO in fasta format / include file */
/* */
/* @history: */
/* @+ <Gloup> : Aug 92 : first version */
/* @+ <Gloup> : Nov 95 : last revised version */
/* ---------------------------------------------------------------- */
#ifndef _H_fasta_io
#define _H_fasta_io
/* ==================================================== */
/* Constantes */
/* ==================================================== */
#define FASTA_NAMLEN 64 /* max length of seq. name */
#define FASTA_COMLEN 512 /* max length of seq. comment */
#define FASTA_CHAR_PER_LINE 50 /* # of chars per line in output */
/* ==================================================== */
/* Macros standards */
/* ==================================================== */
#ifndef NEW
#define NEW(typ) (typ*)malloc(sizeof(typ))
#define NEWN(typ, dim) (typ*)malloc((unsigned)(dim) * sizeof(typ))
#define REALLOC(typ, ptr, dim) (typ*)realloc((void *) (ptr), (unsigned long)(dim) * sizeof(typ))
#define FREE(ptr) free(ptr)
#endif
/* ==================================================== */
/* Structures de donnees */
/* ==================================================== */
typedef struct { /* -- Sequence ---------------- */
int ok; /* error flag */
long length, /* longueur */
offset, /* current offset */
bufsize; /* size of current seq buffer */
char name[FASTA_NAMLEN+2], /* nom */
comment[FASTA_COMLEN+2], /* commentaire */
*seq; /* sequence */
} FastaSequence, *FastaSequencePtr;
/* ==================================================== */
/* Prototypes (generated by mkproto) */
/* ==================================================== */
/* libfasta.c */
FastaSequencePtr NewFastaSequence ( void );
FastaSequencePtr FreeFastaSequence ( FastaSequencePtr seq );
int ReadFastaSequence ( FILE *streamin, FastaSequencePtr seq );
int GetFastaSequence ( FILE *streamin, FastaSequencePtr seq );
void WriteFastaSequence ( FILE *streamou, FastaSequencePtr seq , int char_per_line );
void RewindFastaDB ( FILE *streamin );
#endif
+169
View File
@@ -0,0 +1,169 @@
/* ==================================================== */
/* @File kimono.h */
/* @history: */
/* @+ Nov. 03 <Gloup> first draft */
/* ==================================================== */
#define _H_kimono
#ifndef _H_fasta_io
#include "fasta_io.h"
#endif
/* -------------------------------------------- */
/* constantes */
/* -------------------------------------------- */
#define NB_NUC 4
#define NB_AA 21
#define NB_CODONS 64
#define SHIFT_NUC 2 /* # bits for NB_NUC */
#define KIM_DNA "ACGT"
#define KIM_AA "ACDEFGHIKLMNPQRSTVWY*"
#define MASKED_SYMBOL 'X'
/* -------------------------------------------- */
/* struct de donnees */
/* -------------------------------------------- */
typedef struct {
int from, to, strand;
} Interval;
typedef struct {
int size, capacity;
Interval *interval;
} SetOfIntervals;
typedef struct {
char index;
char mask;
} SeqCell;
typedef struct {
int length;
char symbol[128];
} Alphabet;
typedef struct {
Alphabet *alphabet;
FastaSequence *fasta;
SeqCell *cell;
} Sequence;
/* -------------------------------------------- */
/* counting, indexing and distance functions */
/* -------------------------------------------- */
typedef void (*IndexFunction) (Sequence *seq, SetOfIntervals *zones, int phase);
typedef void (*CountFunction) (Sequence *seq, int from, int to, int count[][2], int nbins, int increment);
typedef void (*MixFunction) (int left[][2], int right[][2], int countLeft[], int countRight[], int nbins);
typedef float (*DistFunction) (int bins1[], int bins2[], int nbins, int ibin);
/* -------------------------------------------- */
/* masks for sequence */
/* -------------------------------------------- */
#define EXCLUDE_MASK 0x01 /* 00000001 */
#define INCLUDE_MASK 0x7e /* 01111110 */
#define DIRECT_MASK 0x02 /* 00000010 */
#define REVERSE_MASK 0x04 /* 00000100 */
/* -------------------------------------------- */
/* macros */
/* -------------------------------------------- */
#define IS_UPPER(c) (((c) >= 'A') && ((c) <= 'Z'))
#define IS_LOWER(c) (((c) >= 'a') && ((c) <= 'z'))
#define IS_ALPHA(c) (IS_UPPER(c) || IS_LOWER(c))
#define TO_UPPER(c) ((c) - 'a' + 'A')
#define TO_LOWER(c) ((c) - 'A' + 'a')
#define UPPER(x) (IS_LOWER(x) ? TO_UPPER(x) : (x))
#define LOWER(x) (IS_UPPER(x) ? TO_LOWER(x) : (x))
#define MIN2(a, b) ((a) < (b) ? (a) : (b))
#define MAX2(a, b) ((a) > (b) ? (a) : (b))
#ifndef NEW
#define NEW(type) (type *) malloc(sizeof(type))
#define NEWN(type, n) (type *) malloc((n) * sizeof(type))
#define REALLOC(type, ptr, n) (type *) realloc(ptr, (n) * sizeof(type))
#define FREE(ptr) free(ptr)
#endif
/* -------------------------------------------- */
/* Prototypes */
/* -------------------------------------------- */
/* kim_util.c */
int Erreur (char *msg , int stat);
int MemoryErreur (char *where, int stat);
int AssignToStdin (char *filename);
/* kim_alphabet.c */
Alphabet *FreeAlphabet (Alphabet *alpha);
Alphabet *NewAlphabet (char *symbols);
Alphabet *CopyAlphabet (Alphabet *alpha);
Alphabet *NucleicAlphabet ();
Alphabet *AminoAlphabet ();
/* kim_sequence.c */
Sequence *FreeSequence (Sequence *seq);
Sequence *NewSequence (Alphabet *alpha);
int ReadSequence (FILE *streamin, Sequence *seq);
/* kim_genetic.c */
int BaseComplement (int ch);
char *SeqComplement (char *str);
int CodonTranslate (char *codon, int codid);
/* kim_zone.c */
SetOfIntervals *FreeZones (SetOfIntervals *set);
SetOfIntervals *ReadZones (int seqlength);
/* kim_indexer.c */
void NoZoneIndexer (Sequence *seq, SetOfIntervals *zones, int phase);
void ExcludeIndexer (Sequence *seq, SetOfIntervals *zones, int phase);
void GeneIndexer (Sequence *seq, SetOfIntervals *zones, int phase);
void PhaseIndexer (Sequence *seq, SetOfIntervals *zones, int phase);
void CodonIndexer (Sequence *seq, SetOfIntervals *zones, int phase);
/* kim_counter.c */
void BasicCounter (Sequence *seq, int from, int to,
int count[][2], int nbins, int increment);
void CodonSkewCounter (Sequence *seq, int from, int to,
int count[][2], int nbins, int increment);
/* kim_mixer.c */
void BasicMixer (int left[][2], int right[][2],
int *countLeft, int *countRight, int nbins);
void CrossMixer (int left[][2], int right[][2],
int *countLeft, int *countRight, int nbins);
/* kim_distance.c */
float ChisTwo(int bins1[], int bins2[], int nbins, int ibin);
float Euclid(int bins1[], int bins2[], int nbins, int ibin);
float HellTwo(int bins1[], int bins2[], int nbins, int ibin);
int SignTwoBins(int bins1[], int bins2[]);
/* kim_codonskew.c */
void CodonSkew (int code, float score[NB_NUC][NB_CODONS]);
/* kim*_help.c */
void PrintHelp (void);
int ExitUsage (int stat);
+43
View File
@@ -0,0 +1,43 @@
# ---------------------------------------------------------------
# $Id: $
#
# @file: Makefile
# @desc: makefile for kimono/src
#
# @history:
#
# @note: should be processed with gnu compatible make
# @note: helixware_compatible
#
# @end:
# ---------------------------------------------------------------
#
include ../config/auto.conf
PROGS = kimono kimfit
OSRC = fasta_io.c \
kim_util.c \
kim_alphabet.c \
kim_sequence.c \
kim_zone.c \
kim_indexer.c \
kim_counter.c \
kim_mixer.c \
kim_distance.c \
kim_genetic.c \
kim_codonskew.c
include ../config/targets/lxbin.targ
include ../config/targets/help.targ
#
# file dependencies
#
kimono: $(OBJ) kimono_main.c kimono_help.c
$(CC) $(CFLAGS) -o $@ $^ $(LDFLAGS) $(LDLIBS)
kimfit: $(OBJ) kimfit_main.c
$(CC) $(CFLAGS) -o $@ $^ $(LDFLAGS) $(LDLIBS)
+6
View File
@@ -0,0 +1,6 @@
- dist PHI2
- inversion strand -
+388
View File
@@ -0,0 +1,388 @@
/* ---------------------------------------------------------------- */
/* Copyright (c) Atelier de BioInformatique */
/* @file: fasta_io.c */
/* @desc: sequence IO in fasta format */
/* */
/* @history: */
/* @+ <Gloup> : Aug 92 : first version */
/* @+ <Gloup> : Nov 95 : last revised version */
/* ---------------------------------------------------------------- */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "fasta_io.h"
#define SECURE 1 /* 1 : secure copy ; 0 : quickest copy */
#define READ_NEXT 0 /* force to read next io buffer line */
#define PUSH_BACK 1 /* force to push back io buffer line */
#define SERIAL 1 /* serial reading */
#define INDEXED 0 /* indexed reading */
#ifdef MAC_OS_C
#define LINE_FEED '\r'
#else
#define LINE_FEED '\n'
#endif
static int sRetained = 0; /* 1 : reuse last buffer line */
/* -------------------------------------------- */
/* @static: lecture bufferisee */
/* this is the main IO function */
/* -------------------------------------------- */
static char * sNextIOBuffer(FILE *streamin, int retain, int serial)
{
char *buf, *end;
int reused;
static char sBuffer[BUFSIZ]; /* BUFSIZ in <stdio.h> */
reused = (retain || sRetained) && serial;
sRetained = retain;
buf = ( reused
? sBuffer
: fgets(sBuffer, sizeof(sBuffer), streamin));
if (! buf) /* end of file */
return NULL;
end = buf + strlen(buf) - 1;
if (*end == LINE_FEED) /* remove trailing \n */
*end = '\000';
return ( *buf || reused
? buf
: sNextIOBuffer(streamin, retain, serial));
}
#if SECURE
/* -------------------------------------------- */
/* compte le nombre de caracteres alpha dans */
/* un buffer */
/* -------------------------------------------- */
static long sCountAlpha(char *buf)
{
long count;
for (count = 0 ; *buf ; buf++)
if (isalpha(*buf))
count++;
return count;
}
/* -------------------------------------------- */
/* copy only alpha chars from s2 to s1 */
/* -------------------------------------------- */
static char *sStrcpyAlpha(char *s1, char *s2)
{
for( ; *s2 ; s2++)
if (isalpha(*s2))
*s1++ = *s2;
*s1 = '\000';
return s1;
}
#endif
/* -------------------------------------------- */
/* skip to next space in buffer */
/* -------------------------------------------- */
static char *sNextSpace(char *buffer)
{
for (; *buffer ; buffer++)
if (isspace(*buffer))
return buffer;
return NULL;
}
/* -------------------------------------------- */
/* returns sequence name (FASTA) */
/* -------------------------------------------- */
static char *sGetFastaName(char *buffer)
{
char c[2];
static char sName[FASTA_NAMLEN+2];
*c = buffer[FASTA_NAMLEN];
buffer[FASTA_NAMLEN] = '\000';
if (sscanf(buffer + 1, "%s", sName) != 1)
(void) strcpy(sName, "<no Name>");
buffer[FASTA_NAMLEN] = *c;
return sName;
}
/* -------------------------------------------- */
/* returns sequence comment (FASTA) */
/* -------------------------------------------- */
static char *sGetFastaComment(char *buffer)
{
char c[2], *space;
static char sComment[FASTA_COMLEN+2];
*c = buffer[FASTA_COMLEN];
buffer[FASTA_COMLEN] = '\000';
space = sNextSpace(buffer);
(void) strcpy(sComment, (space ? space + 1 : "<no comment>"));
buffer[FASTA_COMLEN] = *c;
return sComment;
}
/* -------------------------------------------- */
/* API */
/* -------------------------------------------- */
/* -------------------------------------------- */
/* liberation d'une sequence */
/* -------------------------------------------- */
FastaSequencePtr FreeFastaSequence(FastaSequencePtr seq)
{
if (seq) {
if (seq->seq)
FREE(seq->seq);
FREE(seq);
}
return NULL;
}
/* -------------------------------------------- */
/* allocation d'une sequence */
/* -------------------------------------------- */
FastaSequencePtr NewFastaSequence()
{
FastaSequencePtr seq;
if (! (seq = NEW(FastaSequence)))
return NULL;
seq->length = 0;
seq->offset = -1;
if (! (seq->seq = NEWN(char, BUFSIZ)))
return FreeFastaSequence(seq);
seq->bufsize = BUFSIZ;
*(seq->name) = '\000';
*(seq->comment) = '\000';
seq->ok = 1;
return seq;
}
/* ----------------------------------------------- */
/* lecture <Serie> d'une sequence au format Fasta */
/* returns : 0 -> last sequence */
/* 1 -> more to read */
/* <but> you must check seq->ok */
/* that may be 0 (memory error) */
/* ----------------------------------------------- */
int ReadFastaSequence(FILE *streamin, FastaSequencePtr seq)
{
long readlen, buflen;
char *buffer, *tbuf;
seq->ok = 0; /* assume error */
buflen = seq->length = 0;
seq->offset = ftell(streamin);
buffer = sNextIOBuffer(streamin, READ_NEXT, SERIAL);
if (! (buffer && (*buffer == '>'))) /* sync error */
return 0; /* last sequence */
if (seq->offset)
seq->offset -= (strlen(buffer) + 1);
(void) strcpy(seq->name, sGetFastaName(buffer));
(void) strcpy(seq->comment, sGetFastaComment(buffer));
while (buffer = sNextIOBuffer(streamin, READ_NEXT, SERIAL)) {
if (*buffer == '>') {
(void) sNextIOBuffer(streamin, PUSH_BACK, SERIAL); /* push it back */
break;
}
#if SECURE
readlen = sCountAlpha(buffer);
#else
readlen = strlen(buffer);
#endif
buflen += readlen;
if (buflen >= seq->bufsize) {
if (! (tbuf = REALLOC(char, seq->seq, 2 * buflen + 1)))
return 1; /* but seq->ok is 0 */
seq->seq = tbuf;
seq->bufsize = 2 * buflen + 1;
}
#if SECURE
sStrcpyAlpha(seq->seq + seq->length, buffer);
#else
(void) memcpy(seq->seq + seq->length, buffer, readlen);
#endif
seq->length = buflen;
}
seq->seq[seq->length] = '\000';
return (seq->ok = 1);
}
/* ------------------------------------------------- */
/* lecture <Indexee> d'une sequence au format Fasta */
/* use the internal seq->offset variable to position */
/* on the correct sequence. */
/* returns : 0 -> sync or memory error */
/* 1 -> read ok */
/* ------------------------------------------------- */
int GetFastaSequence(FILE *streamin, FastaSequencePtr seq)
{
long readlen, buflen;
char *buffer, *tbuf;
seq->ok = 0; /* assume error */
if (seq->offset < 0)
return 0; /* bad offset */
buflen = seq->length = 0;
(void) fseek(streamin, seq->offset, SEEK_SET);
buffer = sNextIOBuffer(streamin, READ_NEXT, INDEXED);
if (! (buffer && (*buffer == '>'))) /* sync error */
return 0; /* last sequence */
(void) strcpy(seq->name, sGetFastaName(buffer));
(void) strcpy(seq->comment, sGetFastaComment(buffer));
while (buffer = sNextIOBuffer(streamin, READ_NEXT, INDEXED)) {
if (*buffer == '>')
break;
#if SECURE
readlen = sCountAlpha(buffer);
#else
readlen = strlen(buffer);
#endif
buflen += readlen;
if (buflen >= seq->bufsize) {
if (! (tbuf = REALLOC(char, seq->seq, 2 * buflen + 1)))
return 0;
seq->seq = tbuf;
seq->bufsize = 2 * buflen + 1;
}
#if SECURE
sStrcpyAlpha(seq->seq + seq->length, buffer);
#else
(void) memcpy(seq->seq + seq->length, buffer, readlen);
#endif
seq->length = buflen;
}
seq->seq[seq->length] = '\000';
return (seq->ok = 1);
}
/* -------------------------------------------- */
/* ecriture d'une sequence au format Fasta */
/* -------------------------------------------- */
void WriteFastaSequence(FILE *streamou, FastaSequencePtr seq,
int char_per_line)
{
long i, nlines, nrest, nchar;
char *buf, *end, tempo;
(void) fputc('>', streamou);
(void) fputs((*(seq->name) ? seq->name : "<no name>"), streamou);
(void) fputc(' ', streamou);
(void) fputs((*(seq->comment) ? seq->comment : "<no comment>"), streamou);
(void) fputc(LINE_FEED, streamou);
nlines = seq->length / char_per_line;
nrest = seq->length % char_per_line;
if (nrest)
nlines++;
buf = seq->seq;
for (i = 1 ; i <= nlines ; i++) {
nchar = ((nrest && (i == nlines)) ? nrest : char_per_line);
end = buf + nchar;
tempo = *end;
*end = '\000';
(void) fputs(buf, streamou);
(void) fputc(LINE_FEED , streamou);
*end = tempo;
buf += nchar;
}
}
/* -------------------------------------------- */
/* rewind db file */
/* -------------------------------------------- */
void RewindFastaDB(FILE *streamin)
{
sRetained = 0; /* forget previous buffer */
if (streamin)
rewind(streamin);
}
+83
View File
@@ -0,0 +1,83 @@
/* ==================================================== */
/* @file: kim_alphabet.c */
/* alphabet handling */
/* @history: */
/* @+ Apr. 97 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "kimono.h"
/* some static alphabets */
static char sDNA[] = KIM_DNA;
static char sAA[] = KIM_AA;
/* -------------------------------------------- */
/* API */
/* -------------------------------------------- */
/* -------------------------------------------- */
/* free alphabet */
/* -------------------------------------------- */
Alphabet * FreeAlphabet(Alphabet *alpha) {
if (alpha) FREE(alpha);
return NULL;
}
/* -------------------------------------------- */
/* new alphabet */
/* -------------------------------------------- */
Alphabet *NewAlphabet(char *symbols) {
Alphabet *alpha;
if (alpha = NEW(Alphabet)) {
(void) strcpy(alpha->symbol, symbols);
alpha->length = strlen(alpha->symbol);
}
return alpha;
}
/* -------------------------------------------- */
/* copy alphabet */
/* -------------------------------------------- */
Alphabet *CopyAlphabet(Alphabet *alpha) {
return NewAlphabet(alpha->symbol);
}
/* -------------------------------------------- */
/* standard alphabets */
/* -------------------------------------------- */
/* DNA */
Alphabet *NucleicAlphabet() {
return NewAlphabet(sDNA);
}
/* AA */
Alphabet *AminoAlphabet() {
return NewAlphabet(sAA);
}
/* ----------------------------------------------- */
/* index of symbol in alphabet */
/* return : index of symbol in alphabet */
/* -1 if not found */
/* ----------------------------------------------- */
int AlphaIndex(Alphabet *alpha, char symbol) {
char *pos = strchr(alpha->symbol, UPPER(symbol));
return (pos ? (int) (pos - alpha->symbol) : -1);
}
+142
View File
@@ -0,0 +1,142 @@
/* ==================================================== */
/* @file: kim_codonskew.c */
/* general utilities functions */
/* @history: */
/* @+ Apr. 97 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "kimono.h"
/* ----------------------------------------------- */
/* make string buffer of all codons : */
/* "AAA/AAC/AAT/AAG/ACA/....../GGG/" */
/* ----------------------------------------------- */
static void sMakeStdCodons(char *buffer, char *alphaN)
{
int i, j, k, n;
n = strlen(alphaN);
for (i = 0 ; i < n ; i++)
for (j = 0 ; j < n ; j++)
for (k = 0 ; k < n ; k++) {
*buffer++ = alphaN[i];
*buffer++ = alphaN[j];
*buffer++ = alphaN[k];
*buffer++ = '/';
}
*buffer = '\000';
}
/* ----------------------------------------------- */
/* make string buffer of synonymous codons coding */
/* for aa */
/* ----------------------------------------------- */
static void sMakeAaCodons(char *buffer, char *alphaN, int aa, int code)
{
int aai;
char *c, codons[4*NB_CODONS+1];
sMakeStdCodons(codons, alphaN);
for (c = codons ; *c ; c += 4) {
aai = CodonTranslate(c, code);
if (aai == aa) {
strncpy(buffer, c, 3);
buffer[3] = '/';
buffer += 4;
}
}
*buffer = '\000';
}
/* ----------------------------------------------- */
/* return index of aa encoded by codon */
/* or -1 if not found */
/* ----------------------------------------------- */
static int sAaIndex(char *codon, char *alphaA, int code)
{
int aa;
char *paa;
aa = CodonTranslate(codon, code);
if ((paa = strchr(alphaA, aa)) != 0)
return (int) (paa - alphaA);
return -1;
}
/* ----------------------------------------------- */
/* count # occurences of char mark in buffer */
/* ----------------------------------------------- */
static int sCount(char *buffer, int mark)
{
int count;
for (count = 0 ; *buffer ; buffer++) {
if (*buffer == mark)
count++;
}
return count;
}
/* ----------------------------------------------- */
/* skew score of one codon */
/* ----------------------------------------------- */
static float sCodonSkew(char *codon, char *alphaN, char *alphaA, int symb, int code) {
int iaa, nsyn, n0, nM;
char synon[4*NB_CODONS+1], buf[4];
strncpy(buf, codon, 3);
buf[3] = '\000';
iaa = sAaIndex(buf, alphaA, code);
sMakeAaCodons(synon, alphaN, alphaA[iaa], code);
n0 = sCount(buf, symb);
nsyn = strlen(synon) / 4;
nM = sCount(synon, symb);
return ((float) (n0) - ((float) (nM) / (float) nsyn));
}
/* ----------------------------------------------- */
/* API */
/* ----------------------------------------------- */
/* ----------------------------------------------- */
/* skew scores of all codons */
/* ----------------------------------------------- */
void CodonSkew(int code, float score[NB_NUC][NB_CODONS]) {
int i, j;
char *trip;
char alpha[NB_NUC+1], codons[4*NB_CODONS+1];
(void) strcpy(alpha, KIM_DNA);
sMakeStdCodons(codons, alpha);
for (i = 0 ; i < NB_NUC ; i++) {
for (j = 0, trip = codons ; j < NB_CODONS ; j++, trip += 4) {
score[i][j] = sCodonSkew(trip, alpha, KIM_AA, alpha[i], code);
}
}
}
+140
View File
@@ -0,0 +1,140 @@
/* ==================================================== */
/* @file: kim_counter.c */
/* counting functions */
/* @history: */
/* @+ Jul. 06 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "Genetic.h"
#include "kimono.h"
/* holds nucleotide enrichment for each codon */
static float sCodonScore[NB_NUC][NB_CODONS];
static int sScoreInited = 0;
/* hold DNA amhabet
static char sDNA[] = KIM_DNA;
/* -------------------------------------------- */
/* API */
/* -------------------------------------------- */
/* ----------------------------------------------- */
/* basic nucleotide counting */
/* */
/* count : second dimension is for strand */
/* increment : 1, -1 or 0 (0 means reset then 1) */
/* ----------------------------------------------- */
void BasicCounter(Sequence *seq, int from, int to,
int count[][2], int nbins, int increment) {
int i, len;
if (increment == 0) { /* this is a reset */
for (i = 0 ; i <= nbins ; i++)
count[i][0] = count[i][1] = 0;
increment = 1;
}
len = seq->fasta->length;
for (i = from ; i < to ; i++) {
int mask = seq->cell[i % len].mask;
if (mask & EXCLUDE_MASK)
continue;
int index = seq->cell[i % len].index;
if ((index < 0) || (index > nbins)) /* other symbol */
index = nbins;
if (mask & DIRECT_MASK)
count[index][0] += increment;
if (mask & REVERSE_MASK)
count[index][1] += increment;
}
}
/* ----------------------------------------------- */
/* counting skewed codon */
/* note: don't forget to init counter before */
/* InitCodonSkewCounter(code) */
/* ----------------------------------------------- */
void InitCodonSkewCounter(int code) {
CodonSkew(code, sCodonScore);
sScoreInited = 1;
}
void CodonSkewCounter(Sequence *seq, int from, int to,
int count[][2], int nbins, int increment) {
int i, len;
if (! sScoreInited) {
Erreur("CodonSkewCounter: initialized with default genetic code", 0);
InitCodonSkewCounter(GEN_CODE_UNIVL);
}
if (increment == 0) { /* this is a reset */
for (i = 0 ; i <= nbins ; i++)
count[i][0] = count[i][1] = 0;
increment = 1;
}
len = seq->fasta->length;
for (i = from ; i < to ; i++) {
int mask = seq->cell[i % len].mask;
if (mask & EXCLUDE_MASK)
continue;
int index = seq->cell[i % len].index; /* codon index */
if ((index < 0) || (index > NB_CODONS)) /* invalid codon */
continue;
int strand = ((mask & DIRECT_MASK) ? 0 : 1);
int nuc;
for (nuc = 0 ; nuc < NB_NUC ; nuc++) {
float score = sCodonScore[nuc][index]; /* enrichment for symbol nuc */
/* ---------------------------------------------------------------- */
/* important property : */
/* if codon causes enrichment/depletion in X and if the gene is */
/* located on the reverse strand then choice of this codon causes */
/* enrichment/depletion in ~X on the direct strand. */
/* Therefore for reverse strand codons we should increment the bin */
/* associated to ~X */
/* */
int bin = nuc;
if (mask & REVERSE_MASK) {
char compl = BaseComplement(seq->alphabet->symbol[nuc]);
bin = AlphaIndex(seq->alphabet, compl);
}
/* ---------------------------------------------------------------- */
/* increment bin associated to null, enrichment, depletion */
bin = 3 * bin + ((score == 0.) ? 0 : ((score > 0) ? 1 : 2));
count[bin][strand] += increment;
}
count[3 * NB_NUC][strand] += increment; /* total # codons */
}
}
+142
View File
@@ -0,0 +1,142 @@
/* ==================================================== */
/* @file: kim_distance.c */
/* general utilities functions */
/* @history: */
/* @+ Apr. 97 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <math.h>
#include "kimono.h"
#define SQRTF(x) (float) sqrt((float) x)
#define FABSF(x) (float) fabs((float) x)
/* ---------------------- */
/* API */
/* ---------------------- */
/*
* for all distance functions :
* int bins1[], int bins2[] : count distributions
* int nbins : total number of bins
* int ibin : if < 0 : compute distance using all bins
* : if >= 0 : compute distance only for ibin (partial distance)
*/
/* ---------------------- */
/* chisquare distance */
float ChisTwo(int bins1[], int bins2[], int nbins, int ibin)
{
int j, jmin, jmax;
float num, s1, s2, c1, c2, sj, dist;
s1 = s2 = 0.;
for (j = 0 ; j < nbins ; j++) {
s1 += bins1[j];
s2 += bins2[j];
}
if (s1 == 0.) s1 = 1.0;
if (s2 == 0.) s2 = 1.0;
c1 = SQRTF(s2/s1);
c2 = SQRTF(s1/s2);
jmin = (ibin < 0 ? 0 : ibin);
jmax = (ibin < 0 ? nbins : ibin + 1);
dist = 0.0;
for (j = jmin ; j < jmax ; j++) {
sj = bins1[j] + bins2[j];
if (sj == 0.) sj = 1.;
num = (c1 * (float) bins1[j]) - (c2 * (float) bins2[j]);
dist += (num * num) / sj;
}
return SQRTF(dist);
}
/* ---------------------- */
/* euclidian distance */
float Euclid(int bins1[], int bins2[], int nbins, int ibin)
{
int j, jmin, jmax;
float num, s1, s2, dist;
s1 = s2 = 0.;
for (j = 0 ; j < nbins ; j++) {
s1 += bins1[j];
s2 += bins2[j];
}
if (s1 == 0.) s1 = 1.0;
if (s2 == 0.) s2 = 1.0;
jmin = (ibin < 0 ? 0 : ibin);
jmax = (ibin < 0 ? nbins : ibin + 1);
dist = 0.0;
for (j = jmin ; j < jmax ; j++) {
num = ((float) bins1[j]/s1) - ((float) bins2[j]/s2);
dist += num*num;
}
return SQRTF(dist);
}
/* ---------------------- */
/* hellinger distance */
float HellTwo(int bins1[], int bins2[], int nbins, int ibin)
{
int j, jmin, jmax;
float num, s1, s2, dist;
s1 = s2 = 0.;
for (j = 0 ; j < nbins ; j++) {
s1 += bins1[j];
s2 += bins2[j];
}
if (s1 == 0.) s1 = 1.0;
if (s2 == 0.) s2 = 1.0;
jmin = (ibin < 0 ? 0 : ibin);
jmax = (ibin < 0 ? nbins : ibin + 1);
dist = 0.0;
for (j = jmin ; j < jmax ; j++) {
num = SQRTF((float) bins1[j]/s1) - SQRTF((float) bins2[j]/s2);
dist += num*num;
}
return SQRTF(dist);
}
/* ----------------------------------------------- */
/* compute skew sign for two-binned data */
/* ----------------------------------------------- */
int SignTwoBins(int bins1[], int bins2[]) {
int s1, s2;
s1 = bins1[0] + bins1[1];
s2 = bins2[0] + bins2[1];
if (s1 == 0) s1 = 1;
if (s2 == 0) s2 = 1;
return ( (((float) bins1[0] / (float) s1) >= ((float) bins2[0] / (float) s2))
? 1 : -1);
}
+109
View File
@@ -0,0 +1,109 @@
/* ---------------------------------------------------------------- */
/* Copyright (c) Atelier de BioInformatique */
/* @file: kim_genetic.c */
/* @desc: bio. sequences utility functions */
/* */
/* @history: */
/* @+ <Gloup> : Jan 96 : quick draft */
/* ---------------------------------------------------------------- */
#include <ctype.h>
#include <stdio.h>
#include <string.h>
#include "kimono.h"
#define GENETIC_CODE_INSTANCE
#include "Genetic.h"
static char sNuc[] = DNA_ALPHA;
static char sAnuc[] = C_DNA_ALPHA;
static char sGenNuc[] = GEN_NUC_ALPHA;
static char sGenPro[] = GEN_PRO_ALPHA;
static int sNucNum[5] = {0, 1, 2, 3, 3};
/* ---------------------------------------------------- */
/* @Function : int BaseComplement */
/* Purpose : return DNA/RNA-Iupac base complement */
/* ---------------------------------------------------- */
int BaseComplement(int ch)
{
char *c;
if (c = strchr(sNuc, ch))
return sAnuc[(int) (c - sNuc)];
else
return ch;
}
/* ---------------------------------------------------- */
/* @Function : char * SeqComplement */
/* Purpose : return sequence complement */
/* ---------------------------------------------------- */
char *SeqComplement(char *str)
{
char *s;
for (s = str ; *s ; s++)
*s = BaseComplement(*s);
return str;
}
/* ---------------------------------------------------- */
/* @Static : int * sTranslateCodon */
/* Purpose : translate codon -> aa */
/* see bio_codon_translate */
/* ---------------------------------------------------- */
static int sTranslateCodon(char *codon, int *code)
{
int i, base, hash;
char *p;
for (i = hash = 0 ; i < 3 ; i++) {
if ((p = strchr(sGenNuc, *codon++)) != NULL) {
base = ((int) (p - sGenNuc)) / 2;
hash = (hash * 4) + sNucNum[base];
}
else {
hash = 64; /* bad letter in codon */
break; /* or incomplete codon */
}
}
return (int) sGenPro[code[hash]];
}
/* ---------------------------------------------------- */
/* @Function : int * CodonTranslate */
/* Purpose : return amino-acid */
/* input: codon char* 3 bases (in GEN_NUC_ALPHA) */
/* codid int (see Genetic.h) */
/* output: aa in one letter code (in GEN_PRO_ALPHA) */
/* ---------------------------------------------------- */
int CodonTranslate(char *codon, int codid)
{
return sTranslateCodon(codon, theGeneticCode[codid].code);
}
/* ---------------------------------------------------- */
/* @Function : int * SeqTranslate */
/* Purpose : translate sequence to protein */
/* ---------------------------------------------------- */
char* SeqTranslate(char *seq, int codid)
{
int *code;
char *ps, *ns;
if ((codid < 0) || (codid >= GEN_MAX_CODES))
return NULL;
code = theGeneticCode[codid].code;
for (ns = ps = seq ; ns[0] && ns[1] && ns[2] ; ns += 3)
*ps++ = sTranslateCodon(ns, code);
*ps = '\000';
return seq;
}
+309
View File
@@ -0,0 +1,309 @@
/* ==================================================== */
/* @file: kim_indexer.c */
/* indexing functions */
/* @history: */
/* @+ Jul. 06 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "kimono.h"
/* -------------------------------------------- */
/* internal functions */
/* -------------------------------------------- */
/* ----------------------------------------------- */
/* codon index */
/* codon: start of codon sequence */
/* read left to right for direct strand */
/* right to left for reverse strand */
/* ----------------------------------------------- */
static int sCodonIndex(char *codon, Alphabet *alpha, int strand)
{
int i, code;
code = 0;
for (i = 0 ; i < 3 ; i++) { /* loop on codon positions */
char symb;
if (strand > 0) {
symb = codon[i]; /* move to left */
}
else {
symb = codon[-i]; /* move to right */
symb = BaseComplement(symb); /* complement */
}
int k = AlphaIndex(alpha, symb);
if (k < 0)
return -1; /* invalid symbol */
code = (code << SHIFT_NUC) | k; /* encode codon */
}
return code;
}
/* ----------------------------------------------- */
/* basic sequence indexing */
/* ----------------------------------------------- */
static void sBasicIndexer(Sequence *seq) {
int i;
for (i = 0 ; i < seq->fasta->length ; i++) {
seq->cell[i].index = AlphaIndex(seq->alphabet, seq->fasta->seq[i]);
}
}
/* ----------------------------------------------- */
/* reset mask */
/* ----------------------------------------------- */
static void sSetMask(Sequence *seq, int mask) {
int i;
for (i = 0 ; i < seq->fasta->length ; i++) {
seq->cell[i].mask = mask;
}
}
/* ----------------------------------------------- */
/* mask masked symbol positions */
/* ----------------------------------------------- */
static void sMaskMaskedSymbol(Sequence *seq) {
int i;
for (i = 0 ; i < seq->fasta->length ; i++) {
if (seq->fasta->seq[i] == MASKED_SYMBOL)
seq->cell[i].mask |= EXCLUDE_MASK;
}
}
/* ----------------------------------------------- */
/* mask overlaps */
/* there is an overlap when a position is both on */
/* direct and reverse strand. */
/* this situation makes trouble since the index is */
/* wrong on one strand. */
/* note [AV] : overlaps on the same strand are not */
/* detected yet but this situation is */
/* not such a big trouble. */
/* ----------------------------------------------- */
static void sMaskOverlap(Sequence *seq) {
int i;
for (i = 0 ; i < seq->fasta->length ; i++) {
if (seq->cell[i].mask & (DIRECT_MASK & REVERSE_MASK))
seq->cell[i].mask |= EXCLUDE_MASK;
}
}
/* -------------------------------------------- */
/* API */
/* -------------------------------------------- */
/* ----------------------------------------------- */
/* no zone indexing */
/* (no strand, no phase) */
/* ----------------------------------------------- */
void NoZoneIndexer(Sequence *seq, SetOfIntervals *zones, int phase) {
/*ARGSUSED*/
/* ---------------------------------- */
/* assume everything is direct */
sSetMask(seq, DIRECT_MASK);
/* ---------------------------------- */
/* exclude masked symbol */
sMaskMaskedSymbol(seq);
/* ---------------------------------- */
/* just use basic indexer */
sBasicIndexer(seq);
}
/* ----------------------------------------------- */
/* zone exclusion indexing */
/* (no strand, no phase) */
/* ----------------------------------------------- */
void ExcludeIndexer(Sequence *seq, SetOfIntervals *zones, int phase) {
/*ARGSUSED*/
int i, j;
Interval inter;
/* ---------------------------------- */
/* assume everything is direct */
sSetMask(seq, DIRECT_MASK);
/* ---------------------------------- */
/* mask zone positions */
for (i = 0; i < zones->size ; i++) {
inter = zones->interval[i];
for (j = inter.from ; j <= inter.to ; j++)
seq->cell[j].mask |= EXCLUDE_MASK;
}
/* ---------------------------------- */
/* exclude masked symbol */
sMaskMaskedSymbol(seq);
/* ---------------------------------- */
/* then use basic indexer */
sBasicIndexer(seq);
}
/* ----------------------------------------------- */
/* gene indexing */
/* (strand, no phase) */
/* note: alpha is unused */
/* ----------------------------------------------- */
void GeneIndexer(Sequence *seq, SetOfIntervals *zones, int phase) {
/*ARGSUSED*/
int i;
/* ---------------------------------- */
/* first reset mask, excluding all */
sSetMask(seq, EXCLUDE_MASK);
/* ---------------------------------- */
/* then unmask start of genes */
for (i = 0; i < zones->size ; i++) {
Interval inter = zones->interval[i];
int pos = (inter.strand > 0 ? inter.from : inter.to);
int mask = (inter.strand > 0 ? DIRECT_MASK : REVERSE_MASK);
seq->cell[pos].mask = (seq->cell[pos].mask & INCLUDE_MASK) | mask;
seq->cell[pos].index = (inter.strand > 0 ? 0 : 1);
}
/* ---------------------------------- */
/* finally, exclude overlaps */
/* when two genes start at same pos */
sMaskOverlap(seq);
}
/* ----------------------------------------------- */
/* phased nucleotide indexing */
/* phase: binary mask indicating valid phases */
/* 1[01] : 1 ; 2[10] : 2 ; 4[100] : 3 */
/* or any combination eg: 3[11] : 12 */
/* 7[111] : 123 */
/* ----------------------------------------------- */
void PhaseIndexer(Sequence *seq, SetOfIntervals *zones, int phase) {
/*ARGSUSED*/
int i, j;
/* ---------------------------------- */
/* first reset mask, excluding all */
sSetMask(seq, EXCLUDE_MASK);
/* ---------------------------------- */
/* then unmask valid positions */
for (i = 0; i < zones->size ; i++) {
Interval inter = zones->interval[i];
int iphase = 0;
if (inter.strand > 0) {
for (j = inter.from ; j <= inter.to ; j++) {
if (((0x1 << iphase) & phase) != 0)
seq->cell[j].mask = (seq->cell[j].mask & INCLUDE_MASK) | DIRECT_MASK;
iphase = (iphase + 1) % 3;
}
}
else {
for (j = inter.to ; j >= inter.from ; j--) {
if (((0x1 << iphase) & phase) != 0)
seq->cell[j].mask = (seq->cell[j].mask & INCLUDE_MASK) | REVERSE_MASK;
iphase = (iphase + 1) % 3;
}
}
}
/* ---------------------------------- */
/* exclude masked symbol */
sMaskMaskedSymbol(seq);
/* ---------------------------------- */
/* exclude overlaps */
sMaskOverlap(seq);
/* ------------------------------------------ */
/* finally, use basic indexer */
sBasicIndexer(seq);
}
/* ----------------------------------------------- */
/* codon indexing */
/* ----------------------------------------------- */
void CodonIndexer(Sequence *seq, SetOfIntervals *zones, int phase) {
int i, j;
/* ---------------------------------- */
/* reset mask, excluding all */
sSetMask(seq, EXCLUDE_MASK);
/* ------------------------------------------ */
/* now unmask phase 1 and compute codon index */
for (i = 0; i < zones->size ; i++) {
Interval inter = zones->interval[i];
int iphase = 0;
if (inter.strand > 0) {
for (j = inter.from ; j <= inter.to - 2 ; j++) { // ZZ to - 2
if (iphase == 0) {
int k = sCodonIndex(seq->fasta->seq + j, seq->alphabet, 1);
seq->cell[j].mask = (seq->cell[j].mask & INCLUDE_MASK) | DIRECT_MASK;
seq->cell[j].index = k;
}
iphase = (iphase + 1) % 3;
}
}
else {
for (j = inter.to ; j >= inter.from + 2 ; j--) { // ZZ from + 2
if (iphase == 0) {
int k = sCodonIndex(seq->fasta->seq + j, seq->alphabet, -1);
seq->cell[j].mask = (seq->cell[j].mask & INCLUDE_MASK) | REVERSE_MASK;
seq->cell[j].index = k;
}
iphase = (iphase + 1) % 3;
}
}
}
/* ---------------------------------- */
/* exclude overlaps */
sMaskOverlap(seq);
}
+56
View File
@@ -0,0 +1,56 @@
/* ==================================================== */
/* @file: kim_mixer.c */
/* count mixing functions */
/* @history: */
/* @+ Apr. 97 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "kimono.h"
/* ----------------------------------------------- */
/* basic mixer */
/* */
/* this mixer just pool the two strands on both */
/* sides */
/* ----------------------------------------------- */
void BasicMixer(int left[][2], int right[][2],
int *countLeft, int *countRight,
int nbins) {
int i;
for (i = 0 ; i <= nbins ; i++)
countLeft[i] = countRight[i] = 0;
for (i = 0 ; i <= nbins ; i++) {
countLeft[i] += left[i][0] + left[i][1]; /* leftDirect + leftReverse */
countRight[i] += right[i][0] + right[i][1]; /* rightDirect + rightReverse */
}
}
/* ----------------------------------------------- */
/* cross mixer */
/* */
/* this mixer cross the two strands on both */
/* sides */
/* ----------------------------------------------- */
void CrossMixer(int left[][2], int right[][2],
int *countLeft, int *countRight,
int nbins) {
int i;
for (i = 0 ; i <= nbins ; i++)
countLeft[i] = countRight[i] = 0;
for (i = 0 ; i <= nbins ; i++) {
countLeft[i] += left[i][0] + right[i][1]; /* leftDirect + rightReverse */
countRight[i] += right[i][0] + left[i][1]; /* rightDirect + leftReverse */
}
}
+87
View File
@@ -0,0 +1,87 @@
/* ==================================================== */
/* @file: kim_sequence.c */
/* sequence handling */
/* @history: */
/* @+ Jul. 06 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "kimono.h"
/* -------------------------------------------- */
/* internal functions */
/* -------------------------------------------- */
static int sReallocCells(Sequence *seq) {
SeqCell *buf;
buf = ( seq->cell
? REALLOC(SeqCell, seq->cell, seq->fasta->length)
: NEWN(SeqCell, seq->fasta->length));
if (! buf) {
MemoryErreur("NewSequence", 2);
return 0;
}
seq->cell = buf;
return 1;
}
/* -------------------------------------------- */
/* API */
/* -------------------------------------------- */
/* -------------------------------------------- */
/* Sequence deallocation */
/* -------------------------------------------- */
Sequence *FreeSequence(Sequence *seq) {
if (seq) {
if (seq->alphabet) FreeAlphabet(seq->alphabet);
if (seq->fasta) FreeFastaSequence(seq->fasta);
if (seq->cell) FREE(seq->cell);
FREE(seq);
}
return NULL;
}
/* -------------------------------------------- */
/* Sequence allocation */
/* -------------------------------------------- */
Sequence *NewSequence(Alphabet *alpha) {
Sequence *seq;
if (! (seq = NEW(Sequence)))
MemoryErreur("NewSequence", 2);
seq->alphabet = NULL;
seq->fasta = NULL;
seq->cell = NULL;
if (! (seq->alphabet = CopyAlphabet(alpha)))
MemoryErreur("NewSequence", 2);
if (! (seq->fasta = NewFastaSequence()))
MemoryErreur("NewSequence", 2);
return seq;
}
/* -------------------------------------------- */
/* read sequence */
/* -------------------------------------------- */
int ReadSequence(FILE *streamin, Sequence *seq) {
int ok;
ok = ReadFastaSequence(streamin, seq->fasta)
&& seq->fasta->ok
&& sReallocCells(seq);
return ok;
}
+82
View File
@@ -0,0 +1,82 @@
/* ==================================================== */
/* @file: kim_util.c */
/* general utilities functions */
/* @history: */
/* @+ Apr. 97 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "kimono.h"
/* -------------------------------------------- */
/* error reporting */
/* -------------------------------------------- */
int Erreur(char *msg, int stat)
{
fprintf(stderr, "*%s* [%d] %s\n", (stat > 0 ? "Error" : "Warning"),
stat, msg);
if (stat > 0)
exit(stat);
fflush(stderr);
return 0;
}
/* -------------------------------------------- */
/* memory error */
/* -------------------------------------------- */
int MemoryErreur(char *where, int stat)
{
char buffer[BUFSIZ];
sprintf(buffer, "Not enough memory in %s", where);
return Erreur(buffer, stat);
}
/* -------------------------------------------- */
/* open a file and assign it to stdin */
/* -------------------------------------------- */
int AssignToStdin(char *filename)
{
char buffer[256];
if (! freopen(filename, "r", stdin)) {
sprintf(buffer, "cant open file %s to read", filename);
return Erreur(buffer, -1);
}
return 1;
}
/* ---------------------------------------------------- */
/* Trim leading spaces from string 'str' */
/* ---------------------------------------------------- */
char *StrTrimLeading(char *str)
{
char *sb, *sn;
if (! (str && isspace(*str)))
return str;
for (sb = sn = str ; isspace(*sn) ; sn++)
/* nop */ ;
while (*sn)
*sb++ = *sn++;
*sb = '\000';
return str;
}
+98
View File
@@ -0,0 +1,98 @@
/* ==================================================== */
/* @file: kim_zone.c */
/* zones handling */
/* @history: */
/* @+ Jul. 06 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "kimono.h"
/* -------------------------------------------- */
/* internal functions */
/* -------------------------------------------- */
/* -------------------------------------------- */
/* API */
/* -------------------------------------------- */
/* ----------------------------------------------- */
/* free zones */
/* ----------------------------------------------- */
SetOfIntervals *FreeZones(SetOfIntervals *set) {
if (set) {
if (set->interval)
FREE(set->interval);
FREE(set);
}
return NULL;
}
/* ----------------------------------------------- */
/* read zones */
/* note: zones are read as 1-based intervals */
/* but stored as 0-based intervals */
/* ----------------------------------------------- */
SetOfIntervals *ReadZones(int seqlength) {
int from, to;
SetOfIntervals *set;
Interval *tbuf;
char buffer[BUFSIZ], err[BUFSIZ];
char strand[2];
set = NEW(SetOfIntervals);
set->capacity = 256; /* just to start with */
set->size = 0;
set->interval = NEWN(Interval, set->capacity);
while (fgets(buffer, sizeof(buffer), stdin)) {
StrTrimLeading(buffer);
if ( (*buffer == '#')
|| (*buffer == '/')
|| (strlen(buffer) == 0))
continue;
if (sscanf(buffer, "%d%d%1s", &from, &to, strand) != 3) {
(void) sprintf(err, "include buffer: invalid format : %s", buffer);
Erreur(err, -1);
// return FreeZones(set);
continue;
}
if ((from > to) || (from <= 0) || (to <= 0) || (to > seqlength)) {
(void) sprintf(err, "include buffer: invalid from/to values : %s", buffer);
Erreur(err, -1);
// return FreeZones(set);
continue;
}
set->size++;
if (set->size >= set->capacity) {
set->capacity *= 2;
if (! (tbuf = REALLOC(Interval, set->interval, set->capacity))) {
MemoryErreur("ReadZones", 2);
return FreeZones(set);
}
set->interval = tbuf;
}
tbuf = set->interval + set->size - 1;
tbuf->from = from - 1;
tbuf->to = to - 1;
tbuf->strand = (strcmp(strand, "D") && strcmp(strand, "+") ? -1 : +1);
}
return set;
}
+205
View File
@@ -0,0 +1,205 @@
/* ==================================================== */
/* @file: kimfit_main.c */
/* triangle fit program */
/* @history: */
/* @+ Apr. 97 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <math.h>
#include "kimono.h"
#ifndef BUFSIZ
#define BUFSIZ 1024
#endif
#define NBEST 2
/* ----------------------------------------------- */
/* look for best window on signal */
/* ----------------------------------------------- */
static float sLookBest(float *x, int n, int iwidth) {
int i;
float sum, best;
if (iwidth > n) iwidth = n;
sum = 0.;
for (i = 0 ; i < iwidth ; i++) {
sum += x[i];
}
best = sum;
for (i = 1 ; i < n ; i++) {
sum -= x[i-1];
sum += x[(i+iwidth-1) % n];
if (sum > best)
best = sum;
}
return best;
}
/* ----------------------------------------------- */
/* fit triangle on signal */
/* ----------------------------------------------- */
static int sFitTriangle(float *x, int n, int iwidth, float height) {
int i, j, fitpos;
if (iwidth <= 1) iwidth = 2;
/* -------------------------- */
/* fit sliding triangle */
for (i = 0 ; i < n ; i++) {
int j;
float sum, fitval;
sum = 0.;
for (j = 0 ; j < iwidth ; j++) {
int k = (j < iwidth/2 ? j : iwidth - j);
float val = x[(i+j) % n] - (2. * (float) k / (float) iwidth * height);
sum += val * val;
}
if ((i == 0) || (sum < fitval)) {
fitval = sum;
fitpos = i;
}
}
fitpos = (fitpos + (iwidth /2)) % n;
return fitpos;
}
/* ----------------------------------------------- */
/* zero signal */
/* ----------------------------------------------- */
static void sZero(float *x, int from, int to, int n) {
int i;
for (i = from ; i < to ; i++) {
x[(i+n) % n] = 0.;
}
}
/* ----------------------------------------------- */
/* integrate signal */
/* ----------------------------------------------- */
static float sIntegrate(float *x, int from, int to, int n) {
int i;
float sum;
sum = 0.;
for (i = from ; i < to ; i++) {
sum += x[(i+n) % n];
}
return sum;
}
/* ----------------------------------------------- */
/* main */
/* ----------------------------------------------- */
main() {
int i, npt, nread, seqlength, window, iwidth;
float sum, tsum, best;
float *x, *xx;
char buffer[BUFSIZ];
/* --------------------------------------------- */
/* first line : npt, seqlength, window */
fgets(buffer, sizeof(buffer), stdin);
if ( (sscanf(buffer, "%d%d%d", &npt, &seqlength, &window) != 3)
|| ((npt <= 0) || (seqlength <= 0) || (window <= 0))) {
fprintf(stderr, "bad header (npt seqlength window) %s\n", buffer);
exit(1);
}
/* --------------------------------------------- */
/* allocate buffer */
if (! (x = NEWN(float, npt))) {
MemoryErreur("main", 2);
}
if (! (xx = NEWN(float, npt))) {
MemoryErreur("main", 2);
}
/* --------------------------------------------- */
/* other lines : data */
nread = 0;
while (fscanf(stdin, "%f", x + nread) == 1) {
if (nread > npt) {
(void) sprintf(buffer, "too many points (declared=%d)", npt);
Erreur(buffer, 3);
}
nread++;
}
if (nread != npt) {
(void) sprintf(buffer, "number of points does not match : declared=%d actual=%d", npt, nread);
Erreur(buffer, 0);
}
/* --------------------------------------------- */
/* print header */
printf("seqlength : %d\n", seqlength);
printf("window : %d\n", window);
/* --------------------------------------------- */
/* fit */
iwidth = (int) ((float) window * (float) npt / (float) seqlength);
sum = sIntegrate(x, 0, npt, npt);
for (i = 1 ; i < npt ; i++)
xx[i] = x[i];
for (i = 0 ; i < NBEST ; i++) {
tsum = sLookBest(xx, npt, iwidth);
best = sFitTriangle(xx, npt, iwidth, tsum / (iwidth /2));
tsum = sIntegrate(x, best - iwidth/2, best + iwidth/2, npt);
best = sFitTriangle(xx, npt, iwidth, tsum / (iwidth /2));
tsum = sIntegrate(x, best - iwidth/2, best + iwidth/2, npt);
sZero(xx, best - iwidth/2, best + iwidth/2, npt);
printf("best[%d] : %.0f %.0f %.2f\n", i, best, 1 + best * (float) seqlength / (float) npt,
tsum * 100. / sum);
}
exit(0);
}
+132
View File
@@ -0,0 +1,132 @@
/* ==================================================== */
/* @file: kim_help.c */
/* Help & usage */
/* @history: */
/* @+ Apr. 97 <AV> first draft */
/* ==================================================== */
#include <ctype.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "kimono.h"
/* ----------------------------------------------- */
/* printout help */
/* ----------------------------------------------- */
#define PP fprintf(stdout,
void PrintHelp()
{
PP "------------------------------------------ \n");
PP " Kimono Version 0.2 Nov. 05 \n");
PP "------------------------------------------ \n");
PP "synopsis : \n");
PP " \n");
PP "usage: kimono [options] [fastafile] \n");
PP "------------------------------------------ \n");
PP "options: \n");
PP "----- General options ------------------ \n");
PP "-a string : use symbols from string as [A]lphabet\n");
PP " default = acgt \n");
PP " \n");
PP "-b string : exclude symbols from string \n");
PP " in practice replace symbols from \n");
PP " string by X's \n");
PP " default = <none> \n");
PP " \n");
PP "-c selector : use selector as [C]ount selector \n");
PP " selector: \n");
PP " count : counts symbols \n");
PP " cumul : cumulative plot \n");
PP " codon : count codons \n");
PP " genes : count genes \n");
PP " default = count \n");
PP " \n");
PP "-e code : g[E]netic code \n");
PP " code: \n");
PP " 0 : Universal \n");
PP " 1 : mito yeast \n");
PP " 2 : mito vertebrate \n");
PP " 3 : filamentous fungi \n");
PP " 4 : mito insects & platyhelminthes\n");
PP " 5 : Candida cylindracea \n");
PP " 6 : Ciliata \n");
PP " 7 : Euplotes \n");
PP " 8 : mito echinoderms \n");
PP " default = 0 \n");
PP " \n");
PP "-d selector : use selector as [D]istance \n");
PP " selector: \n");
PP " chi : chi square distance \n");
PP " hell : hellinger distance \n");
PP " euclid : euclidian distance \n");
PP " default = chi \n");
PP " \n");
PP "-h : [H]elp - print <this> help \n");
PP " \n");
PP "-i filename : genes [I]nclude file \n");
PP " default = <none> \n");
PP " \n");
PP "-m selector : use selector as [M]ixer \n");
PP " selector: \n");
PP " basic : basic mixer \n");
PP " cross : cross strands mixer \n");
PP " default = basic \n");
PP " \n");
PP "-p [1[2[3]]] : [P]hase(s) for counts \n");
PP " default = <nophase> \n");
PP " \n");
PP "-P [1[2[3]]] : [P]hase(s) for counts \n");
PP " same as -p + base complement on \n");
PP " reverse strand \n");
PP " default = <nophase> <nocomplement>\n");
PP " \n");
PP "-s step : window [S]tep in bp \n");
PP " default = 1000 \n");
PP " \n");
PP "-w width : window [W]idth in bp \n");
PP " default = <see -W> \n");
PP " \n");
PP "-W %%width : window [W]idth in %% of chromosome length\n");
PP " default = 25%% \n");
PP " \n");
PP "-x filename : genes e[X]clude file \n");
PP " default = <none> \n");
PP " \n");
PP "------------------------------------------ \n");
PP "file formats \n");
PP " \n");
PP "fastafile: fasta format \n");
PP "include/exclude files: one gene per line : \n");
PP " from to strand [comments] \n");
PP " from, to : integers (from <= to) \n");
PP " strand : C|D|+|- \n");
PP "-------------------------------- \n");
PP " see documentation for more information \n");
PP "-------------------------------- \n");
PP " \n");
}
#undef PP
/* ----------------------------------------------- */
/* printout usage and exit */
/* ----------------------------------------------- */
#define PP fprintf(stderr,
int ExitUsage(int stat)
{
PP "usage: \n");
PP "type \"kimono -h\" for help \n");
if (stat)
exit(stat);
return stat;
}
#undef PP
+800
View File
@@ -0,0 +1,800 @@
/* ==================================================== */
/* @File kimono_main.c */
/* @history: */
/* @+ Apr. 97 <Gloup> first draft */
/* ==================================================== */
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include "Genetic.h"
#include "fasta_io.h"
#include "kimono.h"
#ifdef HAS_UNISTD_H
#include HAS_UNISTD_H
#endif
#ifdef HAS_GETOPT_H
#include HAS_GETOPT_H
#endif
#ifndef FILENAME_MAX
#define FILENAME_MAX 1024 /* max # of characters in a path name */
#endif
#ifndef BUFSIZ
#define BUFSIZ 1024
#endif
#define SELECTOR_NONE 0
#define SELECTOR_COUNT 1
#define SELECTOR_CUMUL 2
#define SELECTOR_CODON 3
#define SELECTOR_GENE 4
#define DISTANCE_NONE 0
#define DISTANCE_CHI 1
#define DISTANCE_EUCLID 2
#define DISTANCE_HELL 3
#define MIXER_NONE 0
#define MIXER_BASIC 1
#define MIXER_CROSS 2
#define DFT_WINDOW -25 /* aka 25% */
#define DFT_STEP 1000
#define CUMUL_NORM 1.0e6
#define DEBUG 0
/* -------------------------------------------- */
/* macros */
/* -------------------------------------------- */
/* -------------------------------------------- */
/* globals */
/* -------------------------------------------- */
static char sDNA[] = KIM_DNA;
static float sCodonScore[NB_NUC][NB_CODONS];
/* -------------------------------------------- */
/* getopt globals */
/* -------------------------------------------- */
extern char *optarg;
extern int optind;
/* =============================================== */
/* Utilities Functions */
/* =============================================== */
/* ----------------------------------------------- */
/* make a count selector */
/* ----------------------------------------------- */
static int sSetSelector(char *buf) {
if (! strcmp(buf, "count"))
return SELECTOR_COUNT;
if (! strcmp(buf, "cumul"))
return SELECTOR_CUMUL;
if (! strcmp(buf, "codon"))
return SELECTOR_CODON;
if (! strcmp(buf, "genes"))
return SELECTOR_GENE;
return SELECTOR_NONE;
}
/* ----------------------------------------------- */
/* get the count selector */
/* ----------------------------------------------- */
static char *sGetSelector(int selector) {
switch (selector) {
case SELECTOR_COUNT : return "count";
case SELECTOR_CUMUL : return "cumul";
case SELECTOR_CODON : return "codon";
case SELECTOR_GENE : return "genes";
}
return "<unknown>";
}
/* ----------------------------------------------- */
/* make a distance selector */
/* ----------------------------------------------- */
static int sSetDistance(char *buf) {
if (! strcmp(buf, "chi"))
return DISTANCE_CHI;
if (! strcmp(buf, "euclid"))
return DISTANCE_EUCLID;
if (! strcmp(buf, "hell"))
return DISTANCE_HELL;
return DISTANCE_NONE;
}
/* ----------------------------------------------- */
/* get the count selector */
/* ----------------------------------------------- */
static char *sGetDistance(int selector) {
switch (selector) {
case DISTANCE_CHI : return "chi";
case DISTANCE_EUCLID : return "euclid";
case DISTANCE_HELL : return "hell";
}
return "<unknown>";
}
/* ----------------------------------------------- */
/* make a mixer selector */
/* ----------------------------------------------- */
static int sSetMixer(char *buf) {
if (! strcmp(buf, "basic"))
return MIXER_BASIC;
if (! strcmp(buf, "cross"))
return MIXER_CROSS;
return MIXER_NONE;
}
/* ----------------------------------------------- */
/* get the mixer selector */
/* ----------------------------------------------- */
static char *sGetMixer(int selector) {
switch (selector) {
case MIXER_BASIC : return "basic";
case MIXER_CROSS : return "cross";
}
return "<unknown>";
}
/* ----------------------------------------------- */
/* make a phase mask */
/* ----------------------------------------------- */
static int sGetPhaseMask(char *buf) {
int mask = 0x0;
if (strchr(buf, '1'))
mask |= 0x1;
if (strchr(buf, '2'))
mask |= 0x2;
if (strchr(buf, '3'))
mask |= 0x4;
return mask;
}
/* ----------------------------------------------- */
/* uppercase string */
/* ----------------------------------------------- */
static char *sUpper(char *buf) {
char *c;
for (c = buf ; *c ; c++) {
*c = UPPER(*c);
}
return buf;
}
/* ----------------------------------------------- */
/* replace symbols in alphaOut by MASKED_SYMBOL */
/* ----------------------------------------------- */
static char *sExcludeFromSeq(char *buf, char *alphaOut, char maskSymbol) {
char *c;
if (! *alphaOut)
return buf;
for (c = buf ; *c ; c++) {
if (strchr(alphaOut, *c))
*c = maskSymbol;
}
return buf;
}
/* ----------------------------------------------- */
/* check alphabet */
/* ----------------------------------------------- */
static int sCheckAlphabet(char *alpha) {
char *c;
for (c = alpha ; *c ; c++) {
if (! strchr(sDNA, *c)) /* invalid symbol */
return 0;
if (strchr(c+1, *c)) /* duplicate symbol */
return 0;
}
return strlen(alpha);
}
/* ----------------------------------------------- */
/* main */
/* ----------------------------------------------- */
main(int argn, char *argv[])
{
int i, j, carg, errflag;
int gflag, iflag, xflag, dflag, code;
int selector, mixer, phase;
int pos, len, step, window, nopen, nvalid, nbins, sign;
int allLeft[3 * NB_NUC + 1][2], allRight[3 * NB_NUC + 1][2],
countLeft[3 * NB_NUC + 1], countRight[3 * NB_NUC + 1],
tmpLeft[2], tmpRight[2];
float skew, sum;
Alphabet *alpha;
Sequence *seq;
SetOfIntervals *zones;
char alphaOut[128];
char inputfile[FILENAME_MAX], includefile[FILENAME_MAX];
IndexFunction indexingFunction;
CountFunction countingFunction;
DistFunction distanceFunction;
MixFunction mixingFunction;
/* ---------------------------- */
/* defaut options */
errflag = 0;
selector = SELECTOR_COUNT; /* mono countings */
mixer = MIXER_BASIC; /* basic mixer */
dflag = DISTANCE_CHI; /* chi-square distance */
iflag = 0; /* no inclusion */
phase = 0x7; /* all phases */
xflag = 0; /* no exclusion */
code = 0; /* universal code */
step = DFT_STEP;
window = DFT_WINDOW;
alpha = NucleicAlphabet();
alphaOut[0] = '\000';
(void) strcpy(inputfile, "<stdin>");
(void) strcpy(includefile, "<none>");
/* ---------------------------- */
/* parse cmdline arguments */
while ((carg = getopt(argn, argv, "a:b:c:d:e:g:hi:m:p:s:w:W:x:")) != -1) {
switch(carg) {
case 'a' : /* [a]lphabet */
(void) FreeAlphabet(alpha);
alpha = NewAlphabet(sUpper(optarg));
if (! sCheckAlphabet(alpha->symbol)) {
Erreur("bad alphabet", -1);
errflag++;
}
break;
case 'b' : /* excluded symbols */
(void) strcpy(alphaOut, sUpper(optarg));
break;
case 'c' : /* [c]ount selector */
selector = sSetSelector(optarg);
if (selector == SELECTOR_NONE) {
Erreur("bad count selector", -1);
errflag++;
}
break;
case 'e': /* g[e]netic code */
if ( (sscanf(optarg, "%d", &code) != 1)
|| (code < 0) || (code > GEN_MAX_CODES)) {
Erreur("bad code value: -e (0-8)", -1);
errflag++;
}
else {
InitCodonSkewCounter(code);
}
break;
case 'd' : /* [d]istance selector */
dflag = sSetDistance(optarg);
if (dflag == DISTANCE_NONE) {
Erreur("bad distance selector", -1);
errflag++;
}
break;
case 'h' : /* help */
PrintHelp();
exit(0);
case 'i' : /* [i]nclude file */
if (xflag) {
Erreur("-x and -i options are incompatibles", -1);
errflag++;
}
iflag = 1;
(void) strcpy(includefile, optarg);
break;
case 'm' : /* [m]ixer selector */
mixer = sSetMixer(optarg);
if (mixer == MIXER_NONE) {
Erreur("bad mixer selector", -1);
errflag++;
}
break;
case 'p' : /* [p]hase mask */
phase = sGetPhaseMask(optarg);
if (phase == 0) {
Erreur("bad phase value", -1);
errflag++;
}
break;
case 's': /* [s]tep */
if ( (sscanf(optarg, "%d", &step) != 1)
|| (step <= 0) ) {
Erreur("bad step value", 0);
errflag++;
}
break;
case 'w': /* [w]indow */
if ( (sscanf(optarg, "%d", &window) != 1)
|| (window <= 0) ) {
Erreur("bad window value", -1);
errflag++;
}
break;
case 'W': /* [W]indow */
if ( (sscanf(optarg, "%d", &window) != 1)
|| (window <= 0)
|| (window > 100)) {
Erreur("bad bad window percent value", -1);
errflag++;
}
window = -window;
break;
case 'x' : /* e[X]lude file */
if (iflag) {
Erreur("-x and -i options are incompatibles", -1);
errflag++;
}
xflag = 1;
(void) strcpy(includefile, optarg);
break;
case '?' : /* misusage */
errflag++;
}
}
/* -------------------------------- */
/* check some options compatibility */
if ((phase != 0x7) && (! iflag)) {
Erreur("-p flag requires -i flag", -1);
errflag++;
}
if (selector == SELECTOR_CUMUL) {
if (alpha->length != 2) {
Erreur("need a two-letters alphabet for -c cumul", -1);
errflag++;
}
}
if (selector == SELECTOR_GENE) {
if (! iflag) {
Erreur("-c gene requires -i flag", -1);
errflag++;
}
if (phase != 0x7) {
Erreur("-c gene needs -p 123", -1);
errflag++;
}
if (strcmp(alpha->symbol, sDNA)) {
Erreur("-a ignored for -c gene", 0);
(void) FreeAlphabet(alpha);
alpha = NucleicAlphabet();
}
}
if (selector == SELECTOR_CODON) {
if (! iflag) {
Erreur("-c codon requires -i flag", -1);
errflag++;
}
if (phase != 0x7) {
Erreur("-c codon is incompatible with -p flag", -1);
errflag++;
}
if (strcmp(alpha->symbol, sDNA)) {
Erreur("-a ignored for -c codon", 0);
(void) FreeAlphabet(alpha);
alpha = NucleicAlphabet();
}
}
/* ---------------------------- */
/* may remain 1 argument */
argn -= optind;
if (argn > 1)
errflag++;
if (errflag)
ExitUsage(1);
/* ---------------------------- */
/* allocate sequences */
seq = NewSequence(alpha);
/* ---------------------------- */
/* read genome */
if (argn == 1) {
(void) strcpy(inputfile, argv[optind]);
if (! AssignToStdin(inputfile))
Erreur("cannot open sequence file", 3);
}
if (! ReadSequence(stdin, seq))
Erreur("cannot read sequence file", 4);
(void) sUpper(seq->fasta->seq); /* upper case sequence */
(void) sExcludeFromSeq(seq->fasta->seq, alphaOut, MASKED_SYMBOL);
/* ---------------------------- */
/* read include file */
if (iflag || xflag) {
if (! (AssignToStdin(includefile)))
Erreur("cannot open include file", 4);
if (! (zones = ReadZones(seq->fasta->length)))
Erreur("cannot read include zones", 5);
}
else {
zones = NULL;
}
/* ---------------------------- */
/* adjust parameters */
/* -------------------- */
len = seq->fasta->length; /* sequence length */
/* -------------------- */
if (window < 0) /* window */
window = len * (-window) / 100;
window /= 2; /* actual wondow for each half */
/* -------------------- */
if (selector == SELECTOR_GENE) { /* alphabet */
(void) strcpy(alpha->symbol, "DR");
alpha->length = 2;
}
/* -------------------- */
nbins = alpha->length; /* # bins (for chi2) */
/* -------------------- */
if (xflag) { /* indexing function */
indexingFunction = ExcludeIndexer;
}
else if (iflag) {
indexingFunction = PhaseIndexer;
}
else {
indexingFunction = NoZoneIndexer;
}
if (selector == SELECTOR_GENE) {
indexingFunction = GeneIndexer;
}
if (selector == SELECTOR_CODON) {
indexingFunction = CodonIndexer;
}
/* -------------------- */
if (selector == SELECTOR_CODON) { /* counting function */
/* precompute score for each possible codon */
/* to speedup computation */
CodonSkew(code, sCodonScore);
countingFunction = CodonSkewCounter;
nbins = 3 * NB_NUC;
}
else {
countingFunction = BasicCounter;
}
/* -------------------- */
if (dflag == DISTANCE_EUCLID) { /* distance function */
distanceFunction = Euclid;
}
else if (dflag == DISTANCE_HELL) {
distanceFunction = HellTwo;
}
else {
distanceFunction = ChisTwo;
}
/* -------------------- */
if (mixer == MIXER_CROSS) { /* mixing function */
mixingFunction = CrossMixer;
}
else {
mixingFunction = BasicMixer;
}
/* ---------------------------- */
/* index sequence */
indexingFunction(seq, zones, phase);
/* ---------------------------- */
/* # included positions */
for (i = nopen = nvalid = 0 ; i < len ; i++) {
if ((seq->cell[i].mask & EXCLUDE_MASK) == 0) {
nopen++;
if (seq->cell[i].index >= 0)
nvalid++;
}
}
/* ---------------------------- */
/* printout header */
printf("# input : %s\n", inputfile);
printf("# %s : %s\n", (xflag ? "exclude" : "include"), includefile);
printf("# selector : %s\n", sGetSelector(selector));
printf("# mixer : %s\n", sGetMixer(mixer));
printf("# distance : %s\n", sGetDistance(dflag));
printf("# phase : %d\n", phase);
printf("# alphabet : %s\n", alpha->symbol);
printf("# excluded : X%s\n", alphaOut);
printf("# seqname : %s\n", seq->fasta->name);
printf("# seqlength : %d\n", len);
printf("# unmasked : %d\n", nopen);
printf("# valid : %d\n", nvalid);
printf("# window : %d\n", 2 * window);
printf("# step : %d\n", step);
printf("#\n");
printf("# pos");
if (selector == SELECTOR_COUNT) {
for (i = 0 ; i < alpha->length ; i++) {
printf(" Left%c Right%c", alpha->symbol[i], alpha->symbol[i]);
}
printf(" LeftOther RightOther");
printf(" %s%s", sGetDistance(dflag), alpha->symbol);
printf(" %s[%s]Other", sGetDistance(dflag), alpha->symbol);
for (i = 0 ; i < alpha->length ; i++) {
printf(" %s%c", sGetDistance(dflag), alpha->symbol[i]);
}
}
if (selector == SELECTOR_CUMUL) {
printf(" %c-%c/%c+%c", alpha->symbol[0], alpha->symbol[1], alpha->symbol[0], alpha->symbol[1]);
}
if (selector == SELECTOR_GENE) {
printf(" LeftDirect RightDirect LeftReverse RightReverse");
printf(" %s_Direct", sGetDistance(dflag));
}
if (selector == SELECTOR_CODON) {
printf(" LeftTotalCodon RightTotalCodon");
for (i = 0 ; i < alpha->length ; i++) {
printf(" Left%c0 Left%cP Left%cM", alpha->symbol[i], alpha->symbol[i], alpha->symbol[i]);
printf(" Right%c0 Right%cP Right%cM", alpha->symbol[i], alpha->symbol[i], alpha->symbol[i]);
}
for (i = 0 ; i < alpha->length ; i++) {
printf(" Total%s%c", sGetDistance(dflag), alpha->symbol[i]);
}
}
printf("\n");
/* ---------------------------- */
/* now go ahead ! */
skew = 0.; /* just for SELECTOR_CUMUL */
for (pos = 0 ; pos < len ; pos += step) {
/* compute skew */
if ((pos == 0) || (window < step)) {
countingFunction(seq, pos, pos + window, allRight, nbins, 0);
countingFunction(seq, pos + len - window, pos + len, allLeft, nbins, 0);
}
else {
countingFunction(seq, pos - step, pos, allRight, nbins, -1);
countingFunction(seq, pos - step + window, pos + window, allRight, nbins, 1);
countingFunction(seq, pos - step + len - window, pos + len - window, allLeft, nbins, -1);
countingFunction(seq, pos - step, pos, allLeft, nbins, 1);
}
mixingFunction(allLeft, allRight, countLeft, countRight, nbins);
/* printout result */
printf("%d", pos+1);
/* printout skew */
if (selector == SELECTOR_COUNT) {
/* -- printout counts -- */
for (i = 0 ; i <= alpha->length ; i++) {
printf(" %d %d", countLeft[i], countRight[i]);
}
/* -- printout total alphabet chisquare -- */
skew = distanceFunction(countLeft, countRight, nbins, -1);
sign = ((nbins == 2) ? SignTwoBins(countRight, countLeft) : 1);
printf(" %g", skew * sign);
/* -- printout anti alphabet chisquare -- */
tmpLeft[1] = countLeft[alpha->length];
tmpRight[1] = countRight[alpha->length];
tmpLeft[0] = tmpRight[0] = 0;
for (i = 0 ; i < alpha->length ; i++) {
tmpLeft[0] += countLeft[i];
tmpRight[0] += countRight[i];
}
skew = distanceFunction(tmpLeft, tmpRight, 2, -1);
sign = SignTwoBins(tmpRight, tmpLeft);
printf(" %g", skew * sign);
/* -- printout partial chisquares -- */
tmpLeft[0] = tmpRight[0] = 0;
tmpLeft[1] = tmpRight[1] = 0;
for (j = 0 ; j < alpha->length ; j++) {
tmpLeft[1] += countLeft[j];
tmpRight[1] += countRight[j];
}
for (i = 0 ; i < alpha->length ; i++) {
skew = distanceFunction(countLeft, countRight, nbins, i);
tmpLeft[0] = countLeft[i];
tmpRight[0] = countRight[i];
tmpLeft[1] -= countLeft[i];
tmpRight[1] -= countRight[i];
sign = SignTwoBins(tmpRight, tmpLeft);
tmpLeft[1] += countLeft[i];
tmpRight[1] += countRight[i];
printf(" %g", skew * sign);
}
}
if (selector == SELECTOR_CUMUL) {
/* -- printout XY cumulatives -- */
sum = (float) ((countRight[0] + countLeft[0]) + (countRight[1] + countLeft[1]));
if (sum != 0.) {
skew += (float) ((countRight[0] + countLeft[0]) - (countRight[1] + countLeft[1]))
/ (sum * (float) len) * CUMUL_NORM;
}
printf(" %g", skew);
}
if (selector == SELECTOR_GENE) {
/* -- printout direct -- */
printf(" %d %d", countLeft[0], countRight[0]);
/* -- printout reverse -- */
printf(" %d %d", countLeft[1], countRight[1]);
/* -- printout chi direct -- */
skew = distanceFunction(countLeft, countRight, nbins, -1);
sign = SignTwoBins(countRight, countLeft);
printf(" %g", skew * sign);
}
if (selector == SELECTOR_CODON) {
/* -- printout total codons -- */
printf(" %d %d", countLeft[3* NB_NUC], countRight[3 * NB_NUC]);
/* -- printout nuc-enrichment -- */
for (i = 0 ; i < NB_NUC ; i++) {
for (j = 0 ; j < 3 ; j++) {
printf(" %d", countLeft[3*i + j]);
}
for (j = 0 ; j < 3 ; j++) {
printf(" %d", countRight[3*i + j]);
}
}
/* -- printout total chi nuc-enrichment -- */
for (i = 0 ; i < NB_NUC ; i++) {
skew = distanceFunction(countLeft + 3*i, countRight + 3*i, 3, -1);
printf(" %g", skew);
}
}
printf("\n");
}
FreeAlphabet(alpha);
FreeSequence(seq);
FreeZones(zones);
exit(0);
}
+25
View File
@@ -0,0 +1,25 @@
# ---------------------------------------------------------------
# $Id: $
# ---------------------------------------------------------------
# @file: Makefile
# @desc: makefile for kimono/test
#
# @history:
# @history:
# @+ <Gloup> : Apr 97 : Created
# @+ <Gloup> : Mar 02 : Updated for LXxware
#
# @note: should be processed with gnu compatible make
# @note: helixware_compatible
#
# @end:
# ---------------------------------------------------------------
#
include ../config/targets/empty.targ
clean::
-\rm -f *.tst
test::
./test.csh
File diff suppressed because it is too large Load Diff
+850
View File
@@ -0,0 +1,850 @@
105 677 D
768 1796 C
1784 3148 C
3395 5188 D
5251 6312 C
6309 7433 C
7458 8315 C
8412 9197 D
9202 10206 D
10203 10577 D
10581 11420 D
11421 12161 D
12154 12753 D
12746 14728 D
14725 15348 C
15345 15722 C
15845 16804 D
16807 17817 C
17792 18304 C
18312 19979 C
20445 21092 C
21058 22101 C
22146 22739 C
22819 23958 D
23965 24696 C
24697 25623 C
25753 26391 D
26399 27448 D
27434 27865 C
27855 28490 C
28492 29472 C
29543 31015 D
31027 31479 D
31550 32089 C
32157 34037 C
34037 35836 C
35857 36609 C
36606 38123 C
38136 39638 C
39826 40677 D
40677 40769 D
40761 41432 C
41443 42483 C
42480 42881 C
42907 45366 C
45446 45991 D
46011 46394 C
46601 46771 C
46921 47040 C
47167 47841 D
47905 48606 D
48603 49259 C
49341 50012 D
50112 50489 C
50490 51251 C
51253 52434 C
52454 53461 C
53534 55504 C
55501 56280 C
56281 56748 C
56832 57185 C
57259 57975 D
58029 59036 C
59101 60039 C
60036 60554 C
60568 61257 C
61254 63032 C
63147 64028 D
64038 65276 D
65291 65752 D
65768 67240 D
67248 69569 D
69566 70126 D
70173 71219 D
71201 72610 D
72647 73492 D
73489 74517 D
74518 75039 D
75110 75772 D
75732 76454 D
76451 77701 D
77711 79009 C
79002 79376 C
79505 80773 D
80983 81408 D
81405 82940 D
82970 83920 C
84041 85720 C
85880 86854 C
86926 87360 C
87377 89203 C
89200 89814 C
89811 91115 C
91137 92792 C
92878 93423 C
93433 94035 C
94219 94605 C
94611 96953 C
96943 97866 C
97863 98648 C
98805 100205 D
100228 100749 D
100746 101339 C
101525 102976 C
103016 103771 C
103764 105473 C
105418 105855 C
105884 106894 C
106974 108170 C
108307 109671 D
109675 111042 C
111046 111567 C
111585 111875 C
111889 112338 C
112350 112769 C
112909 114633 C
114807 115508 D
115505 116818 C
117678 118370 C
118375 118929 C
118964 119803 C
119807 120589 C
120804 121082 C
121101 121823 C
121880 122491 C
122491 124152 C
124149 124814 C
124798 125547 C
125534 126301 C
126316 127413 C
127427 130132 C
130170 131114 C
131277 132425 D
132472 133845 C
133975 135864 D
135874 137766 C
137880 138089 C
138434 138823 C
138850 141960 C
141979 142935 C
142944 144266 C
144307 144597 D
144586 145458 C
145471 146370 C
146377 147495 C
147649 148659 C
148710 148805 D
148786 150783 C
150805 150897 C
150974 152179 D
152206 153012 D
153075 153719 C
153701 156400 C
156462 157598 D
157627 158061 D
158058 158474 D
158628 159344 D
159368 160042 D
160090 161208 D
161200 162864 C
162878 163045 D
163072 164820 C
164901 165914 C
165915 167759 C
167879 169399 C
169539 170708 D
170720 171097 C
171212 171484 D
171532 173580 C
173529 174116 C
174098 175138 C
175081 176106 C
176069 176974 C
176978 177853 C
177868 178881 C
178917 179543 C
179540 181423 C
181408 182802 C
182886 183380 D
183392 185275 D
185278 186552 D
186554 186946 D
186949 187194 D
187178 187831 C
187824 188237 C
188234 188494 C
188708 189055 C
189076 189276 C
189299 189859 C
189949 190044 D
190064 190717 D
190719 191459 D
191518 192327 C
192324 193463 C
193800 194873 D
194876 195736 D
195693 197696 D
197686 199950 D
199965 201035 C
201052 202578 C
202850 204088 D
204137 205072 D
205073 206044 D
206529 208106 D
208084 208653 C
208706 209542 D
209529 211274 D
211301 212068 D
212061 215420 D
215427 217259 D
217278 218312 D
218425 219078 C
219056 219634 C
219797 220639 D
220729 221637 D
222192 223178 D
223179 223961 D
223964 224785 C
224826 226610 C
226610 227836 C
227814 228521 C
228542 228895 C
228864 229148 C
229217 230224 D
230214 231491 C
231621 232322 D
232338 235253 D
235289 235534 C
235595 237142 C
237222 237629 C
237630 237956 C
237969 238292 C
238301 239128 C
239144 240250 C
240283 242289 C
242438 244003 D
243943 244731 C
244777 245394 C
245790 246554 D
246597 248102 D
248156 248434 D
248506 250089 D
250176 250670 C
250657 251211 C
251212 252237 C
252434 253039 D
253159 254931 D
254945 255649 D
255646 256260 D
256463 258985 D
259000 261303 D
261292 263712 C
263988 266114 D
266095 267051 D
267066 267275 D
267313 269676 C
269673 270473 C
270488 272701 C
272634 273647 C
273854 275236 D
275243 276496 C
276558 277064 D
277090 278565 C
278537 279058 C
279078 279386 C
279407 281311 C
281314 281793 C
281800 282687 C
282699 283865 C
283869 285962 C
285971 287089 C
287089 287898 C
287910 288173 C
288182 288946 C
288957 289583 C
289576 289917 C
289963 291021 C
291059 291595 C
291644 292426 C
292426 293208 C
293205 293429 C
293452 294780 C
294785 295228 C
295242 296426 C
296428 297051 C
297038 297469 C
297466 298776 C
298795 299715 C
299730 300764 C
300780 302489 C
302504 302839 C
302851 303309 C
303333 303740 C
303774 305141 C
305113 305661 C
305671 306618 C
306625 307317 C
307318 308532 C
308539 309780 C
309780 310523 C
310559 311653 C
311660 312715 C
312729 314123 C
314146 314427 C
314424 315314 C
315307 316143 C
316140 317216 C
317247 318026 C
318119 318256 C
318277 319158 C
319106 319636 C
319680 320258 C
320309 321352 D
321352 322038 D
322040 322846 C
322847 323779 C
323776 325236 C
325236 326288 C
326325 326432 C
326469 326666 C
326699 327757 C
328032 329165 D
329262 329621 D
329643 330752 C
330803 333598 C
333619 334515 C
334919 336508 D
336629 338215 D
338358 339983 D
340062 340217 C
340341 341261 D
341274 342323 D
342335 343207 D
343208 344179 D
344192 344947 C
345063 346364 D
346431 346841 C
346861 347301 C
347351 348160 C
348153 349610 C
349600 351090 C
351056 351331 C
351341 353440 C
353440 354636 C
354648 355298 C
355482 356909 D
357007 358440 D
358458 359198 D
359217 359495 C
359513 361081 C
361188 362321 D
362318 364117 C
364130 365170 C
365115 365603 C
365643 366137 C
366144 366236 C
366229 366960 C
366964 368391 C
368456 368881 D
368885 370027 D
370027 371013 D
371034 373046 D
373140 373520 D
373567 374151 C
374277 375653 D
375661 375939 D
375961 377052 C
377039 379330 C
379341 380558 C
380555 381892 C
381910 383382 C
383395 384162 C
384287 385426 D
385449 386162 D
386159 387337 D
387286 387807 D
387818 388480 C
388507 388956 C
388977 390341 C
390392 391819 C
391932 392957 C
393044 394063 C
394105 395166 C
395481 396563 C
396604 397077 C
397102 397476 C
397544 401677 C
401693 405160 C
405243 405617 C
405688 406194 C
406181 406861 C
406861 407292 C
407344 407898 C
407922 408092 C
408201 408380 C
408554 409402 C
409416 410447 C
410787 411446 D
411456 413006 C
413113 414315 D
414327 415793 C
415846 416523 C
416689 417105 D
417102 417713 D
417724 418335 D
418388 419506 C
419503 421380 C
421554 422183 D
422180 422299 D
422471 423058 D
423055 423834 D
423822 424445 C
424694 425551 D
425584 426711 D
426736 427950 D
427987 428622 D
428646 429674 D
429693 430616 C
430619 435103 C
441713 442552 C
442688 443248 C
443763 444053 C
444150 444299 D
446113 446205 C
446327 446890 C
446969 447760 C
447855 448172 D
448202 448591 C
448705 449310 D
449419 450171 D
450174 450887 D
450972 451070 C
451139 451921 C
452040 454472 C
454484 456403 C
456576 458036 D
458277 459434 D
459525 459824 D
459916 460071 D
460052 460411 D
460398 462032 D
462045 462773 D
462819 463886 D
464053 465132 D
465518 467038 C
467282 469387 C
469390 469665 C
469678 469971 C
469961 471220 C
471223 471756 C
471771 472475 C
472566 473408 D
473405 474556 C
474613 475602 D
475606 476211 D
476263 478074 C
478139 479716 D
479709 481019 D
481344 482057 C
482600 484282 D
484254 484586 D
484757 485266 D
485550 486077 D
486074 486769 D
486705 487538 D
487535 488224 D
488226 488972 D
488983 489495 D
489492 489719 D
489733 490554 D
490599 491927 D
492588 493952 D
493991 494092 D
494150 494542 C
495012 496217 D
496268 496579 D
496615 497235 D
497245 497874 D
497880 498191 D
498213 499046 D
499056 499334 D
499341 499703 D
499707 500588 D
500593 501009 D
501012 501212 D
501215 501469 D
501491 501865 D
501880 502185 D
502191 502739 D
502717 502941 D
502951 503349 D
503366 503908 D
503926 504285 D
504298 504795 D
504799 505104 D
505104 505541 D
505554 506858 D
506865 506984 D
507002 507379 D
507394 507798 D
507811 508848 D
508870 509241 D
509314 510846 D
510836 511624 D
511605 512396 D
512393 513148 C
513226 514527 D
514524 515783 D
515780 515998 D
516090 516473 D
516493 522993 D
522990 524576 D
524554 526254 D
526325 527305 D
527361 528047 C
528104 529198 C
529198 531105 C
531129 531692 C
531851 531967 C
532069 532521 D
532938 533606 D
533980 534072 D
534301 535155 D
535178 535600 C
535704 537527 D
537520 538308 D
538328 539275 C
539256 539372 D
539367 540020 C
540159 540773 C
541182 542069 C
542263 543024 D
543049 543816 D
543832 544605 D
544586 547387 D
547846 548490 C
548487 548885 C
548920 549618 C
549642 551723 C
552007 552225 D
552440 553018 D
553133 553789 D
553992 555212 D
555216 556580 D
556563 557423 C
557407 558024 C
558006 560732 C
560729 561127 C
561117 561554 C
561563 561964 C
562185 564167 D
564188 565681 C
565943 567823 D
567810 568277 D
568270 569139 D
569278 569538 D
569559 571280 D
571283 571852 D
571890 573842 C
573853 575247 D
575274 575816 C
575981 576526 C
576582 577187 C
577395 577937 D
577950 578261 D
578277 580421 D
580486 581643 D
581645 583417 D
583458 583832 D
584191 584880 C
585080 586156 D
586212 587024 D
587031 587882 D
588066 589667 D
589684 590232 C
590348 590935 D
591188 592357 D
592446 595931 D
595943 596521 D
596531 598591 D
598588 599376 C
599495 600844 D
600998 602344 D
602374 603729 D
603726 604769 C
604779 606983 C
607138 607935 D
608020 609078 D
609061 609906 C
609943 611193 C
611309 612022 D
612048 613985 D
614014 615789 C
615764 616390 C
616412 618559 C
618828 621035 D
621045 621953 C
622005 623447 D
623451 625007 D
625007 626260 D
626286 627038 D
627092 628948 C
629196 630698 C
630769 631986 D
631991 632482 D
632485 634464 D
634581 636011 D
636024 636134 C
636593 637957 D
637963 638556 D
638580 639872 D
639808 642249 D
642289 642441 D
642500 643129 C
643295 644650 C
644772 645140 D
645137 645601 C
645689 646681 D
646659 648326 C
648553 649107 D
649170 650411 C
650413 653790 C
653887 654849 D
654809 656902 D
656998 657543 C
657546 658817 C
658898 659623 D
659644 661524 C
661606 662529 D
662603 662917 C
663179 665011 C
665008 668517 C
668848 671763 C
671767 673212 C
673342 674778 D
675029 676378 D
676472 677860 D
677892 678938 C
678959 679750 C
679754 680563 C
680563 681606 C
681685 682524 C
682679 683377 D
683423 684967 D
684997 685980 C
685977 686507 C
686607 688295 C
688490 690127 D
690151 690489 D
690482 690799 D
690885 692645 D
692629 693528 D
693554 694696 D
694693 695523 C
695631 696764 D
696751 697437 C
697571 698332 D
698400 699965 C
700052 700924 C
701014 701385 D
701395 701805 D
701825 702274 D
702283 702966 C
703009 703968 D
703931 704959 D
704949 705500 D
705571 706605 D
706673 709267 D
709274 710674 D
710686 711171 D
711211 711651 D
711692 712207 C
712204 713250 C
713244 714107 C
714104 714766 C
715009 716619 D
716620 717771 D
717734 718669 D
718827 721088 D
721110 723020 D
723063 724130 C
724224 725447 D
725413 726495 D
726458 727753 D
727737 728675 D
728666 729619 D
729613 730506 D
730632 731099 C
731151 731720 D
731794 733803 D
733809 733922 D
734081 735289 D
735343 736686 D
736699 736959 D
736960 737208 D
737212 737712 D
737709 738428 D
738406 738771 D
738851 738964 D
739144 739683 D
739685 740176 D
740240 740422 D
740446 740688 D
740685 741425 D
741396 742628 C
742690 744516 D
744522 744845 D
745302 746333 D
746339 747910 D
747925 748119 D
748123 750018 D
750028 750789 D
751191 752159 D
752134 753219 D
753223 754068 D
754068 754550 D
754550 756349 D
756291 757670 D
757836 759581 D
759586 760215 D
760202 761647 D
761621 762154 C
762242 763573 D
763570 764361 D
764371 765342 D
765370 766716 D
766733 768067 C
768079 769470 C
769547 771145 C
771162 771563 C
771570 774368 C
774632 775462 D
775666 776679 C
776746 777573 D
777625 777768 D
777747 778754 D
778758 781385 D
781486 782073 C
782152 782829 C
782976 783257 C
783324 785021 D
785057 786754 D
786860 788962 D
789270 789938 D
789947 790807 C
790807 791787 C
791794 792252 C
792333 793625 D
793693 793836 D
793842 794915 C
794875 796383 C
796388 797122 C
797119 798048 C
798057 799016 C
799208 800275 C
800452 801072 D
800996 801778 D
801941 802798 C
802838 803212 C
803278 804165 D
804240 804353 C
804417 805778 C
805775 806923 C
806920 807966 C
807976 808464 C
808461 809552 C
809701 810495 C
810470 811510 C
811507 812388 C
812439 813239 C
813690 814697 C
814868 815302 C
815502 816299 C
816312 817214 C
817393 817956 D
818018 818548 D
818605 818916 D
818922 819242 D
819242 819487 D
819542 820528 D
820568 821188 D
821185 822369 D
822335 822694 D
822810 823103 D
823167 823811 D
823816 824382 D
824382 825704 D
825701 827620 D
827625 829112 D
829218 830321 D
830318 830941 C
830955 831728 C
831646 836043 D
836061 838526 D
838523 839080 D
839244 841832 D
841834 842451 D
842501 842989 D
843003 844451 D
844454 847102 D
847105 847488 D
847491 848339 D
848538 848804 D
848819 850987 D
850994 852514 D
852489 853778 D
853775 854842 D
854869 855996 D
855971 857509 D
857506 858915 D
858939 860111 C
860186 860362 D
860440 861774 D
861784 862677 D
862696 863646 D
863636 865042 D
865053 865919 D
865916 866458 D
866494 866694 D
866681 867601 D
867605 867700 D
867743 868114 C
868189 868740 D
868733 869515 C
869508 870023 C
870112 872583 C
872586 875132 C
875207 876448 D
876429 879281 D
879303 880250 D
880267 881091 C
881085 884213 C
884228 886447 C
886470 888182 C
888297 890318 D
890322 893174 D
893129 896569 D
897096 897740 C
897704 899320 C
899499 900731 D
900796 901782 D
901810 903258 D
903929 904900 C
905120 905227 D
905752 905865 C
905839 905946 D
905928 906032 D
906162 906263 D
907935 908081 D
908407 909591 D
+927
View File
@@ -0,0 +1,927 @@
# input : borbu1.fst
# include : <none>
# selector : count
# mixer : basic
# distance : chi
# phase : 7
# alphabet : ACGT
# excluded : X
# seqname : borbu1
# seqlength : 910724
# unmasked : 910724
# valid : 910681
# window : 227680
# step : 1000
#
# pos LeftA RightA LeftC
1 36566 44476 13342 18949
1001 36655 44524 13339 18989
2001 36782 44547 13364 18962
3001 36858 44580 13415 18951
4001 37042 44544 13413 19003
5001 37142 44434 13449 19062
6001 37169 44406 13498 19085
7001 37270 44326 13557 19097
8001 37350 44361 13624 19095
9001 37490 44294 13596 19130
10001 37685 44156 13595 19223
11001 37856 44039 13616 19296
12001 37999 43953 13627 19316
13001 38183 43804 13615 19393
14001 38354 43662 13612 19477
15001 38499 43597 13580 19499
16001 38618 43545 13630 19522
17001 38733 43519 13644 19561
18001 38821 43555 13691 19562
19001 38914 43623 13756 19502
20001 38997 43648 13772 19512
21001 39060 43694 13800 19517
22001 39024 43853 13901 19448
23001 39089 43809 13992 19469
24001 39182 43772 14043 19474
25001 39136 43869 14174 19413
26001 39122 43859 14280 19413
27001 39222 43861 14291 19445
28001 39293 43803 14333 19478
29001 39315 43737 14433 19504
30001 39438 43681 14438 19496
31001 39538 43610 14449 19529
32001 39613 43536 14519 19577
33001 39628 43599 14582 19577
34001 39659 43600 14655 19583
35001 39668 43582 14731 19583
36001 39687 43550 14826 19595
37001 39731 43486 14903 19605
38001 39764 43521 14956 19608
39001 39817 43536 15005 19611
40001 39896 43487 15067 19651
41001 39988 43397 15092 19711
42001 40046 43362 15156 19736
43001 40058 43363 15239 19739
44001 40030 43469 15307 19699
45001 40047 43557 15341 19666
46001 40116 43543 15419 19639
47001 40081 43661 15506 19579
48001 40077 43708 15542 19583
49001 40072 43692 15558 19582
50001 40160 43643 15578 19604
51001 40169 43648 15668 19572
52001 40125 43775 15810 19510
53001 40112 43869 15910 19467
54001 40149 43910 15984 19425
55001 40164 43887 16083 19445
56001 40209 43936 16151 19406
57001 40231 44014 16226 19381
58001 40357 43954 16265 19391
59001 40386 43993 16310 19369
60001 40458 44005 16377 19346
61001 40528 44049 16477 19328
62001 40558 44072 16546 19329
63001 40627 44134 16617 19291
64001 40798 44057 16647 19336
65001 40948 43949 16669 19414
66001 40975 43930 16708 19421
67001 41028 43833 16772 19456
68001 41181 43686 16801 19536
69001 41251 43635 16850 19589
70001 41263 43701 16901 19574
71001 41310 43708 16933 19572
72001 41535 43641 16926 19603
73001 41741 43566 16932 19642
74001 41932 43511 16947 19656
75001 42172 43400 16929 19704
76001 42364 43215 16881 19800
77001 42578 43156 16880 19806
78001 42757 43212 16867 19809
79001 42790 43225 16929 19817
80001 42882 43187 16948 19844
81001 42915 43228 16981 19867
82001 42942 43251 17022 19860
83001 43037 43266 17074 19844
84001 43090 43353 17169 19805
85001 43194 43474 17233 19713
86001 43268 43588 17264 19670
87001 43417 43555 17241 19703
88001 43542 43558 17317 19668
89001 43680 43559 17333 19678
90001 43752 43652 17386 19651
91001 43831 43757 17452 19569
92001 43833 43865 17543 19497
93001 43844 43958 17634 19420
94001 43799 44055 17722 19357
95001 43852 44114 17775 19322
96001 43846 44246 17828 19278
97001 43841 44335 17852 19262
98001 43902 44417 17918 19210
99001 43941 44475 17946 19205
100001 44030 44507 17980 19270
101001 44182 44513 17993 19321
102001 44291 44604 18064 19272
103001 44308 44739 18198 19199
104001 44308 44889 18291 19106
105001 44372 44984 18308 19109
106001 44477 44969 18363 19115
107001 44485 45057 18438 19066
108001 44549 45087 18470 19009
109001 44604 45113 18503 19027
110001 44660 45136 18585 19035
111001 44599 45193 18656 19067
112001 44502 45187 18741 19074
113001 44415 45197 18858 19075
114001 44485 45094 18977 19045
115001 44516 45064 18984 19031
116001 44561 45065 18953 19020
117001 44572 45038 18966 19011
118001 44528 44986 19009 19010
119001 44414 45104 19077 18956
120001 44401 45231 19089 18880
121001 44337 45312 19096 18821
122001 44354 45295 19091 18814
123001 44279 45303 19152 18807
124001 44139 45330 19228 18805
125001 44019 45370 19298 18749
126001 43930 45405 19316 18757
127001 43787 45422 19408 18728
128001 43630 45481 19490 18699
129001 43581 45506 19507 18689
130001 43556 45543 19533 18665
131001 43521 45571 19566 18653
132001 43578 45578 19558 18643
133001 43623 45511 19509 18635
134001 43646 45500 19509 18618
135001 43718 45494 19513 18595
136001 43852 45463 19440 18609
137001 43806 45500 19471 18563
138001 43800 45451 19465 18616
139001 43876 45530 19401 18580
140001 43862 45625 19423 18523
141001 43859 45622 19446 18510
142001 43805 45662 19479 18464
143001 43751 45712 19499 18413
144001 43671 45774 19511 18391
145001 43593 45806 19550 18376
146001 43530 45880 19580 18312
147001 43592 45911 19598 18292
148001 43589 45909 19579 18312
149001 43564 45960 19587 18323
150001 43552 45945 19602 18296
151001 43517 46025 19598 18269
152001 43515 46101 19610 18240
153001 43540 46148 19614 18223
154001 43462 46185 19655 18215
155001 43380 46225 19719 18197
156001 43375 46347 19733 18125
157001 43364 46358 19735 18115
158001 43490 46270 19694 18175
159001 43566 46243 19661 18197
160001 43580 46185 19615 18250
161001 43660 46190 19565 18252
162001 43694 46190 19582 18266
163001 43712 46199 19571 18241
164001 43636 46245 19614 18200
165001 43689 46178 19562 18241
166001 43800 46088 19500 18251
167001 43870 46059 19463 18311
168001 43911 46001 19423 18355
169001 43885 45982 19445 18357
170001 43959 45893 19397 18406
171001 44006 45818 19377 18450
172001 43971 45796 19385 18496
173001 44007 45787 19358 18545
174001 44011 45883 19348 18515
175001 44063 45905 19328 18497
176001 44083 45878 19326 18474
177001 44130 45781 19291 18529
178001 44037 45755 19359 18521
179001 43960 45761 19411 18517
180001 43911 45752 19423 18572
181001 43818 45755 19476 18583
182001 43667 45746 19549 18567
183001 43657 45696 19582 18555
184001 43692 45610 19579 18561
185001 43694 45546 19579 18638
186001 43627 45399 19607 18708
187001 43583 45286 19638 18767
188001 43480 45180 19680 18827
189001 43361 45166 19725 18853
190001 43213 45187 19800 18851
191001 43168 45074 19811 18932
192001 43207 44949 19813 19001
193001 43238 44930 19811 19010
194001 43210 44874 19834 19036
195001 43232 44713 19864 19138
196001 43244 44593 19853 19237
197001 43273 44579 19837 19238
198001 43389 44536 19784 19257
199001 43486 44516 19708 19330
200001 43604 44398 19660 19378
201001 43573 44364 19676 19382
202001 43555 44376 19676 19355
203001 43568 44407 19673 19339
204001 43678 44396 19643 19341
205001 43784 44380 19559 19364
206001 43896 44289 19474 19403
207001 43965 44265 19412 19420
208001 44063 44282 19351 19423
209001 44155 44314 19305 19425
210001 44264 44314 19282 19442
211001 44344 44236 19264 19492
212001 44429 44155 19202 19564
213001 44475 44100 19205 19559
214001 44513 44071 19284 19488
215001 44530 44074 19310 19429
216001 44625 44024 19266 19444
217001 44752 43935 19187 19467
218001 44927 43766 19096 19536
219001 44988 43679 19094 19570
220001 44986 43672 19102 19571
221001 45062 43648 19054 19605
222001 45096 43715 19004 19586
223001 45097 43727 19034 19567
224001 45143 43712 19033 19568
225001 45193 43749 19068 19492
226001 45191 43843 19070 19467
227001 45192 43910 19069 19409
228001 45079 43995 19046 19368
229001 45061 44004 19025 19362
230001 45070 44013 19011 19389
231001 45033 44022 19010 19363
232001 45001 44011 19000 19372
233001 45123 43969 18944 19398
234001 45250 43870 18869 19449
235001 45292 43797 18820 19496
236001 45290 43774 18824 19512
237001 45317 43817 18802 19505
238001 45336 43835 18789 19486
239001 45399 43816 18749 19497
240001 45407 43815 18756 19465
241001 45428 43859 18709 19457
242001 45485 43921 18698 19402
243001 45509 44016 18682 19368
244001 45553 44033 18665 19355
245001 45564 44111 18647 19311
246001 45554 44040 18646 19355
247001 45526 44054 18627 19362
248001 45487 44138 18620 19321
249001 45498 44160 18602 19322
250001 45480 44121 18610 19307
251001 45491 44241 18574 19257
252001 45446 44308 18615 19224
253001 45545 44203 18559 19260
254001 45639 44082 18520 19304
255001 45626 44029 18505 19331
256001 45670 44066 18445 19329
257001 45715 44041 18410 19336
258001 45781 44109 18395 19323
259001 45851 44109 18351 19333
260001 45866 44107 18318 19325
261001 45909 44083 18286 19331
262001 45915 44156 18302 19277
263001 45937 44198 18319 19246
264001 45964 44197 18291 19280
265001 46039 44082 18270 19327
266001 46119 43994 18235 19365
267001 46137 43900 18229 19405
268001 46187 43859 18213 19454
269001 46231 43872 18191 19430
270001 46369 43759 18115 19490
271001 46336 43831 18132 19437
272001 46270 43887 18182 19414
273001 46237 43932 18209 19423
274001 46167 43951 18246 19417
275001 46187 43883 18256 19451
276001 46183 43912 18267 19458
277001 46233 43828 18225 19501
278001 46235 43823 18207 19517
279001 46151 43843 18243 19529
280001 46086 43811 18252 19550
281001 46056 43840 18315 19516
282001 45993 43882 18356 19491
283001 45981 43887 18359 19521
284001 45872 43849 18413 19530
285001 45815 43831 18449 19552
286001 45808 43738 18505 19583
287001 45787 43697 18542 19592
288001 45880 43551 18510 19661
289001 45885 43425 18498 19719
290001 45857 43397 18486 19758
291001 45780 43408 18526 19760
292001 45743 43399 18522 19785
293001 45766 43372 18522 19774
294001 45755 43327 18572 19780
295001 45758 43342 18589 19761
296001 45749 43348 18561 19761
297001 45690 43412 18558 19750
298001 45602 43498 18579 19724
299001 45526 43488 18648 19679
300001 45378 43599 18709 19609
301001 45241 43665 18801 19554
302001 45163 43685 18833 19565
303001 45170 43749 18855 19504
304001 45170 43800 18865 19456
305001 45042 43856 18943 19402
306001 44949 43885 19006 19371
307001 44955 43860 19004 19445
308001 44844 43893 19054 19417
309001 44685 44004 19148 19327
310001 44589 44051 19241 19234
311001 44551 44093 19250 19198
312001 44527 44087 19280 19163
313001 44499 44109 19340 19123
314001 44400 44171 19387 19089
315001 44376 44230 19377 19036
316001 44390 44215 19352 19027
317001 44418 44128 19327 19064
318001 44381 44081 19345 19083
319001 44381 44012 19373 19118
320001 44280 44049 19410 19096
321001 44253 44042 19427 19091
322001 44280 43879 19425 19192
323001 44336 43643 19413 19323
324001 44291 43426 19454 19439
325001 44226 43338 19504 19498
326001 44157 43221 19569 19587
327001 44088 43037 19566 19724
328001 44077 42921 19460 19805
329001 44057 42855 19432 19822
330001 44011 42824 19452 19822
331001 43931 42763 19472 19876
332001 43733 42643 19536 20001
333001 43683 42604 19566 20022
334001 43655 42632 19581 20030
335001 43677 42592 19596 20030
336001 43699 42611 19585 20012
337001 43724 42662 19564 19998
338001 43712 42611 19566 19971
339001 43752 42564 19491 20029
340001 43845 42466 19449 20068
341001 43930 42387 19403 20126
342001 43988 42313 19366 20193
343001 44000 42336 19367 20231
344001 43993 42381 19396 20222
345001 44046 42443 19352 20168
346001 44007 42436 19369 20103
347001 43936 42430 19412 20015
348001 43865 42379 19451 19953
349001 43769 42415 19498 19853
350001 43786 42402 19501 19765
351001 43831 42363 19492 19692
352001 43862 42323 19484 19617
353001 43779 42233 19494 19604
354001 43826 42127 19458 19603
355001 43862 42062 19450 19562
356001 43937 41894 19398 19573
357001 44030 41675 19355 19585
358001 44039 41579 19361 19532
359001 44113 41466 19296 19514
360001 44046 41387 19357 19441
361001 44051 41292 19358 19414
362001 44132 41204 19320 19371
363001 44157 41057 19315 19342
364001 44125 40916 19316 19344
365001 44270 40743 19236 19321
366001 44289 40683 19227 19267
367001 44189 40649 19279 19209
368001 44065 40636 19323 19134
369001 44027 40575 19332 19111
370001 44097 40473 19321 19090
371001 44040 40496 19347 19002
372001 44131 40322 19314 18971
373001 44128 40266 19324 18925
374001 44088 40247 19330 18877
375001 44102 40149 19328 18842
376001 44168 40050 19267 18769
377001 44202 40007 19250 18678
378001 44198 39940 19276 18632
379001 44065 39926 19330 18505
380001 43970 39847 19385 18427
381001 43884 39785 19426 18328
382001 43861 39798 19450 18229
383001 43866 39782 19439 18179
384001 43751 39747 19485 18113
385001 43844 39639 19435 18098
386001 43890 39552 19413 18091
387001 43936 39496 19423 18038
388001 43930 39439 19411 17985
389001 43892 39414 19458 17914
390001 43889 39393 19471 17824
391001 43830 39415 19521 17750
392001 43836 39397 19501 17694
393001 43831 39352 19538 17612
394001 43818 39419 19536 17511
395001 43851 39387 19512 17418
396001 43878 39410 19497 17323
397001 43882 39394 19520 17228
398001 43843 39486 19546 17132
399001 43811 39484 19557 17020
400001 43745 39489 19583 16893
401001 43688 39529 19600 16775
402001 43521 39537 19689 16661
403001 43429 39594 19727 16549
404001 43398 39661 19762 16403
405001 43414 39736 19768 16303
406001 43409 39832 19787 16173
407001 43337 39946 19783 16048
408001 43343 40026 19775 15923
409001 43353 40133 19754 15802
410001 43347 40149 19764 15711
411001 43439 40014 19743 15709
412001 43497 39949 19720 15654
413001 43498 39939 19678 15590
414001 43620 39834 19588 15564
415001 43657 39719 19560 15527
416001 43688 39619 19556 15513
417001 43775 39434 19495 15566
418001 43808 39317 19448 15595
419001 43874 39260 19404 15514
420001 43887 39225 19386 15420
421001 43852 39229 19458 15269
422001 43908 39143 19409 15194
423001 44018 39080 19305 15174
424001 44080 39020 19226 15132
425001 44081 38888 19190 15121
426001 44100 38738 19151 15129
427001 44126 38579 19119 15132
428001 44177 38474 19071 15096
429001 44224 38412 19029 15079
430001 44196 38380 19023 15015
431001 44108 38414 19069 14926
432001 44071 38426 19085 14850
433001 44023 38426 19109 14763
434001 44044 38410 19086 14752
435001 44015 38301 19103 14745
436001 43841 38331 19219 14645
437001 43606 38337 19337 14567
438001 43416 38368 19449 14476
439001 43331 38422 19508 14319
440001 43211 38470 19605 14160
441001 43000 38601 19749 13988
442001 42917 38591 19809 13899
443001 42848 38535 19816 13836
444001 42812 38405 19826 13761
445001 42735 38367 19897 13684
446001 42638 38392 20012 13525
447001 42628 38309 20017 13471
448001 42636 38220 20018 13417
449001 42589 38182 20022 13365
450001 42614 38073 20004 13338
451001 42672 37878 19993 13319
452001 42612 37773 19974 13287
453001 42541 37754 20044 13159
454001 42450 37722 20081 13069
455001 42394 37738 20135 12966
456001 42319 37786 20197 12857
457001 42349 37687 20238 12789
458001 42376 37551 20211 12767
459001 42434 37368 20162 12813
460001 42432 37280 20099 12868
461001 42438 37267 20000 12889
462001 42360 37283 19942 12921
463001 42407 37241 19831 13010
464001 42391 37239 19754 12994
465001 42353 37233 19684 12976
466001 42303 37258 19607 12986
467001 42215 37308 19602 12943
468001 42108 37378 19591 12935
469001 42041 37424 19562 12900
470001 41863 37508 19575 12859
471001 41642 37570 19577 12860
472001 41569 37576 19521 12854
473001 41432 37590 19500 12861
474001 41364 37601 19435 12829
475001 41286 37635 19399 12825
476001 41211 37599 19355 12858
477001 41044 37693 19345 12823
478001 40880 37773 19339 12789
479001 40728 37773 19309 12798
480001 40673 37766 19256 12805
481001 40658 37759 19201 12829
482001 40637 37835 19123 12815
483001 40569 37819 19105 12771
484001 40480 37794 19078 12804
485001 40466 37754 18998 12834
486001 40317 37731 18965 12860
487001 40242 37612 18928 12869
488001 40236 37531 18863 12877
489001 40152 37486 18824 12908
490001 40041 37531 18759 12937
491001 40006 37483 18667 12958
492001 39951 37414 18615 12971
493001 39904 37401 18499 13050
494001 39835 37425 18417 13052
495001 39792 37457 18305 13077
496001 39793 37381 18224 13065
497001 39780 37407 18160 13034
498001 39729 37364 18107 13016
499001 39620 37340 18105 12998
500001 39540 37273 18082 12989
501001 39471 37237 18035 13008
502001 39428 37116 17971 13073
503001 39410 37047 17900 13088
504001 39423 36921 17802 13129
505001 39427 36877 17732 13136
506001 39408 36853 17679 13127
507001 39369 36900 17603 13123
508001 39397 36821 17503 13158
509001 39380 36795 17408 13145
510001 39401 36748 17303 13155
511001 39419 36752 17211 13134
512001 39477 36698 17111 13152
513001 39467 36700 16997 13172
514001 39491 36657 16873 13231
515001 39529 36568 16765 13300
516001 39544 36570 16652 13311
517001 39612 36519 16530 13367
518001 39666 36478 16394 13406
519001 39755 36387 16286 13438
520001 39849 36332 16157 13453
521001 39963 36295 16033 13467
522001 40049 36211 15891 13492
523001 40124 36105 15789 13551
524001 40135 36125 15721 13533
525001 40004 36135 15707 13531
526001 39957 36162 15644 13529
527001 39932 36212 15588 13521
528001 39820 36261 15554 13530
529001 39719 36313 15532 13502
530001 39591 36370 15521 13460
531001 39402 36434 15582 13398
532001 39300 36494 15580 13383
533001 39242 36524 15519 13379
534001 39215 36474 15390 13398
535001 39205 36473 15261 13439
536001 39136 36462 15198 13493
537001 39064 36372 15169 13503
538001 38989 36315 15127 13562
539001 38878 36283 15127 13593
540001 38696 36281 15140 13559
541001 38549 36324 15123 13537
542001 38478 36352 15091 13545
543001 38418 36369 15080 13543
544001 38374 36308 14996 13607
545001 38402 36218 14912 13654
546001 38428 36186 14837 13666
547001 38417 36091 14750 13755
548001 38384 36041 14744 13755
549001 38288 36066 14740 13735
550001 38321 36053 14637 13690
551001 38345 36042 14549 13621
552001 38388 36058 14451 13577
553001 38453 35991 14298 13591
554001 38488 35952 14123 13594
555001 38606 35873 13973 13591
556001 38572 35827 13884 13593
557001 38510 35813 13811 13632
558001 38392 35827 13755 13620
559001 38358 35822 13660 13623
560001 38391 35879 13509 13612
561001 38304 35943 13450 13575
562001 38216 35918 13424 13569
563001 38178 35861 13364 13569
564001 38042 35783 13331 13606
565001 37840 35806 13324 13624
566001 37749 35920 13268 13631
567001 37746 35907 13149 13699
568001 37720 35884 13052 13762
569001 37750 35826 12943 13788
570001 37788 35760 12832 13821
571001 37678 35677 12790 13830
572001 37517 35640 12766 13854
573001 37348 35664 12817 13813
574001 37269 35668 12865 13772
575001 37252 35660 12890 13785
576001 37269 35660 12925 13771
577001 37248 35672 13010 13687
578001 37234 35663 12999 13721
579001 37214 35633 12978 13726
580001 37254 35616 12981 13709
581001 37339 35631 12931 13723
582001 37385 35577 12938 13722
583001 37429 35528 12900 13711
584001 37528 35463 12845 13756
585001 37579 35487 12864 13744
586001 37568 35418 12836 13827
587001 37596 35349 12848 13850
588001 37611 35367 12822 13872
589001 37633 35293 12825 13879
590001 37597 35304 12861 13868
591001 37704 35301 12814 13886
592001 37780 35293 12791 13864
593001 37771 35295 12800 13882
594001 37757 35339 12810 13856
595001 37756 35378 12830 13823
596001 37825 35363 12807 13840
597001 37819 35394 12762 13829
598001 37793 35406 12813 13806
599001 37753 35414 12838 13790
600001 37727 35423 12865 13785
601001 37601 35468 12861 13819
602001 37523 35566 12882 13796
603001 37494 35596 12916 13763
604001 37520 35563 12944 13771
605001 37473 35566 12960 13771
606001 37422 35621 12993 13761
607001 37398 35683 13061 13730
608001 37446 35670 13054 13750
609001 37443 35705 13078 13768
610001 37397 35712 13052 13796
611001 37391 35670 13017 13855
612001 37351 35699 13002 13870
613001 37326 35703 12997 13857
614001 37278 35717 12985 13854
615001 37217 35767 13027 13808
616001 37102 35811 13072 13787
617001 37023 35835 13105 13791
618001 36902 35905 13139 13765
619001 36869 35944 13136 13787
620001 36861 35954 13126 13775
621001 36896 35915 13121 13763
622001 36814 35966 13149 13722
623001 36793 35996 13150 13723
624001 36752 36006 13151 13715
625001 36752 36005 13128 13722
626001 36701 36052 13158 13665
627001 36704 36079 13174 13635
628001 36647 36122 13241 13576
629001 36564 36147 13303 13519
630001 36563 36152 13316 13488
631001 36502 36163 13385 13417
632001 36466 36123 13396 13435
633001 36369 36134 13445 13428
634001 36328 36097 13455 13425
635001 36278 36106 13478 13406
636001 36192 36153 13502 13421
637001 36098 36239 13559 13389
638001 36147 36188 13520 13417
639001 36141 36224 13524 13400
640001 36173 36194 13535 13418
641001 36204 36148 13534 13413
642001 36269 36157 13540 13414
643001 36316 36190 13501 13380
644001 36358 36165 13449 13344
645001 36462 36175 13373 13353
646001 36494 36201 13382 13336
647001 36519 36230 13380 13334
648001 36455 36295 13417 13309
649001 36442 36260 13444 13282
650001 36456 36256 13500 13250
651001 36361 36337 13523 13234
652001 36306 36386 13574 13169
653001 36282 36440 13588 13166
654001 36274 36409 13549 13219
655001 36337 36331 13534 13278
656001 36340 36264 13551 13296
657001 36363 36189 13553 13338
658001 36278 36178 13612 13323
659001 36197 36150 13647 13361
660001 36172 36049 13685 13395
661001 36068 36112 13760 13323
662001 36063 36075 13748 13312
663001 36067 36037 13717 13318
664001 36053 36083 13687 13306
665001 36054 36169 13607 13302
666001 36052 36199 13574 13307
667001 35985 36246 13600 13310
668001 35926 36353 13606 13288
669001 35863 36374 13591 13306
670001 35817 36431 13599 13318
671001 35830 36496 13645 13302
672001 35822 36525 13610 13312
673001 35827 36622 13628 13247
674001 35891 36657 13600 13246
675001 35939 36728 13579 13249
676001 35912 36812 13576 13239
677001 35846 36866 13580 13244
678001 35775 36944 13603 13241
679001 35815 36988 13621 13206
680001 35917 36997 13644 13183
681001 35903 36967 13719 13155
682001 35877 36979 13766 13147
683001 35813 37013 13797 13149
684001 35742 37038 13813 13160
685001 35702 37008 13824 13191
686001 35659 37027 13851 13177
687001 35674 37023 13805 13206
688001 35651 37064 13778 13180
689001 35675 37056 13781 13190
690001 35667 37027 13746 13188
691001 35676 36963 13685 13224
692001 35645 36926 13727 13264
693001 35632 36866 13726 13307
694001 35630 36812 13709 13301
695001 35616 36783 13728 13322
696001 35571 36788 13709 13332
697001 35504 36746 13732 13371
698001 35460 36719 13755 13420
699001 35478 36687 13760 13402
700001 35398 36682 13841 13361
701001 35337 36680 13860 13356
702001 35360 36657 13873 13380
703001 35304 36641 13875 13426
704001 35303 36606 13871 13456
705001 35303 36588 13885 13465
706001 35286 36597 13872 13451
707001 35282 36576 13878 13449
708001 35371 36533 13842 13457
709001 35367 36566 13828 13418
710001 35389 36514 13835 13434
711001 35389 36535 13826 13445
712001 35395 36571 13806 13416
713001 35423 36542 13783 13460
714001 35431 36567 13790 13481
715001 35478 36619 13806 13444
716001 35586 36598 13782 13427
717001 35579 36596 13767 13432
718001 35561 36597 13771 13425
719001 35566 36681 13757 13392
720001 35624 36709 13755 13362
721001 35688 36703 13738 13341
722001 35682 36708 13752 13342
723001 35722 36694 13766 13287
724001 35694 36732 13810 13259
725001 35652 36736 13862 13226
726001 35714 36736 13871 13227
727001 35704 36811 13858 13221
728001 35739 36797 13848 13242
729001 35785 36834 13795 13212
730001 35802 36910 13799 13185
731001 35842 36971 13786 13158
732001 35909 37005 13774 13195
733001 35948 36982 13785 13222
734001 35941 37022 13768 13226
735001 35919 37057 13762 13202
736001 35967 37028 13723 13224
737001 36011 36975 13719 13255
738001 36000 37007 13725 13230
739001 35985 36979 13718 13249
740001 36052 36964 13652 13269
741001 36080 36915 13630 13286
742001 36120 36929 13569 13312
743001 36128 36909 13531 13335
744001 36159 36855 13477 13341
745001 36154 36871 13419 13365
746001 36124 36853 13432 13384
747001 36125 36797 13438 13364
748001 36091 36723 13425 13389
749001 36117 36717 13402 13421
750001 36161 36688 13430 13393
751001 36241 36628 13401 13387
752001 36208 36624 13410 13386
753001 36216 36652 13406 13364
754001 36201 36707 13416 13353
755001 36146 36663 13417 13373
756001 36167 36594 13407 13371
757001 36188 36579 13363 13382
758001 36170 36560 13345 13421
759001 36168 36484 13358 13437
760001 36192 36412 13332 13477
761001 36249 36283 13330 13523
762001 36285 36293 13304 13532
763001 36249 36312 13286 13545
764001 36271 36391 13254 13511
765001 36343 36486 13220 13489
766001 36404 36476 13160 13505
767001 36440 36473 13174 13465
768001 36402 36479 13228 13442
769001 36315 36478 13275 13429
770001 36256 36454 13297 13454
771001 36196 36435 13339 13435
772001 36177 36425 13318 13452
773001 36128 36439 13381 13398
774001 36046 36434 13377 13383
775001 36111 36440 13332 13393
776001 36073 36467 13299 13412
777001 36027 36594 13307 13368
778001 36098 36590 13309 13380
779001 36154 36602 13302 13390
780001 36216 36632 13304 13383
781001 36278 36605 13304 13388
782001 36348 36652 13288 13403
783001 36383 36666 13303 13398
784001 36427 36637 13319 13409
785001 36494 36557 13300 13417
786001 36536 36562 13311 13397
787001 36617 36544 13238 13422
788001 36673 36482 13250 13435
789001 36743 36359 13248 13450
790001 36809 36354 13231 13433
791001 36889 36279 13245 13487
792001 36951 36281 13237 13487
793001 36991 36278 13202 13460
794001 36987 36332 13178 13456
795001 36977 36461 13145 13422
796001 36975 36590 13152 13358
797001 37017 36576 13154 13331
798001 37042 36669 13171 13334
799001 37007 36783 13203 13361
800001 37023 36875 13175 13427
801001 37035 37050 13199 13418
802001 37059 37164 13182 13445
803001 37043 37182 13203 13500
804001 37024 37282 13190 13562
805001 36947 37372 13228 13627
806001 36917 37506 13279 13592
807001 36869 37698 13301 13604
808001 36784 37880 13310 13626
809001 36787 38024 13327 13626
810001 36775 38201 13342 13608
811001 36753 38381 13365 13605
812001 36703 38522 13411 13592
813001 36674 38618 13392 13634
814001 36682 38743 13361 13654
815001 36679 38839 13351 13698
816001 36655 38924 13385 13761
817001 36625 39023 13444 13759
818001 36620 39050 13459 13804
819001 36604 39027 13465 13914
820001 36589 39107 13454 13997
821001 36566 39179 13453 14051
822001 36536 39136 13451 14190
823001 36563 39123 13419 14279
824001 36521 39225 13440 14299
825001 36540 39296 13440 14347
826001 36573 39330 13421 14434
827001 36547 39436 13465 14445
828001 36585 39545 13480 14448
829001 36616 39621 13437 14535
830001 36580 39631 13433 14576
831001 36596 39654 13433 14675
832001 36613 39663 13404 14754
833001 36684 39685 13380 14838
834001 36705 39735 13361 14909
835001 36705 39779 13344 14963
836001 36701 39836 13329 15010
837001 36697 39910 13277 15076
838001 36728 40008 13250 15095
839001 36747 40027 13223 15183
840001 36760 40057 13223 15247
841001 36818 40030 13222 15308
842001 36802 40055 13226 15348
843001 36856 40109 13202 15439
844001 36885 40098 13195 15514
845001 36986 40064 13166 15541
846001 37007 40067 13196 15562
847001 36977 40170 13224 15578
848001 37014 40164 13237 15684
849001 37032 40134 13216 15820
850001 37030 40117 13235 15908
851001 36986 40139 13252 15992
852001 37010 40179 13232 16087
853001 36984 40203 13260 16163
854001 36946 40243 13277 16233
855001 36921 40367 13284 16269
856001 36944 40379 13310 16321
857001 36897 40471 13337 16387
858001 36849 40531 13350 16482
859001 36898 40561 13354 16555
860001 36844 40647 13378 16620
861001 36782 40816 13374 16640
862001 36723 40938 13394 16680
863001 36695 40986 13420 16719
864001 36665 41055 13400 16769
865001 36638 41193 13373 16807
866001 36621 41250 13382 16852
867001 36687 41267 13351 16904
868001 36693 41337 13362 16931
869001 36655 41559 13391 16918
870001 36590 41740 13367 16942
871001 36585 41968 13392 16942
872001 36531 42204 13427 16922
873001 36477 42391 13445 16879
874001 36414 42603 13474 16873
875001 36270 42774 13522 16873
876001 36298 42787 13538 16934
877001 36326 42891 13539 16953
878001 36410 42932 13513 16980
879001 36491 42940 13492 17035
880001 36486 43037 13498 17089
881001 36493 43088 13456 17181
882001 36493 43190 13429 17244
883001 36473 43283 13428 17259
884001 36445 43430 13459 17254
885001 36433 43559 13434 17322
886001 36424 43694 13459 17331
887001 36454 43751 13396 17385
888001 36420 43833 13368 17465
889001 36430 43830 13386 17566
890001 36483 43847 13405 17641
891001 36604 43805 13366 17731
892001 36580 43843 13390 17782
893001 36585 43848 13395 17832
894001 36640 43862 13386 17854
895001 36631 43887 13394 17925
896001 36647 43958 13406 17947
897001 36678 44034 13383 17989
898001 36627 44188 13420 17998
899001 36559 44298 13420 18077
900001 36551 44333 13404 18203
901001 36552 44302 13423 18294
902001 36454 44375 13436 18320
903001 36354 44481 13430 18368
904001 36361 44481 13434 18448
905001 36283 44559 13494 18480
906001 36286 44632 13483 18514
907001 36280 44652 13465 18586
908001 36335 44596 13458 18663
909001 36476 44490 13410 18761
910001 36580 44431 13351 18869
+924
View File
@@ -0,0 +1,924 @@
# input : borbu1.fst
# include : <none>
# selector : count
# distance : chi
# phase : 7
# alphabet : ACGT
# seqname : borbu1
# seqlength : 910724
# unmasked : 910681
# window : 227680
# step : 1000
#
# pos LeftA RightA LeftC RightC LeftG RightG LeftT RightX chiACGT/not*s chiA chiC chiG chiT
1 36566 44476 13342 18949 18446 13078 45482 37333 58.8352 27.7857 31.2025 -30.2337 -28.3172
1001 36655 44524 13339 18989 18400 13116 45442 37207 58.7935 27.6183 31.4238 -29.7644 -28.6447
2001 36782 44547 13364 18962 18360 13151 45330 37176 58.1183 27.2282 31.1356 -29.3443 -28.3876
3001 36858 44580 13415 18951 18332 13135 45231 37170 57.6715 27.0593 30.7717 -29.2971 -28.0817
4001 37042 44544 13413 19003 18275 13135 45106 37154 57.1282 26.2645 31.0479 -29.0021 -27.7257
5001 37142 44434 13449 19062 18276 13084 44969 37256 56.6039 25.5309 31.1301 -29.3188 -26.8981
6001 37169 44406 13498 19085 18259 13071 44910 37274 56.2905 25.3384 30.9516 -29.3103 -26.6362
7001 37270 44326 13557 19097 18246 13048 44763 37365 55.4966 24.7015 30.6578 -29.3836 -25.8148
8001 37350 44361 13624 19095 18202 13048 44662 37332 54.9699 24.5292 30.2475 -29.1539 -25.5959
9001 37490 44294 13596 19130 18174 13026 44578 37386 54.6109 23.7945 30.5925 -29.1433 -25.1186
10001 37685 44156 13595 19223 18183 12999 44375 37458 54.0676 22.6222 31.0685 -29.3555 -24.1773
11001 37856 44039 13616 19296 18200 12945 44166 37556 53.5572 21.6083 31.3107 -29.7753 -23.1198
12001 37999 43953 13627 19316 18196 12894 44016 37673 53.0257 20.8009 31.3456 -30.0682 -22.1903
13001 38183 43804 13615 19393 18164 12882 43876 37757 52.4797 19.6334 31.8046 -29.976 -21.414
14001 38354 43662 13612 19477 18140 12883 43732 37814 51.9943 18.537 32.2439 -29.8451 -20.7215
15001 38499 43597 13580 19499 18134 12835 43625 37905 51.8044 17.7951 32.5457 -30.1098 -20.0301
16001 38618 43545 13630 19522 18109 12831 43481 37938 51.1894 17.1913 32.3615 -30.0045 -19.4234
17001 38733 43519 13644 19561 18110 12798 43351 37958 51.0247 16.6903 32.4729 -30.2135 -18.9105
18001 38821 43555 13691 19562 18098 12785 43228 37934 50.675 16.4966 32.1972 -30.2314 -18.5801
19001 38914 43623 13756 19502 18058 12789 43109 37923 49.933 16.391 31.5078 -30 -18.2181
20001 38997 43648 13772 19512 18018 12770 43050 37907 49.7284 16.1785 31.4626 -29.9091 -18.0755
21001 39060 43694 13800 19517 17962 12774 43015 37852 49.4553 16.1087 31.321 -29.5921 -18.1558
22001 39024 43853 13901 19448 17900 12771 43012 37765 49.0158 16.7741 30.375 -29.2866 -18.4615
23001 39089 43809 13992 19469 17761 12792 42995 37767 48.0812 16.3934 29.9415 -28.4277 -18.3964
24001 39182 43772 14043 19474 17702 12783 42910 37808 47.4363 15.9365 29.6652 -28.173 -17.9579
25001 39136 43869 14174 19413 17665 12748 42862 37807 46.8913 16.428 28.5866 -28.1949 -17.7979
26001 39122 43859 14280 19413 17601 12771 42834 37794 46.2121 16.4442 27.9641 -27.7147 -17.7496
27001 39222 43861 14291 19445 17526 12743 42798 37788 45.9748 16.0942 28.0606 -27.4917 -17.6485
28001 39293 43803 14333 19478 17461 12767 42750 37788 45.4127 15.6467 27.9814 -26.9977 -17.4834
29001 39315 43737 14433 19504 17377 12800 42712 37795 44.5834 15.3454 27.5277 -26.3469 -17.3281
30001 39438 43681 14438 19496 17266 12799 42695 37860 43.8681 14.7184 27.4583 -25.7616 -17.0341
31001 39538 43610 14449 19529 17167 12794 42683 37903 43.3672 14.1228 27.5599 -25.2632 -16.837
32001 39613 43536 14519 19577 17161 12763 42544 37960 42.9281 13.606 27.393 -25.4233 -16.1548
33001 39628 43599 14582 19577 17077 12780 42550 37880 42.5377 13.766 27.0269 -24.8673 -16.4655
34001 39659 43600 14655 19583 17064 12754 42459 37899 42.1615 13.6594 26.6336 -24.9589 -16.0848
35001 39668 43582 14731 19583 17048 12801 42390 37870 41.5803 13.5666 26.1938 -24.5813 -15.9535
36001 39687 43550 14826 19595 16976 12801 42348 37890 40.9033 13.3908 25.7057 -24.1937 -15.7368
37001 39731 43486 14903 19605 16946 12829 42257 37916 40.1799 13.0181 25.3126 -23.8584 -15.3299
38001 39764 43521 14956 19608 16881 12888 42237 37819 39.6863 13.0209 25.024 -23.1414 -15.6121
39001 39817 43536 15005 19611 16793 12941 42223 37748 39.0927 12.884 24.7579 -22.3373 -15.8219
40001 39896 43487 15067 19651 16711 12952 42164 37746 38.4774 12.4384 24.6035 -21.824 -15.6263
41001 39988 43397 15092 19711 16631 12967 42127 37761 38.0076 11.808 24.761 -21.2958 -15.4445
42001 40046 43362 15156 19736 16557 12996 42079 37742 37.3864 11.4843 24.5206 -20.7128 -15.3483
43001 40058 43363 15239 19739 16485 13033 42056 37701 36.761 11.4454 24.0627 -20.0907 -15.4182
44001 40030 43469 15307 19699 16431 13059 42070 37609 36.4418 11.9037 23.4759 -19.6344 -15.8013
45001 40047 43557 15341 19666 16335 13097 42115 37516 36.1046 12.1418 23.1174 -18.8726 -16.2951
46001 40116 43543 15419 19639 16282 13124 42021 37530 35.2283 11.8509 22.5398 -18.4144 -15.9204
47001 40081 43661 15506 19579 16205 13111 42046 37485 34.8423 12.3737 21.7464 -18.0689 -16.1706
48001 40077 43708 15542 19583 16098 13084 42121 37461 34.7336 12.5467 21.5632 -17.642 -16.5163
49001 40072 43692 15558 19582 16001 13086 42207 37476 34.5003 12.5103 21.4679 -17.0904 -16.7574
50001 40160 43643 15578 19604 15893 13078 42207 37511 33.9944 12.0341 21.4658 -16.537 -16.6297
51001 40169 43648 15668 19572 15811 13065 42190 37551 33.2853 12.0193 20.7982 -16.1582 -16.4255
52001 40125 43775 15810 19510 15767 13031 42136 37520 32.7692 12.6037 19.6892 -16.1211 -16.3528
53001 40112 43869 15910 19467 15688 13005 42128 37495 32.3446 12.9669 18.913 -15.8377 -16.4164
54001 40149 43910 15984 19425 15554 12996 42151 37505 31.6676 12.9747 18.288 -15.1375 -16.4591
55001 40164 43887 16083 19445 15473 13000 42118 37504 31.068 12.8442 17.8383 -14.6543 -16.3492
56001 40209 43936 16151 19406 15438 12993 42040 37501 30.5341 12.8508 17.2635 -14.499 -16.0916
57001 40231 44014 16226 19381 15402 13023 41979 37418 30.1752 13.0361 16.7215 -14.1091 -16.1842
58001 40357 43954 16265 19391 15346 13025 41870 37466 29.3576 12.3905 16.5564 -13.7782 -15.633
59001 40386 43993 16310 19369 15271 13006 41871 37468 29.0213 12.4199 16.1964 -13.468 -15.6292
60001 40458 44005 16377 19346 15223 13011 41780 37474 28.3366 12.2073 15.7102 -13.1629 -15.293
61001 40528 44049 16477 19328 15162 13005 41671 37454 27.6319 12.1096 15.0686 -12.8508 -14.9891
62001 40558 44072 16546 19329 15094 12990 41640 37444 27.2407 12.0831 14.6957 -12.5528 -14.9171
63001 40627 44134 16617 19291 15057 12991 41536 37420 26.6642 12.0471 14.1121 -12.3354 -14.6469
64001 40798 44057 16647 19336 15048 12960 41344 37483 25.9016 11.1891 14.1765 -12.4757 -13.7506
65001 40948 43949 16669 19414 15080 12933 41140 37540 25.3806 10.3009 14.4516 -12.8271 -12.833
66001 40975 43930 16708 19421 15082 12862 41072 37623 25.1813 10.1425 14.2741 -13.2796 -12.2935
67001 41028 43833 16772 19456 14983 12924 41054 37623 24.3537 9.63023 14.1022 -12.3246 -12.2307
68001 41181 43686 16801 19536 14900 12947 40955 37667 23.543 8.60009 14.3486 -11.7027 -11.725
69001 41251 43635 16850 19589 14830 12946 40906 37666 23.1134 8.18383 14.3494 -11.3036 -11.5575
70001 41263 43701 16901 19574 14756 12997 40917 37564 22.8163 8.36533 13.9968 -10.558 -11.9676
71001 41310 43708 16933 19572 14758 13002 40836 37554 22.5145 8.22549 13.8131 -10.5386 -11.7209
72001 41535 43641 16926 19603 14711 13054 40665 37538 21.7296 7.21734 14.0073 -9.94355 -11.1807
73001 41741 43566 16932 19642 14721 13076 40443 37552 21.0797 6.24971 14.1713 -9.86586 -10.3505
74001 41932 43511 16947 19656 14716 13066 40242 37603 20.4238 5.40315 14.1604 -9.89852 -9.45731
75001 42172 43400 16929 19704 14682 13049 40054 37683 19.9076 4.1992 14.4995 -9.80553 -8.50266
76001 42364 43215 16881 19800 14661 13045 39931 37775 19.8702 2.91158 15.2427 -9.7071 -7.73187
77001 42578 43156 16880 19806 14619 13017 39760 37856 19.4124 1.97658 15.2782 -9.63517 -6.83181
78001 42757 43212 16867 19809 14580 13004 39633 37810 19.2707 1.55439 15.3638 -9.4877 -6.54837
79001 42790 43225 16929 19817 14541 12992 39577 37801 18.8968 1.48578 15.0675 -9.33377 -6.38217
80001 42882 43187 16948 19844 14460 12987 39547 37817 18.6218 1.0422 15.0998 -8.88964 -6.21737
81001 42915 43228 16981 19867 14425 13019 39516 37721 18.4641 1.06901 15.0362 -8.48569 -6.45637
82001 42942 43251 17022 19860 14431 13014 39442 37709 18.2092 1.05636 14.7802 -8.55121 -6.23553
83001 43037 43266 17074 19844 14373 13014 39353 37710 17.6326 0.783371 14.4191 -8.20979 -5.91489
84001 43090 43353 17169 19805 14316 13043 39261 37634 16.8044 0.895823 13.7096 -7.6955 -5.86608
85001 43194 43474 17233 19713 14309 13005 39100 37643 16.0403 0.952407 12.9032 -7.88941 -5.25823
86001 43268 43588 17264 19670 14259 12972 39045 37604 15.679 1.08839 12.5211 -7.79769 -5.20246
87001 43417 43555 17241 19703 14226 12974 38952 37602 15.6756 0.470522 12.8107 -7.58992 -4.87679
88001 43542 43558 17317 19668 14221 12960 38756 37648 14.9672 0.0567954 12.2264 -7.64717 -4.00607
89001 43680 43559 17333 19678 14184 12980 38638 37618 14.6886 -0.409666 12.1893 -7.30516 -3.69371
90001 43752 43652 17386 19651 14180 13011 38517 37521 14.2104 -0.338247 11.7693 -7.08928 -3.61197
91001 43831 43757 17452 19569 14179 13013 38373 37496 13.4632 -0.25004 11.0026 -7.07095 -3.18396
92001 43833 43865 17543 19497 14164 13037 38295 37436 12.6305 0.108058 10.1529 -6.83332 -3.12145
93001 43844 43958 17634 19420 14070 13066 38288 37391 11.5763 0.38604 9.27905 -6.09409 -3.25944
94001 43799 44055 17722 19357 13984 13098 38331 37325 10.7333 0.864994 8.49175 -5.38313 -3.65622
95001 43852 44114 17775 19322 13890 13118 38319 37281 10.0802 0.884687 8.0328 -4.69682 -3.77396
96001 43846 44246 17828 19278 13798 13147 38364 37164 9.65777 1.34901 7.52826 -3.96518 -4.36523
97001 43841 44335 17852 19262 13715 13151 38428 37086 9.59294 1.66621 7.32067 -3.43951 -4.88117
98001 43902 44417 17918 19210 13652 13170 38364 37037 8.94307 1.73553 6.70689 -2.94164 -4.83021
99001 43941 44475 17946 19205 13628 13193 38321 36961 8.80426 1.79848 6.5336 -2.65471 -4.9543
100001 44030 44507 17980 19270 13653 13148 38173 36909 8.83394 1.60568 6.68554 -3.08329 -4.61056
101001 44182 44513 17993 19321 13630 13172 38031 36828 8.69813 1.11403 6.87652 -2.79614 -4.39447
102001 44291 44604 18064 19272 13571 13217 37910 36741 7.948 1.05241 6.25347 -2.16145 -4.27615
103001 44308 44739 18198 19199 13552 13202 37778 36694 7.01691 1.44695 5.17795 -2.13837 -3.96983
104001 44308 44889 18291 19106 13471 13195 37766 36644 6.42813 1.94798 4.21613 -1.68874 -4.11079
105001 44372 44984 18308 19109 13336 13208 37820 36533 6.65081 2.04995 4.14263 -0.784221 -4.71748
106001 44477 44969 18363 19115 13214 13204 37782 36546 6.19294 1.64769 3.88615 -0.0601028 -4.53121
107001 44485 45057 18438 19066 13185 13238 37728 36473 5.9584 1.91415 3.2445 0.327474 -4.60484
108001 44549 45087 18470 19009 13205 13240 37612 36498 5.26994 1.7996 2.78586 0.21665 -4.08972
109001 44604 45113 18503 19027 13215 13249 37514 36445 5.06941 1.70197 2.70654 0.210425 -3.92842
110001 44660 45136 18585 19035 13191 13289 37400 36374 4.74739 1.5911 2.32178 0.603661 -3.77505
111001 44599 45193 18656 19067 13183 13303 37398 36271 5.11783 1.98492 2.11781 0.738774 -4.14986
112001 44502 45187 18741 19074 13137 13329 37456 36244 5.43031 2.28991 1.71413 1.18163 -4.46207
113001 44415 45197 18858 19075 13074 13355 37489 36207 5.77533 2.61492 1.11587 1.72991 -4.72005
114001 44485 45094 18977 19045 13079 13332 37295 36363 4.29862 2.03738 0.350443 1.55821 -3.43167
115001 44516 45064 18984 19031 13119 13315 37217 36424 3.66103 1.83357 0.242768 1.20695 -2.91985
116001 44561 45065 18953 19020 13155 13308 37167 36441 3.31626 1.68613 0.345536 0.941955 -2.67355
117001 44572 45038 18966 19011 13145 13344 37153 36441 3.29546 1.55934 0.232626 1.22413 -2.6222
118001 44528 44986 19009 19010 13134 13339 37165 36499 3.15471 1.53343 0.00683848 1.26137 -2.45146
119001 44414 45104 19077 18956 13069 13368 37276 36406 4.39973 2.3088 -0.61874 1.84035 -3.2027
120001 44401 45231 19089 18880 13061 13398 37285 36325 5.06444 2.77496 -1.07088 2.0732 -3.53599
121001 44337 45312 19096 18821 13043 13436 37360 36265 5.8921 3.25898 -1.41056 2.41656 -4.03317
122001 44354 45295 19091 18814 13045 13451 37346 36274 5.80795 3.14542 -1.42106 2.49565 -3.94853
123001 44279 45303 19152 18807 13013 13494 37392 36230 6.47375 3.42391 -1.76906 2.9558 -4.28018
124001 44139 45330 19228 18805 12993 13484 37476 36215 7.15839 3.98439 -2.16729 3.01892 -4.64285
125001 44019 45370 19298 18749 12931 13484 37588 36231 8.05375 4.52131 -2.81286 3.40394 -4.99216
126001 43930 45405 19316 18757 12883 13489 37707 36183 8.82718 4.93755 -2.86315 3.73307 -5.60412
127001 43787 45422 19408 18728 12880 13508 37761 36176 9.54015 5.47673 -3.48039 3.86737 -5.82668
128001 43630 45481 19490 18699 12877 13497 37839 36157 10.375 6.20332 -4.04598 3.81914 -6.18094
129001 43581 45506 19507 18689 12835 13523 37913 36116 10.986 6.45207 -4.18376 4.23914 -6.60222
130001 43556 45543 19533 18665 12823 13562 37924 36064 11.4671 6.65935 -4.43948 4.55095 -6.83566
131001 43521 45571 19566 18653 12787 13567 37962 36043 11.9091 6.87068 -4.66844 4.80618 -7.05176
132001 43578 45578 19558 18643 12785 13544 37915 36069 11.607 6.70076 -4.67978 4.67903 -6.78438
133001 43623 45511 19509 18635 12788 13636 37917 36052 11.5868 6.32775 -4.47248 5.21884 -6.85374
134001 43646 45500 19509 18618 12774 13747 37908 35969 12.0818 6.21345 -4.56054 5.97686 -7.13026
135001 43718 45494 19513 18595 12764 13775 37842 35970 11.9775 5.95001 -4.69999 6.2081 -6.88679
136001 43852 45463 19440 18609 12778 13791 37767 35971 11.3831 5.39448 -4.25763 6.21686 -6.61038
137001 43806 45500 19471 18563 12792 13790 37768 35981 11.6008 5.6725 -4.6533 6.12335 -6.57675
138001 43800 45451 19465 18616 12778 13798 37794 35969 11.5659 5.53031 -4.34808 6.25898 -6.71604
139001 43876 45530 19401 18580 12754 13806 37806 35918 11.7628 5.53555 -4.21013 6.45722 -6.94984
140001 43862 45625 19423 18523 12767 13795 37785 35891 12.0231 5.89742 -4.61763 6.30972 -6.97421
141001 43859 45622 19446 18510 12744 13809 37788 35893 12.2176 5.89762 -4.8018 6.53785 -6.97766
142001 43805 45662 19479 18464 12769 13804 37783 35905 12.4045 6.20972 -5.20989 6.34994 -6.91706
143001 43751 45712 19499 18413 12789 13862 37797 35848 12.9951 6.55757 -5.57667 6.57341 -7.18071
144001 43671 45774 19511 18391 12804 13928 37850 35742 13.7907 7.03303 -5.75204 6.87537 -7.76941
145001 43593 45806 19550 18376 12786 13985 37907 35668 14.5931 7.40274 -6.02751 7.32875 -8.25327
146001 43530 45880 19580 18312 12777 13984 37949 35659 15.1618 7.86045 -6.51311 7.37902 -8.43939
147001 43592 45911 19598 18292 12777 14019 37869 35612 15.2313 7.75405 -6.70765 7.58872 -8.32376
148001 43589 45909 19579 18312 12773 14020 37895 35593 15.253 7.75761 -6.50721 7.61969 -8.48937
149001 43564 45960 19587 18323 12795 13994 37890 35557 15.2984 8.01049 -6.49017 7.327 -8.60612
150001 43552 45945 19602 18296 12799 14006 37883 35587 15.3327 8.00167 -6.70694 7.37367 -8.46827
151001 43517 46025 19598 18269 12818 14005 37903 35535 15.6772 8.38397 -6.82788 7.24908 -8.7358
152001 43515 46101 19610 18240 12900 13946 37811 35547 15.3244 8.64107 -7.04015 6.38542 -8.3566
153001 43540 46148 19614 18223 12949 13922 37733 35541 15.0924 8.71106 -7.14932 5.93712 -8.0954
154001 43462 46185 19655 18215 12962 13961 37757 35472 15.6791 9.09846 -7.39715 6.09057 -8.44038
155001 43380 46225 19719 18197 12970 13950 37767 35461 16.1158 9.50814 -7.81378 5.9751 -8.51804
156001 43375 46347 19733 18125 12996 13912 37732 35449 16.4058 9.92593 -8.26176 5.58627 -8.43575
157001 43364 46358 19735 18115 13035 13892 37702 35468 16.2705 9.99938 -8.32432 5.22476 -8.25524
158001 43490 46270 19694 18175 13065 13885 37587 35503 15.2119 9.28299 -7.80321 4.99714 -7.70492
159001 43566 46243 19661 18197 13105 13838 37504 35555 14.4341 8.93676 -7.52167 4.46777 -7.20711
160001 43580 46185 19615 18250 13122 13785 37519 35613 13.8136 8.69863 -7.01222 4.04401 -7.04449
161001 43660 46190 19565 18252 13119 13800 37492 35591 13.5463 8.44431 -6.74927 4.15282 -7.02837
162001 43694 46190 19582 18266 13079 13832 37481 35545 13.6918 8.3293 -6.76192 4.59234 -7.16064
163001 43712 46199 19571 18241 13093 13827 37460 35566 13.5908 8.29804 -6.83714 4.47577 -7.00521
164001 43636 46245 19614 18200 13082 13852 37504 35536 14.2705 8.70636 -7.26893 4.69396 -7.27835
165001 43689 46178 19562 18241 13045 13891 37540 35523 14.0482 8.30674 -6.79167 5.15686 -7.45847
166001 43800 46088 19500 18251 13032 13861 37504 35633 13.1522 7.63536 -6.42577 5.05732 -6.91484
167001 43870 46059 19463 18311 13000 13835 37503 35628 12.7464 7.30349 -5.92474 5.0994 -6.92992
168001 43911 46001 19423 18355 12999 13829 37503 35648 12.3083 6.97401 -5.49224 5.06954 -6.85503
169001 43885 45982 19445 18357 12993 13848 37513 35646 12.455 6.99911 -5.59337 5.2209 -6.899
170001 43959 45893 19397 18406 12999 13834 37481 35700 11.7019 6.45591 -5.09439 5.09959 -6.58007
171001 44006 45818 19377 18450 13021 13836 37432 35729 11.1195 6.04985 -4.76371 4.97528 -6.29259
172001 43971 45796 19385 18496 13025 13862 37455 35679 11.2761 6.09516 -4.56507 5.10667 -6.5637
173001 44007 45787 19358 18545 13017 13856 37454 35645 11.1214 5.94407 -4.17337 5.1202 -6.68732
174001 44011 45883 19348 18515 13010 13871 37467 35564 11.5963 6.24761 -4.27837 5.25362 -7.03828
175001 44063 45905 19328 18497 13013 13908 37432 35523 11.648 6.14504 -4.27024 5.45694 -7.06416
176001 44083 45878 19326 18474 12998 13921 37428 35561 11.5941 5.98596 -4.38135 5.62637 -6.90941
177001 44130 45781 19291 18529 12999 13941 37416 35583 11.164 5.50869 -3.91657 5.74065 -6.78192
178001 44037 45755 19359 18521 12956 13948 37484 35610 11.6633 5.73591 -4.30395 6.04932 -6.92915
179001 43960 45761 19411 18517 12912 13949 37553 35607 12.2074 6.01528 -4.58876 6.32873 -7.19222
180001 43911 45752 19423 18572 12862 13965 37640 35545 12.7351 6.15081 -4.36411 6.73569 -7.74177
181001 43818 45755 19476 18583 12933 13954 37609 35542 12.6498 6.47466 -4.57573 6.22809 -7.64004
182001 43667 45746 19549 18567 12939 13943 37681 35578 13.0961 6.95534 -5.02817 6.12498 -7.76741
183001 43657 45696 19582 18555 12946 13919 37651 35664 12.778 6.82385 -5.25722 5.93779 -7.33603
184001 43692 45610 19579 18561 13011 13850 37554 35813 11.657 6.42089 -5.21093 5.12062 -6.42522
185001 43694 45546 19579 18638 13002 13785 37561 35865 11.1205 6.20219 -4.8118 4.78553 -6.25656
186001 43627 45399 19607 18708 13056 13726 37546 36001 10.2753 5.94151 -4.59106 4.09549 -5.69462
187001 43583 45286 19638 18767 13064 13703 37551 36078 9.8545 5.71528 -4.44279 3.90715 -5.4261
188001 43480 45180 19680 18827 13068 13715 37608 36112 9.87319 5.71194 -4.34517 3.95487 -5.50746
189001 43361 45166 19725 18853 13052 13740 37697 36076 10.4785 6.06652 -4.43963 4.20326 -5.96808
190001 43213 45187 19800 18851 13037 13761 37785 36036 11.3305 6.63928 -4.8271 4.4227 -6.43724
191001 43168 45074 19811 18932 13006 13767 37850 36062 11.2248 6.41631 -4.46573 4.65089 -6.57673
192001 43207 44949 19813 19001 13004 13787 37811 36098 10.6769 5.86708 -4.12156 4.78374 -6.30099
193001 43238 44930 19811 19010 12993 13796 37793 36099 10.5784 5.69829 -4.06536 4.90611 -6.23182
194001 43210 44874 19834 19036 12980 13818 37811 36107 10.6444 5.60667 -4.04758 5.11909 -6.2675
195001 43232 44713 19864 19138 13019 13788 37719 36197 9.58403 4.99142 -3.67788 4.69537 -5.60054
196001 43244 44593 19853 19237 13014 13765 37723 36241 9.01005 4.5491 -3.11737 4.58783 -5.45165
197001 43273 44579 19837 19238 13020 13708 37704 36311 8.5161 4.40364 -3.03197 4.20685 -5.12263
198001 43389 44536 19784 19257 13041 13703 37621 36340 7.78781 3.86688 -2.66804 4.04732 -4.71148
199001 43486 44516 19708 19330 12996 13732 37644 36259 7.87009 3.46819 -1.91574 4.49973 -5.09827
200001 43604 44398 19660 19378 12966 13758 37604 36303 7.45484 2.67265 -1.42986 4.84264 -4.78915
201001 43573 44364 19676 19382 12975 13719 37610 36372 7.12607 2.66352 -1.49022 4.55157 -4.5551
202001 43555 44376 19676 19355 12960 13709 37643 36397 7.23255 2.76478 -1.6274 4.58432 -4.58272
203001 43568 44407 19673 19339 12985 13655 37609 36436 6.80396 2.82607 -1.69275 4.10352 -4.31311
204001 43678 44396 19643 19341 13012 13610 37502 36490 5.9554 2.41676 -1.53128 3.66363 -3.72278
205001 43784 44380 19559 19364 13024 13559 37468 36533 5.25232 2.00594 -0.989266 3.28062 -3.4383
206001 43896 44289 19474 19403 13040 13508 37425 36636 4.30542 1.3221 -0.360961 2.87158 -2.90042
207001 43965 44265 19412 19420 13069 13482 37389 36669 3.80076 1.00867 0.0397263 2.53388 -2.64693
208001 44063 44282 19351 19423 13112 13453 37309 36678 3.23037 0.735492 0.364776 2.09146 -2.321
209001 44155 44314 19305 19425 13125 13447 37250 36649 3.07365 0.534566 0.609758 1.97535 -2.21083
210001 44264 44314 19282 19442 13137 13405 37152 36674 2.5476 0.167999 0.813074 1.64501 -1.75923
211001 44344 44236 19264 19492 13140 13407 37086 36701 2.48338 -0.365485 1.15642 1.63729 -1.41971
212001 44429 44155 19202 19564 13182 13360 37021 36757 2.52314 -0.923212 1.83685 1.09116 -0.974315
213001 44475 44100 19205 19559 13192 13323 36962 36854 2.37184 -1.26262 1.79627 0.80307 -0.399886
214001 44513 44071 19284 19488 13140 13297 36897 36980 2.07469 -1.48767 1.0343 0.964168 0.302989
215001 44530 44074 19310 19429 13172 13327 36822 37006 2.01929 -1.53453 0.602882 0.950751 0.674805
216001 44625 44024 19266 19444 13213 13321 36730 37047 2.58739 -2.02114 0.902982 0.661585 1.16469
217001 44752 43935 19187 19467 13202 13307 36693 37127 3.53865 -2.74603 1.42245 0.643472 1.59498
218001 44927 43766 19096 19536 13196 13310 36615 37224 5.07169 -3.90102 2.23689 0.698788 2.23878
219001 44988 43679 19094 19570 13207 13317 36545 37270 5.72381 -4.39862 2.41905 0.67399 2.66612
220001 44986 43672 19102 19571 13211 13315 36535 37278 5.74885 -4.41563 2.38317 0.637125 2.7324
221001 45062 43648 19054 19605 13227 13281 36491 37302 6.27813 -4.75008 2.80065 0.330242 2.9831
222001 45096 43715 19004 19586 13245 13288 36489 37247 6.17363 -4.63665 2.96096 0.262556 2.78907
223001 45097 43727 19034 19567 13262 13322 36441 37220 6.07156 -4.5994 2.71114 0.366567 2.86787
224001 45143 43712 19033 19568 13290 13327 36368 37229 6.37065 -4.80325 2.72132 0.225362 3.17138
225001 45193 43749 19068 19492 13308 13354 36265 37241 6.4144 -4.84449 2.1575 0.280283 3.5975
226001 45191 43843 19070 19467 13331 13379 36242 37147 5.97873 -4.52026 2.02061 0.292267 3.33829
227001 45192 43910 19069 19409 13350 13389 36223 37128 5.71598 -4.29743 1.73158 0.237069 3.33915
228001 45079 43995 19046 19368 13333 13453 36376 37020 4.69885 -3.63468 1.64118 0.731773 2.37474
229001 45061 44004 19025 19362 13311 13526 36437 36944 4.55281 -3.54439 1.71832 1.31098 1.86924
230001 45070 44013 19011 19389 13323 13535 36430 36899 4.57554 -3.54403 1.92725 1.29216 1.72958
231001 45033 44022 19010 19363 13340 13531 36451 36920 4.36809 -3.39044 1.80031 1.16374 1.72908
232001 45001 44011 19000 19372 13353 13605 36480 36848 4.33817 -3.32087 1.89733 1.53338 1.35661
233001 45123 43969 18944 19398 13371 13635 36396 36834 5.05212 -3.86884 2.31685 1.60504 1.61619
234001 45250 43870 18869 19449 13392 13628 36323 36889 6.04856 -4.62527 2.96125 1.43428 2.08945
235001 45292 43797 18820 19496 13444 13599 36278 36944 6.63024 -5.01136 3.45176 0.941108 2.45886
236001 45290 43774 18824 19512 13454 13620 36266 36930 6.72258 -5.08243 3.51215 1.00742 2.45191
237001 45317 43817 18802 19505 13491 13624 36224 36890 6.69799 -5.02685 3.59012 0.806252 2.46068
238001 45336 43835 18789 19486 13488 13627 36221 36887 6.68867 -5.02785 3.56181 0.843404 2.46196
239001 45399 43816 18749 19497 13480 13643 36206 36879 7.06358 -5.30114 3.82394 0.989007 2.48824
240001 45407 43815 18756 19465 13491 13661 36180 36894 7.04266 -5.33107 3.6257 1.03096 2.6401
241001 45428 43859 18709 19457 13499 13612 36198 36907 7.04118 -5.25215 3.82795 0.68556 2.62105
242001 45485 43921 18698 19402 13502 13603 36149 36909 6.97496 -5.23194 3.60584 0.612748 2.81057
243001 45509 44016 18682 19368 13524 13611 36119 36840 6.68359 -4.99117 3.51593 0.52742 2.6681
244001 45553 44033 18665 19355 13569 13627 36047 36820 6.82905 -5.07967 3.53784 0.350977 2.86242
245001 45564 44111 18647 19311 13569 13673 36054 36740 6.48228 -4.85342 3.40727 0.62938 2.5414
246001 45554 44040 18646 19355 13563 13655 36071 36785 6.79121 -5.0594 3.63619 0.556921 2.64405
247001 45526 44054 18627 19362 13649 13578 36032 36841 6.89746 -4.91947 3.77016 -0.431017 2.99566
248001 45487 44138 18620 19321 13763 13454 35964 36922 7.02539 -4.50738 3.59799 -1.87373 3.54729
249001 45498 44160 18602 19322 13758 13429 35976 36924 7.06725 -4.46981 3.69636 -1.99606 3.50991
250001 45480 44121 18610 19307 13801 13358 35943 37049 7.57688 -4.54139 3.57859 -2.68883 4.09252
251001 45491 44241 18574 19257 13777 13341 35992 36996 7.11087 -4.1742 3.51067 -2.64836 3.71508
252001 45446 44308 18615 19224 13810 13288 35963 37015 7.03212 -3.79985 3.12989 -3.17176 3.89302
253001 45545 44203 18559 19260 13808 13290 35922 37082 7.83544 -4.48093 3.60379 -3.14747 4.29204
254001 45639 44082 18520 19304 13796 13288 35879 37160 8.67557 -5.19806 4.03118 -3.08679 4.73993
255001 45626 44029 18505 19331 13817 13236 35886 37238 9.16267 -5.33357 4.24646 -3.53239 4.99973
256001 45670 44066 18445 19329 13810 13246 35910 37193 9.14511 -5.3532 4.54923 -3.42812 4.74645
257001 45715 44041 18410 19336 13880 13228 35830 37229 9.81882 -5.58625 4.7671 -3.95931 5.17703
258001 45781 44109 18395 19323 13936 13145 35723 37257 10.4537 -5.57542 4.77916 -4.80594 5.67955
259001 45851 44109 18351 19333 13984 13111 35649 37281 11.1342 -5.80663 5.05948 -5.30286 6.04439
260001 45866 44107 18318 19325 13979 13138 35672 37264 11.0526 -5.86289 5.19109 -5.10638 5.89603
261001 45909 44083 18286 19331 14029 13134 35610 37287 11.5823 -6.08826 5.38711 -5.43115 6.21005
262001 45915 44156 18302 19277 14004 13203 35613 37199 10.8525 -5.86235 5.02873 -4.85688 5.87644
263001 45937 44198 18319 19246 13999 13195 35579 37196 10.7762 -5.79365 4.78201 -4.87623 5.99284
264001 45964 44197 18291 19280 14003 13154 35576 37204 11.1186 -5.88606 5.10149 -5.15262 6.03341
265001 46039 44082 18270 19327 13995 13143 35530 37283 11.8813 -6.52028 5.45043 -5.17263 6.49528
266001 46119 43994 18235 19365 13938 13129 35542 37347 12.3673 -7.08021 5.82668 -4.91805 6.6845
267001 46137 43900 18229 19405 13939 13103 35529 37427 12.9441 -7.45646 6.06116 -5.08451 7.02574
268001 46187 43859 18213 19454 13964 13092 35469 37431 13.4901 -7.76196 6.39173 -5.30349 7.26312
269001 46231 43872 18191 19430 13946 13097 35465 37437 13.5116 -7.86278 6.38532 -5.1649 7.30006
270001 46369 43759 18115 19490 13908 13116 35441 37471 14.3384 -8.69777 7.088 -4.81998 7.51435
271001 46336 43831 18132 19437 13897 13128 35468 37440 13.7893 -8.34622 6.73025 -4.67998 7.29976
272001 46270 43887 18182 19414 13872 13170 35509 37365 12.9943 -7.94036 6.35135 -4.27108 6.87176
273001 46237 43932 18209 19423 13822 13229 35565 37252 12.2544 -7.68007 6.25552 -3.60764 6.24817
274001 46167 43951 18246 19417 13799 13301 35621 37167 11.5277 -7.38577 6.03136 -3.0273 5.72678
275001 46187 43883 18256 19451 13789 13293 35601 37209 11.8914 -7.68096 6.15144 -3.01615 5.95568
276001 46183 43912 18267 19458 13835 13280 35548 37186 11.9622 -7.56995 6.12937 -3.37262 6.07005
277001 46233 43828 18225 19501 13824 13292 35551 37212 12.4794 -8.01395 6.56947 -3.23072 6.15764
278001 46235 43823 18207 19517 13852 13282 35539 37211 12.6685 -8.03741 6.7447 -3.46033 6.19897
279001 46151 43843 18243 19529 13887 13277 35552 37184 12.3811 -7.69359 6.61692 -3.70112 6.05126
280001 46086 43811 18252 19550 13861 13317 35634 37155 12.0339 -7.58768 6.67601 -3.29982 5.63763
281001 46056 43840 18315 19516 13836 13315 35626 37162 11.626 -7.39094 6.17475 -3.16188 5.69326
282001 45993 43882 18356 19491 13840 13305 35644 37155 11.2039 -7.04156 5.83418 -3.2472 5.60018
283001 45981 43887 18359 19521 13855 13302 35638 37123 11.2252 -6.98512 5.97037 -3.35571 5.50525
284001 45872 43849 18413 19530 13833 13332 35715 37122 10.7199 -6.75381 5.73439 -3.03972 5.21336
285001 45815 43831 18449 19552 13847 13302 35722 37148 10.7131 -6.62638 5.6582 -3.30765 5.28257
286001 45808 43738 18505 19583 13860 13273 35660 37239 11.1921 -6.91747 5.52363 -3.5636 5.84819
287001 45787 43697 18542 19592 13860 13309 35644 37235 11.119 -6.98672 5.37691 -3.34283 5.89344
288001 45880 43551 18510 19661 13870 13322 35573 37299 12.1361 -7.78799 5.89126 -3.32323 6.39382
289001 45885 43425 18498 19719 13916 13331 35534 37358 12.8441 -8.23162 6.24579 -3.54402 6.75593
290001 45857 43397 18486 19758 13917 13369 35574 37309 12.7443 -8.23288 6.50524 -3.31677 6.42786
291001 45780 43408 18526 19760 13959 13344 35569 37321 12.6025 -7.94126 6.30746 -3.72122 6.49052
292001 45743 43399 18522 19785 13944 13355 35625 37294 12.4172 -7.84952 6.4539 -3.56413 6.18186
293001 45766 43372 18522 19774 13957 13324 35589 37363 12.7693 -8.01717 6.39862 -3.8317 6.56922
294001 45755 43327 18572 19780 13964 13322 35543 37404 12.9154 -8.13361 6.16927 -3.88583 6.89156
295001 45758 43342 18589 19761 13944 13302 35543 37428 12.851 -8.09258 5.9856 -3.88868 6.97927
296001 45749 43348 18561 19761 13934 13325 35590 37399 12.6775 -8.04247 6.13082 -3.68788 6.6971
297001 45690 43412 18558 19750 13912 13308 35674 37363 12.1569 -7.63018 6.09106 -3.66021 6.25087
298001 45602 43498 18579 19724 13845 13308 35808 37303 11.1849 -7.04736 5.85131 -3.25813 5.53023
299001 45526 43488 18648 19679 13782 13328 35878 37338 10.5409 -6.82954 5.26717 -2.75662 5.39693
300001 45378 43599 18709 19609 13726 13328 36021 37297 9.20708 -5.96268 4.59857 -2.41901 4.71363
301001 45241 43665 18801 19554 13708 13297 36084 37317 8.34791 -5.28424 3.84575 -2.50031 4.55225
302001 45163 43685 18833 19565 13725 13299 36113 37284 7.9962 -4.95719 3.73644 -2.59068 4.32353
303001 45170 43749 18855 19504 13742 13266 36068 37314 7.95205 -4.76276 3.3154 -2.89498 4.602
304001 45170 43800 18865 19456 13762 13315 36038 37262 7.61765 -4.59041 3.02075 -2.71504 4.52331
305001 45042 43856 18943 19402 13771 13357 36079 37218 6.73308 -3.97514 2.34572 -2.51213 4.20944
306001 44949 43885 19006 19371 13790 13367 36090 37210 6.31802 -3.56725 1.86491 -2.5654 4.13919
307001 44955 43860 19004 19445 13792 13392 36084 37136 6.28958 -3.67165 2.25075 -2.42462 3.89014
308001 44844 43893 19054 19417 13813 13380 36124 37143 5.88933 -3.18987 1.85243 -2.62434 3.76699
309001 44685 44004 19148 19327 13792 13375 36211 37127 4.88912 -2.2828 0.915141 -2.5278 3.386
310001 44589 44051 19241 19234 13749 13353 36257 37195 4.58598 -1.80313 -0.0331066 -2.40328 3.46455
311001 44551 44093 19250 19198 13704 13356 36331 37186 4.10557 -1.53439 -0.262617 -2.11335 3.15692
312001 44527 44087 19280 19163 13707 13349 36322 37234 4.31108 -1.47418 -0.594153 -2.1743 3.36624
313001 44499 44109 19340 19123 13738 13389 36260 37212 4.44591 -1.30495 -1.10302 -2.11608 3.51693
314001 44400 44171 19387 19089 13749 13429 36301 37144 4.04273 -0.764241 -1.51577 -1.93817 3.11537
315001 44376 44230 19377 19036 13729 13482 36355 37085 3.57295 -0.485252 -1.73643 -1.49446 2.69851
316001 44390 44215 19352 19027 13694 13545 36401 37046 3.09468 -0.58268 -1.65553 -0.899899 2.38474
317001 44418 44128 19327 19064 13656 13580 36436 37061 2.87721 -0.969347 -1.33883 -0.457615 2.31015
318001 44381 44081 19345 19083 13604 13584 36507 37085 2.71256 -1.00343 -1.33309 -0.1184 2.13541
319001 44381 44012 19373 19118 13564 13579 36518 37125 2.87074 -1.23853 -1.29803 0.0924926 2.23915
320001 44280 44049 19410 19096 13518 13560 36628 37129 2.57543 -0.774645 -1.59844 0.256677 1.84713
321001 44253 44042 19427 19091 13483 13541 36673 37160 2.60229 -0.707487 -1.71029 0.354262 1.79465
322001 44280 43879 19425 19192 13455 13599 36676 37164 2.68727 -1.34795 -1.18395 0.876925 1.79825
323001 44336 43643 19413 19323 13429 13671 36657 37198 3.43391 -2.33638 -0.457283 1.47005 1.99071
324001 44291 43426 19454 19439 13412 13734 36678 37236 4.07035 -2.92061 -0.0760599 1.95435 2.05244
325001 44226 43338 19504 19498 13402 13775 36704 37224 4.21702 -2.99958 -0.0295108 2.26333 1.91368
326001 44157 43221 19569 19587 13356 13869 36754 37158 4.68075 -3.16516 0.0918357 3.10982 1.48722
327001 44088 43037 19566 19724 13324 13939 36858 37135 5.31261 -3.55936 0.797978 3.7254 1.01953
328001 44077 42921 19460 19805 13293 13973 37006 37136 5.96478 -3.91795 1.74194 4.11884 0.478636
329001 44057 42855 19432 19822 13338 13895 37009 37263 5.72359 -4.07592 1.96932 3.37599 0.933216
330001 44011 42824 19452 19822 13319 13894 37054 37295 5.71334 -4.02682 1.8679 3.48634 0.885057
331001 43931 42763 19472 19876 13297 13953 37136 37243 5.98583 -3.96557 2.03754 3.97466 0.39354
332001 43733 42643 19536 20001 13313 14029 37254 37162 6.1715 -3.70748 2.33945 4.33083 -0.33605
333001 43683 42604 19566 20022 13313 14026 37274 37183 6.11976 -3.67194 2.29271 4.31292 -0.332292
334001 43655 42632 19581 20030 13306 14018 37294 37155 6.00255 -3.4813 2.25687 4.30806 -0.508229
335001 43677 42592 19596 20030 13265 14021 37298 37192 6.28461 -3.69276 2.18109 4.57742 -0.387178
336001 43699 42611 19585 20012 13298 13983 37254 37229 5.96052 -3.70209 2.14671 4.14798 -0.0904005
337001 43724 42662 19564 19998 13334 13931 37214 37244 5.55887 -3.612 2.18285 3.61625 0.111146
338001 43712 42611 19566 19971 13332 13870 37226 37383 5.4002 -3.74606 2.0377 3.26271 0.575987
339001 43752 42564 19491 20029 13372 13800 37221 37442 5.57411 -4.04233 2.70716 2.59719 0.810002
340001 43845 42466 19449 20068 13382 13763 37160 37538 6.24411 -4.69257 3.11473 2.31322 1.38425
341001 43930 42387 19403 20126 13402 13758 37101 37564 6.95298 -5.25061 3.63735 2.16089 1.69563
342001 43988 42313 19366 20193 13455 13700 37027 37629 7.54078 -5.70043 4.15886 1.48749 2.20446
343001 44000 42336 19367 20231 13527 13639 36942 37629 7.59697 -5.66184 4.34275 0.680251 2.51698
344001 43993 42381 19396 20222 13536 13626 36911 37606 7.35435 -5.48366 4.15074 0.546813 2.5472
345001 44046 42443 19352 20168 13523 13650 36915 37574 7.27891 -5.44941 4.10558 0.77116 2.41578
346001 44007 42436 19369 20103 13624 13609 36836 37687 7.20599 -5.34202 3.69534 -0.0901651 3.11855
347001 43936 42430 19412 20015 13641 13637 36847 37753 6.81812 -5.12322 3.03771 -0.0234881 3.31831
348001 43865 42379 19451 19953 13629 13707 36891 37794 6.5681 -5.05618 2.53152 0.47394 3.30782
349001 43769 42415 19498 19853 13597 13792 36972 37773 5.86914 -4.60831 1.79219 1.18045 2.93342
350001 43786 42402 19501 19765 13618 13864 36931 37802 6.0293 -4.71039 1.33489 1.4861 3.18972
351001 43831 42363 19492 19692 13624 13929 36889 37849 6.45988 -4.99634 1.01296 1.83963 3.51515
352001 43862 42323 19484 19617 13624 14003 36865 37891 6.87132 -5.24101 0.673473 2.28093 3.75374
353001 43779 42233 19494 19604 13650 14059 36912 37938 6.94252 -5.27016 0.55718 2.45778 3.75139
354001 43826 42127 19458 19603 13641 14073 36910 38031 7.59106 -5.79384 0.734535 2.59572 4.09614
355001 43862 42062 19450 19562 13618 14137 36905 38073 8.11968 -6.13936 0.567919 3.11602 4.26677
356001 43937 41894 19398 19573 13605 14191 36895 38176 9.1448 -6.97213 0.887349 3.51558 4.67655
357001 44030 41675 19355 19585 13605 14191 36845 38383 10.4817 -8.043 1.16642 3.51558 5.60868
358001 44039 41579 19361 19532 13637 14147 36798 38576 11.0786 -8.40593 0.867955 3.0604 6.47743
359001 44113 41466 19296 19514 13667 14170 36759 38684 11.8872 -9.04708 1.10746 3.01553 7.00966
360001 44046 41387 19357 19441 13642 14229 36790 38777 12.147 -9.09586 0.427328 3.51684 7.22945
361001 44051 41292 19358 19414 13563 14262 36863 38866 12.6417 -9.44296 0.285271 4.19117 7.27985
362001 44132 41204 19320 19371 13447 14312 36936 38947 13.4454 -10.0219 0.260149 5.19249 7.3015
363001 44157 41057 19315 19342 13418 14353 36945 39082 14.2948 -10.6183 0.138196 5.61142 7.75156
364001 44125 40916 19316 19344 13357 14396 37037 39178 14.8375 -11.0028 0.143277 6.23751 7.75648
365001 44270 40743 19236 19321 13346 14467 36983 39302 16.1924 -12.094 0.434601 6.7232 8.39859
366001 44289 40683 19227 19267 13281 14574 37038 39309 16.7524 -12.368 0.205595 7.7487 8.22147
367001 44189 40649 19279 19209 13289 14615 37078 39360 16.7026 -12.1511 -0.35509 7.93945 8.25636
368001 44065 40636 19323 19134 13285 14668 37161 39396 16.5354 -11.7821 -0.963772 8.27195 8.07765
369001 44027 40575 19332 19111 13243 14750 37232 39398 16.8664 -11.8681 -1.12715 9.00717 7.82454
370001 44097 40473 19321 19090 13246 14787 37170 39484 17.6423 -12.4618 -1.17865 9.20381 8.35788
371001 44040 40496 19347 19002 13212 14806 37235 39530 17.6345 -12.1891 -1.76174 9.52291 8.28326
372001 44131 40322 19314 18971 13133 14892 37256 39649 18.9666 -13.107 -1.75299 10.5073 8.6291
373001 44128 40266 19324 18925 13111 14958 37271 39685 19.4462 -13.294 -2.04015 11.0244 8.70194
374001 44088 40247 19330 18877 13139 15011 37278 39699 19.5177 -13.2251 -2.31667 11.1582 8.7272
375001 44102 40149 19328 18842 13149 15038 37256 39805 20.0641 -13.6175 -2.4867 11.2522 9.18355
376001 44168 40050 19267 18769 13208 15035 37192 39980 20.6588 -14.1888 -2.55261 10.8721 10.0373
377001 44202 40007 19250 18678 13192 15119 37191 40030 21.2872 -14.4549 -2.93623 11.4533 10.2176
378001 44198 39940 19276 18632 13142 15277 37219 39985 22.0435 -14.6782 -3.30679 12.6654 9.95602
379001 44065 39926 19330 18505 13140 15322 37300 40081 22.1175 -14.2804 -4.24052 12.9344 9.99855
380001 43970 39847 19385 18427 13125 15389 37355 40171 22.5639 -14.2399 -4.92578 13.4082 10.1149
381001 43884 39785 19426 18328 13106 15392 37419 40329 22.9137 -14.1696 -5.65008 13.5423 10.4376
382001 43861 39798 19450 18229 13085 15478 37440 40329 23.3388 -14.0447 -6.28852 14.1607 10.3621
383001 43866 39782 19439 18179 13099 15574 37432 40299 23.6851 -14.1182 -6.4947 14.6178 10.2857
384001 43751 39747 19485 18113 13122 15702 37478 40272 23.9459 -13.854 -7.07404 15.198 10.0226
385001 43844 39639 19435 18098 13135 15794 37422 40303 24.7107 -14.551 -6.8995 15.6348 10.3363
386001 43890 39552 19413 18091 13181 15871 37352 40320 25.1915 -15.015 -6.82471 15.7836 10.652
387001 43936 39496 19423 18038 13256 15925 37221 40375 25.6867 -15.369 -7.15413 15.6257 11.3249
388001 43930 39439 19411 17985 13304 16020 37191 40390 26.0724 -15.5514 -7.37237 15.862 11.4876
389001 43892 39414 19458 17914 13277 16140 37209 40366 26.6761 -15.5123 -7.98513 16.694 11.3372
390001 43889 39393 19471 17824 13280 16233 37196 40384 27.2383 -15.5769 -8.52672 17.1907 11.4482
391001 43830 39415 19521 17750 13293 16342 37189 40330 27.5549 -15.3072 -9.17684 17.7085 11.2765
392001 43836 39397 19501 17694 13267 16424 37229 40322 27.9923 -15.3915 -9.37287 18.3185 11.1018
393001 43831 39352 19538 17612 13282 16487 37182 40386 28.6081 -15.5348 -9.99594 18.5727 11.4992
394001 43818 39419 19536 17511 13318 16578 37161 40329 28.778 -15.2525 -10.5242 18.8513 11.3756
395001 43851 39387 19512 17418 13321 16680 37149 40352 29.438 -15.4777 -10.8999 19.3898 11.5005
396001 43878 39410 19497 17323 13318 16781 37140 40323 29.9545 -15.4869 -11.333 19.9577 11.4315
397001 43882 39394 19520 17228 13299 16926 37132 40289 30.8026 -15.5573 -11.9597 20.8594 11.3412
398001 43843 39486 19546 17132 13321 16971 37123 40247 30.8648 -15.0973 -12.6073 20.9692 11.2275
399001 43811 39484 19557 17020 13295 17015 37170 40317 31.3866 -14.9964 -13.2678 21.365 11.3016
400001 43745 39489 19583 16893 13277 17085 37228 40369 31.9491 -14.7558 -14.0872 21.8518 11.2721
401001 43688 39529 19600 16775 13317 17095 37228 40437 32.0808 -14.4211 -14.8146 21.6617 11.5112
402001 43521 39537 19689 16661 13320 17158 37303 40480 32.5024 -13.8276 -15.8844 21.982 11.3877
403001 43429 39594 19727 16549 13328 17187 37349 40506 32.7352 -13.3134 -16.6882 22.0888 11.3107
404001 43398 39661 19762 16403 13372 17239 37301 40533 33.2089 -12.9705 -17.6656 22.0999 11.5811
405001 43414 39736 19768 16303 13344 17297 37307 40500 33.7128 -12.7588 -18.2467 22.5804 11.4433
406001 43409 39832 19787 16173 13346 17355 37291 40476 34.2179 -12.4018 -19.0605 22.8779 11.4175
407001 43337 39946 19783 16048 13317 17433 37396 40409 34.5691 -11.7541 -19.734 23.4698 10.7981
408001 43343 40026 19775 15923 13320 17485 37395 40402 35.0283 -11.4918 -20.39 23.7281 10.7772
409001 43353 40133 19754 15802 13301 17537 37425 40364 35.4452 -11.148 -20.961 24.1197 10.5339
410001 43347 40149 19764 15711 13326 17629 37396 40347 35.9959 -11.0712 -21.5211 24.4548 10.5801
411001 43439 40014 19743 15709 13311 17750 37340 40363 36.7639 -11.8598 -21.4272 25.1847 10.8411
412001 43497 39949 19720 15654 13306 17832 37310 40401 37.4036 -12.2861 -21.621 25.6466 11.0845
413001 43498 39939 19678 15590 13326 17902 37331 40405 37.6532 -12.3249 -21.7706 25.8926 11.0217
414001 43620 39834 19588 15564 13328 17976 37297 40462 38.0967 -13.1094 -21.4651 26.268 11.3464
415001 43657 39719 19560 15527 13303 18009 37313 40581 38.6517 -13.6419 -21.533 26.5925 11.7056
416001 43688 39619 19556 15513 13287 18033 37302 40671 39.11 -14.1015 -21.5919 26.8151 12.0614
417001 43775 39434 19495 15566 13254 18117 37309 40719 39.6185 -15.0527 -20.9856 27.4538 12.2039
418001 43808 39317 19448 15595 13323 18052 37254 40872 39.3269 -15.5806 -20.585 26.6956 12.9404
419001 43874 39260 19404 15514 13349 18100 37206 40962 39.8453 -16.0063 -20.8198 26.7882 13.4305
420001 43887 39225 19386 15420 13374 18135 37186 41056 40.3016 -16.1749 -21.2606 26.819 13.8317
421001 43852 39229 19458 15269 13396 18165 37127 41173 41.1368 -16.0426 -22.4814 26.842 14.4555
422001 43908 39143 19409 15194 13378 18210 37138 41289 41.7812 -16.5383 -22.6614 27.1849 14.8188
423001 44018 39080 19305 15174 13375 18237 37135 41345 41.9763 -17.1337 -22.2498 27.3434 15.0244
424001 44080 39020 19226 15132 13361 18286 37166 41398 42.3124 -17.5567 -22.0893 27.6824 15.0948
425001 44081 38888 19190 15121 13345 18342 37217 41485 42.744 -18.0323 -21.9694 28.0694 15.2099
426001 44100 38738 19151 15129 13347 18339 37235 41630 43.0158 -18.6337 -21.7255 28.0417 15.6464
427001 44126 38579 19119 15132 13396 18322 37192 41799 43.2421 -19.287 -21.5424 27.6601 16.3931
428001 44177 38474 19071 15096 13441 18335 37144 41927 43.578 -19.8359 -21.5039 27.4553 17.0107
429001 44224 38412 19029 15079 13488 18355 37092 41986 43.7377 -20.2169 -21.3871 27.2751 17.4047
430001 44196 38380 19023 15015 13552 18410 37062 42027 43.9505 -20.2381 -21.7235 27.174 17.656
431001 44108 38414 19069 14926 13585 18465 37071 42027 44.1742 -19.8201 -22.4694 27.2595 17.623
432001 44071 38426 19085 14850 13595 18546 37082 42010 44.5476 -19.6525 -22.9887 27.6169 17.5241
433001 44023 38426 19109 14763 13574 18614 37128 42029 45.0575 -19.4898 -23.6124 28.0936 17.4221
434001 44044 38410 19086 14752 13550 18700 37154 41969 45.3375 -19.6168 -23.5582 28.6799 17.1214
435001 44015 38301 19103 14745 13535 18734 37181 42051 45.768 -19.9121 -23.6852 28.9443 17.305
436001 43841 38331 19219 14645 13608 18715 37166 42140 45.8927 -19.2178 -24.8533 28.4084 17.6662
437001 43606 38337 19337 14567 13682 18704 37210 42223 45.8804 -18.4015 -25.9023 27.9092 17.7917
438001 43416 38368 19449 14476 13737 18710 37233 42277 46.0732 -17.6466 -26.9964 27.6109 17.8931
439001 43331 38422 19508 14319 13803 18708 37193 42381 46.5728 -17.1626 -28.2091 27.2074 18.3976
440001 43211 38470 19605 14160 13871 18710 37148 42490 47.2259 -16.5823 -29.6282 26.8125 18.9359
441001 43000 38601 19749 13988 13959 18714 37127 42527 47.7388 -15.3932 -31.3609 26.31 19.1395
442001 42917 38591 19809 13899 13962 18806 37147 42534 48.4362 -15.1463 -32.186 26.7635 19.0902
443001 42848 38535 19816 13836 13896 18872 37275 42587 48.9917 -15.1124 -32.5943 27.4928 18.8032
444001 42812 38405 19826 13761 13905 18924 37292 42740 49.7243 -15.4577 -33.0897 27.7045 19.264
445001 42735 38367 19897 13684 13969 18895 37234 42884 50.2151 -15.3317 -33.9003 27.1768 19.9673
446001 42638 38392 20012 13525 14033 18860 37152 43053 51.1837 -14.9099 -35.4187 26.6189 20.8427
447001 42628 38309 20017 13471 14026 18906 37164 43144 51.7539 -15.1751 -35.767 26.8952 21.1081
448001 42636 38220 20018 13417 14020 18907 37161 43286 52.3074 -15.5238 -36.0961 26.9358 21.6011
449001 42589 38182 20022 13365 14027 18959 37197 43324 52.6443 -15.5003 -36.4286 27.1595 21.5982
450001 42614 38073 20004 13338 13977 19031 37240 43388 53.2064 -15.9801 -36.5024 27.822 21.6579
451001 42672 37878 19993 13319 13910 19073 37260 43560 54.053 -16.8852 -36.5627 28.4327 22.1668
452001 42612 37773 19974 13287 13856 19092 37393 43677 54.3588 -17.06 -36.6612 28.8507 22.0777
453001 42541 37754 20044 13159 13793 19154 37457 43762 55.4513 -16.886 -37.7798 29.5398 22.1311
454001 42450 37722 20081 13069 13772 19224 37532 43814 56.1071 -16.6906 -38.5076 30.0189 22.0332
455001 42394 37738 20135 12966 13746 19246 37560 43879 56.8365 -16.4404 -39.399 30.285 22.1503
456001 42319 37786 20197 12857 13692 19327 37627 43859 57.6604 -16.0086 -40.3676 31.0155 21.8391
457001 42349 37687 20238 12789 13632 19429 37616 43924 58.7884 -16.4715 -40.9838 31.8868 22.0981
458001 42376 37551 20211 12767 13635 19496 37613 44015 59.2496 -17.0593 -40.9867 32.2047 22.4152
459001 42434 37368 20162 12813 13654 19498 37585 44150 59.3036 -17.9258 -40.4655 32.1011 22.9706
460001 42432 37280 20099 12868 13612 19448 37692 44233 58.9194 -18.2405 -39.8205 32.1017 22.8602
461001 42438 37267 20000 12889 13638 19479 37759 44194 58.3819 -18.3086 -39.206 32.1016 22.486
462001 42360 37283 19942 12921 13719 19439 37812 44188 57.4992 -17.9876 -38.7282 31.414 22.2685
463001 42407 37241 19831 13010 13814 19358 37781 44222 56.4292 -18.3024 -37.6376 30.4411 22.495
464001 42391 37239 19754 12994 13859 19340 37829 44258 56.0104 -18.2549 -37.3539 30.0829 22.4416
465001 42353 37233 19684 12976 13954 19325 37842 44297 55.509 -18.1465 -37.1164 29.4438 22.5253
466001 42303 37258 19607 12986 14022 19363 37902 44224 54.8273 -17.8822 -36.6719 29.2336 22.0642
467001 42215 37308 19602 12943 14059 19429 37958 44151 54.7128 -17.3971 -36.9096 29.3471 21.6163
468001 42108 37378 19591 12935 14081 19486 38054 44032 54.3066 -16.7734 -36.9037 29.5036 20.8689
469001 42041 37424 19562 12900 14155 19468 38076 44039 53.9261 -16.3747 -36.9734 28.9773 20.8129
470001 41863 37508 19575 12859 14189 19519 38207 43945 53.6021 -15.4544 -37.2892 29.0333 20.0232
471001 41642 37570 19577 12860 14195 19518 38420 43883 52.9466 -14.4644 -37.293 28.993 19.0462
472001 41569 37576 19521 12854 14140 19567 38604 43834 52.7254 -14.1897 -37.0508 29.5621 18.2191
473001 41432 37590 19500 12861 14196 19545 38706 43834 52.1094 -13.6624 -36.9024 29.1234 17.8541
474001 41364 37601 19435 12829 14229 19551 38806 43849 51.7499 -13.3862 -36.7741 28.9597 17.5461
475001 41286 37635 19399 12825 14272 19592 38877 43778 51.3462 -12.9912 -36.6187 28.9129 17.0521
476001 41211 37599 19355 12858 14320 19643 38948 43730 50.8603 -12.8615 -36.1959 28.887 16.6359
477001 41044 37693 19345 12823 14360 19653 39085 43661 50.4151 -11.9373 -36.3606 28.7031 15.9129
478001 40880 37773 19339 12789 14401 19702 39214 43566 50.1087 -11.0736 -36.5395 28.7085 15.1311
479001 40728 37773 19309 12798 14488 19705 39308 43555 49.4496 -10.5443 -36.3353 28.2148 14.7563
480001 40673 37766 19256 12805 14573 19742 39331 43518 48.9486 -10.3771 -36.0263 27.9055 14.5491
481001 40658 37759 19201 12829 14630 19781 39344 43462 48.4836 -10.35 -35.6023 27.7695 14.313
482001 40637 37835 19123 12815 14666 19797 39408 43384 47.9666 -9.99887 -35.2947 27.6416 13.822
483001 40569 37819 19105 12771 14758 19784 39402 43457 47.8 -9.8185 -35.4746 27.0451 14.0909
484001 40480 37794 19078 12804 14794 19795 39482 43438 47.314 -9.59689 -35.1352 26.8923 13.7419
485001 40466 37754 18998 12834 14820 19810 39550 43433 46.78 -9.69318 -34.5463 26.8172 13.4833
486001 40317 37731 18965 12860 14900 19762 39652 43478 45.9879 -9.25284 -34.2193 26.1173 13.2736
487001 40242 37612 18928 12869 14974 19756 39690 43594 45.6601 -9.42206 -33.9764 25.6625 13.5317
488001 40236 37531 18863 12877 15026 19723 39709 43700 45.2645 -9.69628 -33.5972 25.1995 13.8228
489001 40152 37486 18824 12908 15035 19721 39823 43716 44.8075 -9.56438 -33.2085 25.1379 13.4729
490001 40041 37531 18759 12937 15048 19702 39986 43661 43.9929 -9.00834 -32.6993 24.9684 12.7105
491001 40006 37483 18667 12958 15146 19649 40015 43741 43.1423 -9.05987 -32.1006 24.1428 12.8784
492001 39951 37414 18615 12971 15293 19558 39975 43888 42.3819 -9.11746 -31.7547 22.8485 13.516
493001 39904 37401 18499 13050 15334 19557 40097 43823 41.2156 -8.99871 -30.6754 22.6106 12.8659
494001 39835 37425 18417 13052 15388 19594 40194 43760 40.5832 -8.66676 -30.2409 22.4903 12.3111
495001 39792 37457 18305 13077 15394 19642 40343 43654 39.8383 -8.39631 -29.5087 22.6981 11.4293
496001 39793 37381 18224 13065 15501 19577 40316 43807 39.3002 -8.67757 -29.1624 21.7662 12.0414
497001 39780 37407 18160 13034 15602 19515 40292 43874 38.7783 -8.53646 -29.02 20.8843 12.352
498001 39729 37364 18107 13016 15720 19416 40278 44034 38.2287 -8.51285 -28.8546 19.721 12.9405
499001 39620 37340 18105 12998 15815 19381 40294 44111 37.9475 -8.21382 -28.9546 19.0112 13.1434
500001 39540 37273 18082 12989 15885 19402 40327 44166 37.7715 -8.17477 -28.8901 18.7258 13.2122
501001 39471 37237 18035 13008 15945 19304 40383 44281 37.1305 -8.06122 -28.5286 17.8944 13.4016
502001 39428 37116 17971 13073 16043 19206 40392 44435 36.32 -8.3518 -27.796 16.8504 13.8866
503001 39410 37047 17900 13088 16151 19138 40373 44557 35.7662 -8.541 -27.3325 15.904 14.362
504001 39423 36921 17802 13129 16250 19076 40359 44704 35.1568 -9.05039 -26.5674 15.039 14.9028
505001 39427 36877 17732 13136 16350 19005 40328 44812 34.714 -9.22289 -26.1539 14.1259 15.3763
506001 39408 36853 17679 13127 16442 18968 40308 44882 34.4093 -9.2436 -25.9295 13.4294 15.6802
507001 39369 36900 17603 13123 16503 18948 40362 44859 33.75 -8.9317 -25.5525 12.9915 15.4136
508001 39397 36821 17503 13158 16601 18863 40336 44988 33.1769 -9.32227 -24.8086 12.0173 15.9349
509001 39380 36795 17408 13145 16695 18863 40354 45027 32.7181 -9.35752 -24.3833 11.503 16.0014
510001 39401 36748 17303 13155 16809 18825 40324 45102 32.2278 -9.60554 -23.7624 10.6855 16.3565
511001 39419 36752 17211 13134 16941 18745 40266 45199 31.8916 -9.65488 -23.399 9.55547 16.8829
512001 39477 36698 17111 13152 16988 18775 40260 45206 31.5408 -10.0628 -22.7539 9.45362 16.9248
513001 39467 36700 16997 13172 17016 18801 40356 45158 30.726 -10.0199 -22.0179 9.43594 16.4276
514001 39491 36657 16873 13231 17109 18781 40363 45162 29.8875 -10.2639 -20.9869 8.82987 16.4163
515001 39529 36568 16765 13300 17100 18804 40442 45159 29.2465 -10.7278 -19.9797 8.99703 16.1287
516001 39544 36570 16652 13311 17148 18774 40492 45176 28.6084 -10.7737 -19.2974 8.58323 16.0097
517001 39612 36519 16530 13367 17199 18763 40495 45182 28.0128 -11.2038 -18.2892 8.25153 16.0191
518001 39666 36478 16394 13406 17238 18735 40538 45212 27.3887 -11.5471 -17.3052 7.89701 15.9679
519001 39755 36387 16286 13438 17301 18759 40494 45247 27.2816 -12.1996 -16.5153 7.68211 16.2385
520001 39849 36332 16157 13453 17373 18748 40457 45298 27.1094 -12.7363 -15.7102 7.23892 16.5377
521001 39963 36295 16033 13467 17428 18739 40412 45330 27.0044 -13.2766 -14.9361 6.89778 16.8019
522001 40049 36211 15891 13492 17487 18768 40409 45360 26.8344 -13.8921 -13.9915 6.73186 16.9119
523001 40124 36105 15789 13551 17560 18777 40363 45398 26.8135 -14.5505 -13.0619 6.38853 17.1995
524001 40135 36125 15721 13533 17637 18784 40343 45389 26.6012 -14.5149 -12.7887 6.01438 17.24
525001 40004 36135 15707 13531 17767 18787 40358 45378 26.0948 -14.0155 -12.722 5.33918 17.1508
526001 39957 36162 15644 13529 17830 18821 40405 45319 25.5151 -13.7491 -12.3791 5.18064 16.79
527001 39932 36212 15588 13521 17915 18795 40401 45303 25.0996 -13.475 -12.1113 4.59715 16.7509
528001 39820 36261 15554 13530 17984 18827 40478 45213 24.2546 -12.8969 -11.8644 4.398 16.1817
529001 39719 36313 15532 13502 18002 18873 40583 45143 23.6145 -12.3462 -11.9098 4.54 15.5807
530001 39591 36370 15521 13460 18050 18864 40674 45137 23.0915 -11.6807 -12.1028 4.24093 15.2419
531001 39402 36434 15582 13398 18125 18851 40727 45148 22.8606 -10.7717 -12.8256 3.77974 15.0929
532001 39300 36494 15580 13383 18039 18870 40917 45084 22.1619 -10.1862 -12.9057 4.3297 14.2157
533001 39242 36524 15519 13379 18112 18886 40963 45042 21.5784 -9.86839 -12.5849 4.02817 13.9153
534001 39215 36474 15390 13398 18140 18865 41091 45094 20.91 -9.95701 -11.7367 3.77306 13.6419
535001 39205 36473 15261 13439 18175 18853 41195 45066 20.0105 -9.92502 -10.7512 3.52765 13.1865
536001 39136 36462 15198 13493 18220 18853 41282 45023 19.206 -9.71934 -10.0622 3.2918 12.7406
537001 39064 36372 15169 13503 18245 18848 41358 45108 19.1131 -9.79531 -9.83517 3.13514 12.7593
538001 38989 36315 15127 13562 18302 18816 41418 45138 18.6365 -9.7383 -9.23595 2.67214 12.6507
539001 38878 36283 15127 13593 18331 18809 41500 45146 18.1962 -9.45942 -9.04804 2.48454 12.3928
540001 38696 36281 15140 13559 18348 18804 41652 45187 17.7308 -8.81367 -9.32879 2.37001 12.0024
541001 38549 36324 15123 13537 18327 18830 41833 45144 16.9333 -8.13503 -9.37062 2.60691 11.223
542001 38478 36352 15091 13545 18325 18856 41938 45082 16.2801 -7.77546 -9.13817 2.75128 10.6541
543001 38418 36369 15080 13543 18347 18870 41987 45053 15.9381 -7.49613 -9.08704 2.70848 10.3884
544001 38374 36308 14996 13607 18425 18802 42037 45118 15.4058 -7.5636 -8.21512 1.95141 10.4324
545001 38402 36218 14912 13654 18479 18786 42039 45175 15.3171 -7.99632 -7.44388 1.58948 10.6177
546001 38428 36186 14837 13666 18555 18779 42012 45202 15.2807 -8.20897 -6.93679 1.15845 10.8005
547001 38417 36091 14750 13755 18629 18778 42035 45210 14.9493 -8.52493 -5.89557 0.767847 10.7453
548001 38384 36041 14744 13755 18707 18763 41996 45275 15.2107 -8.592 -5.86065 0.28675 11.0957
549001 38288 36066 14740 13735 18738 18819 42065 45214 14.6855 -8.15236 -5.95794 0.415416 10.6552
550001 38321 36053 14637 13690 18719 18790 42154 45301 14.6355 -8.31993 -5.62886 0.36405 10.6376
551001 38345 36042 14549 13621 18707 18767 42230 45404 14.7284 -8.44753 -5.53131 0.307398 10.718
552001 38388 36058 14451 13577 18697 18730 42295 45469 14.6627 -8.54314 -5.22274 0.16803 10.71
553001 38453 35991 14298 13591 18700 18689 42379 45564 14.6526 -9.02946 -4.2372 -0.061135 10.7336
554001 38488 35952 14123 13594 18700 18638 42519 45651 14.417 -9.30092 -3.18113 -0.325105 10.5413
555001 38606 35873 13973 13591 18732 18590 42519 45781 15.0541 -10.0203 -2.30452 -0.739271 10.971
556001 38572 35827 13884 13593 18827 18527 42547 45888 15.264 -10.0697 -1.75917 -1.55646 11.2282
557001 38510 35813 13811 13632 18902 18461 42607 45929 15.129 -9.89879 -1.08417 -2.28573 11.158
558001 38392 35827 13755 13620 18921 18435 42762 45953 14.5056 -9.4212 -0.819571 -2.51877 10.7069
559001 38358 35822 13660 13623 18883 18454 42929 45936 13.9078 -9.31718 -0.227633 -2.22442 10.0806
560001 38391 35879 13509 13612 18858 18454 43072 45890 13.3788 -9.22349 0.621823 -2.09574 9.44142
561001 38304 35943 13450 13575 18909 18505 43167 45812 12.5954 -8.67074 0.756764 -2.09289 8.86056
562001 38216 35918 13424 13569 18899 18562 43291 45786 12.0386 -8.44596 0.878945 -1.74541 8.35309
563001 38178 35861 13364 13569 18959 18565 43329 45840 12.2031 -8.52119 1.24554 -2.03821 8.40236
564001 38042 35783 13331 13606 19045 18549 43412 45897 12.1499 -8.32006 1.67195 -2.56239 8.30875
565001 37840 35806 13324 13624 19077 18562 43589 45843 11.1072 -7.50103 1.8239 -2.65879 7.53058
566001 37749 35920 13268 13631 19113 18564 43699 45721 10.1995 -6.74697 2.20825 -2.83433 6.75263
567001 37746 35907 13149 13699 19163 18578 43771 45652 10.2868 -6.78455 3.35162 -3.01724 6.28099
568001 37720 35884 13052 13762 19228 18527 43829 45663 10.733 -6.77575 4.33085 -3.61368 6.12146
569001 37750 35826 12943 13788 19250 18518 43886 45704 11.3182 -7.10145 5.16329 -3.77257 6.06464
570001 37788 35760 12832 13821 19334 18528 43875 45727 12.1678 -7.4863 6.0529 -4.1482 6.17783
571001 37678 35677 12790 13830 19430 18527 43931 45802 12.4783 -7.39643 6.36923 -4.64091 6.23672
572001 37517 35640 12766 13854 19510 18498 44036 45844 12.4876 -6.94794 6.66343 -5.1969 6.02146
573001 37348 35664 12817 13813 19503 18494 44161 45865 11.6249 -6.24056 6.09841 -5.18226 5.66995
574001 37269 35668 12865 13772 19455 18500 44240 45896 10.9763 -5.93643 5.55229 -4.90794 5.5066
575001 37252 35660 12890 13785 19483 18465 44205 45926 11.1786 -5.90292 5.47557 -5.23094 5.72459
576001 37269 35660 12925 13771 19416 18567 44221 45838 10.5033 -5.964 5.17424 -4.36053 5.38165
577001 37248 35672 13010 13687 19349 18645 44224 45832 9.64291 -5.84216 4.13982 -3.61601 5.35175
578001 37234 35663 12999 13721 19336 18683 44262 45768 9.47487 -5.82338 4.41405 -3.3524 5.01389
579001 37214 35633 12978 13726 19336 18672 44303 45804 9.58479 -5.86242 4.57447 -3.40931 4.99509
580001 37254 35616 12981 13709 19384 18621 44212 45889 10.1591 -6.07265 4.45325 -3.91727 5.5816
581001 37339 35631 12931 13723 19434 18568 44127 45913 10.8937 -6.32764 4.84828 -4.44579 5.94674
582001 37385 35577 12938 13722 19485 18511 44023 46025 11.719 -6.6982 4.79873 -5.0002 6.66629
583001 37429 35528 12900 13711 19473 18540 44029 46056 11.9482 -7.04273 4.96867 -4.7888 6.7482
584001 37528 35463 12845 13756 19519 18518 43939 46098 12.9512 -7.64812 5.58273 -5.13595 7.18992
585001 37579 35487 12864 13744 19518 18539 43870 46065 12.9521 -7.74409 5.39195 -5.02182 7.31404
586001 37568 35418 12836 13827 19563 18539 43864 46051 13.4492 -7.96302 6.06616 -5.2494 7.28818
587001 37596 35349 12848 13850 19555 18508 43831 46129 13.94 -8.32678 6.12806 -5.37169 7.6538
588001 37611 35367 12822 13872 19545 18551 43852 46046 13.7762 -8.31379 6.42231 -5.09783 7.30958
589001 37633 35293 12825 13879 19598 18506 43774 46158 14.5319 -8.67224 6.44559 -5.59933 7.94177
590001 37597 35304 12861 13868 19642 18477 43730 46187 14.5878 -8.49965 6.15509 -5.97213 8.18588
591001 37704 35301 12814 13886 19660 18500 43652 46149 15.0609 -8.90071 6.55623 -5.94333 8.32466
592001 37780 35293 12791 13864 19705 18497 43554 46182 15.5884 -9.20732 6.56789 -6.18566 8.76498
593001 37771 35295 12800 13882 19710 18500 43550 46159 15.5556 -9.16588 6.62037 -6.19438 8.70418
594001 37757 35339 12810 13856 19745 18473 43519 46168 15.5433 -8.94948 6.40191 -6.51088 8.83882
595001 37756 35378 12830 13823 19780 18467 43465 46168 15.5211 -8.79925 6.07883 -6.71806 9.02185
596001 37825 35363 12807 13840 19813 18462 43386 46171 16.0362 -9.1065 6.32455 -6.90984 9.29969
597001 37819 35394 12762 13829 19789 18489 43461 46124 15.6987 -8.9682 6.53972 -6.64889 8.89063
598001 37793 35406 12813 13806 19791 18480 43434 46144 15.5492 -8.82861 6.08272 -6.70573 9.04801
599001 37753 35414 12838 13790 19797 18412 43443 46220 15.6531 -8.65308 5.83043 -7.08973 9.26747
600001 37727 35423 12865 13785 19760 18435 43479 46193 15.2458 -8.52468 5.632 -6.78403 9.05662
601001 37601 35468 12861 13819 19752 18387 43617 46162 14.7534 -7.89679 5.86147 -6.99382 8.48719
602001 37523 35566 12882 13796 19722 18410 43704 46064 13.8167 -7.24471 5.59231 -6.72304 7.87025
603001 37494 35596 12916 13763 19720 18444 43701 46033 13.3957 -7.02643 5.18201 -6.53595 7.77827
604001 37520 35563 12944 13771 19704 18460 43663 46042 13.4776 -7.24501 5.05615 -6.37215 7.93645
605001 37473 35566 12960 13771 19631 18502 43767 45997 12.7758 -7.06217 4.95677 -5.78582 7.43651
606001 37422 35621 12993 13761 19556 18554 43860 45900 11.7967 -6.66977 4.69174 -5.13702 6.80251
607001 37398 35683 13061 13730 19568 18618 43804 45805 11.1924 -6.34992 4.08366 -4.86581 6.67796
608001 37446 35670 13054 13750 19597 18617 43734 45799 11.5746 -6.57399 4.24758 -5.01749 6.89468
609001 37443 35705 13078 13768 19645 18623 43664 45741 11.6006 -6.43444 4.20619 -5.23037 6.93713
610001 37397 35712 13052 13796 19558 18640 43823 45689 10.9733 -6.24012 4.5356 -4.70303 6.22773
611001 37391 35670 13017 13855 19498 18642 43924 45670 10.9503 -6.37535 5.107 -4.38913 5.82396
612001 37351 35699 13002 13870 19406 18699 44071 45569 10.1758 -6.12054 5.29001 -3.62784 4.99414
613001 37326 35703 12997 13857 19384 18701 44123 45576 9.96977 -6.01411 5.24296 -3.5058 4.84225
614001 37278 35717 12985 13854 19394 18687 44173 45579 9.83209 -5.78604 5.29937 -3.62897 4.68392
615001 37217 35767 13027 13808 19293 18736 44293 45526 8.75339 -5.37559 4.76257 -2.86226 4.10492
616001 37102 35811 13072 13787 19202 18807 44454 45432 7.52582 -4.78936 4.35772 -2.03206 3.25285
617001 37023 35835 13105 13791 19140 18829 44562 45382 6.8477 -4.40958 4.17788 -1.60204 2.72496
618001 36902 35905 13139 13765 19067 18857 44722 45310 5.76379 -3.70326 3.81146 -1.08434 1.95042
619001 36869 35944 13136 13787 18989 18895 44836 45211 5.41174 -3.43627 3.96247 -0.488934 1.24044
620001 36861 35954 13126 13775 18950 18956 44893 45152 5.26317 -3.36952 3.95191 0.0248335 0.853895
621001 36896 35915 13121 13763 18947 18973 44866 45186 5.45007 -3.64386 3.91047 0.127532 1.05713
622001 36814 35966 13149 13722 18855 19030 45012 45119 4.79942 -3.15163 3.49049 0.893105 0.347179
623001 36793 35996 13150 13723 18856 19041 45031 45077 4.67664 -2.9624 3.49036 0.944331 0.144003
624001 36752 36006 13151 13715 18810 19087 45117 45029 4.64751 -2.77395 3.4359 1.41692 -0.302327
625001 36752 36005 13128 13722 18750 19150 45200 44960 5.06663 -2.77767 3.62002 2.04868 -0.808526
626001 36701 36052 13158 13665 18784 19112 45188 45008 4.30937 -2.41324 3.09135 1.67979 -0.607263
627001 36704 36079 13174 13635 18816 19143 45137 44980 4.04778 -2.32379 2.81122 1.67325 -0.530897
628001 36647 36122 13241 13576 18775 19139 45168 45000 3.4322 -1.9533 2.04138 1.86427 -0.567394
629001 36564 36147 13303 13519 18794 19109 45170 45062 2.62259 -1.55356 1.31457 1.61285 -0.367455
630001 36563 36152 13316 13488 18779 19119 45173 45078 2.56455 -1.53127 1.04627 1.74138 -0.324145
631001 36502 36163 13385 13417 18755 19113 45189 45144 2.24198 -1.26468 0.191151 1.83457 -0.157644
632001 36466 36123 13396 13435 18747 19111 45222 45168 2.2824 -1.28019 0.23378 1.86565 -0.187532
633001 36369 36134 13445 13428 18758 19102 45259 45173 1.99492 -0.87984 -0.108023 1.76282 -0.2939
634001 36328 36097 13455 13425 18748 19107 45300 45208 2.06597 -0.865446 -0.187301 1.84003 -0.313737
635001 36278 36106 13478 13406 18751 19145 45324 45180 2.21966 -0.646396 -0.443444 2.01882 -0.486591
636001 36192 36153 13502 13421 18778 19163 45359 45100 2.2165 -0.152082 -0.497976 1.97141 -0.869065
637001 36098 36239 13559 13389 18771 19169 45403 45040 2.64181 0.517172 -1.03991 2.03818 -1.21495
638001 36147 36188 13520 13417 18779 19161 45385 45071 2.31368 0.145355 -0.631896 1.95604 -1.05195
639001 36141 36224 13524 13400 18799 19162 45367 45051 2.28947 0.301451 -0.760028 1.85797 -1.05882
640001 36173 36194 13535 13418 18815 19155 45308 45070 2.04575 0.070976 -0.716984 1.73972 -0.799598
641001 36204 36148 13534 13413 18789 19119 45304 45157 1.92306 -0.215275 -0.74143 1.68979 -0.49668
642001 36269 36157 13540 13414 18842 19113 45180 45153 1.64471 -0.423266 -0.771789 1.38589 -0.0977559
643001 36316 36190 13501 13380 18869 19119 45145 45148 1.55203 -0.475028 -0.742329 1.27754 0.00207351
644001 36358 36165 13449 13344 18877 19130 45147 45198 1.62415 -0.723762 -0.645787 1.2926 0.161763
645001 36462 36175 13373 13353 18850 19187 45146 45121 2.03507 -1.07081 -0.125927 1.72365 -0.0898155
646001 36494 36201 13382 13336 18877 19232 45078 45067 2.13737 -1.09264 -0.285013 1.81422 -0.0432302
647001 36519 36230 13380 13334 18878 19162 45054 45110 1.83909 -1.0774 -0.285034 1.45184 0.179901
648001 36455 36295 13417 13309 18868 19174 45091 45058 1.80601 -0.599132 -0.664216 1.56459 -0.116501
649001 36442 36260 13444 13282 18869 19154 45076 45139 1.90203 -0.679717 -0.99381 1.45816 0.20448
650001 36456 36256 13500 13250 18859 19193 45016 45136 2.44498 -0.746438 -1.53141 1.70879 0.394391
651001 36361 36337 13523 13234 18834 19244 45113 45020 2.76404 -0.0937435 -1.76964 2.09767 -0.315036
652001 36306 36386 13574 13169 18818 19308 45133 44972 3.57863 0.291985 -2.47944 2.50606 -0.541617
653001 36282 36440 13588 13166 18813 19390 45148 44839 4.09577 0.581164 -2.58286 2.94864 -1.03535
654001 36274 36409 13549 13219 18809 19399 45201 44808 3.89174 0.498381 -2.01844 3.01667 -1.31257
655001 36337 36331 13534 13278 18831 19429 45133 44797 3.61204 -0.0222577 -1.56342 3.05723 -1.12044
656001 36340 36264 13551 13296 18859 19399 45085 44876 3.25716 -0.282055 -1.5563 2.76079 -0.696818
657001 36363 36189 13553 13338 18871 19346 45048 44962 2.84995 -0.645988 -1.3111 2.42977 -0.286651
658001 36278 36178 13612 13323 18808 19321 45137 45013 3.21115 -0.371503 -1.76092 2.62718 -0.412989
659001 36197 36150 13647 13361 18784 19334 45205 44992 3.39086 -0.179454 -1.74317 2.81364 -0.714499
660001 36172 36049 13685 13395 18778 19318 45198 45075 3.33721 -0.462405 -1.76517 2.76323 -0.414657
661001 36068 36112 13760 13323 18775 19335 45231 45067 3.95028 0.160244 -2.65758 2.86603 -0.549715
662001 36063 36075 13748 13312 18760 19366 45263 45084 4.12477 0.0411495 -2.65263 3.10101 -0.599471
663001 36067 36037 13717 13318 18817 19334 45233 45148 3.60377 -0.115251 -2.42882 2.64434 -0.286689
664001 36053 36083 13687 13306 18782 19369 45312 45079 3.87589 0.108168 -2.32115 3.00272 -0.778935
665001 36054 36169 13607 13302 18765 19409 45408 44957 4.09333 0.424386 -1.86146 3.29354 -1.50424
666001 36052 36199 13574 13307 18717 19515 45491 44816 4.96514 0.543352 -1.63066 4.07864 -2.25013
667001 35985 36246 13600 13310 18681 19578 45569 44703 5.77985 0.968781 -1.76927 4.5842 -2.88495
668001 35926 36353 13606 13288 18625 19604 45678 44591 6.66657 1.58707 -1.93982 5.00624 -3.61926
669001 35863 36374 13591 13306 18576 19588 45805 44568 7.09942 1.90008 -1.73849 5.17942 -4.11614
670001 35817 36431 13599 13318 18527 19630 45892 44457 7.9264 2.28313 -1.71347 5.64575 -4.77541
671001 35830 36496 13645 13302 18438 19706 45922 44332 8.98115 2.47526 -2.09021 6.49155 -5.29386
672001 35822 36525 13610 13312 18447 19769 45956 44230 9.42836 2.61246 -1.81692 6.76166 -5.74872
673001 35827 36622 13628 13247 18460 19798 45920 44169 9.74434 2.95241 -2.3248 6.83975 -5.83511
674001 35891 36657 13600 13246 18469 19846 45875 44087 9.88839 2.84272 -2.16127 7.0339 -5.96258
675001 35939 36728 13579 13249 18516 19862 45801 43997 9.80176 2.92571 -2.01546 6.86988 -6.02142
676001 35912 36812 13576 13239 18571 19844 45776 43941 9.75139 3.33617 -2.0587 6.49412 -6.12763
677001 35846 36866 13580 13244 18555 19816 45854 43910 10.1024 3.78148 -2.05225 6.43658 -6.48984
678001 35775 36944 13603 13241 18536 19796 45921 43855 10.613 4.33383 -2.21017 6.43475 -6.89658
679001 35815 36988 13621 13206 18565 19833 45835 43809 10.6292 4.34734 -2.53374 6.4709 -6.76673
680001 35917 36997 13644 13183 18569 19850 45706 43806 10.3422 3.99962 -2.81459 6.53546 -6.35057
681001 35903 36967 13719 13155 18562 19825 45652 43889 10.1804 3.94155 -3.44043 6.44631 -5.89171
682001 35877 36979 13766 13147 18517 19832 45676 43878 10.5876 4.08271 -3.7732 6.71504 -6.00824
683001 35813 37013 13797 13149 18530 19836 45696 43837 10.8817 4.44789 -3.94683 6.66847 -6.21148
684001 35742 37038 13813 13160 18524 19770 45757 43867 10.9218 4.80514 -3.9753 6.36813 -6.31188
685001 35702 37008 13824 13191 18513 19697 45797 43939 10.6512 4.84454 -3.85052 6.05794 -6.20111
686001 35659 37027 13851 13177 18493 19666 45833 43965 10.8384 5.0753 -4.09898 6.00568 -6.23234
687001 35674 37023 13805 13206 18496 19693 45861 43913 10.8676 5.00445 -3.64393 6.12613 -6.50018
688001 35651 37064 13778 13180 18496 19713 45911 43878 11.2034 5.24117 -3.64142 6.22684 -6.7833
689001 35675 37056 13781 13190 18482 19673 45898 43916 10.9584 5.12194 -3.59792 6.09814 -6.61218
690001 35667 37027 13746 13188 18582 19578 45841 44042 9.95022 5.04535 -3.39931 5.09951 -5.99924
691001 35676 36963 13685 13224 18651 19525 45824 44121 9.10791 4.77876 -2.80814 4.47575 -5.67445
692001 35645 36926 13727 13264 18698 19436 45765 44208 8.47234 4.75637 -2.81747 3.78006 -5.18945
693001 35632 36866 13726 13307 18665 19371 45812 44290 8.14323 4.58421 -2.54767 3.62085 -5.06913
694001 35630 36812 13709 13301 18609 19355 45887 44366 8.10808 4.39278 -2.48182 3.82957 -5.06156
695001 35616 36783 13728 13322 18560 19349 45931 44380 8.24396 4.33834 -2.46783 4.0532 -5.15976
696001 35571 36788 13709 13332 18506 19361 46049 44353 8.76629 4.52541 -2.29188 4.39461 -5.63942
697001 35504 36746 13732 13371 18540 19329 46059 44388 8.57141 4.62183 -2.19207 4.05534 -5.55489
698001 35460 36719 13755 13420 18527 19305 46093 44390 8.61057 4.68738 -2.03144 4.00077 -5.66017
699001 35478 36687 13760 13402 18531 19304 46066 44441 8.36314 4.50171 -2.17149 3.9749 -5.40015
700001 35398 36682 13841 13361 18546 19263 46050 44528 8.39726 4.78371 -2.90959 3.68827 -5.05579
701001 35337 36680 13860 13356 18509 19268 46130 44530 8.82412 5.00683 -3.05361 3.90677 -5.31125
702001 35360 36657 13873 13380 18548 19225 46055 44572 8.28722 4.83542 -2.9849 3.48506 -4.92357
703001 35304 36641 13875 13426 18491 19239 46166 44528 8.75462 4.98696 -2.71598 3.85257 -5.43643
704001 35303 36606 13871 13456 18491 19240 46171 44532 8.62543 4.86142 -2.50901 3.85767 -5.43948
705001 35303 36588 13885 13465 18497 19276 46151 44505 8.68156 4.79489 -2.53818 4.00988 -5.46414
706001 35286 36597 13872 13451 18495 19317 46183 44469 8.98187 4.89214 -2.54549 4.22895 -5.69012
707001 35282 36576 13878 13449 18501 19327 46175 44482 8.9269 4.82957 -2.5937 4.24862 -5.62021
708001 35371 36533 13842 13457 18463 19308 46160 44536 8.49656 4.33576 -2.32872 4.34958 -5.38989
709001 35367 36566 13828 13418 18468 19292 46173 44558 8.53716 4.47284 -2.48244 4.24214 -5.35897
710001 35389 36514 13835 13434 18460 19345 46152 44541 8.53421 4.1978 -2.42689 4.55335 -5.34681
711001 35389 36535 13826 13445 18500 19314 46121 44540 8.28708 4.2755 -2.30569 4.1877 -5.24812
712001 35395 36571 13806 13416 18466 19327 46169 44520 8.62575 4.38608 -2.36232 4.43062 -5.47311
713001 35423 36542 13783 13460 18422 19422 46208 44410 9.12844 4.17363 -1.95548 5.14216 -5.97023
714001 35431 36567 13790 13481 18430 19478 46185 44308 9.45149 4.23603 -1.8697 5.38435 -6.23697
715001 35478 36619 13806 13444 18375 19496 46177 44275 9.80016 4.25175 -2.19148 5.7621 -6.32151
716001 35586 36598 13782 13427 18432 19462 46036 44347 8.85318 3.76904 -2.15071 5.29288 -5.61542
717001 35579 36596 13767 13432 18446 19426 46044 44380 8.62767 3.78789 -2.02983 5.03748 -5.53101
718001 35561 36597 13771 13425 18470 19376 46034 44436 8.31811 3.85906 -2.09664 4.65883 -5.31018
719001 35566 36681 13757 13392 18512 19372 46001 44389 8.38964 4.1506 -2.21377 4.42017 -5.35909
720001 35624 36709 13755 13362 18560 19305 45897 44458 7.71662 4.03659 -2.38512 3.83028 -4.7846
721001 35688 36703 13738 13341 18626 19255 45784 44534 6.91347 3.77598 -2.41038 3.23433 -4.15538
722001 35682 36708 13752 13342 18613 19253 45789 44530 7.00806 3.81689 -2.48869 3.2915 -4.1853
723001 35722 36694 13766 13287 18630 19236 45719 44616 6.68534 3.61674 -2.90936 3.11763 -3.66456
724001 35694 36732 13810 13259 18634 19289 45699 44553 7.20812 3.86173 -3.34611 3.36691 -3.80939
725001 35652 36736 13862 13226 18657 19279 45666 44592 7.35821 4.0337 -3.86139 3.1969 -3.5696
726001 35714 36736 13871 13227 18694 19252 45558 44618 6.90838 3.80165 -3.90927 2.86793 -3.125
727001 35704 36811 13858 13221 18719 19193 45556 44608 6.91213 4.1156 -3.86811 2.43781 -3.15185
728001 35739 36797 13848 13242 18686 19190 45564 44604 6.77609 3.93307 -3.67898 2.59311 -3.19175
729001 35785 36834 13795 13212 18743 19157 45514 44630 6.39762 3.89742 -3.54468 2.12999 -2.93904
730001 35802 36910 13799 13185 18808 19155 45428 44583 6.4776 4.11374 -3.73491 1.78436 -2.81123
731001 35842 36971 13786 13158 18836 19208 45373 44496 6.65872 4.18871 -3.82298 1.91064 -2.9202
732001 35909 37005 13774 13195 18867 19225 45287 44408 6.39403 4.06361 -3.52282 1.83771 -2.92972
733001 35948 36982 13785 13222 18894 19269 45210 44360 6.17638 3.83358 -3.42298 1.92303 -2.83487
734001 35941 37022 13768 13226 18951 19261 45177 44324 6.12723 4.00672 -3.29599 1.58928 -2.846
735001 35919 37057 13762 13202 18984 19241 45172 44333 6.24251 4.21737 -3.40744 1.31793 -2.79914
736001 35967 37028 13723 13224 19040 19275 45107 44306 5.76882 3.93182 -3.03692 1.20399 -2.6735
737001 36011 36975 13719 13255 19054 19297 45053 44306 5.33838 3.57301 -2.82229 1.24429 -2.49366
738001 36000 37007 13725 13230 19103 19264 45009 44332 5.36521 3.73164 -3.01211 0.825391 -2.25972
739001 35985 36979 13718 13249 19150 19205 44984 44400 5.05891 3.68461 -2.85311 0.284269 -1.94812
740001 36052 36964 13652 13269 19109 19174 45024 44426 4.57692 3.37983 -2.3314 0.335642 -1.9942
741001 36080 36915 13630 13286 19144 19145 44983 44487 4.0863 3.09532 -2.0939 0.00854184 -1.65298
742001 36120 36929 13569 13312 19129 19184 45019 44408 3.95854 2.99799 -1.56463 0.284423 -2.03793
743001 36128 36909 13531 13335 19125 19195 45053 44394 3.84243 2.89463 -1.19291 0.361024 -2.19819
744001 36159 36855 13477 13341 19111 19189 45090 44448 3.47653 2.58051 -0.827597 0.401996 -2.14026
745001 36154 36871 13419 13365 19119 19220 45145 44377 3.74211 2.65803 -0.327081 0.519259 -2.56158
746001 36124 36853 13432 13384 19116 19175 45165 44421 3.69296 2.70332 -0.290244 0.304945 -2.48047
747001 36125 36797 13438 13364 19108 19159 45166 44513 3.3496 2.49326 -0.449136 0.264144 -2.17531
748001 36091 36723 13425 13389 19104 19124 45217 44597 3.13435 2.34685 -0.216972 0.105724 -2.06354
749001 36117 36717 13402 13421 19145 19056 45173 44639 2.88766 2.22797 0.118884 -0.45193 -1.77661
750001 36161 36688 13430 13393 19175 19034 45071 44718 2.40239 1.95728 -0.223041 -0.717899 -1.17279
751001 36241 36628 13401 13387 19172 19006 45023 44812 1.81105 1.43837 -0.0826665 -0.846141 -0.698713
752001 36208 36624 13410 13386 19155 19015 45064 44808 1.90794 1.5462 -0.143744 -0.713159 -0.848677
753001 36216 36652 13406 13364 19162 18970 45053 44847 2.02814 1.61991 -0.25383 -0.9798 -0.681783
754001 36201 36707 13416 13353 19150 18946 45070 44827 2.32577 1.87871 -0.382182 -1.04176 -0.805199
755001 36146 36663 13417 13373 19105 18968 45169 44829 2.34963 1.92075 -0.265947 -0.698696 -1.12808
756001 36167 36594 13407 13371 19107 18895 45156 44973 2.02693 1.58773 -0.217125 -1.08409 -0.604297
757001 36188 36579 13363 13382 19118 18833 45168 45039 2.10693 1.45421 0.119053 -1.45954 -0.424238
758001 36170 36560 13345 13421 19127 18825 45195 45027 2.24121 1.45087 0.467409 -1.54679 -0.554044
759001 36168 36484 13358 13437 19200 18758 45110 45155 2.60319 1.17473 0.484051 -2.26696 0.152414
760001 36192 36412 13332 13477 19225 18736 45087 45209 2.81333 0.818839 0.887012 -2.5081 0.408635
761001 36249 36283 13330 13523 19174 18743 45083 45285 2.59879 0.128607 1.1792 -2.21169 0.674597
762001 36285 36293 13304 13532 19173 18754 45074 45255 2.6324 0.0320566 1.39323 -2.14978 0.60487
763001 36249 36312 13286 13545 19155 18784 45145 45194 2.49186 0.233878 1.58118 -1.90472 0.163027
764001 36271 36391 13254 13511 19191 18759 45119 45174 2.7599 0.445172 1.5709 -2.21757 0.183036
765001 36343 36486 13220 13489 19255 18719 45017 45141 3.27508 0.529888 1.64598 -2.75056 0.412971
766001 36404 36476 13160 13505 19328 18713 44943 45141 3.86168 0.266703 2.11275 -3.15318 0.659692
767001 36440 36473 13174 13465 19393 18697 44828 45200 4.17715 0.122211 1.78293 -3.56618 1.23981
768001 36402 36479 13228 13442 19402 18686 44803 45228 4.15506 0.285222 1.3104 -3.66876 1.41642
769001 36315 36478 13275 13429 19435 18660 44810 45268 4.39867 0.604147 0.942394 -3.97071 1.52601
770001 36256 36454 13297 13454 19396 18666 44886 45261 4.1257 0.734291 0.959908 -3.74177 1.24898
771001 36196 36435 13339 13435 19344 18654 44956 45311 3.88026 0.886823 0.586698 -3.53972 1.18158
772001 36177 36425 13318 13452 19314 18693 45026 45265 3.50672 0.920402 0.818994 -3.18537 0.795382
773001 36128 36439 13381 13398 19330 18626 44998 45372 3.99364 1.15686 0.105319 -3.61183 1.24675
774001 36046 36434 13377 13383 19325 18621 45089 45397 4.02341 1.44355 0.0381125 -3.61231 1.02654
775001 36111 36440 13332 13393 19335 18594 45059 45408 4.17781 1.22381 0.374569 -3.8031 1.16297
776001 36073 36467 13299 13412 19360 18624 45105 45331 4.17659 1.46642 0.693552 -3.77383 0.755466
777001 36027 36594 13307 13368 19332 18660 45171 45212 4.05848 2.10756 0.375632 -3.44509 0.140324
778001 36098 36590 13309 13380 19367 18679 45063 45185 4.01563 1.82842 0.436752 -3.52466 0.410056
779001 36154 36602 13302 13390 19427 18690 44954 45152 4.21115 1.66445 0.540777 -3.77236 0.663562
780001 36216 36632 13304 13383 19534 18662 44783 45157 4.90632 1.54484 0.485734 -4.4592 1.25102
781001 36278 36605 13304 13388 19574 18663 44681 45178 5.11712 1.2148 0.516293 -4.65626 1.66191
782001 36348 36652 13288 13403 19612 18637 44588 45143 5.48159 1.12635 0.704628 -4.98448 1.85409
783001 36383 36666 13303 13398 19591 18658 44559 45113 5.25505 1.04827 0.5821 -4.76972 1.85136
784001 36427 36637 13319 13409 19648 18591 44442 45198 6.04153 0.778095 0.551223 -5.40447 2.52637
785001 36494 36557 13300 13417 19716 18561 44326 45300 6.78258 0.234281 0.716521 -5.90268 3.25475
786001 36536 36562 13311 13397 19771 18517 44218 45359 7.476 0.0973546 0.526953 -6.40778 3.81362
787001 36617 36544 13238 13422 19812 18544 44169 45325 7.62845 -0.2687 1.12763 -6.47358 3.86553
788001 36673 36482 13250 13435 19851 18561 44062 45357 7.99114 -0.704986 1.13322 -6.58111 4.33199
789001 36743 36359 13248 13450 19851 18598 43994 45428 8.20824 -1.41907 1.23699 -6.38925 4.79675
790001 36809 36354 13231 13433 19838 18595 43958 45453 8.34016 -1.68095 1.23778 -6.33957 5.00104
791001 36889 36279 13245 13487 19806 18560 43896 45509 8.76603 -2.25392 1.48085 -6.36042 5.39585
792001 36951 36281 13237 13487 19802 18503 43846 45564 9.24832 -2.47465 1.53001 -6.63628 5.74686
793001 36991 36278 13202 13460 19837 18464 43806 45633 9.79665 -2.63289 1.58078 -7.01475 6.11038
794001 36987 36332 13178 13456 19849 18436 43822 45611 9.83311 -2.41779 1.70416 -7.22064 5.98352
795001 36977 36461 13145 13422 19816 18460 43898 45492 9.10916 -1.9029 1.70017 -6.93014 5.33276
796001 36975 36590 13152 13358 19834 18476 43875 45411 8.84181 -1.41827 1.26592 -6.93728 5.14176
797001 37017 36576 13154 13331 19839 18432 43825 45497 9.31937 -1.62682 1.08689 -7.19302 5.59313
798001 37042 36669 13171 13334 19759 18393 43863 45440 8.92449 -1.37506 1.00049 -6.99432 5.27582
799001 37007 36783 13203 13361 19692 18346 43933 45346 8.46239 -0.825813 0.968695 -6.90224 4.72766
800001 37023 36875 13175 13427 19660 18323 43977 45211 8.17431 -0.545636 1.54433 -6.86106 4.13069
801001 37035 37050 13199 13418 19702 18266 43899 45102 8.50746 0.0539063 1.34162 -7.37048 4.03112
802001 37059 37164 13182 13445 19721 18279 43873 44948 8.39506 0.384204 1.61102 -7.39817 3.60572
803001 37043 37182 13203 13500 19667 18258 43922 44896 8.16041 0.508995 1.81679 -7.23602 3.26688
804001 37024 37282 13190 13562 19572 18236 44049 44756 7.67507 0.945267 2.27367 -6.87177 2.37115
805001 36947 37372 13228 13627 19516 18195 44142 44644 7.58095 1.55299 2.43118 -6.80677 1.67819
806001 36917 37506 13279 13592 19416 18186 44222 44554 7.05574 2.15425 1.90655 -6.34647 1.10904
807001 36869 37698 13301 13604 19372 18182 44292 44354 7.09792 3.03107 1.84437 -6.14412 0.203009
808001 36784 37880 13310 13626 19357 18196 44383 44136 7.50856 4.00622 1.92252 -5.99455 -0.835413
809001 36787 38024 13327 13626 19362 18185 44358 44003 7.8799 4.51779 1.81836 -6.0776 -1.19948
810001 36775 38201 13342 13608 19360 18165 44357 43864 8.39985 5.20304 1.61745 -6.1723 -1.66503
811001 36753 38381 13365 13605 19335 18136 44381 43716 8.98868 5.9345 1.45852 -6.1974 -2.24569
812001 36703 38522 13411 13592 19291 18135 44429 43589 9.42977 6.62729 1.09858 -5.97885 -2.83655
813001 36674 38618 13392 13634 19300 18110 44468 43476 10.0699 7.07988 1.46917 -6.15591 -3.35029
814001 36682 38743 13361 13654 19264 18113 44527 43328 10.55 7.49965 1.77976 -5.9569 -4.05037
815001 36679 38839 13351 13698 19249 18097 44555 43204 11.0709 7.85528 2.10697 -5.96455 -4.56567
816001 36655 38924 13385 13761 19224 18049 44570 43103 11.6153 8.24981 2.27993 -6.08866 -4.95837
817001 36625 39023 13444 13759 19246 18005 44519 43050 12.0685 8.71506 1.90769 -6.43241 -4.96805
818001 36620 39050 13459 13804 19242 17959 44513 43024 12.3279 8.83012 2.08728 -6.65449 -5.03656
819001 36604 39027 13465 13914 19280 17886 44485 43010 12.7334 8.80694 2.71137 -7.23339 -4.99044
820001 36589 39107 13454 13997 19326 17742 44465 42991 13.676 9.14845 3.27515 -8.2298 -4.98817
821001 36566 39179 13453 14051 19322 17697 44493 42910 14.2529 9.49067 3.60363 -8.44834 -5.35837
822001 36536 39136 13451 14190 19314 17661 44533 42850 14.6766 9.44799 4.44277 -8.59897 -5.69726
823001 36563 39123 13419 14279 19296 17588 44556 42847 15.0267 9.30172 5.16524 -8.89595 -5.78457
824001 36521 39225 13440 14299 19335 17527 44538 42786 15.7149 9.82125 5.15542 -9.41945 -5.9327
825001 36540 39296 13440 14347 19312 17449 44542 42745 16.1608 10.0042 5.43891 -9.71923 -6.08627
826001 36573 39330 13421 14434 19331 17373 44509 42700 16.702 10.0035 6.06738 -10.2226 -6.12961
827001 36547 39436 13465 14445 19424 17248 44398 42708 17.4974 10.477 5.86386 -11.3655 -5.73003
828001 36585 39545 13480 14448 19473 17172 44296 42672 17.9847 10.7242 5.79016 -12.0227 -5.51077
829001 36616 39621 13437 14535 19489 17153 44292 42528 18.6095 10.8797 6.56289 -12.206 -5.99059
830001 36580 39631 13433 14576 19462 17074 44359 42556 19.0334 11.0482 6.82744 -12.4957 -6.11961
831001 36596 39654 13433 14675 19425 17057 44380 42451 19.3411 11.0707 7.40589 -12.4002 -6.55016
832001 36613 39663 13404 14754 19385 17044 44432 42376 19.6422 11.0398 8.04292 -12.2678 -6.98207
833001 36684 39685 13380 14838 19361 16975 44409 42339 19.9833 10.8558 8.67728 -12.5196 -7.03201
834001 36705 39735 13361 14909 19299 16943 44469 42250 20.3669 10.9557 9.20458 -12.3782 -7.53916
835001 36705 39779 13344 14963 19248 16873 44536 42223 20.8319 11.1092 9.61907 -12.5005 -7.85916
836001 36701 39836 13329 15010 19266 16788 44537 42204 21.4753 11.3258 9.98193 -13.0546 -7.92788
837001 36697 39910 13277 15076 19239 16700 44620 42152 22.3265 11.6024 10.6802 -13.3972 -8.38476
838001 36728 40008 13250 15095 19297 16622 44558 42113 22.9887 11.8345 10.955 -14.1185 -8.31151
839001 36747 40027 13223 15183 19276 16559 44587 42069 23.5486 11.8316 11.6255 -14.3569 -8.56021
840001 36760 40057 13223 15247 19232 16488 44618 42046 23.9275 11.8896 11.9918 -14.5229 -8.74326
841001 36818 40030 13222 15308 19187 16419 44606 42081 23.9896 11.5806 12.3462 -14.6733 -8.58245
842001 36802 40055 13226 15348 19179 16328 44626 42107 24.4407 11.7278 12.5496 -15.1342 -8.55982
843001 36856 40109 13202 15439 19151 16265 44624 42025 25.0069 11.7196 13.2145 -15.3396 -8.83573
844001 36885 40098 13195 15514 19166 16187 44587 42039 25.4438 11.574 13.6828 -15.8479 -8.66362
845001 36986 40064 13166 15541 19233 16085 44448 42148 25.7124 11.0826 14.0137 -16.755 -7.82237
846001 37007 40067 13196 15562 19220 15993 44410 42216 25.8349 11.0161 13.9482 -17.2009 -7.46086
847001 36977 40170 13224 15578 19275 15875 44357 42215 26.5786 11.4897 13.8669 -18.1391 -7.28645
848001 37014 40164 13237 15684 19260 15810 44322 42180 26.9822 11.3326 14.3852 -18.4267 -7.2894
849001 37032 40134 13216 15820 19264 15744 44321 42140 27.6979 11.1607 15.278 -18.8171 -7.42375
850001 37030 40117 13235 15908 19272 15682 44296 42131 28.1361 11.1081 15.6541 -19.2061 -7.37079
851001 36986 40139 13252 15992 19292 15543 44303 42164 29.0174 11.3473 16.0188 -20.0908 -7.28067
852001 37010 40179 13232 16087 19261 15464 44330 42108 29.6718 11.4002 16.6699 -20.3801 -7.56419
853001 36984 40203 13260 16163 19207 15433 44382 42039 29.9226 11.5803 16.9203 -20.2815 -7.97653
854001 36946 40243 13277 16233 19171 15399 44439 41963 30.3225 11.8609 17.2038 -20.2913 -8.42989
855001 36921 40367 13284 16269 19136 15329 44492 41873 30.9045 12.3893 17.36 -20.5107 -8.91828
856001 36944 40379 13310 16321 19191 15263 44388 41875 31.2984 12.3469 17.4881 -21.1658 -8.56263
857001 36897 40471 13337 16387 19192 15216 44407 41764 31.9151 12.843 17.687 -21.4387 -9.01005
858001 36849 40531 13350 16482 19192 15150 44442 41675 32.6905 13.2303 18.1297 -21.8155 -9.43543
859001 36898 40561 13354 16555 19199 15094 44382 41628 33.0964 13.1553 18.5053 -22.1712 -9.39695
860001 36844 40647 13378 16620 19179 15044 44432 41526 33.6878 13.6567 18.7153 -22.3553 -9.91694
861001 36782 40816 13374 16640 19155 15045 44522 41336 34.3111 14.4765 18.8488 -22.2276 -10.8783
862001 36723 40938 13394 16680 19110 15082 44606 41137 34.6796 15.1201 18.9453 -21.7867 -11.852
863001 36695 40986 13420 16719 19060 15068 44658 41064 34.8679 15.3909 18.9998 -21.6123 -12.2804
864001 36665 41055 13400 16769 19032 14967 44736 41046 35.6222 15.7421 19.3933 -22.0491 -12.6039
865001 36638 41193 13373 16807 18985 14904 44837 40933 36.4205 16.3223 19.7639 -22.1718 -13.3355
866001 36621 41250 13382 16852 19017 14814 44813 40921 37.0441 16.5833 19.9533 -22.8541 -13.2973
867001 36687 41267 13351 16904 18949 14742 44846 40924 37.2962 16.399 20.4236 -22.9233 -13.397
868001 36693 41337 13362 16931 18944 14761 44834 40808 37.487 16.6201 20.5027 -22.7878 -13.7623
869001 36655 41559 13391 16918 18960 14709 44827 40651 38.1923 17.5302 20.256 -23.1705 -14.2886
870001 36590 41740 13367 16942 18876 14734 45000 40421 38.9382 18.3962 20.5317 -22.5963 -15.6722
871001 36585 41968 13392 16942 18830 14716 45026 40211 39.5078 19.2013 20.3797 -22.465 -16.4975
872001 36531 42204 13427 16922 18809 14683 45066 40028 40.222 20.2126 20.059 -22.5487 -17.2758
873001 36477 42391 13445 16879 18754 14644 45158 39923 40.746 21.055 19.7177 -22.492 -17.9512
874001 36414 42603 13474 16873 18739 14622 45207 39739 41.5392 22.0134 19.5093 -22.5428 -18.7649
875001 36270 42774 13522 16873 18736 14570 45306 39620 42.5017 23.1301 19.2186 -22.8299 -19.5151
876001 36298 42787 13538 16934 18763 14536 45236 39580 42.716 23.0719 19.4528 -23.1658 -19.4235
877001 36326 42891 13539 16953 18780 14457 45190 39536 43.196 23.3227 19.5495 -23.7139 -19.4269
878001 36410 42932 13513 16980 18750 14419 45162 39506 43.2857 23.1517 19.8527 -23.7822 -19.4405
879001 36491 42940 13492 17035 18718 14429 45134 39433 43.2908 22.8797 20.2767 -23.5593 -19.6068
880001 36486 43037 13498 17089 18711 14361 45140 39350 43.934 23.2282 20.5312 -23.9215 -19.9219
881001 36493 43088 13456 17181 18696 14310 45190 39257 44.7114 23.3769 21.2808 -24.1427 -20.4178
882001 36493 43190 13429 17244 18682 14302 45231 39100 45.4391 23.7233 21.7822 -24.1178 -21.1137
883001 36473 43283 13428 17259 18649 14261 45285 39033 45.9171 24.1125 21.8685 -24.189 -21.532
884001 36445 43430 13459 17254 18664 14230 45267 38922 46.4289 24.7138 21.6539 -24.4485 -21.869
885001 36433 43559 13434 17322 18657 14221 45311 38734 47.3235 25.1942 22.169 -24.4654 -22.688
886001 36424 43694 13459 17331 18690 14179 45262 38631 47.8522 25.6844 22.0663 -24.8817 -22.8937
887001 36454 43751 13396 17385 18619 14178 45366 38521 48.3809 25.7658 22.7365 -24.5224 -23.6334
888001 36420 43833 13368 17465 18625 14177 45422 38360 49.2702 26.1676 23.3323 -24.5592 -24.3979
889001 36430 43830 13386 17566 18602 14154 45417 38285 49.5831 26.1205 23.7592 -24.5765 -24.6515
890001 36483 43847 13405 17641 18636 14060 45310 38288 49.8328 25.9797 24.0395 -25.3085 -24.2889
891001 36604 43805 13366 17731 18650 13971 45214 38329 49.9613 25.3921 24.7513 -25.9078 -23.8229
892001 36580 43843 13390 17782 18672 13882 45192 38329 50.4329 25.6085 24.8744 -26.5497 -23.7499
893001 36585 43848 13395 17832 18696 13788 45158 38368 50.7918 25.6069 25.1072 -27.233 -23.4966
894001 36640 43862 13386 17854 18656 13701 45152 38419 50.874 25.4514 25.2773 -27.5476 -23.2931
895001 36631 43887 13394 17925 18654 13642 45155 38382 51.3454 25.5687 25.6014 -27.8908 -23.4363
896001 36647 43958 13406 17947 18642 13632 45140 38299 51.5695 25.7499 25.6448 -27.8884 -23.6842
897001 36678 44034 13383 17989 18664 13656 45110 38157 51.9928 25.8912 26.004 -27.8574 -24.0968
898001 36627 44188 13420 17998 18587 13626 45201 38024 52.5111 26.5958 25.827 -27.6418 -24.8793
899001 36559 44298 13420 18077 18550 13578 45306 37883 53.4891 27.2149 26.2397 -27.7397 -25.7376
900001 36551 44333 13404 18203 18510 13540 45370 37760 54.2652 27.3615 26.9927 -27.7623 -26.3953
901001 36552 44302 13423 18294 18542 13457 45318 37783 54.6096 27.254 27.3501 -28.4272 -26.1397
902001 36454 44375 13436 18320 18560 13319 45385 37822 55.4657 27.8597 27.4063 -29.3544 -26.2202
903001 36354 44481 13430 18368 18596 13215 45455 37772 56.5984 28.5832 27.691 -30.1707 -26.633
904001 36361 44481 13434 18448 18584 13191 45456 37716 56.9188 28.5574 28.0801 -30.2551 -26.8394
905001 36283 44559 13494 18480 18541 13206 45517 37591 57.2467 29.106 27.8831 -29.9429 -27.4949
906001 36286 44632 13483 18514 18512 13198 45554 37492 57.6631 29.3385 28.1247 -29.8425 -27.9771
907001 36280 44652 13465 18586 18452 13196 45638 37402 58.0863 29.4273 28.6037 -29.5457 -28.582
908001 36335 44596 13458 18663 18442 13181 45600 37396 58.0765 29.0373 29.0412 -29.5855 -28.4784
909001 36476 44490 13410 18761 18463 13128 45486 37457 57.9779 28.163 29.8326 -30.0168 -27.8799
910001 36580 44431 13351 18869 18471 13072 45433 37464 58.2757 27.5825 30.7403 -30.4 -27.6792
+927
View File
@@ -0,0 +1,927 @@
# input : borbu1.fst
# include : borbu1.lst
# selector : count
# mixer : basic
# distance : chi
# phase : 1
# alphabet : ACGT
# excluded : X
# seqname : borbu1
# seqlength : 910724
# unmasked : 284128
# valid : 284117
# window : 227680
# step : 1000
#
# pos LeftA RightA LeftC
1 10620 11521 5303 8176
1001 10649 11516 5252 8212
2001 10687 11570 5253 8172
3001 10714 11567 5286 8173
4001 10772 11466 5269 8151
5001 10793 11397 5270 8210
6001 10792 11385 5292 8237
7001 10795 11327 5319 8235
8001 10824 11333 5349 8244
9001 10903 11285 5292 8291
10001 11016 11179 5241 8375
11001 11095 11098 5211 8447
12001 11171 11042 5179 8484
13001 11283 10941 5148 8540
14001 11361 10853 5112 8618
15001 11430 10812 5058 8659
16001 11456 10799 5070 8687
17001 11555 10741 5077 8726
18001 11604 10757 5096 8698
19001 11649 10798 5118 8653
20001 11666 10808 5121 8654
21001 11639 10889 5120 8642
22001 11593 10982 5195 8571
23001 11569 10959 5246 8597
24001 11579 10902 5255 8635
25001 11506 10911 5343 8559
26001 11461 10893 5404 8578
27001 11490 10863 5397 8625
28001 11488 10821 5415 8666
29001 11453 10788 5481 8683
30001 11477 10759 5492 8695
31001 11510 10719 5487 8735
32001 11492 10698 5530 8765
33001 11457 10718 5589 8771
34001 11429 10707 5639 8756
35001 11406 10702 5669 8769
36001 11370 10680 5741 8781
37001 11332 10673 5790 8794
38001 11298 10699 5857 8755
39001 11258 10744 5911 8714
40001 11235 10734 5947 8734
41001 11258 10667 5962 8780
42001 11242 10639 6011 8805
43001 11211 10652 6076 8791
44001 11163 10724 6132 8737
45001 11128 10771 6169 8698
46001 11114 10784 6199 8675
47001 11045 10866 6218 8662
48001 11019 10888 6211 8706
49001 11005 10850 6224 8732
50001 11009 10839 6240 8748
51001 10957 10858 6308 8741
52001 10918 10896 6412 8689
53001 10866 10942 6485 8665
54001 10806 10974 6557 8625
55001 10784 10961 6625 8625
56001 10742 10986 6692 8574
57001 10682 11053 6747 8533
58001 10681 11003 6762 8558
59001 10626 11033 6809 8553
60001 10577 11045 6867 8559
61001 10546 11076 6927 8549
62001 10511 11089 6998 8547
63001 10530 11118 7023 8524
64001 10572 11082 7027 8571
65001 10589 11011 7030 8651
66001 10583 10963 7032 8694
67001 10612 10867 7047 8742
68001 10646 10773 7049 8817
69001 10675 10690 7056 8890
70001 10688 10671 7066 8894
71001 10688 10683 7061 8896
72001 10781 10653 7044 8896
73001 10875 10638 7006 8914
74001 10971 10601 6982 8948
75001 11073 10505 6936 8986
76001 11192 10393 6871 9045
77001 11308 10352 6825 9051
78001 11400 10349 6780 9063
79001 11389 10351 6824 9073
80001 11384 10297 6843 9078
81001 11375 10327 6845 9101
82001 11391 10334 6841 9114
83001 11405 10330 6867 9124
84001 11374 10440 6929 9064
85001 11386 10548 6956 8986
86001 11376 10667 6964 8937
87001 11407 10638 6951 8956
88001 11442 10623 6968 8960
89001 11482 10595 6964 8944
90001 11498 10676 6963 8905
91001 11501 10759 6990 8825
92001 11485 10849 7054 8754
93001 11445 10863 7109 8669
94001 11388 10924 7181 8612
95001 11338 10988 7212 8595
96001 11285 11077 7263 8538
97001 11251 11137 7296 8500
98001 11244 11186 7351 8451
99001 11205 11251 7386 8421
100001 11257 11254 7409 8455
101001 11338 11250 7407 8461
102001 11323 11340 7427 8408
103001 11315 11427 7502 8342
104001 11270 11515 7581 8268
105001 11256 11553 7629 8236
106001 11240 11534 7688 8235
107001 11260 11607 7763 8176
108001 11276 11636 7782 8092
109001 11344 11627 7812 8075
110001 11433 11652 7863 8068
111001 11502 11668 7957 8076
112001 11491 11670 8017 8094
113001 11447 11688 8087 8110
114001 11537 11654 8190 8095
115001 11524 11656 8204 8109
116001 11576 11651 8171 8103
117001 11547 11678 8161 8101
118001 11453 11722 8162 8152
119001 11381 11789 8219 8106
120001 11382 11872 8244 8027
121001 11331 11961 8234 7994
122001 11321 11970 8241 7961
123001 11270 11951 8311 7951
124001 11162 11971 8387 7933
125001 11090 11997 8449 7897
126001 11024 12007 8493 7906
127001 10929 12012 8551 7902
128001 10840 12026 8627 7892
129001 10815 12026 8656 7858
130001 10792 12084 8693 7788
131001 10742 12102 8727 7791
132001 10775 12037 8685 7801
133001 10799 12033 8653 7781
134001 10816 12080 8656 7733
135001 10892 12041 8633 7744
136001 10985 12043 8571 7738
137001 10945 12069 8606 7700
138001 10913 12047 8617 7739
139001 10914 12097 8551 7732
140001 10883 12162 8589 7661
141001 10851 12188 8636 7621
142001 10822 12251 8657 7560
143001 10796 12283 8677 7487
144001 10752 12316 8705 7451
145001 10713 12344 8744 7424
146001 10698 12425 8770 7355
147001 10716 12492 8782 7299
148001 10703 12528 8763 7292
149001 10695 12534 8771 7294
150001 10681 12518 8790 7270
151001 10672 12571 8784 7233
152001 10702 12609 8754 7208
153001 10753 12628 8709 7216
154001 10721 12654 8741 7210
155001 10660 12654 8780 7210
156001 10644 12711 8806 7170
157001 10655 12704 8784 7172
158001 10742 12631 8730 7228
159001 10773 12619 8690 7272
160001 10795 12554 8662 7342
161001 10887 12548 8662 7338
162001 10879 12540 8713 7342
163001 10862 12546 8722 7315
164001 10849 12547 8763 7301
165001 10866 12521 8733 7332
166001 10910 12468 8677 7341
167001 10949 12440 8658 7383
168001 10968 12439 8620 7417
169001 10965 12403 8622 7425
170001 11003 12347 8564 7484
171001 11047 12286 8534 7537
172001 11008 12275 8561 7572
173001 11035 12267 8557 7587
174001 11049 12301 8563 7560
175001 11086 12284 8542 7544
176001 11102 12269 8543 7530
177001 11130 12217 8533 7560
178001 11069 12197 8585 7561
179001 11005 12204 8651 7555
180001 10944 12192 8697 7592
181001 10851 12193 8755 7609
182001 10757 12191 8830 7599
183001 10684 12196 8888 7595
184001 10677 12148 8895 7626
185001 10679 12085 8899 7704
186001 10649 11987 8900 7800
187001 10642 11904 8916 7873
188001 10585 11862 8967 7907
189001 10498 11850 8997 7948
190001 10382 11854 9041 7957
191001 10354 11759 9057 8030
192001 10353 11698 9061 8090
193001 10355 11697 9069 8086
194001 10299 11705 9075 8146
195001 10331 11608 9098 8217
196001 10324 11513 9113 8287
197001 10336 11469 9115 8299
198001 10462 11404 9059 8335
199001 10563 11329 8974 8395
200001 10667 11239 8927 8449
201001 10643 11241 8943 8433
202001 10615 11258 8971 8417
203001 10601 11296 8934 8430
204001 10692 11247 8898 8461
205001 10777 11197 8813 8504
206001 10866 11114 8729 8569
207001 10868 11152 8666 8608
208001 10951 11161 8614 8601
209001 11012 11171 8580 8607
210001 11089 11149 8534 8629
211001 11139 11091 8502 8677
212001 11199 11032 8445 8740
213001 11253 10980 8420 8756
214001 11257 10944 8457 8753
215001 11260 10925 8447 8730
216001 11354 10883 8398 8744
217001 11439 10816 8333 8785
218001 11532 10727 8257 8849
219001 11555 10692 8230 8892
220001 11548 10695 8220 8919
221001 11624 10611 8165 8947
222001 11625 10663 8073 8957
223001 11622 10656 8077 8961
224001 11661 10645 8061 8953
225001 11669 10680 8078 8870
226001 11671 10750 8095 8820
227001 11687 10776 8103 8760
228001 11646 10837 8099 8715
229001 11652 10862 8112 8686
230001 11663 10865 8092 8703
231001 11689 10869 8120 8690
232001 11731 10883 8143 8668
233001 11804 10851 8093 8683
234001 11889 10774 8019 8718
235001 11963 10710 7985 8785
236001 11967 10706 7964 8806
237001 11960 10739 7951 8803
238001 11975 10757 7920 8802
239001 12010 10745 7892 8822
240001 11998 10751 7913 8802
241001 12020 10761 7893 8803
242001 12028 10799 7886 8747
243001 12036 10851 7841 8740
244001 12106 10833 7785 8741
245001 12104 10918 7787 8670
246001 12029 10965 7799 8690
247001 12044 10936 7772 8725
248001 12066 10955 7740 8721
249001 12049 10972 7742 8728
250001 12057 10927 7731 8759
251001 12059 10986 7714 8731
252001 12053 11024 7749 8704
253001 12111 10995 7720 8751
254001 12176 10945 7652 8813
255001 12195 10916 7610 8854
256001 12263 10926 7543 8854
257001 12288 10941 7480 8869
258001 12323 10988 7443 8862
259001 12369 10993 7406 8865
260001 12429 10930 7348 8888
261001 12503 10881 7284 8910
262001 12531 10927 7282 8849
263001 12528 10949 7292 8834
264001 12514 10997 7257 8857
265001 12576 10917 7230 8911
266001 12612 10848 7209 8961
267001 12638 10772 7215 8997
268001 12649 10764 7210 9012
269001 12657 10790 7209 8986
270001 12722 10755 7163 8992
271001 12692 10783 7186 8956
272001 12618 10829 7238 8902
273001 12614 10863 7293 8861
274001 12550 10929 7341 8818
275001 12546 10883 7341 8857
276001 12537 10874 7338 8872
277001 12560 10825 7311 8907
278001 12545 10841 7302 8908
279001 12509 10846 7333 8912
280001 12465 10830 7343 8926
281001 12436 10842 7389 8904
282001 12435 10812 7417 8876
283001 12402 10836 7422 8887
284001 12335 10832 7496 8867
285001 12290 10820 7544 8878
286001 12278 10780 7572 8907
287001 12268 10752 7587 8916
288001 12290 10682 7555 8946
289001 12269 10635 7538 9009
290001 12247 10620 7532 9033
291001 12220 10619 7562 9035
292001 12192 10617 7562 9058
293001 12204 10611 7563 9063
294001 12190 10596 7598 9058
295001 12197 10587 7609 8999
296001 12190 10597 7593 8988
297001 12188 10571 7605 8957
298001 12142 10624 7638 8928
299001 12068 10626 7718 8896
300001 11975 10701 7809 8811
301001 11880 10763 7896 8748
302001 11852 10768 7915 8741
303001 11850 10806 7955 8704
304001 11838 10880 7966 8655
305001 11744 10926 8037 8602
306001 11703 10936 8096 8578
307001 11700 10906 8089 8614
308001 11686 10921 8155 8572
309001 11591 10992 8220 8482
310001 11501 11084 8293 8388
311001 11453 11090 8313 8358
312001 11388 11119 8347 8320
313001 11310 11162 8408 8274
314001 11244 11219 8453 8221
315001 11246 11264 8430 8181
316001 11260 11296 8415 8136
317001 11292 11243 8435 8156
318001 11239 11227 8472 8180
319001 11183 11212 8516 8209
320001 11120 11229 8579 8183
321001 11151 11203 8609 8201
322001 11152 11068 8600 8190
323001 11177 10929 8603 8123
324001 11134 10806 8636 8051
325001 11086 10707 8679 7971
326001 11029 10631 8748 7863
327001 10972 10525 8764 7806
328001 10924 10459 8740 7755
329001 10916 10390 8732 7793
330001 10873 10313 8753 7782
331001 10802 10268 8793 7718
332001 10700 10184 8861 7627
333001 10693 10141 8893 7586
334001 10682 10138 8931 7560
335001 10612 10181 8943 7566
336001 10682 10187 8964 7556
337001 10658 10231 8956 7553
338001 10649 10179 8939 7577
339001 10691 10124 8866 7636
340001 10747 10046 8814 7692
341001 10796 9993 8754 7764
342001 10834 9931 8712 7828
343001 10868 9880 8684 7862
344001 10861 9895 8708 7850
345001 10877 9919 8680 7789
346001 10874 9928 8667 7775
347001 10829 9979 8688 7743
348001 10772 10016 8725 7706
349001 10691 10077 8788 7641
350001 10715 10112 8800 7577
351001 10748 10097 8799 7515
352001 10769 10063 8802 7463
353001 10738 10038 8823 7464
354001 10757 9998 8798 7444
355001 10769 9986 8799 7425
356001 10809 9922 8737 7466
357001 10840 9850 8736 7496
358001 10841 9778 8727 7513
359001 10925 9694 8658 7541
360001 10961 9693 8694 7524
361001 10933 9665 8729 7498
362001 10966 9664 8718 7491
363001 10962 9625 8732 7490
364001 10938 9569 8767 7506
365001 11006 9539 8716 7488
366001 11019 9566 8705 7436
367001 11001 9591 8766 7388
368001 10937 9586 8832 7318
369001 10914 9524 8854 7278
370001 10934 9485 8854 7283
371001 10952 9482 8869 7247
372001 10995 9394 8859 7232
373001 10996 9386 8862 7222
374001 10918 9430 8897 7194
375001 10882 9432 8909 7176
376001 10934 9426 8839 7162
377001 10954 9458 8836 7086
378001 10991 9476 8862 7034
379001 10901 9452 8919 6950
380001 10830 9483 8971 6892
381001 10758 9449 9010 6837
382001 10768 9458 9008 6780
383001 10784 9484 8984 6735
384001 10752 9509 8990 6699
385001 10789 9523 8946 6691
386001 10836 9510 8895 6706
387001 10872 9504 8845 6700
388001 10919 9492 8824 6690
389001 10882 9540 8864 6636
390001 10862 9600 8882 6555
391001 10825 9663 8919 6511
392001 10838 9714 8891 6474
393001 10844 9763 8911 6401
394001 10834 9852 8925 6309
395001 10839 9896 8901 6232
396001 10814 9960 8883 6183
397001 10837 10006 8883 6117
398001 10827 10110 8872 6055
399001 10808 10164 8886 5977
400001 10786 10204 8905 5890
401001 10740 10287 8916 5819
402001 10677 10350 8963 5748
403001 10632 10410 9016 5658
404001 10616 10483 9035 5567
405001 10628 10544 9040 5494
406001 10619 10632 9059 5404
407001 10603 10708 9065 5322
408001 10601 10786 9052 5245
409001 10595 10873 9002 5207
410001 10598 10919 8986 5154
411001 10584 10944 8950 5160
412001 10623 10941 8924 5135
413001 10637 10990 8895 5080
414001 10720 10929 8789 5096
415001 10754 10878 8754 5093
416001 10775 10856 8735 5127
417001 10828 10774 8693 5201
418001 10891 10688 8647 5249
419001 10928 10660 8596 5192
420001 10933 10665 8587 5105
421001 10901 10680 8625 4994
422001 10937 10663 8559 4959
423001 11010 10663 8463 4972
424001 11099 10643 8386 4953
425001 11096 10647 8350 4965
426001 11135 10584 8305 5001
427001 11170 10492 8266 5031
428001 11225 10410 8210 5026
429001 11271 10376 8171 5016
430001 11285 10378 8137 4990
431001 11237 10441 8160 4929
432001 11238 10480 8189 4863
433001 11216 10510 8194 4796
434001 11231 10501 8175 4731
435001 11187 10477 8215 4732
436001 11043 10548 8182 4807
437001 10911 10603 8105 4921
438001 10789 10649 8041 5022
439001 10703 10723 7948 5036
440001 10616 10812 7848 5064
441001 10504 10928 7797 5091
442001 10450 11028 7766 5091
443001 10373 11074 7798 5063
444001 10320 11090 7772 5076
445001 10254 11121 7703 5154
446001 10169 11188 7613 5236
447001 10137 11194 7573 5256
448001 10148 11171 7552 5248
449001 10185 11159 7562 5231
450001 10194 11141 7553 5234
451001 10230 11075 7546 5259
452001 10160 11056 7577 5260
453001 10111 11101 7647 5166
454001 10042 11160 7707 5085
455001 9981 11242 7775 5008
456001 9921 11287 7841 4917
457001 9885 11310 7861 4880
458001 9900 11272 7843 4869
459001 9928 11223 7790 4936
460001 9923 11184 7775 5000
461001 9985 11163 7733 5006
462001 10019 11133 7701 5022
463001 10077 11087 7627 5064
464001 10099 11066 7568 5067
465001 10091 11085 7506 5056
466001 10058 11157 7463 5046
467001 10038 11198 7460 5006
468001 9996 11280 7435 4987
469001 9976 11345 7427 4939
470001 9909 11402 7472 4889
471001 9834 11391 7498 4873
472001 9764 11409 7518 4845
473001 9681 11440 7536 4831
474001 9684 11456 7522 4791
475001 9683 11481 7497 4778
476001 9667 11452 7488 4798
477001 9614 11488 7494 4767
478001 9557 11520 7509 4715
479001 9532 11513 7481 4722
480001 9568 11504 7434 4729
481001 9598 11503 7377 4740
482001 9583 11566 7312 4734
483001 9521 11620 7278 4753
484001 9487 11606 7274 4766
485001 9476 11596 7246 4791
486001 9389 11588 7235 4828
487001 9403 11542 7223 4834
488001 9432 11518 7182 4822
489001 9437 11506 7173 4835
490001 9429 11516 7154 4846
491001 9461 11470 7075 4884
492001 9477 11420 7021 4928
493001 9448 11450 6944 4987
494001 9483 11425 6885 4987
495001 9434 11501 6819 4985
496001 9463 11474 6772 4998
497001 9489 11457 6726 5001
498001 9517 11406 6693 4998
499001 9516 11386 6703 4995
500001 9506 11360 6705 4989
501001 9497 11309 6703 5023
502001 9492 11223 6680 5086
503001 9546 11155 6624 5114
504001 9617 11081 6540 5169
505001 9681 11000 6500 5187
506001 9726 10990 6459 5175
507001 9778 11000 6397 5160
508001 9857 10928 6306 5215
509001 9903 10915 6218 5214
510001 9966 10924 6170 5210
511001 10026 10918 6110 5201
512001 10120 10889 6037 5205
513001 10160 10911 5967 5188
514001 10219 10883 5875 5235
515001 10303 10817 5808 5299
516001 10358 10757 5740 5313
517001 10424 10721 5643 5365
518001 10491 10712 5559 5366
519001 10556 10701 5483 5373
520001 10646 10697 5393 5377
521001 10719 10682 5311 5379
522001 10800 10656 5239 5392
523001 10881 10572 5203 5385
524001 10918 10585 5150 5378
525001 10939 10589 5165 5374
526001 10958 10600 5123 5372
527001 11002 10617 5083 5377
528001 10913 10685 5101 5366
529001 10881 10711 5098 5330
530001 10841 10720 5130 5259
531001 10752 10748 5212 5201
532001 10678 10794 5244 5181
533001 10655 10849 5182 5200
534001 10656 10848 5090 5239
535001 10678 10840 4984 5262
536001 10660 10823 4964 5307
537001 10653 10766 4971 5343
538001 10640 10694 4946 5409
539001 10640 10661 4976 5438
540001 10567 10651 5010 5442
541001 10465 10737 5022 5415
542001 10409 10801 5026 5414
543001 10380 10828 5020 5417
544001 10383 10780 4980 5467
545001 10441 10718 4917 5524
546001 10483 10703 4857 5533
547001 10519 10639 4783 5607
548001 10497 10641 4729 5663
549001 10481 10673 4733 5621
550001 10555 10651 4824 5573
551001 10615 10649 4936 5531
552001 10649 10684 5022 5523
553001 10744 10650 5044 5563
554001 10813 10636 5064 5611
555001 10951 10540 5094 5639
556001 11030 10494 5079 5676
557001 11069 10474 5052 5705
558001 11094 10489 5089 5696
559001 11130 10493 5165 5702
560001 11194 10518 5251 5663
561001 11196 10552 5247 5612
562001 11158 10579 5257 5558
563001 11158 10579 5232 5559
564001 11134 10568 5230 5563
565001 11073 10575 5272 5576
566001 11049 10629 5247 5577
567001 11109 10575 5158 5634
568001 11172 10507 5069 5688
569001 11256 10422 4994 5715
570001 11294 10429 4897 5723
571001 11306 10413 4877 5736
572001 11273 10378 4876 5772
573001 11213 10378 4942 5740
574001 11172 10376 4998 5724
575001 11160 10339 5006 5730
576001 11121 10378 5018 5714
577001 11088 10407 5065 5658
578001 11075 10431 5070 5669
579001 11083 10445 5058 5663
580001 11162 10452 5038 5650
581001 11221 10448 5008 5656
582001 11290 10392 4982 5684
583001 11352 10370 4932 5695
584001 11391 10334 4877 5736
585001 11381 10371 4867 5738
586001 11417 10332 4833 5805
587001 11437 10272 4827 5852
588001 11449 10278 4785 5868
589001 11477 10223 4781 5903
590001 11448 10225 4801 5889
591001 11489 10265 4755 5885
592001 11531 10267 4715 5881
593001 11511 10263 4724 5878
594001 11507 10274 4731 5873
595001 11518 10296 4746 5862
596001 11575 10298 4737 5868
597001 11619 10296 4747 5852
598001 11605 10307 4769 5832
599001 11591 10298 4800 5834
600001 11584 10317 4829 5845
601001 11525 10294 4825 5893
602001 11520 10288 4824 5894
603001 11508 10311 4839 5895
604001 11507 10326 4854 5895
605001 11453 10358 4896 5863
606001 11434 10401 4941 5820
607001 11436 10450 4997 5776
608001 11426 10479 4986 5791
609001 11491 10499 4982 5799
610001 11468 10497 4994 5803
611001 11446 10501 4999 5806
612001 11405 10527 4995 5813
613001 11382 10532 4997 5803
614001 11356 10549 4988 5802
615001 11299 10605 5039 5735
616001 11209 10671 5090 5685
617001 11141 10691 5134 5656
618001 11069 10722 5179 5614
619001 10990 10796 5189 5613
620001 10990 10803 5173 5615
621001 10997 10774 5161 5620
622001 10913 10832 5211 5575
623001 10908 10847 5214 5579
624001 10926 10841 5210 5578
625001 10912 10837 5197 5585
626001 10887 10844 5207 5566
627001 10919 10840 5188 5560
628001 10875 10863 5246 5518
629001 10807 10864 5302 5486
630001 10763 10917 5321 5454
631001 10717 10970 5370 5401
632001 10712 10909 5367 5392
633001 10694 10902 5378 5388
634001 10697 10875 5376 5386
635001 10674 10885 5384 5386
636001 10657 10902 5394 5397
637001 10571 10963 5387 5423
638001 10590 10899 5377 5408
639001 10594 10919 5369 5396
640001 10608 10909 5377 5405
641001 10621 10902 5384 5399
642001 10695 10882 5364 5402
643001 10710 10939 5324 5379
644001 10724 10967 5249 5353
645001 10766 11006 5187 5343
646001 10801 11041 5182 5328
647001 10849 11064 5203 5313
648001 10852 11131 5251 5278
649001 10829 11141 5266 5277
650001 10819 11197 5313 5231
651001 10756 11268 5360 5187
652001 10680 11332 5421 5135
653001 10661 11386 5441 5092
654001 10664 11355 5443 5137
655001 10760 11277 5420 5200
656001 10817 11197 5417 5234
657001 10820 11148 5416 5292
658001 10767 11130 5479 5290
659001 10707 11117 5518 5315
660001 10697 11067 5548 5356
661001 10623 11098 5623 5290
662001 10654 11090 5651 5271
663001 10671 11060 5608 5301
664001 10653 11118 5569 5276
665001 10656 11179 5520 5254
666001 10681 11222 5526 5226
667001 10649 11275 5572 5197
668001 10617 11323 5621 5157
669001 10536 11348 5642 5169
670001 10487 11345 5683 5154
671001 10477 11383 5717 5121
672001 10489 11424 5688 5096
673001 10496 11481 5703 5029
674001 10524 11509 5652 5024
675001 10537 11551 5599 5044
676001 10597 11541 5564 5034
677001 10580 11527 5559 5056
678001 10557 11513 5566 5079
679001 10579 11535 5564 5038
680001 10620 11560 5586 5002
681001 10566 11565 5651 5004
682001 10496 11587 5695 5016
683001 10424 11597 5718 5030
684001 10425 11567 5725 5082
685001 10415 11512 5732 5132
686001 10386 11516 5767 5110
687001 10380 11511 5735 5106
688001 10363 11556 5728 5073
689001 10343 11543 5726 5092
690001 10388 11513 5701 5106
691001 10412 11468 5653 5133
692001 10424 11402 5667 5202
693001 10446 11318 5664 5271
694001 10450 11264 5651 5306
695001 10436 11222 5666 5333
696001 10384 11206 5683 5338
697001 10355 11163 5709 5370
698001 10349 11159 5745 5419
699001 10373 11142 5753 5415
700001 10320 11107 5814 5362
701001 10257 11101 5856 5358
702001 10276 11044 5872 5392
703001 10215 11034 5903 5418
704001 10235 10985 5887 5437
705001 10291 10957 5887 5441
706001 10266 10977 5880 5437
707001 10263 10991 5876 5440
708001 10288 10987 5867 5444
709001 10294 10992 5865 5419
710001 10304 10965 5863 5426
711001 10299 10978 5849 5447
712001 10300 11006 5834 5437
713001 10308 11020 5825 5432
714001 10305 11034 5857 5409
715001 10277 11107 5888 5368
716001 10296 11090 5890 5348
717001 10312 11060 5898 5354
718001 10331 11020 5888 5382
719001 10363 11049 5850 5371
720001 10408 11053 5816 5367
721001 10465 11054 5780 5366
722001 10486 11056 5792 5361
723001 10498 11052 5796 5346
724001 10491 11088 5812 5316
725001 10496 11098 5809 5313
726001 10532 11078 5811 5315
727001 10534 11102 5802 5319
728001 10560 11096 5800 5323
729001 10615 11103 5722 5329
730001 10673 11117 5687 5332
731001 10691 11165 5654 5316
732001 10733 11188 5609 5331
733001 10795 11169 5615 5334
734001 10792 11177 5614 5341
735001 10781 11167 5612 5329
736001 10829 11158 5578 5337
737001 10860 11140 5578 5346
738001 10836 11145 5581 5337
739001 10831 11151 5581 5346
740001 10842 11155 5565 5358
741001 10849 11177 5560 5361
742001 10854 11217 5515 5353
743001 10881 11262 5494 5331
744001 10927 11251 5447 5342
745001 10952 11261 5395 5350
746001 10911 11249 5391 5404
747001 10896 11221 5391 5400
748001 10873 11209 5387 5408
749001 10886 11229 5385 5406
750001 10912 11227 5404 5382
751001 10946 11249 5419 5379
752001 10902 11286 5406 5391
753001 10917 11291 5403 5381
754001 10911 11299 5405 5378
755001 10898 11261 5402 5397
756001 10887 11212 5403 5416
757001 10948 11152 5373 5446
758001 10974 11129 5353 5495
759001 11005 11065 5343 5534
760001 11040 10993 5328 5583
761001 11078 10903 5306 5644
762001 11128 10881 5276 5657
763001 11151 10893 5278 5661
764001 11213 10889 5227 5659
765001 11271 10904 5179 5665
766001 11346 10900 5122 5656
767001 11384 10884 5096 5636
768001 11344 10904 5148 5609
769001 11260 10918 5205 5600
770001 11190 10935 5242 5612
771001 11144 10933 5297 5601
772001 11119 10947 5288 5612
773001 11107 10936 5329 5587
774001 11075 10935 5344 5579
775001 11105 10938 5288 5593
776001 11082 10964 5268 5607
777001 11075 11040 5307 5566
778001 11128 11039 5271 5580
779001 11179 11040 5251 5579
780001 11233 11053 5220 5578
781001 11294 11039 5184 5576
782001 11318 11082 5155 5570
783001 11336 11099 5163 5537
784001 11345 11077 5152 5533
785001 11390 11032 5116 5558
786001 11435 10987 5087 5571
787001 11485 10991 5022 5569
788001 11511 10982 5030 5562
789001 11555 10960 5043 5561
790001 11536 10916 5034 5554
791001 11524 10887 5067 5585
792001 11514 10824 5074 5550
793001 11544 10757 5034 5517
794001 11559 10654 5007 5479
795001 11573 10653 5003 5425
796001 11586 10694 5021 5350
797001 11594 10608 5038 5295
798001 11561 10654 5091 5248
799001 11515 10683 5134 5252
800001 11513 10724 5109 5290
801001 11524 10773 5098 5269
802001 11549 10805 5065 5268
803001 11533 10792 5105 5294
804001 11515 10795 5107 5326
805001 11453 10836 5142 5348
806001 11391 10915 5214 5282
807001 11312 11024 5273 5244
808001 11249 11102 5312 5212
809001 11226 11188 5334 5172
810001 11197 11288 5344 5141
811001 11171 11370 5366 5105
812001 11150 11429 5420 5064
813001 11140 11458 5407 5069
814001 11108 11560 5367 5078
815001 11096 11609 5357 5101
816001 11038 11649 5398 5123
817001 11024 11661 5435 5104
818001 10984 11648 5440 5125
819001 10961 11588 5441 5202
820001 10976 11577 5439 5245
821001 10990 11571 5441 5265
822001 10992 11500 5443 5351
823001 10991 11461 5418 5403
824001 10971 11494 5429 5397
825001 10981 11484 5449 5421
826001 11012 11452 5430 5487
827001 11026 11473 5430 5495
828001 11045 11508 5403 5487
829001 11107 11485 5366 5539
830001 11078 11453 5347 5590
831001 11052 11427 5362 5643
832001 11022 11397 5375 5681
833001 11052 11361 5371 5746
834001 11047 11330 5366 5796
835001 11060 11296 5360 5865
836001 11048 11260 5358 5915
837001 11058 11238 5341 5948
838001 11092 11259 5308 5970
839001 11111 11223 5316 6024
840001 11088 11206 5317 6082
841001 11105 11159 5321 6134
842001 11094 11130 5325 6172
843001 11107 11112 5327 6209
844001 11111 11038 5338 6213
845001 11180 11016 5317 6209
846001 11189 10999 5330 6229
847001 11167 10998 5336 6235
848001 11184 10948 5342 6315
849001 11157 10917 5329 6426
850001 11158 10860 5345 6491
851001 11141 10802 5346 6560
852001 11147 10782 5339 6632
853001 11164 10736 5352 6700
854001 11152 10682 5363 6750
855001 11178 10675 5362 6761
856001 11231 10612 5348 6810
857001 11261 10579 5330 6872
858001 11245 10541 5344 6934
859001 11278 10509 5360 7002
860001 11238 10526 5406 7018
861001 11220 10575 5400 7028
862001 11211 10586 5409 7032
863001 11220 10589 5401 7039
864001 11219 10625 5382 7046
865001 11273 10648 5382 7053
866001 11290 10673 5390 7057
867001 11300 10693 5378 7065
868001 11289 10699 5391 7054
869001 11252 10797 5410 7031
870001 11201 10878 5420 7005
871001 11147 10986 5452 6976
872001 11117 11078 5504 6924
873001 11053 11206 5541 6866
874001 10986 11323 5588 6816
875001 10893 11401 5652 6787
876001 10888 11384 5657 6828
877001 10890 11391 5663 6844
878001 10890 11382 5665 6843
879001 10900 11390 5664 6848
880001 10903 11401 5654 6877
881001 10893 11365 5629 6930
882001 10910 11383 5608 6962
883001 10922 11379 5593 6968
884001 10935 11408 5618 6960
885001 10939 11445 5603 6964
886001 10945 11486 5612 6961
887001 10945 11495 5588 6958
888001 10936 11495 5575 7000
889001 10933 11477 5589 7071
890001 10976 11439 5594 7117
891001 11042 11373 5569 7178
892001 11032 11328 5589 7216
893001 11036 11281 5577 7269
894001 11057 11257 5575 7300
895001 11048 11232 5582 7356
896001 11088 11210 5571 7387
897001 11095 11268 5513 7419
898001 11070 11338 5538 7408
899001 11029 11326 5566 7432
900001 10988 11316 5572 7510
901001 10993 11266 5570 7588
902001 10977 11254 5563 7637
903001 10979 11234 5567 7697
904001 10915 11260 5551 7768
905001 10880 11284 5578 7797
906001 10828 11354 5546 7812
907001 10740 11440 5511 7871
908001 10654 11503 5465 7968
909001 10655 11487 5416 8027
910001 10682 11456 5339 8100
+924
View File
@@ -0,0 +1,924 @@
# input : borbu1.fst
# include : borbu1.lst
# selector : count
# distance : chi
# phase : 1
# alphabet : ACGT
# seqname : borbu1
# seqlength : 910724
# unmasked : 284117
# window : 227680
# step : 1000
#
# pos LeftA RightA LeftC RightC LeftG RightG LeftT RightX chiACGT/not*s chiA chiC chiG chiT
1 10619 11521 5303 8176 7756 5291 11375 11287 33.0842 3.51336 22.7604 -23.5408 -3.16408
1001 10648 11516 5252 8212 7742 5294 11344 11262 33.4884 3.11949 23.4003 -23.524 -3.28422
2001 10686 11570 5253 8172 7731 5310 11323 11228 33.1173 3.2322 23.1044 -23.2661 -3.34483
3001 10713 11567 5286 8173 7734 5306 11324 11227 32.9256 3.17724 22.9108 -23.2124 -3.20642
4001 10771 11466 5269 8151 7715 5263 11278 11195 33.0028 2.47574 23.1831 -23.1955 -2.75071
5001 10792 11397 5270 8210 7725 5207 11257 11259 33.6652 1.90639 23.6448 -23.7902 -2.15803
6001 10791 11385 5292 8237 7738 5197 11234 11263 33.7875 1.83912 23.6426 -23.9864 -1.97226
7001 10794 11327 5319 8235 7722 5185 11241 11263 33.5679 1.6296 23.5193 -23.8258 -1.82453
8001 10823 11333 5349 8244 7697 5187 11246 11242 33.2612 1.56164 23.372 -23.5369 -1.90552
9001 10902 11285 5292 8291 7699 5165 11190 11283 34.0008 0.600148 24.1921 -23.8449 -1.3636
10001 11015 11179 5241 8375 7737 5126 11088 11346 35.2589 -0.879103 25.3095 -24.531 -0.268041
11001 11094 11098 5211 8447 7781 5083 10994 11405 36.4359 -1.9697 26.1257 -25.31 0.740571
12001 11170 11042 5179 8484 7805 5037 10928 11474 37.3839 -2.86039 26.7075 -25.9499 1.63827
13001 11282 10941 5148 8540 7837 4999 10869 11548 38.5083 -4.15634 27.5282 -26.4716 2.65855
14001 11360 10853 5112 8618 7857 4981 10799 11571 39.5823 -5.27694 28.4494 -26.8102 3.28049
15001 11429 10812 5058 8659 7886 4942 10754 11609 40.7405 -6.01368 29.2754 -27.42 3.83661
16001 11455 10799 5070 8687 7876 4947 10704 11628 40.805 -6.40198 29.2651 -27.3894 4.17603
17001 11554 10741 5077 8726 7922 4921 10700 11662 41.5721 -7.1143 29.7476 -27.7494 4.76189
18001 11603 10757 5096 8698 7935 4927 10685 11606 41.3279 -7.06085 29.5683 -27.5883 4.76818
19001 11648 10798 5118 8653 7944 4951 10672 11574 40.8173 -6.92086 29.1477 -27.3032 4.80617
20001 11665 10808 5121 8654 7929 4955 10664 11565 40.7044 -6.98375 29.1115 -27.161 4.7835
21001 11638 10889 5120 8642 7880 4998 10652 11559 39.9943 -6.66875 28.7129 -26.6666 4.41997
22001 11592 10982 5195 8571 7841 5029 10712 11494 38.4569 -5.6087 27.5662 -25.9576 3.7122
23001 11568 10959 5246 8597 7766 5035 10739 11522 37.8045 -5.72624 27.1751 -25.3971 3.58973
24001 11578 10902 5255 8635 7751 4993 10746 11561 38.2299 -6.10658 27.4249 -25.6353 3.86561
25001 11505 10911 5343 8559 7702 4979 10778 11509 36.918 -5.29078 26.2348 -25.177 3.57735
26001 11460 10893 5404 8578 7642 4983 10807 11543 36.2315 -5.22672 25.7094 -24.7437 3.48929
27001 11489 10863 5397 8625 7616 4933 10831 11578 36.7842 -5.58325 26.1557 -24.9976 3.59261
28001 11487 10821 5415 8666 7581 4916 10857 11589 36.8349 -5.8245 26.3133 -24.8622 3.5166
29001 11452 10788 5481 8683 7527 4924 10878 11591 36.1208 -5.80761 25.8245 -24.3425 3.39489
30001 11476 10759 5492 8695 7456 4915 10892 11637 35.8645 -6.25129 25.7402 -23.9227 3.51152
31001 11509 10719 5487 8735 7403 4887 10918 11656 36.0927 -6.72072 26.0996 -23.7534 3.47944
32001 11491 10698 5530 8765 7380 4862 10889 11695 36.0524 -6.84884 25.8346 -23.8917 3.82512
33001 11456 10718 5589 8771 7318 4876 10939 11675 35.1447 -6.49678 25.3153 -23.2578 3.33885
34001 11428 10707 5639 8756 7293 4866 10941 11661 34.6302 -6.28431 24.8211 -23.0768 3.33634
35001 11405 10701 5669 8769 7286 4877 10918 11626 34.3616 -6.18553 24.6284 -22.9201 3.25098
36001 11369 10679 5741 8781 7221 4885 10941 11634 33.5128 -6.12058 24.0321 -22.324 3.1216
37001 11331 10672 5790 8794 7179 4890 10972 11616 32.9275 -5.9004 23.6895 -21.9163 2.80841
38001 11297 10698 5857 8755 7125 4949 10995 11544 31.4699 -5.43851 22.8346 -20.8408 2.24037
39001 11257 10743 5911 8714 7061 5001 11041 11484 30.0582 -4.86528 22.0377 -19.794 1.53549
40001 11234 10733 5947 8734 6992 5022 11041 11499 29.4029 -4.99172 21.6858 -19.1657 1.41869
41001 11257 10666 5962 8780 6954 5019 11044 11521 29.4823 -5.59095 21.8993 -18.8668 1.55316
42001 11241 10638 6011 8805 6909 5023 11051 11523 29.0363 -5.69116 21.6271 -18.4589 1.50199
43001 11210 10651 6076 8791 6857 5053 11116 11482 27.9665 -5.27127 21.0389 -17.6312 0.919579
44001 11162 10723 6132 8737 6807 5082 11158 11426 26.6772 -4.44029 20.1504 -16.9066 0.287457
45001 11127 10770 6169 8698 6750 5094 11214 11355 25.7378 -3.77861 19.6167 -16.2216 -0.448155
46001 11113 10783 6199 8675 6742 5124 11193 11357 25.1454 -3.66876 19.1172 -15.9131 -0.367673
47001 11044 10865 6218 8662 6656 5164 11211 11355 24.0918 -3.11659 18.4654 -15.1253 -0.976879
48001 11018 10887 6211 8706 6597 5150 11241 11367 24.1222 -3.05422 18.6405 -14.9405 -1.36546
49001 11004 10849 6224 8732 6531 5138 11309 11391 23.9401 -3.21296 18.7195 -14.4783 -1.66157
50001 11008 10838 6240 8748 6460 5120 11333 11417 23.6653 -3.39782 18.6267 -14.0901 -1.73656
51001 10956 10857 6308 8741 6385 5116 11360 11436 22.7136 -3.03888 17.8683 -13.5543 -1.91782
52001 10917 10895 6412 8689 6353 5115 11398 11431 21.4865 -2.3269 16.7192 -13.141 -2.00968
53001 10865 10941 6485 8665 6280 5107 11443 11423 20.4702 -1.6899 15.8757 -12.5868 -2.38985
54001 10805 10973 6557 8625 6185 5106 11502 11430 19.2321 -1.11109 14.9073 -11.7754 -2.78398
55001 10783 10960 6625 8625 6116 5108 11528 11427 18.4053 -1.01245 14.344 -11.1055 -2.9405
56001 10741 10985 6692 8574 6075 5101 11536 11414 17.4767 -0.47942 13.444 -10.7455 -2.9997
57001 10681 11052 6747 8533 6044 5138 11543 11374 16.5331 0.273553 12.569 -10.1779 -3.42013
58001 10680 11002 6762 8558 6022 5128 11527 11388 16.4728 -0.0613001 12.6221 -10.0797 -3.22973
59001 10625 11032 6809 8553 5977 5114 11571 11386 16.0382 0.481639 12.1487 -9.83027 -3.57303
60001 10576 11044 6867 8559 5946 5111 11563 11410 15.5091 0.758414 11.5766 -9.67607 -3.50919
61001 10545 11075 6927 8549 5904 5097 11571 11412 14.952 1.1513 10.9641 -9.44547 -3.57884
62001 10510 11088 6998 8547 5843 5092 11598 11423 14.2302 1.4507 10.3192 -8.94943 -3.71688
63001 10529 11117 7023 8524 5843 5087 11562 11435 13.9099 1.50194 9.92515 -9.00534 -3.40949
64001 10571 11081 7027 8571 5879 5032 11492 11515 14.4716 0.922939 10.2057 -9.9155 -2.47024
65001 10588 11010 7030 8651 5910 4989 11441 11548 15.2638 0.333589 10.7839 -10.6264 -1.91297
66001 10582 10962 7032 8694 5929 4934 11423 11607 15.9292 0.0499121 11.0856 -11.3512 -1.41287
67001 10611 10866 7047 8742 5878 4946 11426 11643 15.6819 -0.803555 11.3103 -10.7655 -1.2075
68001 10645 10772 7049 8817 5845 4927 11420 11689 16.0435 -1.6948 11.8326 -10.6638 -0.892232
69001 10674 10689 7056 8890 5815 4895 11418 11718 16.5142 -2.42225 12.3443 -10.6789 -0.65497
70001 10687 10670 7066 8894 5770 4928 11447 11681 16.0548 -2.58787 12.3352 -9.89108 -1.03306
71001 10687 10682 7061 8896 5802 4940 11420 11670 16.1903 -2.53674 12.3661 -10.0925 -0.95588
72001 10781 10652 7044 8896 5817 4969 11359 11664 16.3455 -3.30851 12.5777 -9.88818 -0.505281
73001 10875 10637 7006 8914 5869 4976 11236 11666 17.1034 -4.1104 12.9842 -10.3425 0.275218
74001 10971 10597 6982 8948 5912 4945 11152 11703 18.1439 -4.97264 13.4942 -11.0028 1.14821
75001 11073 10501 6936 8986 5946 4889 11061 11748 19.6406 -6.18272 14.2828 -11.7772 2.19691
76001 11192 10389 6871 9045 5972 4862 10973 11823 21.3309 -7.76172 15.2635 -12.2915 3.27181
77001 11308 10348 6825 9051 5983 4842 10893 11841 22.3245 -8.74565 15.7667 -12.5384 4.01211
78001 11400 10345 6780 9063 5980 4848 10845 11810 22.8887 -9.35685 16.2607 -12.4334 4.16474
79001 11389 10347 6824 9073 5942 4858 10875 11789 22.3331 -9.21907 16.0001 -11.9479 3.87585
80001 11384 10293 6843 9078 5891 4844 10866 11780 22.2118 -9.50819 15.9174 -11.5822 3.93058
81001 11375 10323 6845 9101 5878 4868 10815 11773 22.0719 -9.53379 15.818 -11.4271 3.93542
82001 11391 10330 6841 9114 5895 4865 10788 11769 22.3156 -9.61472 15.9279 -11.6304 4.07188
83001 11405 10326 6867 9124 5864 4876 10776 11762 22.0638 -9.76252 15.7558 -11.2516 4.08174
84001 11374 10436 6929 9064 5837 4918 10750 11701 20.5675 -8.90884 14.6958 -10.6581 3.75415
85001 11386 10544 6956 8986 5846 4924 10687 11678 19.7872 -8.30863 13.8448 -10.7231 3.97981
86001 11376 10663 6964 8937 5834 4942 10647 11643 18.9776 -7.65598 13.2265 -10.5889 3.80394
87001 11407 10634 6951 8956 5825 4951 10615 11662 19.2943 -8.14614 13.404 -10.4757 4.06212
88001 11442 10619 6968 8960 5829 4944 10558 11680 19.5307 -8.48395 13.2871 -10.5841 4.57175
89001 11482 10591 6964 8944 5827 4942 10524 11639 19.6681 -8.76213 13.3548 -10.4602 4.72138
90001 11498 10672 6963 8905 5836 4975 10510 11559 19.0532 -8.28672 13.1026 -10.1943 4.33045
91001 11501 10755 6990 8825 5845 5016 10471 11499 18.0556 -7.71186 12.3091 -9.84943 4.2436
92001 11485 10845 7054 8754 5816 5063 10483 11439 16.5097 -6.94448 11.2843 -9.07784 3.82133
93001 11445 10859 7109 8669 5744 5072 10512 11368 15.033 -6.36809 10.3656 -8.16418 3.3673
94001 11388 10920 7181 8612 5679 5115 10560 11325 13.289 -5.59041 9.32152 -7.13814 2.73867
95001 11338 10980 7212 8595 5609 5138 10587 11304 12.1692 -5.08049 8.74332 -6.40641 2.18889
96001 11285 11069 7263 8538 5537 5189 10660 11226 10.3869 -4.14335 7.876 -5.22989 1.1565
97001 11251 11129 7296 8500 5467 5210 10720 11180 9.21816 -3.53308 7.29831 -4.36456 0.42076
98001 11244 11178 7351 8451 5416 5239 10724 11140 8.04587 -3.13579 6.48959 -3.57278 0.152628
99001 11205 11243 7386 8421 5384 5277 10709 11121 7.06124 -2.66522 5.78439 -3.04803 -0.0894082
100001 11257 11246 7409 8455 5429 5259 10694 11103 7.51416 -2.77112 6.04094 -3.50388 0.115609
101001 11338 11242 7407 8461 5448 5295 10648 11071 7.71926 -3.24162 6.18664 -3.27159 0.318126
102001 11323 11332 7427 8408 5429 5358 10600 11031 6.64429 -2.80636 5.40098 -2.66147 0.130379
103001 11315 11419 7502 8342 5408 5394 10605 10982 5.24885 -2.08748 4.35593 -2.04918 -0.140022
104001 11270 11507 7581 8268 5350 5425 10648 10933 3.64813 -1.15985 3.18026 -1.15536 -0.717459
105001 11256 11545 7629 8236 5270 5439 10703 10875 3.05973 -0.718748 2.62359 -0.171085 -1.39027
106001 11240 11526 7688 8235 5190 5425 10749 10854 2.94864 -0.600632 2.24769 0.576598 -1.7173
107001 11260 11599 7763 8176 5199 5464 10828 10798 2.94177 0.142983 1.51854 1.13267 -2.24603
108001 11276 11628 7782 8092 5195 5492 10812 10757 2.89042 0.3999 0.857127 1.55746 -2.24371
109001 11344 11619 7812 8075 5231 5496 10871 10707 3.11488 0.453926 0.954698 1.62858 -2.43571
110001 11433 11644 7863 8068 5274 5525 10930 10662 3.3909 0.540046 0.91884 1.83466 -2.64505
111001 11502 11660 7957 8076 5315 5531 11060 10617 3.90912 0.932068 0.851534 2.00144 -3.11152
112001 11491 11662 8017 8094 5293 5537 11146 10602 4.54952 1.23395 0.698512 2.41996 -3.5821
113001 11447 11680 8087 8110 5251 5554 11210 10602 5.27175 1.63572 0.267409 2.98575 -4.01617
114001 11537 11646 8190 8095 5294 5547 11289 10665 4.78998 1.46811 -0.113996 2.94431 -3.47946
115001 11524 11648 8204 8109 5299 5544 11256 10702 4.43235 1.40423 -0.249074 2.7562 -3.16468
116001 11576 11643 8171 8103 5308 5550 11225 10695 4.18694 1.04904 -0.0229131 2.73913 -2.98775
117001 11547 11669 8161 8101 5302 5587 11213 10695 4.49056 1.16118 -0.168798 2.97807 -3.1495
118001 11453 11713 8162 8152 5258 5615 11201 10756 4.82719 1.36726 -0.364441 3.19009 -3.33511
119001 11381 11780 8219 8106 5198 5664 11264 10693 6.48416 2.2408 -1.20426 4.21038 -4.2244
120001 11382 11863 8244 8027 5191 5713 11265 10641 7.43295 2.81338 -1.9869 4.76506 -4.54754
121001 11331 11952 8234 7994 5184 5755 11260 10615 8.22401 3.42213 -2.42474 5.01552 -4.98884
122001 11321 11961 8241 7961 5189 5775 11242 10611 8.40245 3.52965 -2.75434 5.14031 -4.91259
123001 11270 11942 8311 7951 5155 5795 11289 10619 9.17729 3.81681 -3.32022 5.70816 -5.10371
124001 11162 11962 8387 7933 5119 5776 11358 10610 10.2224 4.72463 -4.00437 5.92629 -5.56943
125001 11090 11988 8449 7897 5069 5769 11424 10614 11.3047 5.41537 -4.73486 6.38415 -5.94092
126001 11024 11998 8493 7906 5026 5768 11491 10586 12.2324 5.94918 -4.98066 6.81999 -6.55129
127001 10929 12003 8551 7902 4997 5769 11550 10578 13.1627 6.62087 -5.45899 7.11733 -6.99734
128001 10840 12017 8627 7892 4973 5753 11583 10594 13.9065 7.29783 -6.13302 7.19758 -7.12127
129001 10815 12017 8656 7858 4938 5773 11613 10560 14.7128 7.56577 -6.54073 7.80162 -7.45505
130001 10792 12075 8693 7788 4946 5817 11630 10527 15.7093 8.17894 -7.30884 8.18602 -7.71076
131001 10742 12093 8727 7791 4916 5814 11665 10526 16.3146 8.57658 -7.59222 8.41979 -8.00468
132001 10775 12028 8685 7801 4935 5784 11593 10533 15.2949 7.96691 -7.16611 7.97356 -7.45197
133001 10799 12024 8653 7781 4950 5839 11573 10505 15.3791 7.74423 -7.11142 8.3082 -7.54622
134001 10816 12071 8656 7733 4955 5915 11566 10472 16.1043 7.88069 -7.56102 8.92187 -7.77661
135001 10892 12032 8633 7744 4999 5918 11552 10456 15.3889 7.37427 -7.07791 8.68852 -7.53988
136001 10985 12034 8571 7738 5032 5928 11499 10453 14.6076 6.77544 -6.63944 8.46296 -7.1952
137001 10945 12060 8606 7700 5031 5940 11531 10429 15.3295 7.31771 -7.12331 8.65523 -7.46926
138001 10913 12038 8617 7739 4989 5949 11559 10440 15.5995 7.24142 -7.02103 9.05176 -7.72514
139001 10914 12088 8551 7732 4980 5963 11510 10442 15.5038 7.17352 -6.89563 9.00567 -7.7626
140001 10883 12153 8589 7661 4977 5990 11548 10382 16.6758 7.97021 -7.61363 9.39893 -8.26148
141001 10851 12179 8636 7621 4924 6045 11589 10340 18.0327 8.36197 -8.2874 10.435 -8.81392
142001 10822 12242 8657 7560 4917 6078 11589 10308 18.9367 8.92307 -8.97255 10.7773 -9.07304
143001 10796 12274 8677 7487 4919 6116 11591 10246 19.8673 9.43596 -9.60679 11.1909 -9.3887
144001 10752 12307 8705 7451 4912 6172 11637 10194 20.9909 9.99184 -10.0737 11.7958 -10.008
145001 10713 12335 8744 7424 4883 6219 11660 10155 22.0516 10.4041 -10.6156 12.4854 -10.462
146001 10698 12416 8770 7355 4871 6258 11703 10104 23.2778 11.1085 -11.3032 13.0147 -11.0143
147001 10716 12483 8782 7299 4873 6296 11670 10056 23.9256 11.4049 -11.858 13.3286 -11.1399
148001 10703 12519 8763 7292 4869 6311 11654 10067 24.0454 11.4948 -11.9605 13.3449 -11.1765
149001 10694 12526 8771 7294 4876 6311 11632 10074 23.9895 11.5328 -12.0605 13.2274 -11.0485
150001 10680 12510 8790 7270 4886 6312 11624 10070 24.0983 11.633 -12.3139 13.2087 -10.9223
151001 10671 12563 8784 7233 4888 6347 11603 10003 24.7319 11.9897 -12.6064 13.4708 -11.2929
152001 10701 12601 8754 7208 4960 6318 11536 10018 23.9702 12.0361 -12.5768 12.5017 -10.7348
153001 10752 12620 8709 7216 5011 6304 11470 10021 23.1098 11.7545 -12.2143 11.8324 -10.3295
154001 10720 12646 8741 7210 5020 6324 11508 9978 23.752 12.2418 -12.4181 11.9937 -10.7813
155001 10659 12646 8780 7210 5019 6310 11528 9992 24.0813 12.6519 -12.7173 11.8754 -10.8203
156001 10643 12703 8806 7170 5028 6298 11512 9989 24.4783 13.1201 -13.243 11.6812 -10.7341
157001 10654 12696 8784 7172 5060 6269 11479 10037 23.8026 12.9461 -13.1065 11.0682 -10.2312
158001 10741 12623 8730 7228 5085 6252 11411 10081 22.2431 11.8528 -12.2699 10.6401 -9.51317
159001 10772 12611 8690 7272 5107 6226 11349 10147 21.136 11.3103 -11.8154 10.0129 -8.88505
160001 10794 12546 8662 7342 5131 6160 11355 10152 20.0134 10.9216 -10.8867 9.30392 -8.72758
161001 10886 12540 8662 7338 5176 6179 11361 10154 19.5559 10.5398 -10.6876 9.22685 -8.48446
162001 10878 12532 8713 7342 5143 6192 11376 10140 20.0472 10.6071 -10.9883 9.71159 -8.62104
163001 10861 12538 8722 7315 5141 6196 11381 10142 20.3232 10.7812 -11.2611 9.78175 -8.61992
164001 10848 12539 8763 7301 5122 6205 11423 10146 20.8438 10.9835 -11.5964 10.1244 -8.76617
165001 10865 12513 8733 7332 5110 6225 11422 10157 20.5441 10.5734 -11.2234 10.3301 -8.80836
166001 10909 12460 8677 7341 5117 6218 11427 10195 19.7842 9.96844 -10.703 10.2177 -8.54918
167001 10948 12432 8658 7383 5107 6199 11424 10200 19.2408 9.54264 -10.2017 10.1568 -8.48014
168001 10967 12431 8620 7417 5106 6201 11427 10202 18.8953 9.29401 -9.72881 10.1052 -8.5957
169001 10964 12395 8622 7425 5105 6204 11430 10223 18.7301 9.09686 -9.66981 10.1493 -8.45875
170001 11002 12339 8564 7484 5109 6192 11398 10278 17.6141 8.28686 -8.91053 9.86442 -8.05489
171001 11046 12278 8534 7537 5138 6177 11379 10305 16.5824 7.64506 -8.21481 9.47377 -7.70032
172001 11007 12267 8561 7572 5125 6181 11392 10330 16.6862 7.70107 -8.25118 9.54244 -7.74493
173001 11034 12259 8557 7587 5118 6179 11397 10323 16.5727 7.51672 -8.05867 9.62742 -7.77972
174001 11048 12293 8563 7560 5108 6184 11404 10293 16.9598 7.71264 -8.26192 9.82218 -7.96336
175001 11085 12276 8542 7544 5099 6214 11408 10283 17.0417 7.40628 -8.18914 10.2144 -8.01061
176001 11101 12261 8543 7530 5090 6214 11416 10294 17.0554 7.27499 -8.25102 10.3532 -7.91793
177001 11129 12209 8533 7560 5093 6221 11444 10282 16.8328 6.91568 -7.79777 10.4976 -8.03192
178001 11068 12189 8585 7561 5027 6227 11518 10271 17.8399 7.24545 -8.14645 11.2385 -8.54977
179001 11004 12196 8651 7555 4976 6221 11555 10288 18.6337 7.67028 -8.73943 11.6576 -8.72372
180001 10943 12184 8697 7592 4937 6213 11620 10264 19.2758 8.04287 -8.7566 12.0025 -9.28069
181001 10850 12185 8755 7609 4946 6203 11646 10254 19.6923 8.68291 -9.05395 11.826 -9.51657
182001 10756 12183 8830 7599 4916 6199 11702 10261 20.5823 9.34242 -9.67124 12.1142 -9.80114
183001 10683 12188 8888 7595 4896 6193 11711 10292 21.061 9.76375 -10.2307 12.1859 -9.75053
184001 10676 12140 8895 7626 4937 6139 11676 10374 19.9653 9.49415 -10.0414 11.2833 -8.96281
185001 10678 12077 8899 7704 4943 6068 11668 10423 18.8953 9.09939 -9.42354 10.5995 -8.54879
186001 10648 11979 8900 7800 4970 6008 11663 10482 17.6571 8.66569 -8.66902 9.7796 -8.11695
187001 10641 11896 8916 7873 4967 5963 11668 10532 16.8375 8.21062 -8.17832 9.42297 -7.7724
188001 10581 11857 8967 7907 4937 5959 11709 10538 17.2217 8.3799 -8.28024 9.69427 -7.98886
189001 10494 11845 8997 7948 4885 5977 11771 10557 17.9441 8.66788 -8.38184 10.2189 -8.49559
190001 10378 11849 9041 7957 4853 5984 11819 10557 18.836 9.33989 -8.7752 10.4966 -8.96531
191001 10350 11754 9057 8030 4839 5966 11836 10604 18.3052 8.88525 -8.34756 10.4518 -8.78687
192001 10349 11693 9061 8090 4850 5952 11806 10645 17.5508 8.40921 -7.98207 10.1526 -8.39795
193001 10351 11692 9069 8086 4863 5950 11781 10650 17.4026 8.38875 -8.07292 10.0027 -8.20084
194001 10295 11700 9075 8146 4841 5949 11784 10694 17.4111 8.46302 -7.97378 9.95897 -8.29221
195001 10327 11603 9098 8217 4870 5894 11769 10773 16.0635 7.75323 -7.46254 9.26517 -7.50931
196001 10320 11508 9113 8287 4871 5846 11774 10832 15.1552 7.23672 -6.98016 8.85471 -7.08395
197001 10332 11464 9115 8299 4886 5791 11755 10908 14.2643 6.9066 -6.86396 8.22582 -6.40247
198001 10458 11399 9059 8335 4919 5763 11696 10959 12.6438 5.70511 -6.07832 7.70488 -5.56839
199001 10559 11324 8974 8395 4923 5749 11676 10984 11.3886 4.51926 -4.97438 7.54034 -5.26072
200001 10663 11234 8927 8449 4947 5727 11643 11047 9.98187 3.29444 -4.12893 7.15579 -4.53113
201001 10639 11236 8943 8433 4954 5714 11667 11069 10.0141 3.52959 -4.32076 7.00427 -4.48271
202001 10611 11253 8971 8417 4947 5712 11674 11078 10.301 3.81884 -4.66773 7.04463 -4.48479
203001 10597 11291 8934 8430 4947 5697 11636 11132 9.90072 3.80325 -4.61553 6.65065 -4.24563
204001 10688 11242 8898 8461 4984 5647 11541 11191 8.31809 2.86459 -4.09667 5.82008 -3.21382
205001 10773 11192 8813 8504 5031 5577 11484 11247 6.45479 1.97208 -3.10744 4.70705 -2.44188
206001 10862 11109 8729 8569 5073 5524 11438 11320 4.6513 0.809163 -1.97717 3.78585 -1.65466
207001 10864 11147 8666 8608 5073 5534 11366 11379 4.14146 0.479828 -1.70616 3.48522 -1.36518
208001 10947 11156 8614 8601 5126 5519 11326 11392 3.28404 0.0659688 -1.28156 2.87938 -0.920487
209001 11004 11170 8580 8607 5148 5502 11286 11405 2.75238 -0.249352 -0.995048 2.485 -0.589964
210001 11081 11148 8534 8629 5188 5449 11220 11454 1.9 -0.897975 -0.458751 1.5987 0.193266
211001 11131 11090 8502 8677 5210 5421 11176 11493 2.10982 -1.63251 0.14168 1.10759 0.734462
212001 11191 11031 8445 8740 5245 5383 11128 11535 2.99288 -2.4678 1.02417 0.37432 1.29547
213001 11245 10979 8420 8756 5276 5334 11122 11583 3.82934 -2.99195 1.50224 -0.271278 1.83895
214001 11249 10943 8457 8753 5260 5273 11097 11656 4.32619 -3.20599 1.24206 -0.66686 2.53971
215001 11252 10924 8447 8730 5305 5266 11065 11642 4.57979 -3.21346 1.26973 -1.07723 2.80633
216001 11346 10882 8398 8744 5363 5241 11022 11657 5.80571 -3.92284 1.93088 -1.74463 3.39788
217001 11431 10815 8333 8785 5403 5197 10975 11710 7.41468 -4.87947 2.79741 -2.51815 4.12331
218001 11524 10726 8257 8849 5431 5165 10921 11774 9.26554 -6.13219 3.84046 -3.12401 4.87216
219001 11547 10691 8230 8892 5435 5157 10884 11811 10.0429 -6.67431 4.23973 -3.34585 5.20995
220001 11540 10694 8220 8919 5435 5154 10845 11824 10.3083 -6.80503 4.34626 -3.51148 5.36024
221001 11616 10610 8165 8947 5463 5115 10793 11840 11.7494 -7.72415 5.12165 -4.05706 5.97459
222001 11617 10662 8073 8957 5489 5146 10737 11843 12.0611 -7.82273 5.52907 -4.31021 5.92674
223001 11614 10655 8077 8961 5504 5157 10702 11858 12.2589 -7.93704 5.45169 -4.40587 6.17666
224001 11653 10644 8061 8953 5528 5170 10655 11865 12.7274 -8.27085 5.51696 -4.50963 6.54266
225001 11661 10679 8078 8870 5533 5206 10613 11843 12.2681 -8.04072 4.80331 -4.17506 6.73428
226001 11663 10749 8095 8820 5537 5247 10600 11783 11.4825 -7.55947 4.31164 -3.80124 6.45467
227001 11679 10775 8103 8760 5554 5255 10609 11741 11.0846 -7.24465 4.00956 -3.71666 6.36339
228001 11638 10836 8099 8715 5546 5307 10670 11661 9.79871 -6.52076 3.73798 -3.10787 5.46471
229001 11644 10861 8112 8686 5538 5370 10720 11595 8.96315 -6.24965 3.53891 -2.32576 4.83185
230001 11655 10864 8092 8703 5563 5390 10682 11576 9.19903 -6.39069 3.74805 -2.43378 4.87956
231001 11680 10869 8120 8690 5591 5392 10714 11578 9.11684 -6.27747 3.63955 -2.51067 4.91533
232001 11722 10883 8143 8668 5629 5448 10741 11535 8.80721 -6.19815 3.51642 -2.15223 4.70666
233001 11795 10851 8093 8683 5671 5444 10684 11538 9.82513 -6.8377 4.06925 -2.54873 5.16954
234001 11880 10774 8019 8718 5717 5413 10628 11588 11.4946 -7.86352 4.9602 -3.24272 5.93057
235001 11954 10710 7985 8785 5766 5377 10616 11624 12.8566 -8.62511 5.86644 -3.9388 6.40078
236001 11958 10706 7964 8806 5775 5390 10611 11630 13.0658 -8.77942 6.10376 -3.96857 6.37418
237001 11951 10739 7951 8803 5791 5382 10614 11608 12.9154 -8.51143 6.18254 -4.19588 6.20754
238001 11966 10757 7920 8802 5776 5388 10613 11624 13.0037 -8.63294 6.29524 -4.10153 6.17386
239001 12001 10745 7892 8822 5766 5398 10608 11609 13.3057 -8.96366 6.64872 -3.92823 6.08754
240001 11989 10751 7913 8802 5771 5403 10584 11623 13.1906 -8.87642 6.3047 -3.94868 6.31347
241001 12011 10761 7893 8803 5762 5392 10586 11630 13.3424 -8.97549 6.45019 -3.98771 6.32094
242001 12019 10799 7886 8747 5757 5393 10594 11587 12.8506 -8.6369 6.19763 -3.83893 6.11498
243001 12027 10851 7841 8740 5783 5415 10556 11568 12.8736 -8.53777 6.33236 -4.01124 6.0538
244001 12097 10833 7785 8741 5825 5434 10528 11515 13.4765 -8.94675 6.92779 -4.10495 6.06022
245001 12095 10918 7787 8670 5816 5488 10541 11456 12.4087 -8.36959 6.36665 -3.51313 5.57223
246001 12020 10965 7799 8690 5792 5479 10536 11516 12.0559 -8.00648 6.05162 -3.6819 5.57342
247001 12035 10936 7772 8725 5846 5419 10496 11584 13.1832 -8.32336 6.51148 -4.77393 6.27117
248001 12057 10955 7740 8721 5927 5346 10467 11608 14.054 -8.17913 6.87278 -6.11231 6.78397
249001 12040 10972 7742 8728 5909 5325 10458 11647 14.1125 -8.13004 6.76146 -6.27131 6.92955
250001 12048 10927 7731 8759 5939 5266 10436 11719 15.1606 -8.47196 7.09394 -7.10949 7.56318
251001 12050 10986 7714 8731 5932 5259 10432 11717 14.9229 -8.18817 6.9358 -7.18281 7.4798
252001 12044 11024 7749 8704 5950 5240 10447 11730 14.7064 -7.7745 6.55145 -7.44931 7.57767
253001 12102 10995 7720 8751 5968 5221 10435 11797 15.7142 -8.40653 7.08583 -7.84331 8.03369
254001 12167 10945 7652 8813 5995 5190 10371 11854 17.2677 -9.32358 7.96353 -8.50598 8.68769
255001 12186 10916 7610 8854 6053 5141 10332 11875 18.4481 -9.61619 8.63152 -9.49747 9.11903
256001 12254 10926 7543 8854 6083 5153 10309 11850 18.9798 -9.96216 9.19609 -9.63675 9.14065
257001 12279 10941 7480 8869 6127 5167 10238 11874 19.7623 -10.2992 9.58983 -10.0925 9.52101
258001 12314 10988 7443 8862 6179 5128 10188 11866 20.4267 -10.1933 9.85327 -10.9337 9.83433
259001 12360 10993 7406 8865 6223 5114 10140 11877 21.1969 -10.4535 10.18 -11.4666 10.2429
260001 12420 10930 7348 8888 6261 5110 10103 11874 22.2319 -11.1551 10.9159 -11.7739 10.5849
261001 12494 10881 7284 8910 6302 5097 10054 11873 23.3986 -11.8656 11.6833 -12.2051 11.0108
262001 12522 10927 7282 8849 6305 5172 10080 11807 22.4604 -11.6045 11.3527 -11.4075 10.5258
263001 12520 10949 7292 8834 6311 5160 10081 11805 22.3579 -11.3975 11.1962 -11.5457 10.5505
264001 12506 10997 7257 8857 6304 5147 10047 11842 22.6411 -11.3754 11.3364 -11.882 10.6547
265001 12568 10917 7230 8911 6340 5108 10007 11907 24.1212 -12.2395 12.0169 -12.5383 11.4198
266001 12604 10848 7209 8961 6314 5069 10018 11962 24.957 -12.9255 12.5674 -12.6857 11.7012
267001 12630 10772 7215 8997 6319 5034 10018 12032 25.8264 -13.5142 12.8573 -13.0134 12.2355
268001 12641 10764 7210 9012 6324 5032 9983 12044 26.1534 -13.7239 12.9381 -13.1377 12.4765
269001 12649 10790 7209 8986 6308 5043 9992 12028 25.7916 -13.588 12.7631 -12.8794 12.3206
270001 12714 10755 7163 8992 6296 5056 9986 12038 26.2853 -14.2194 13.2031 -12.6341 12.4411
271001 12684 10783 7186 8956 6267 5081 10038 11985 25.2739 -13.7324 12.8351 -12.0534 11.8392
272001 12610 10829 7238 8902 6244 5135 10090 11932 23.7461 -12.9258 12.026 -11.2971 11.1604
273001 12606 10863 7293 8861 6210 5202 10147 11851 22.338 -12.4708 11.4305 -10.1982 10.4311
274001 12542 10929 7341 8818 6168 5277 10160 11834 20.903 -11.8856 10.4939 -9.2762 9.97486
275001 12538 10883 7341 8857 6174 5232 10159 11877 21.5651 -12.149 10.8023 -9.75184 10.2794
276001 12529 10874 7338 8872 6195 5222 10144 11878 21.8195 -12.1591 10.9335 -10.0427 10.3851
277001 12552 10825 7311 8907 6202 5213 10135 11902 22.5017 -12.6501 11.4049 -10.2035 10.5887
278001 12537 10841 7302 8908 6210 5209 10141 11892 22.4306 -12.4744 11.464 -10.3334 10.4555
279001 12501 10846 7333 8912 6225 5201 10168 11851 22.0586 -12.0514 11.3716 -10.4333 10.1577
280001 12457 10830 7343 8926 6214 5205 10200 11832 21.7528 -11.8724 11.3996 -10.2901 9.81808
281001 12428 10842 7389 8904 6199 5205 10198 11829 21.2606 -11.5801 10.8795 -10.1364 9.83894
282001 12427 10812 7417 8876 6207 5202 10200 11788 21.0622 -11.4868 10.683 -10.0345 9.84118
283001 12394 10836 7422 8887 6205 5190 10226 11756 20.75 -11.1044 10.7327 -10.1264 9.46157
284001 12327 10832 7496 8867 6185 5195 10284 11745 19.8181 -10.548 10.1093 -9.78802 9.13749
285001 12282 10820 7544 8878 6185 5179 10306 11762 19.611 -10.2898 9.84431 -9.90756 9.14565
286001 12270 10780 7572 8907 6180 5166 10326 11788 19.763 -10.4236 9.88434 -9.94723 9.23448
287001 12260 10752 7587 8916 6178 5194 10322 11780 19.6465 -10.5541 9.82618 -9.65843 9.20633
288001 12282 10682 7555 8946 6189 5209 10294 11803 20.363 -11.2231 10.2653 -9.64769 9.49944
289001 12261 10635 7538 9009 6214 5216 10282 11786 20.8376 -11.4741 10.8166 -9.84943 9.4096
290001 12239 10620 7532 9033 6214 5236 10286 11770 20.7848 -11.5128 10.9777 -9.70921 9.20243
291001 12212 10619 7562 9035 6226 5233 10272 11771 20.6842 -11.3426 10.752 -9.84304 9.31072
292001 12184 10617 7562 9058 6225 5230 10278 11731 20.5587 -11.1794 10.9199 -9.86506 9.00653
293001 12196 10611 7563 9063 6225 5210 10276 11757 20.8121 -11.2847 10.9594 -10.0508 9.20179
294001 12182 10596 7598 9058 6214 5208 10259 11767 20.6961 -11.2874 10.6471 -9.96447 9.3954
295001 12189 10587 7609 8999 6195 5196 10259 11747 20.4009 -11.1896 10.2955 -9.76646 9.4662
296001 12182 10597 7593 8988 6198 5201 10269 11743 20.3084 -11.0971 10.3257 -9.75932 9.34994
297001 12180 10571 7605 8957 6183 5188 10301 11701 20.0002 -10.9745 10.2436 -9.54805 9.13636
298001 12134 10624 7638 8928 6127 5205 10379 11651 18.6781 -10.2793 9.79243 -8.8516 8.30453
299001 12060 10626 7718 8896 6061 5218 10433 11674 17.509 -9.81499 8.88741 -8.14515 8.0561
300001 11967 10701 7809 8811 5999 5222 10493 11650 15.6585 -8.64907 7.56652 -7.50422 7.53769
301001 11872 10763 7896 8748 5960 5210 10536 11664 14.3325 -7.62184 6.38919 -7.27238 7.32249
302001 11847 10768 7915 8741 5962 5213 10538 11647 14.0686 -7.39657 6.2101 -7.24104 7.22622
303001 11845 10806 7955 8704 5976 5199 10554 11612 13.633 -6.8849 5.81905 -7.33707 7.12472
304001 11833 10880 7966 8655 5987 5244 10567 11559 12.7348 -6.29238 5.3709 -6.98913 6.69969
305001 11739 10926 8037 8602 5960 5279 10618 11513 11.2156 -5.3298 4.44046 -6.37407 6.0858
306001 11698 10936 8096 8578 5950 5287 10637 11513 10.6437 -4.92628 3.85175 -6.15674 6.02314
307001 11695 10906 8089 8614 5948 5291 10645 11506 10.7642 -5.12414 4.16888 -6.10978 5.90789
308001 11681 10921 8155 8572 5939 5293 10713 11474 9.92438 -4.58406 3.6296 -5.7633 5.57586
309001 11586 10992 8220 8482 5895 5299 10787 11433 8.31614 -3.37028 2.52866 -5.22278 4.91201
310001 11496 11084 8293 8388 5835 5313 10849 11426 6.81934 -2.20015 1.20112 -4.56336 4.40406
311001 11448 11090 8313 8358 5788 5316 10912 11376 5.8406 -1.7209 0.919413 -4.01335 3.76813
312001 11383 11119 8347 8320 5757 5341 10968 11352 4.88918 -1.09243 0.365339 -3.48011 3.23513
313001 11305 11162 8408 8274 5751 5396 10988 11296 4.01289 -0.284917 -0.460918 -2.89112 2.72968
314001 11239 11219 8453 8221 5724 5456 11042 11232 3.12903 0.547855 -1.20963 -2.05394 1.95161
315001 11241 11264 8430 8181 5716 5500 11070 11169 2.59529 0.862367 -1.32283 -1.53902 1.36871
316001 11255 11296 8415 8136 5709 5543 11081 11130 2.36604 1.00769 -1.5393 -1.046 1.05789
317001 11287 11243 8435 8156 5690 5568 11139 11136 1.82697 0.632428 -1.37182 -0.495563 0.900215
318001 11234 11227 8472 8180 5643 5573 11208 11133 1.76027 0.86898 -1.47443 -0.0139043 0.411454
319001 11178 11212 8516 8209 5576 5572 11249 11157 2.04754 0.987044 -1.7172 0.498258 0.145462
320001 11115 11229 8579 8183 5528 5566 11340 11169 2.99965 1.61585 -2.31974 0.961971 -0.283455
321001 11146 11203 8609 8201 5535 5534 11378 11225 2.75365 1.4179 -2.24791 0.720019 0.0247814
322001 11151 11068 8600 8190 5523 5479 11395 11180 2.18065 0.987518 -1.82183 0.66723 0.125663
323001 11176 10929 8603 8123 5490 5458 11415 11075 2.2488 0.5997 -1.74495 1.28547 0.0133805
324001 11133 10806 8636 8051 5449 5427 11463 10966 2.82393 0.73912 -1.95914 1.86413 -0.339246
325001 11085 10707 8679 7971 5418 5402 11499 10837 3.58525 1.07674 -2.30848 2.4097 -0.747592
326001 11028 10631 8748 7863 5376 5373 11535 10716 4.74132 1.64785 -3.06314 3.03311 -1.08727
327001 10971 10525 8764 7806 5326 5348 11591 10606 5.42654 1.85125 -3.14877 3.66236 -1.64092
328001 10923 10459 8740 7755 5260 5335 11649 10525 6.17371 1.99853 -3.13003 4.37098 -2.2843
329001 10915 10390 8732 7793 5270 5266 11644 10591 5.11638 1.61619 -2.71609 3.62856 -1.7383
330001 10872 10313 8753 7782 5236 5235 11663 10578 5.25125 1.56657 -2.77708 3.79353 -1.73735
331001 10801 10268 8793 7718 5190 5226 11724 10500 6.30433 2.10926 -3.25227 4.41999 -2.27641
332001 10699 10184 8861 7627 5161 5197 11792 10371 7.47473 2.91905 -3.85626 4.92229 -2.87245
333001 10692 10141 8893 7586 5155 5185 11803 10336 7.75238 3.00034 -4.12538 5.10154 -2.83776
334001 10681 10138 8931 7560 5141 5180 11837 10324 8.20229 3.24487 -4.44746 5.32189 -2.94041
335001 10611 10181 8943 7566 5101 5191 11832 10346 8.78764 3.64132 -4.82359 5.55026 -3.145
336001 10681 10187 8964 7556 5162 5154 11854 10351 8.18373 3.63716 -4.6853 4.88566 -2.81477
337001 10657 10231 8956 7553 5162 5144 11856 10360 8.30732 3.96717 -4.78153 4.6819 -2.91375
338001 10648 10179 8939 7577 5179 5080 11867 10400 7.44677 3.7712 -4.35484 3.95177 -2.57901
339001 10690 10124 8866 7636 5214 5030 11829 10454 5.84287 3.01052 -3.40814 3.04744 -2.04294
340001 10746 10046 8814 7692 5251 4993 11781 10519 4.22791 2.04761 -2.58846 2.29665 -1.30682
341001 10795 9993 8754 7764 5259 4992 11723 10559 3.05272 1.09248 -1.77365 2.03752 -0.910104
342001 10833 9931 8712 7828 5315 4933 11660 10619 1.35964 0.362538 -0.964596 0.87945 -0.115322
343001 10867 9880 8684 7862 5379 4875 11585 10642 0.794783 -0.130953 -0.388205 -0.252067 0.632684
344001 10860 9895 8708 7850 5392 4878 11574 10635 0.990833 0.0641259 -0.628433 -0.31544 0.695131
345001 10877 9919 8680 7789 5384 4907 11571 10585 0.987581 0.208355 -0.846909 0.117661 0.448114
346001 10874 9928 8667 7775 5455 4866 11538 10616 1.59118 0.369553 -0.797927 -0.918685 0.956363
347001 10829 9979 8688 7743 5445 4865 11547 10614 2.00326 0.953714 -1.29091 -0.894777 0.797747
348001 10772 10016 8725 7706 5406 4911 11590 10584 2.47751 1.53398 -1.92773 -0.100092 0.242432
349001 10691 10077 8788 7641 5377 4944 11640 10534 3.91634 2.5661 -2.88262 0.549001 -0.376719
350001 10715 10112 8800 7577 5389 5004 11628 10499 4.55064 2.73798 -3.43037 1.1083 -0.464707
351001 10748 10097 8799 7515 5384 5066 11607 10458 4.98463 2.54364 -3.82076 1.88286 -0.482745
352001 10769 10063 8802 7463 5389 5085 11611 10387 5.25868 2.52467 -3.95431 2.28882 -0.635985
353001 10738 10038 8823 7464 5399 5105 11619 10392 5.43 2.56335 -4.08771 2.40796 -0.637584
354001 10757 9998 8798 7444 5397 5095 11627 10380 5.20526 2.32617 -3.91421 2.4525 -0.589778
355001 10769 9986 8799 7425 5391 5111 11627 10399 5.35363 2.16438 -4.07663 2.67504 -0.449387
356001 10809 9922 8737 7466 5397 5115 11582 10474 4.45061 1.19124 -3.49149 2.48672 0.120919
357001 10840 9850 8736 7496 5406 5085 11562 10580 4.00698 0.424178 -3.26552 2.07133 0.960151
358001 10841 9778 8727 7513 5451 5011 11504 10705 3.87873 -0.141801 -3.08607 0.871672 2.17735
359001 10925 9694 8658 7541 5484 4992 11464 10757 3.89499 -1.24762 -2.28501 0.416138 2.86704
360001 10961 9693 8694 7524 5468 5026 11527 10754 4.01624 -1.28691 -2.51121 1.05976 2.6542
361001 10933 9665 8729 7498 5410 5046 11593 10769 4.3973 -1.23859 -2.92374 1.85636 2.40994
362001 10966 9664 8718 7491 5347 5058 11616 10800 4.82406 -1.57409 -2.99992 2.49156 2.36357
363001 10962 9625 8732 7490 5316 5078 11661 10801 5.12778 -1.74756 -3.03318 3.05089 2.17534
364001 10938 9569 8767 7506 5267 5085 11724 10834 5.5546 -1.95557 -3.11308 3.62111 2.05562
365001 11006 9539 8716 7488 5261 5114 11709 10835 5.97277 -2.59311 -2.86121 3.99546 2.19077
366001 11019 9566 8705 7436 5239 5188 11735 10783 6.61757 -2.45979 -3.20034 4.96716 1.68131
367001 11001 9591 8766 7388 5227 5243 11808 10752 7.32823 -1.95625 -3.87505 5.77864 1.21135
368001 10937 9586 8832 7318 5179 5248 11854 10713 8.16938 -1.33686 -4.73943 6.4566 0.895423
369001 10914 9524 8854 7278 5143 5231 11874 10674 8.60561 -1.33578 -4.96341 6.85284 0.821773
370001 10934 9485 8854 7283 5153 5246 11842 10693 8.73878 -1.76169 -4.92434 6.90534 1.15317
371001 10952 9482 8869 7247 5158 5264 11872 10666 9.06067 -1.66566 -5.13013 7.20816 1.02246
372001 10995 9394 8859 7232 5127 5268 11864 10677 9.58326 -2.42517 -5.0254 7.67502 1.34044
373001 10996 9386 8862 7222 5119 5302 11872 10685 9.99287 -2.53646 -5.17224 8.06121 1.29944
374001 10918 9430 8897 7194 5107 5357 11880 10662 10.5905 -1.89181 -5.8388 8.58563 0.880896
375001 10882 9432 8909 7176 5108 5365 11862 10710 10.7815 -1.80691 -6.22735 8.53566 1.15687
376001 10934 9426 8839 7162 5177 5339 11798 10760 10.0271 -2.22697 -5.86925 7.59038 1.87636
377001 10954 9458 8836 7086 5154 5413 11803 10716 11.0516 -2.09008 -6.4748 8.56703 1.56575
378001 10991 9476 8862 7034 5138 5513 11852 10645 12.2515 -2.00065 -6.9387 9.85004 0.963308
379001 10901 9452 8919 6950 5101 5506 11923 10540 13.0336 -1.10813 -7.65396 10.4874 0.281398
380001 10830 9483 8971 6892 5061 5552 11972 10524 14.1862 -0.435822 -8.55635 11.3058 -0.166299
381001 10758 9449 9010 6837 5032 5526 12039 10507 14.6794 0.0823522 -9.05363 11.548 -0.390087
382001 10768 9458 9008 6780 5026 5594 12045 10436 15.5723 0.211483 -9.42789 12.3664 -0.799366
383001 10784 9484 8984 6735 5044 5651 12034 10370 16.0393 0.360987 -9.60064 12.7928 -1.14039
384001 10752 9509 8990 6699 5062 5721 12038 10311 16.7093 0.751392 -9.96863 13.2933 -1.59683
385001 10789 9523 8946 6691 5087 5757 11983 10302 16.6179 0.468379 -9.85027 13.2946 -1.46984
386001 10836 9510 8895 6706 5148 5753 11919 10305 15.7833 0.0463644 -9.36475 12.6602 -1.0648
387001 10872 9504 8845 6700 5220 5754 11840 10313 15.0323 -0.268769 -9.08701 11.9593 -0.547516
388001 10919 9492 8824 6690 5271 5786 11844 10281 14.8762 -0.461002 -8.84561 11.9372 -0.588908
389001 10882 9540 8864 6636 5220 5852 11877 10238 16.2487 0.0737918 -9.67156 13.0036 -1.175
390001 10862 9600 8882 6555 5219 5916 11882 10187 17.2991 0.674355 -10.5049 13.6398 -1.55218
391001 10825 9663 8919 6511 5216 5982 11897 10108 18.3255 1.39617 -11.1559 14.3019 -2.20789
392001 10838 9714 8891 6474 5205 6029 11885 10081 18.87 1.54016 -11.4153 14.7388 -2.48279
393001 10844 9763 8911 6401 5197 6089 11850 10059 19.8756 1.79924 -12.2712 15.3304 -2.48929
394001 10834 9852 8925 6309 5205 6147 11830 10002 20.9274 2.51017 -13.2139 15.7881 -2.78999
395001 10839 9896 8901 6232 5212 6223 11828 9974 21.8045 2.73998 -13.7945 16.3822 -3.04373
396001 10814 9960 8883 6183 5205 6290 11776 9965 22.5612 3.01118 -14.4195 16.7953 -3.15232
397001 10837 10006 8883 6117 5188 6402 11760 9888 23.923 3.14241 -15.0692 17.9417 -3.66764
398001 10827 10110 8872 6055 5193 6452 11747 9835 24.7019 3.82058 -15.6817 18.24 -4.1197
399001 10808 10164 8886 5977 5175 6483 11770 9829 25.6733 4.33485 -16.5052 18.6902 -4.311
400001 10786 10204 8905 5890 5165 6536 11786 9797 26.8318 4.83327 -17.3969 19.3116 -4.58188
401001 10740 10287 8916 5819 5203 6547 11782 9776 27.3313 5.72943 -18.1446 19.0445 -4.71746
402001 10677 10350 8963 5748 5209 6593 11791 9745 28.4874 6.58233 -19.1608 19.3873 -5.01987
403001 10632 10410 9016 5658 5215 6615 11783 9715 29.6202 7.4085 -20.3063 19.6008 -5.09288
404001 10616 10483 9035 5567 5239 6670 11768 9679 30.673 8.05812 -21.2874 19.8812 -5.24244
405001 10628 10544 9040 5494 5234 6726 11768 9635 31.6847 8.43647 -22.0007 20.4445 -5.5439
406001 10619 10632 9059 5404 5225 6799 11733 9614 33.0198 8.94066 -23.1458 21.0387 -5.65858
407001 10603 10708 9065 5322 5207 6871 11765 9544 34.4194 9.60139 -23.9666 21.8547 -6.36257
408001 10601 10786 9052 5245 5209 6929 11760 9509 35.3862 10.0738 -24.6965 22.2745 -6.68067
409001 10595 10873 9002 5207 5190 6997 11743 9485 36.0791 10.3291 -25.0323 22.7461 -7.14201
410001 10598 10919 8986 5154 5204 7067 11742 9428 36.8285 10.6167 -25.4492 23.2078 -7.57358
411001 10584 10944 8950 5160 5192 7152 11687 9432 37.1379 10.3781 -25.5401 23.6648 -7.69435
412001 10623 10941 8924 5135 5209 7192 11652 9424 37.1838 10.0771 -25.6163 23.8302 -7.55071
413001 10637 10990 8895 5080 5215 7239 11667 9359 37.8229 10.3901 -25.8993 24.2237 -8.06586
414001 10720 10929 8789 5096 5227 7275 11648 9385 37.0006 9.31372 -25.0659 24.3395 -7.84821
415001 10754 10878 8754 5093 5214 7283 11662 9416 36.8059 8.76623 -24.8186 24.556 -7.67277
416001 10775 10856 8735 5127 5209 7282 11648 9423 36.4162 8.39828 -24.4066 24.5373 -7.60535
417001 10828 10774 8693 5201 5193 7312 11607 9455 35.7027 7.25898 -23.5484 24.7775 -7.31734
418001 10891 10688 8647 5249 5250 7240 11550 9510 34.0238 6.39704 -22.6221 23.7508 -6.39022
419001 10928 10660 8596 5192 5277 7235 11509 9475 33.8631 6.18096 -22.6328 23.6267 -6.16725
420001 10933 10665 8587 5105 5290 7253 11505 9427 34.4798 6.44677 -23.2173 23.86 -6.24088
421001 10901 10680 8625 4994 5290 7279 11501 9375 35.6945 7.04424 -24.3735 24.2972 -6.32888
422001 10937 10663 8559 4959 5296 7299 11467 9423 35.5165 6.53348 -24.3679 24.2918 -5.90347
423001 11010 10663 8463 4972 5309 7323 11424 9441 34.8529 5.82125 -23.7229 24.1935 -5.72141
424001 11099 10643 8386 4953 5311 7362 11414 9439 34.6971 5.11034 -23.3415 24.5135 -5.6598
425001 11096 10647 8350 4965 5317 7384 11378 9476 34.4512 4.84693 -23.1979 24.4023 -5.45661
426001 11135 10584 8305 5001 5345 7355 11346 9552 33.4168 4.08201 -22.5576 23.8455 -4.75071
427001 11170 10492 8266 5031 5409 7299 11283 9608 32.0494 3.33712 -21.8661 22.8797 -3.79795
428001 11225 10410 8210 5026 5464 7248 11224 9644 30.9706 2.61789 -21.3299 22.1078 -2.93308
429001 11271 10376 8171 5016 5505 7229 11168 9651 30.3766 2.18828 -21.0544 21.6531 -2.40927
430001 11285 10378 8137 4990 5545 7253 11136 9645 30.2471 2.10116 -21.0703 21.4807 -2.25618
431001 11237 10441 8160 4929 5571 7295 11135 9608 30.9627 2.84529 -21.8672 21.5865 -2.53901
432001 11238 10480 8189 4863 5576 7359 11140 9572 31.9839 3.19544 -22.6885 22.1442 -2.76109
433001 11216 10510 8194 4796 5568 7432 11155 9535 33.0392 3.53317 -23.4199 22.8185 -3.15094
434001 11231 10501 8175 4731 5561 7450 11180 9440 33.6344 3.74606 -23.6589 23.3263 -3.65746
435001 11187 10477 8215 4732 5527 7464 11234 9449 34.1772 3.89333 -23.9187 23.7812 -3.90775
436001 11043 10548 8182 4807 5474 7498 11166 9548 34.0248 4.09259 -23.8609 23.5805 -3.94409
437001 10911 10603 8105 4921 5453 7544 11063 9666 33.1724 3.91522 -23.2393 23.0334 -3.80513
438001 10789 10649 8041 5022 5424 7591 10943 9767 32.533 3.69836 -22.7941 22.6315 -3.60062
439001 10703 10723 7948 5036 5399 7644 10814 9833 32.37 3.63694 -22.8382 22.3941 -3.39307
440001 10616 10812 7848 5064 5366 7724 10700 9914 32.2778 3.52507 -22.8062 22.3206 -3.33103
441001 10504 10928 7797 5091 5347 7805 10583 9973 32.4238 3.83029 -23.1123 22.1652 -3.34
442001 10450 11028 7766 5091 5330 7897 10539 10018 32.916 4.05367 -23.5065 22.4062 -3.52643
443001 10373 11074 7798 5063 5267 7936 10601 10011 34.0725 4.68994 -24.1917 23.1521 -4.20437
444001 10320 11090 7772 5076 5240 7968 10576 10127 34.1292 4.50474 -24.3722 23.1422 -3.86567
445001 10254 11121 7703 5154 5220 7995 10482 10263 33.3847 4.05665 -23.9354 22.6681 -3.3668
446001 10169 11188 7613 5236 5194 8033 10350 10409 32.6135 3.67335 -23.5357 22.0934 -2.84503
447001 10137 11194 7573 5256 5184 8058 10327 10464 32.4228 3.48816 -23.3724 22.0278 -2.75318
448001 10148 11171 7552 5248 5182 8067 10316 10517 32.3562 3.14317 -23.3671 22.0256 -2.42826
449001 10185 11159 7562 5231 5192 8091 10345 10497 32.5823 3.04226 -23.423 22.3004 -2.53055
450001 10194 11141 7553 5234 5153 8126 10348 10513 32.9326 2.70548 -23.441 22.826 -2.5951
451001 10230 11075 7546 5259 5127 8126 10355 10576 32.8236 1.98978 -23.1644 23.0614 -2.23976
452001 10160 11056 7577 5260 5072 8118 10401 10598 33.3686 2.26332 -23.4834 23.4641 -2.51041
453001 10111 11101 7647 5166 5022 8165 10464 10580 35.091 3.02592 -24.8584 24.4035 -2.95891
454001 10042 11160 7707 5085 4998 8213 10523 10559 36.538 3.95424 -26.0847 25.039 -3.46778
455001 9981 11242 7775 5008 4981 8228 10570 10545 37.8137 4.99891 -27.3213 25.3736 -3.82249
456001 9921 11287 7841 4917 4923 8284 10626 10482 39.6871 5.84337 -28.64 26.4616 -4.52244
457001 9885 11310 7861 4880 4872 8357 10640 10480 40.8393 6.01857 -29.3435 27.3293 -4.86747
458001 9900 11272 7843 4869 4878 8383 10637 10502 40.8324 5.66364 -29.3066 27.4645 -4.69458
459001 9928 11223 7790 4936 4911 8352 10592 10582 39.5217 4.92093 -28.4012 26.733 -4.05772
460001 9923 11184 7775 5000 4850 8316 10613 10653 39.1645 4.44518 -27.8594 26.8722 -3.97968
461001 9985 11163 7733 5006 4869 8346 10613 10625 38.8634 3.97387 -27.3762 26.9938 -4.05628
462001 10019 11133 7701 5022 4910 8311 10585 10656 38.0236 3.60252 -26.9089 26.38 -3.58131
463001 10077 11087 7627 5064 4961 8239 10530 10686 36.4716 2.9355 -25.8647 25.3755 -2.94325
464001 10099 11066 7568 5067 4999 8210 10487 10703 35.6432 2.60973 -25.3796 24.7581 -2.55767
465001 10091 11085 7506 5056 5078 8207 10449 10706 34.7982 2.71237 -25.0422 23.8939 -2.35135
466001 10058 11157 7463 5046 5091 8270 10387 10710 34.8793 2.8812 -25.206 23.8121 -2.43004
467001 10038 11198 7460 5006 5102 8328 10399 10630 35.4475 3.33742 -25.5351 24.1719 -3.01039
468001 9996 11280 7435 4987 5099 8402 10387 10574 35.9414 3.82736 -25.7827 24.4757 -3.65118
469001 9976 11345 7427 4939 5112 8447 10406 10511 36.4939 4.40617 -26.1753 24.6899 -4.20109
470001 9909 11402 7472 4889 5109 8512 10490 10424 37.7129 5.42093 -26.9099 25.3269 -5.22345
471001 9834 11391 7498 4873 5081 8489 10599 10357 38.2973 6.20331 -27.0391 25.6802 -6.13295
472001 9764 11409 7518 4845 5001 8534 10724 10262 39.7266 6.94019 -27.3903 26.8876 -7.54127
473001 9681 11440 7536 4831 5006 8537 10760 10252 40.1142 7.67082 -27.7315 26.8019 -7.93295
474001 9684 11456 7522 4791 5029 8547 10761 10263 40.2089 7.78763 -27.985 26.6768 -7.82941
475001 9683 11481 7497 4778 5054 8565 10771 10190 40.2287 8.0659 -27.8258 26.6504 -8.2928
476001 9667 11452 7488 4798 5063 8602 10794 10157 40.2308 8.01987 -27.5348 26.854 -8.65408
477001 9614 11488 7494 4767 5079 8611 10807 10123 40.6131 8.64136 -27.889 26.7649 -8.97729
478001 9557 11520 7509 4715 5085 8646 10847 10024 41.5356 9.44771 -28.3871 27.1091 -9.75788
479001 9532 11513 7481 4722 5129 8656 10820 10006 41.118 9.52281 -28.1372 26.7031 -9.75958
480001 9568 11504 7434 4729 5196 8673 10778 9988 40.3522 9.23825 -27.6549 26.2069 -9.55834
481001 9598 11503 7377 4740 5252 8697 10747 9955 39.6721 9.00629 -27.0824 25.8362 -9.58086
482001 9583 11566 7312 4734 5248 8772 10722 9931 39.8491 9.05891 -26.9597 26.0448 -10.0363
483001 9521 11620 7278 4753 5237 8811 10671 9993 39.7753 9.1517 -27.0292 25.8587 -9.95354
484001 9487 11606 7274 4766 5259 8806 10686 9999 39.557 9.30973 -26.8687 25.6083 -10.0186
485001 9476 11596 7246 4791 5272 8806 10672 10031 39.0739 9.14136 -26.5292 25.3323 -9.88335
486001 9389 11588 7235 4828 5269 8792 10679 10072 38.8017 9.40995 -26.3198 24.9975 -9.97088
487001 9403 11542 7223 4834 5315 8781 10685 10100 38.2195 9.17758 -26.0322 24.61 -9.65268
488001 9432 11518 7182 4822 5366 8751 10666 10113 37.4649 8.96145 -25.689 24.0273 -9.27744
489001 9437 11506 7173 4835 5358 8751 10712 10107 37.4381 8.93256 -25.4199 24.1738 -9.55413
490001 9429 11516 7154 4846 5349 8746 10756 10094 37.422 9.06758 -25.1428 24.2332 -9.93849
491001 9461 11470 7075 4884 5429 8684 10703 10176 35.5606 8.46597 -24.1538 22.9599 -9.07304
492001 9477 11420 7021 4928 5516 8620 10629 10271 33.7249 7.91846 -23.3446 21.576 -8.0109
493001 9448 11450 6944 4987 5512 8628 10544 10369 32.736 7.49706 -22.7433 20.9939 -7.57872
494001 9483 11425 6885 4987 5548 8646 10523 10338 32.1667 7.13422 -22.1902 20.8298 -7.58407
495001 9434 11501 6819 4985 5519 8724 10493 10330 32.4929 7.30578 -22.154 21.1154 -8.10885
496001 9463 11474 6772 4998 5607 8645 10426 10432 30.8484 6.90573 -21.6259 19.6951 -6.95381
497001 9489 11457 6726 5001 5665 8583 10359 10524 29.606 6.50649 -21.2669 18.6132 -5.95402
498001 9517 11406 6693 4998 5727 8532 10302 10596 28.5331 6.03798 -20.9549 17.709 -4.99642
499001 9516 11386 6703 4995 5758 8522 10295 10628 28.3228 5.99225 -21.0148 17.4062 -4.65584
500001 9506 11360 6705 4989 5760 8546 10301 10642 28.4485 5.88637 -21.0998 17.5541 -4.61715
501001 9497 11309 6703 5023 5760 8477 10311 10719 27.7533 5.63937 -20.7403 17.0586 -4.15783
502001 9492 11223 6680 5086 5798 8411 10275 10829 26.3873 5.01848 -20.0054 16.1306 -3.27033
503001 9546 11155 6624 5114 5857 8354 10236 10917 24.961 4.23419 -19.1961 15.2025 -2.34974
504001 9617 11081 6540 5169 5924 8290 10171 11011 23.0645 3.17977 -17.9562 14.0611 -1.31132
505001 9681 11000 6500 5187 5987 8217 10097 11063 21.8067 2.37605 -17.2754 13.0915 -0.236261
506001 9726 10990 6459 5175 6042 8205 10071 11101 21.2074 2.04532 -16.973 12.5467 0.26633
507001 9778 11000 6397 5160 6093 8225 10051 11093 20.6595 1.76298 -16.5337 12.2553 0.391017
508001 9857 10928 6306 5215 6160 8168 10002 11172 18.9278 0.715123 -15.1797 11.2128 1.26498
509001 9903 10915 6218 5214 6226 8163 9970 11182 17.9233 0.294966 -14.385 10.5731 1.56222
510001 9966 10924 6170 5210 6307 8145 9955 11218 17.1223 0.0311439 -13.8828 9.81215 2.04034
511001 10026 10918 6110 5201 6416 8098 9871 11277 16.159 -0.380596 -13.3696 8.52276 3.09587
512001 10120 10889 6037 5205 6461 8108 9834 11285 15.5082 -1.17074 -12.5961 8.26136 3.49612
513001 10160 10911 5967 5188 6485 8135 9840 11244 15.051 -1.29384 -12.0925 8.26818 3.20418
514001 10219 10883 5875 5235 6555 8085 9779 11281 13.6983 -1.96791 -10.826 7.20762 3.82354
515001 10303 10817 5808 5299 6550 8052 9768 11316 12.919 -3.0036 -9.58025 7.00106 4.13327
516001 10358 10757 5740 5313 6586 7998 9750 11333 12.2522 -3.61325 -8.66818 6.4163 4.55575
517001 10424 10721 5643 5365 6626 7947 9706 11380 11.4075 -4.42502 -7.32017 5.5828 5.07906
518001 10491 10712 5559 5366 6677 7933 9672 11403 11.048 -4.96118 -6.50005 5.02212 5.47474
519001 10556 10701 5483 5373 6729 7935 9630 11403 10.8171 -5.49128 -5.69247 4.58125 5.78483
520001 10646 10697 5393 5377 6807 7913 9604 11424 10.5728 -6.03114 -4.68684 3.82573 6.22948
521001 10719 10682 5311 5379 6880 7898 9534 11414 10.6326 -6.57732 -3.81136 3.1267 6.74458
522001 10800 10656 5239 5392 6943 7909 9509 11416 10.845 -7.21014 -2.89738 2.7536 7.04637
523001 10881 10572 5203 5385 7010 7854 9470 11404 11.4544 -7.8444 -2.25757 2.15583 7.74112
524001 10918 10585 5150 5378 7079 7864 9421 11388 11.5803 -8.0034 -1.78615 1.6493 8.00861
525001 10939 10589 5165 5374 7154 7861 9430 11374 11.4959 -7.81571 -1.76106 1.23999 8.15055
526001 10958 10600 5123 5372 7195 7890 9416 11347 11.4165 -7.88634 -1.36788 1.10659 8.06518
527001 11002 10617 5083 5377 7254 7889 9365 11360 11.7943 -8.11839 -0.94775 0.562294 8.48429
528001 10913 10685 5101 5366 7278 7909 9392 11302 10.6757 -7.1326 -1.2925 0.444801 7.82488
529001 10881 10711 5098 5330 7279 7947 9412 11259 10.1592 -6.73725 -1.60395 0.732118 7.39659
530001 10841 10720 5130 5259 7289 7945 9427 11269 10.1042 -6.24923 -2.49901 0.758784 7.49806
531001 10752 10748 5212 5201 7310 7937 9467 11266 9.81826 -5.23763 -3.73392 0.693284 7.38529
532001 10678 10794 5244 5181 7221 7968 9530 11253 9.32298 -4.6589 -4.41571 1.48066 6.5971
533001 10655 10846 5182 5200 7231 8011 9462 11300 9.31575 -4.80776 -4.06994 1.17778 6.76144
534001 10656 10845 5090 5239 7247 7991 9411 11407 9.59902 -5.36499 -3.14521 0.430588 7.29933
535001 10678 10837 4984 5262 7288 7972 9379 11411 9.56956 -5.74237 -1.96223 -0.206989 7.39651
536001 10660 10820 4964 5307 7304 7967 9415 11409 9.23964 -5.74074 -1.3373 -0.390974 7.10448
537001 10653 10763 4971 5343 7330 7935 9444 11461 9.53212 -5.94448 -0.980735 -0.752123 7.34826
538001 10640 10691 4946 5409 7377 7898 9434 11502 10.063 -6.3322 -0.100733 -1.43437 7.68769
539001 10640 10658 4976 5438 7375 7891 9481 11520 10.0309 -6.39863 -0.0288876 -1.34137 7.60769
540001 10567 10648 5010 5442 7351 7880 9563 11512 9.23757 -5.85873 -0.273332 -1.14528 7.04426
541001 10465 10734 5022 5415 7287 7933 9603 11518 8.16071 -5.06143 -0.998076 -0.613703 6.29335
542001 10409 10798 5026 5414 7235 7992 9659 11459 7.01768 -4.47497 -1.21434 0.0839023 5.26695
543001 10380 10825 5020 5417 7223 8028 9649 11458 6.81517 -4.35059 -1.3079 0.242354 5.0744
544001 10383 10777 4980 5467 7264 7962 9639 11501 7.20971 -4.66128 -0.410057 -0.590624 5.45301
545001 10441 10715 4917 5524 7311 7913 9605 11541 8.2507 -5.43984 0.801335 -1.32943 6.00606
546001 10483 10700 4857 5533 7367 7899 9566 11535 8.89526 -5.78703 1.54177 -1.86891 6.30603
547001 10519 10636 4783 5607 7440 7844 9531 11581 10.3126 -6.47166 2.99412 -2.91348 6.85674
548001 10497 10638 4729 5663 7450 7850 9444 11644 11.2413 -6.90695 3.65128 -3.46453 7.30248
549001 10481 10670 4733 5621 7468 7893 9447 11595 10.631 -6.52682 3.26237 -3.23723 7.02117
550001 10555 10648 4824 5573 7507 7880 9568 11599 10.1942 -6.30362 2.49208 -2.90422 7.03856
551001 10615 10646 4936 5531 7552 7874 9685 11649 9.88725 -5.99249 1.46709 -2.69072 7.24262
552001 10649 10681 5022 5523 7591 7875 9767 11714 9.7306 -5.65097 0.75528 -2.71313 7.40403
553001 10744 10647 5044 5563 7657 7848 9844 11809 10.5148 -6.11963 1.20087 -3.11009 7.87378
554001 10813 10633 5064 5611 7725 7812 9915 11916 11.2632 -6.40692 1.64504 -3.70806 8.32804
555001 10951 10537 5094 5639 7823 7737 9983 11951 12.4381 -7.05987 2.27013 -4.29305 9.01558
556001 11030 10491 5079 5676 7911 7683 10014 12013 13.5518 -7.51545 3.04399 -5.09519 9.58869
557001 11069 10471 5052 5705 7948 7650 10016 12031 14.1892 -7.79537 3.66955 -5.55201 9.81195
558001 11094 10486 5089 5696 7970 7639 10140 12029 13.5942 -7.40151 3.54056 -5.42397 9.38426
559001 11130 10490 5165 5702 8003 7638 10288 12015 12.8559 -6.98214 3.28841 -5.15493 8.8959
560001 11194 10515 5251 5663 8037 7652 10422 11972 11.9222 -6.48021 2.6171 -4.6649 8.45786
561001 11196 10549 5247 5612 8058 7704 10470 11915 11.1137 -6.07412 2.31126 -4.2555 7.94779
562001 11158 10576 5257 5558 8060 7740 10517 11854 10.1341 -5.48236 1.81216 -3.85416 7.38279
563001 11158 10576 5232 5559 8094 7745 10494 11878 10.4983 -5.57375 2.00252 -4.1611 7.60416
564001 11134 10565 5230 5563 8131 7736 10519 11894 10.5628 -5.41159 2.1133 -4.46027 7.61102
565001 11073 10572 5272 5576 8124 7731 10590 11875 9.82584 -4.8495 1.89663 -4.35713 7.10265
566001 11049 10626 5247 5577 8123 7729 10593 11901 9.72964 -4.57961 1.96636 -4.58873 6.98356
567001 11109 10572 5158 5634 8168 7711 10577 11916 10.8471 -5.35372 3.37835 -5.0873 7.19051
568001 11172 10504 5069 5688 8217 7668 10558 11943 12.3168 -6.17369 4.81594 -5.75688 7.56663
569001 11256 10419 4994 5715 8234 7650 10539 11965 13.6113 -7.19586 5.90598 -5.92693 7.96736
570001 11294 10426 4897 5723 8294 7663 10485 11975 14.6057 -7.59186 6.82581 -6.45421 8.21228
571001 11306 10410 4877 5736 8361 7649 10483 11992 15.21 -7.6622 7.23301 -6.98547 8.45712
572001 11273 10375 4876 5772 8387 7599 10519 12044 15.7151 -7.63021 7.61293 -7.54456 8.59453
573001 11213 10375 4942 5740 8348 7590 10590 12054 14.7175 -7.08488 6.74984 -7.19117 8.3148
574001 11172 10373 4998 5724 8326 7586 10648 12078 14.0652 -6.72096 6.11049 -6.9643 8.17432
575001 11160 10336 5006 5730 8346 7555 10627 12076 14.4173 -6.7753 6.17141 -7.26639 8.43006
576001 11121 10375 5018 5714 8293 7662 10647 12011 13.0968 -6.50202 5.71992 -6.21364 7.61066
577001 11088 10404 5065 5658 8227 7735 10696 11964 11.5789 -6.08363 4.72546 -5.11619 6.96811
578001 11075 10428 5070 5669 8210 7760 10704 11961 11.2764 -5.98285 4.67076 -4.91446 6.73765
579001 11083 10442 5058 5663 8212 7750 10711 11973 11.3399 -5.95052 4.72743 -5.01863 6.7564
580001 11162 10449 5038 5650 8285 7713 10698 12008 12.2023 -6.16923 4.99245 -5.65731 7.34206
581001 11221 10445 5008 5656 8339 7695 10634 12046 13.236 -6.59823 5.34496 -6.22682 8.01956
582001 11290 10389 4982 5684 8410 7616 10560 12118 15.0182 -7.29046 5.97621 -7.27896 9.14857
583001 11352 10366 4932 5693 8458 7605 10500 12144 16.1069 -7.86487 6.56185 -7.74021 9.72665
584001 11391 10330 4877 5734 8511 7567 10395 12202 17.7448 -8.56723 7.36391 -8.62201 10.6261
585001 11381 10367 4867 5736 8486 7612 10336 12199 17.6061 -8.62994 7.21547 -8.39769 10.6262
586001 11417 10328 4833 5803 8533 7578 10266 12231 18.9767 -9.23651 8.11173 -9.11772 11.2192
587001 11437 10268 4827 5850 8543 7533 10252 12280 19.9076 -9.74517 8.63177 -9.52399 11.6675
588001 11449 10274 4785 5866 8539 7560 10244 12234 19.9298 -9.87791 9.14135 -9.35649 11.3364
589001 11477 10219 4781 5901 8570 7520 10186 12312 21.1536 -10.4885 9.4713 -9.9552 12.1925
590001 11448 10221 4801 5887 8590 7506 10170 12331 21.1684 -10.2781 9.14166 -10.2187 12.4286
591001 11489 10261 4755 5883 8615 7536 10108 12337 21.6092 -10.5093 9.41189 -10.3713 12.6635
592001 11531 10263 4715 5879 8657 7542 10022 12375 22.5306 -10.949 9.66589 -10.7952 13.3336
593001 11511 10259 4724 5876 8657 7559 10005 12372 22.4233 -10.9175 9.49446 -10.7217 13.3609
594001 11507 10270 4731 5871 8673 7548 9984 12377 22.5339 -10.8191 9.37374 -10.9363 13.537
595001 11518 10292 4746 5860 8715 7538 9963 12376 22.6747 -10.6406 9.18804 -11.2517 13.7804
596001 11575 10294 4737 5866 8785 7545 9937 12362 23.1998 -10.812 9.46924 -11.5613 14.0713
597001 11619 10292 4747 5850 8813 7569 9998 12356 22.9638 -10.8148 9.42955 -11.3191 13.9046
598001 11605 10303 4769 5830 8801 7574 10001 12333 22.5525 -10.593 9.05747 -11.1419 13.7923
599001 11591 10294 4800 5832 8794 7523 10039 12392 22.6621 -10.464 8.82706 -11.4152 13.9947
600001 11584 10313 4829 5843 8792 7505 10074 12421 22.5312 -10.255 8.65365 -11.5187 13.9616
601001 11525 10290 4825 5891 8763 7464 10093 12465 22.7594 -10.2347 8.98624 -11.8131 13.8903
602001 11520 10284 4824 5892 8750 7474 10111 12404 22.3684 -10.1305 9.08433 -11.5362 13.4948
603001 11508 10307 4839 5893 8750 7480 10101 12384 22.1441 -9.92702 8.91594 -11.5179 13.4038
604001 11507 10322 4854 5893 8744 7495 10097 12366 21.895 -9.83288 8.75191 -11.3647 13.3024
605001 11453 10354 4896 5861 8673 7531 10192 12280 20.1803 -9.12595 8.12262 -10.4229 12.2208
606001 11434 10397 4941 5818 8627 7583 10290 12228 18.6349 -8.53958 7.38785 -9.51077 11.371
607001 11436 10446 4997 5774 8627 7660 10369 12152 17.1566 -7.94106 6.61123 -8.65435 10.6152
608001 11426 10475 4986 5789 8651 7655 10331 12173 17.4917 -7.87149 6.7226 -9.04711 10.8147
609001 11491 10495 4982 5797 8731 7659 10339 12147 17.8312 -7.8661 7.04588 -9.36555 10.8957
610001 11468 10493 4994 5801 8627 7682 10448 12114 16.6475 -7.72364 6.96521 -8.38598 9.93201
611001 11446 10497 4999 5804 8568 7709 10552 12050 15.5639 -7.43037 7.0269 -7.61485 8.92533
612001 11405 10523 4995 5811 8525 7751 10607 12024 14.7646 -7.14908 7.01277 -7.09466 8.20793
613001 11382 10528 4997 5801 8527 7766 10628 12035 14.5295 -7.00074 6.87324 -7.0237 8.09449
614001 11356 10545 4988 5800 8541 7761 10646 12035 14.4346 -6.73989 6.93407 -7.196 7.94149
615001 11299 10601 5039 5733 8468 7811 10723 12004 12.662 -5.99692 5.78916 -6.25319 7.19352
616001 11209 10667 5090 5683 8401 7870 10850 11922 10.4395 -4.88601 4.85638 -5.21631 5.85796
617001 11141 10687 5134 5654 8347 7902 10918 11864 9.02741 -4.24225 4.18464 -4.4999 5.07318
618001 11069 10718 5179 5612 8279 7932 11023 11805 7.31546 -3.44362 3.41847 -3.64459 4.08515
619001 10990 10792 5189 5611 8214 7998 11074 11754 5.9006 -2.75943 3.06255 -2.91966 3.04943
620001 10990 10799 5173 5613 8199 8033 11108 11709 5.53373 -2.70373 3.24499 -2.51975 2.53632
621001 10997 10770 5161 5618 8221 8015 11100 11698 5.88558 -2.82074 3.49973 -2.72403 2.64859
622001 10913 10828 5211 5573 8159 8069 11185 11632 4.01562 -1.88271 2.56611 -1.83504 1.62119
623001 10908 10843 5214 5577 8162 8077 11190 11603 3.85481 -1.73071 2.58597 -1.78164 1.41519
624001 10926 10837 5210 5576 8133 8101 11228 11586 3.65878 -1.84582 2.64953 -1.32429 1.09812
625001 10912 10833 5197 5583 8101 8123 11283 11546 3.50326 -1.7554 2.85911 -0.880776 0.491031
626001 10887 10840 5207 5564 8112 8075 11281 11542 3.31911 -1.41964 2.66491 -1.24095 0.599496
627001 10919 10836 5188 5558 8150 8071 11225 11537 3.73306 -1.63571 2.81526 -1.54679 0.970536
628001 10875 10859 5246 5516 8073 8124 11291 11531 2.30588 -1.23206 1.81213 -0.569163 0.437422
629001 10807 10860 5302 5484 8037 8125 11320 11559 1.3262 -0.79705 0.936075 -0.307144 0.39109
630001 10763 10913 5321 5452 8000 8176 11346 11552 0.503347 -0.345949 0.300004 0.20485 -0.0413631
631001 10717 10966 5370 5399 7942 8206 11385 11543 1.2215 0.249932 -0.736152 0.83395 -0.438422
632001 10712 10905 5367 5390 7934 8161 11400 11507 1.11158 0.179742 -0.577459 0.811723 -0.4593
633001 10694 10898 5378 5386 7935 8150 11404 11529 1.10427 0.25187 -0.725305 0.714384 -0.34578
634001 10697 10871 5376 5384 7913 8172 11426 11535 1.3636 0.053109 -0.722235 1.06487 -0.448345
635001 10674 10881 5384 5384 7907 8184 11408 11547 1.46964 0.12833 -0.905864 1.07641 -0.405145
636001 10657 10898 5394 5395 7909 8187 11413 11515 1.59031 0.361957 -0.895677 1.08554 -0.646092
637001 10571 10959 5387 5421 7851 8240 11406 11512 2.28222 0.758471 -1.00922 1.43636 -1.24564
638001 10590 10895 5377 5406 7864 8180 11382 11536 1.60989 0.426357 -0.892879 1.06513 -0.691543
639001 10594 10915 5369 5394 7868 8193 11367 11531 1.67688 0.469573 -0.975233 1.07894 -0.690104
640001 10608 10905 5377 5403 7887 8173 11348 11529 1.38804 0.398213 -0.901164 0.851337 -0.480852
641001 10621 10898 5384 5397 7880 8152 11358 11564 1.33036 0.307191 -0.993989 0.783518 -0.271231
642001 10695 10878 5364 5400 7923 8160 11298 11574 0.989917 -0.262161 -0.718314 0.566709 0.272165
643001 10710 10935 5324 5377 7951 8190 11263 11562 0.848484 -0.15414 -0.671387 0.427462 0.250361
644001 10724 10963 5249 5351 7951 8210 11268 11540 0.582111 -0.179256 -0.269242 0.481674 -0.0471105
645001 10766 11002 5187 5341 7943 8268 11265 11492 1.06754 -0.350707 0.144606 0.869647 -0.489338
646001 10801 11037 5182 5326 7973 8308 11262 11459 1.21141 -0.291969 0.0944604 0.994534 -0.619877
647001 10846 11063 5203 5311 8004 8294 11304 11466 1.06146 -0.142688 -0.0611695 0.884132 -0.566488
648001 10849 11130 5251 5276 7995 8317 11416 11420 2.10593 0.587815 -0.661321 1.39473 -1.30645
649001 10826 11140 5266 5275 7985 8305 11408 11469 2.00761 0.66291 -0.920831 1.25363 -1.08238
650001 10816 11196 5313 5229 7966 8353 11408 11434 3.07051 1.09453 -1.83329 1.7666 -1.32222
651001 10753 11267 5360 5185 7926 8411 11464 11346 4.79194 2.00301 -2.71528 2.53629 -2.2683
652001 10677 11331 5421 5133 7896 8454 11506 11282 6.45825 2.96027 -3.80654 3.1157 -2.95778
653001 10658 11385 5441 5090 7895 8524 11513 11196 7.58956 3.47221 -4.40524 3.67949 -3.54971
654001 10661 11354 5443 5135 7884 8531 11525 11206 7.32666 3.19611 -4.01707 3.77673 -3.61446
655001 10757 11276 5420 5198 7947 8484 11532 11251 5.79911 2.35434 -2.94743 3.20303 -3.02324
656001 10814 11196 5417 5232 8001 8429 11462 11326 4.29871 1.56557 -2.49486 2.46707 -1.92797
657001 10817 11147 5416 5290 8020 8376 11450 11402 3.25991 1.17163 -1.95442 1.86869 -1.39376
658001 10764 11129 5479 5288 7956 8376 11508 11416 4.14008 1.43404 -2.56508 2.39446 -1.66455
659001 10704 11116 5518 5313 7909 8380 11544 11425 4.64228 1.64088 -2.7789 2.69834 -1.96339
660001 10694 11066 5548 5354 7889 8343 11537 11479 4.25152 1.34438 -2.69154 2.54655 -1.59334
661001 10620 11097 5623 5288 7832 8349 11592 11421 5.93613 2.23558 -3.91692 3.2001 -2.15801
662001 10651 11089 5651 5269 7855 8364 11637 11391 6.27495 2.31652 -4.11917 3.4318 -2.29432
663001 10668 11059 5608 5299 7893 8328 11583 11458 5.09878 1.84898 -3.52821 2.72109 -1.65114
664001 10650 11117 5569 5274 7878 8401 11603 11402 5.76291 2.15161 -3.54859 3.22247 -2.36746
665001 10653 11178 5520 5252 7872 8446 11655 11317 6.40925 2.54008 -3.29398 3.61754 -3.26948
666001 10678 11221 5526 5224 7865 8516 11726 11230 7.50731 2.85531 -3.48316 4.3824 -4.1072
667001 10646 11274 5572 5195 7852 8564 11834 11159 8.98555 3.6503 -4.04778 5.0453 -5.05727
668001 10614 11322 5621 5155 7804 8600 11932 11081 10.612 4.39633 -4.75822 5.88293 -6.00306
669001 10533 11347 5642 5167 7723 8607 11964 11117 11.3197 4.73169 -5.11104 6.25133 -6.36751
670001 10484 11344 5683 5152 7681 8637 12015 11039 12.4864 5.18721 -5.54785 6.93594 -7.07939
671001 10474 11382 5717 5119 7642 8702 12024 10969 13.6566 5.49539 -6.19999 7.73236 -7.62073
672001 10486 11423 5688 5094 7641 8760 12030 10884 14.3205 5.68084 -6.17629 8.17571 -8.23506
673001 10493 11480 5703 5027 7639 8800 12009 10825 15.1381 6.06536 -6.94053 8.54217 -8.44009
674001 10521 11508 5652 5022 7665 8850 11964 10788 15.0121 5.89526 -6.62334 8.5676 -8.56365
675001 10534 11550 5599 5042 7701 8880 11889 10771 14.5308 5.76321 -6.14515 8.22585 -8.51488
676001 10594 11540 5564 5032 7754 8843 11869 10735 13.914 5.59547 -5.69635 7.79226 -8.31396
677001 10577 11526 5559 5054 7742 8801 11880 10796 13.489 5.51737 -5.50214 7.48454 -8.07581
678001 10554 11512 5566 5077 7726 8766 11901 10831 13.3167 5.54271 -5.36969 7.31475 -8.01713
679001 10576 11534 5564 5036 7730 8807 11878 10790 13.7017 5.5765 -5.72835 7.62593 -8.10375
680001 10617 11559 5586 5000 7725 8862 11905 10723 14.5188 5.68233 -6.14012 8.27189 -8.50772
681001 10563 11564 5651 5002 7698 8837 11922 10740 14.9536 6.09081 -6.7311 8.30576 -8.49813
682001 10493 11586 5695 5014 7665 8823 11950 10760 15.4629 6.57152 -7.12709 8.34058 -8.6922
683001 10421 11596 5718 5028 7661 8810 11957 10798 15.5908 6.93988 -7.34034 8.10619 -8.67877
684001 10422 11566 5725 5080 7658 8756 11982 10846 15.0021 6.76613 -6.87044 7.75054 -8.48582
685001 10412 11511 5732 5130 7643 8701 11990 10914 14.294 6.43801 -6.46938 7.42577 -8.11634
686001 10383 11515 5767 5108 7594 8687 12048 10881 15.1334 6.82956 -6.89747 7.85889 -8.54633
687001 10377 11510 5735 5104 7588 8715 12059 10837 15.3694 6.82133 -6.6501 8.10415 -8.93229
688001 10360 11555 5728 5071 7581 8759 12092 10786 16.1952 7.22864 -6.9147 8.48705 -9.49671
689001 10340 11542 5726 5090 7570 8697 12062 10859 15.5343 7.11756 -6.82444 7.96711 -8.97819
690001 10385 11512 5701 5104 7672 8628 12003 10923 13.9875 6.78094 -6.33014 6.76743 -7.98758
691001 10409 11467 5653 5131 7736 8594 11948 10962 12.7138 6.31403 -5.61604 5.98915 -7.37327
692001 10421 11401 5667 5200 7770 8525 11959 11031 11.6154 5.93629 -4.97234 5.31156 -6.83672
693001 10443 11317 5664 5269 7751 8464 11970 11101 10.5836 5.26302 -4.24695 5.0279 -6.40285
694001 10447 11263 5651 5304 7710 8434 12012 11160 10.1904 4.84014 -3.81119 5.09627 -6.31824
695001 10433 11221 5666 5331 7684 8415 12059 11191 10.1535 4.70918 -3.65482 5.20445 -6.36185
696001 10381 11205 5683 5336 7616 8416 12128 11186 10.8998 4.92442 -3.79444 5.72878 -6.88038
697001 10351 11163 5707 5370 7595 8388 12154 11231 10.7249 4.83282 -3.70662 5.66649 -6.76902
698001 10345 11159 5743 5419 7585 8367 12214 11252 10.8009 4.92032 -3.52111 5.64844 -6.93879
699001 10369 11142 5751 5415 7609 8348 12211 11299 10.3212 4.73379 -3.56644 5.38796 -6.50909
700001 10316 11107 5812 5362 7575 8326 12227 11270 11.0237 5.12981 -4.45527 5.71919 -6.53063
701001 10253 11101 5854 5358 7532 8318 12268 11283 11.639 5.49239 -4.90937 5.97557 -6.74475
702001 10272 11044 5870 5392 7567 8256 12246 11306 10.7583 5.20042 -4.56765 5.40223 -6.21683
703001 10211 11034 5901 5418 7505 8260 12324 11296 11.5468 5.51067 -4.63894 5.8962 -6.832
704001 10231 10985 5885 5437 7516 8245 12325 11272 11.1905 5.21301 -4.1837 5.83821 -6.81643
705001 10287 10957 5885 5441 7546 8246 12356 11252 10.9887 4.95731 -3.9088 5.88113 -6.80522
706001 10262 10977 5878 5437 7546 8257 12373 11229 11.329 5.22816 -3.9108 5.93366 -7.10705
707001 10259 10991 5874 5440 7559 8252 12374 11226 11.3022 5.33947 -3.84819 5.78559 -7.13776
708001 10284 10987 5865 5444 7544 8234 12373 11246 11.0691 5.13424 -3.72986 5.76368 -7.00226
709001 10290 10992 5863 5419 7538 8233 12375 11241 11.1917 5.17906 -3.91294 5.85014 -6.99265
710001 10300 10965 5861 5426 7548 8236 12359 11237 10.9692 4.97384 -3.79321 5.83253 -6.8686
711001 10295 10978 5847 5447 7583 8210 12342 11233 10.6117 5.08631 -3.4699 5.33692 -6.79807
712001 10296 11006 5832 5437 7561 8209 12351 11244 10.7604 5.15679 -3.50846 5.41151 -6.89925
713001 10304 11020 5823 5432 7525 8285 12388 11158 11.7524 5.19755 -3.47173 6.29778 -7.70651
714001 10301 11034 5855 5409 7496 8370 12430 11078 12.9707 5.40596 -3.92068 7.27299 -8.41112
715001 10273 11107 5886 5368 7447 8409 12450 11084 13.9256 5.88243 -4.75327 7.79359 -8.71693
716001 10292 11090 5888 5348 7483 8379 12391 11118 13.2319 5.69903 -4.91913 7.32245 -8.0491
717001 10308 11060 5896 5354 7481 8361 12378 11161 12.8124 5.40227 -4.92294 7.21365 -7.66164
718001 10327 11020 5886 5382 7508 8308 12354 11237 11.7544 5.0028 -4.55932 6.58476 -6.99947
719001 10359 11049 5848 5371 7536 8335 12283 11245 11.3371 4.76867 -4.46518 6.38774 -6.71177
720001 10404 11053 5814 5367 7589 8304 12220 11275 10.3762 4.48753 -4.18623 5.72058 -6.10556
721001 10461 11054 5778 5366 7675 8264 12163 11314 9.16285 4.20359 -3.7871 4.80373 -5.37304
722001 10482 11056 5790 5361 7653 8276 12173 11313 9.35638 4.09845 -3.92783 5.09725 -5.41616
723001 10494 11052 5794 5346 7666 8259 12139 11342 9.02656 3.99286 -4.10697 4.86365 -5.00136
724001 10487 11088 5810 5316 7681 8310 12112 11301 9.56197 4.24444 -4.57365 5.10562 -5.14105
725001 10492 11098 5807 5313 7719 8302 12041 11333 9.03402 4.15075 -4.66561 4.62881 -4.60335
726001 10528 11078 5809 5315 7758 8274 12022 11313 8.59233 4.02107 -4.48337 4.31587 -4.35107
727001 10530 11102 5800 5319 7773 8247 12027 11300 8.50007 4.21957 -4.32463 4.02936 -4.41681
728001 10556 11096 5798 5323 7769 8245 12022 11298 8.36169 4.04327 -4.23662 4.08264 -4.35351
729001 10611 11103 5720 5329 7819 8217 11999 11293 7.4611 3.76196 -3.41796 3.50655 -4.18776
730001 10669 11117 5685 5332 7877 8228 11912 11258 6.78476 3.46117 -3.06024 3.13207 -3.85726
731001 10687 11165 5652 5316 7905 8278 11864 11217 6.87324 3.50427 -3.01653 3.16506 -3.98051
732001 10729 11188 5607 5331 7940 8309 11790 11190 6.37107 3.19901 -2.56936 2.97965 -3.85706
733001 10791 11169 5613 5334 8006 8332 11746 11182 5.8076 2.8362 -2.46509 2.79663 -3.43312
734001 10788 11177 5612 5341 8023 8346 11704 11180 5.64544 2.79517 -2.46906 2.67174 -3.28992
735001 10777 11167 5610 5329 8022 8320 11696 11184 5.55771 2.84845 -2.53439 2.51727 -3.1646
736001 10825 11158 5576 5337 8077 8346 11626 11176 4.8436 2.4248 -2.16183 2.25365 -2.79792
737001 10856 11140 5576 5346 8075 8363 11592 11172 4.60661 2.07531 -2.08775 2.38497 -2.62053
738001 10832 11145 5579 5337 8107 8353 11583 11184 4.51649 2.2799 -2.19745 2.06331 -2.4728
739001 10827 11151 5579 5346 8116 8345 11547 11217 4.20879 2.20605 -2.21469 1.80266 -2.16629
740001 10838 11155 5563 5358 8073 8343 11548 11251 4.0776 1.96279 -2.08481 1.95633 -2.14491
741001 10845 11177 5558 5361 8083 8343 11535 11254 3.99495 2.00277 -2.05037 1.82617 -2.09992
742001 10850 11217 5513 5353 8127 8348 11540 11199 4.05377 2.29142 -1.66062 1.56701 -2.4432
743001 10877 11262 5492 5331 8137 8380 11575 11172 4.44391 2.45566 -1.63977 1.77689 -2.80569
744001 10923 11251 5445 5342 8178 8366 11547 11188 3.68784 2.09137 -1.06935 1.36548 -2.49364
745001 10948 11261 5393 5350 8192 8410 11529 11179 3.5464 1.8157 -0.6128 1.44585 -2.6104
746001 10907 11249 5389 5404 8159 8380 11508 11259 3.07871 1.61989 -0.328659 1.13289 -2.33729
747001 10892 11221 5389 5400 8156 8344 11525 11279 2.9327 1.63169 -0.299765 0.961916 -2.21882
748001 10869 11209 5385 5408 8168 8318 11536 11310 2.78294 1.69762 -0.19156 0.657884 -2.09603
749001 10882 11229 5383 5406 8182 8275 11548 11331 2.69086 1.82721 -0.132297 0.288079 -1.94975
750001 10908 11227 5402 5382 8200 8267 11498 11369 2.20395 1.65613 -0.533224 0.1012 -1.34909
751001 10942 11249 5417 5379 8213 8282 11506 11408 2.07198 1.56704 -0.710178 0.111485 -1.14922
752001 10898 11286 5404 5391 8181 8306 11534 11395 2.60619 1.86234 -0.643226 0.333227 -1.67306
753001 10913 11291 5401 5381 8190 8279 11529 11413 2.45488 1.85549 -0.667357 0.10678 -1.45837
754001 10907 11299 5403 5378 8174 8245 11527 11426 2.48193 1.93658 -0.724363 -0.0426804 -1.37227
755001 10894 11260 5400 5397 8146 8237 11572 11430 2.46655 1.81701 -0.477055 0.158888 -1.59045
756001 10883 11211 5401 5416 8158 8158 11569 11542 1.88185 1.55736 -0.310113 -0.558 -0.841706
757001 10944 11151 5371 5446 8194 8098 11565 11583 1.56966 0.97348 0.427871 -1.11201 -0.310681
758001 10970 11128 5351 5495 8219 8078 11524 11632 1.94055 0.510538 0.995746 -1.57884 0.144323
759001 11001 11064 5341 5534 8272 8018 11489 11716 3.01036 -0.0454907 1.52105 -2.3936 1.00859
760001 11036 10992 5326 5583 8302 7979 11466 11779 4.02449 -0.712247 2.16801 -2.88887 1.62585
761001 11077 10902 5304 5644 8305 7946 11449 11836 5.07949 -1.57528 2.97079 -3.15568 2.12972
762001 11127 10880 5274 5657 8315 7952 11427 11808 5.49659 -1.98039 3.44101 -3.11727 2.17545
763001 11150 10892 5276 5661 8305 7987 11476 11792 5.18225 -1.99362 3.50118 -2.71134 1.80875
764001 11212 10888 5225 5659 8355 7973 11420 11810 6.11135 -2.42127 3.99033 -3.19734 2.31091
765001 11270 10903 5177 5665 8417 7943 11345 11822 7.16813 -2.71918 4.5087 -3.92448 2.87372
766001 11345 10899 5120 5656 8468 7946 11268 11834 8.11318 -3.26592 4.97164 -4.31108 3.44307
767001 11383 10883 5094 5636 8525 7922 11192 11894 9.04358 -3.6409 5.03102 -4.95124 4.32485
768001 11343 10903 5146 5609 8518 7922 11218 11904 8.39157 -3.18229 4.30304 -4.84798 4.27461
769001 11259 10917 5203 5600 8478 7922 11268 11902 7.47114 -2.5696 3.62907 -4.5764 3.88606
770001 11189 10934 5240 5612 8427 7925 11327 11895 6.67339 -2.08961 3.30823 -4.24828 3.34296
771001 11143 10932 5295 5601 8378 7919 11399 11910 5.86882 -1.72108 2.72007 -3.85407 3.0378
772001 11118 10946 5286 5612 8378 7925 11426 11886 5.69208 -1.48745 2.89123 -3.83109 2.6741
773001 11106 10935 5327 5587 8369 7912 11433 11927 5.5296 -1.40948 2.30744 -3.80306 2.96688
774001 11074 10934 5342 5579 8350 7910 11476 11939 5.18626 -1.1889 2.09515 -3.66134 2.77285
775001 11104 10937 5286 5593 8355 7932 11410 11950 5.69981 -1.65066 2.57398 -3.76651 2.99184
776001 11081 10963 5266 5607 8355 7977 11411 11932 5.46431 -1.54336 2.74454 -3.6022 2.63976
777001 11074 11039 5305 5566 8347 8026 11471 11868 4.25603 -0.853127 2.07014 -3.04025 1.96402
778001 11127 11038 5269 5580 8405 8025 11393 11866 5.12992 -1.24286 2.53457 -3.51998 2.4407
779001 11178 11039 5249 5579 8456 8044 11308 11848 5.69282 -1.58659 2.71476 -3.77108 2.88096
780001 11232 11052 5218 5578 8525 8043 11217 11852 6.59059 -1.88943 2.98896 -4.33415 3.48529
781001 11293 11038 5182 5576 8576 8036 11141 11875 7.53521 -2.39077 3.32371 -4.77998 4.14347
782001 11317 11081 5153 5570 8606 8042 11081 11866 7.90215 -2.40432 3.45455 -5.08456 4.34473
783001 11335 11098 5161 5537 8604 8077 11093 11831 7.37863 -2.30309 3.1376 -4.70191 4.14578
784001 11344 11076 5150 5533 8652 8009 11026 11873 8.46642 -2.44722 3.25182 -5.54822 4.93298
785001 11389 11031 5114 5558 8713 7957 10955 11946 9.99708 -3.05242 3.84161 -6.4258 5.8801
786001 11434 10986 5085 5571 8764 7925 10878 11962 11.1195 -3.57564 4.3057 -6.99811 6.58366
787001 11484 10990 5020 5569 8808 7941 10814 11958 11.8388 -3.98099 4.8645 -7.29127 6.89081
788001 11510 10981 5028 5562 8852 7934 10779 11972 12.2904 -4.10565 4.79236 -7.58509 7.32781
789001 11554 10959 5041 5561 8874 7950 10770 11992 12.5259 -4.42577 4.7344 -7.52162 7.63691
790001 11535 10915 5032 5554 8836 7932 10743 11959 12.4941 -4.58018 4.76981 -7.36338 7.62585
791001 11523 10886 5065 5585 8789 7927 10800 11933 12.0037 -4.57323 4.81964 -6.94178 7.19431
792001 11513 10823 5072 5550 8771 7888 10831 11824 11.533 -4.40593 4.7834 -6.6591 6.80975
793001 11543 10756 5032 5517 8818 7823 10774 11795 12.4379 -4.69833 5.11554 -7.21913 7.37172
794001 11558 10653 5005 5479 8858 7743 10723 11707 13.1137 -4.90488 5.43173 -7.64451 7.74394
795001 11572 10652 5001 5425 8827 7769 10757 11583 12.0801 -4.65549 5.19114 -6.90292 7.04672
796001 11585 10693 5019 5350 8822 7801 10757 11502 11.1423 -4.22996 4.44243 -6.41077 6.73975
797001 11593 10607 5036 5295 8805 7751 10798 11365 10.547 -4.07949 4.28063 -6 6.34613
798001 11560 10653 5089 5248 8748 7741 10852 11344 9.46148 -3.44365 3.36703 -5.56626 5.9448
799001 11514 10682 5132 5252 8700 7729 10910 11331 8.69496 -2.94615 2.98299 -5.30609 5.46533
800001 11512 10723 5107 5290 8682 7732 10890 11312 8.72888 -2.91829 3.41807 -5.37662 5.20438
801001 11523 10772 5096 5269 8726 7712 10823 11279 9.05752 -2.64763 3.32405 -5.86399 5.43994
802001 11548 10804 5063 5268 8749 7735 10777 11255 9.23942 -2.71938 3.55193 -5.95999 5.46206
803001 11532 10791 5103 5294 8687 7741 10866 11228 8.3952 -2.58164 3.49667 -5.34121 4.80201
804001 11514 10794 5105 5326 8630 7713 10925 11244 8.19082 -2.52135 3.73676 -5.20541 4.4354
805001 11452 10835 5140 5348 8589 7693 10973 11239 7.65271 -1.95674 3.52441 -5.1622 3.95795
806001 11390 10914 5212 5282 8508 7709 11046 11177 5.88046 -0.935783 2.22799 -4.35484 3.12659
807001 11311 11023 5271 5244 8464 7741 11106 11071 4.46507 0.32412 1.28151 -3.76238 2.00848
808001 11248 11101 5310 5212 8427 7785 11172 10985 3.56269 1.27061 0.591114 -3.12297 0.987906
809001 11225 11187 5332 5172 8421 7805 11180 10917 3.56907 2.00968 -0.0117075 -2.91045 0.478118
810001 11196 11287 5342 5141 8413 7842 11193 10866 3.85694 2.72758 -0.515309 -2.67591 -0.101373
811001 11171 11369 5366 5105 8391 7862 11225 10791 4.38794 3.4802 -1.07783 -2.31463 -0.789301
812001 11150 11428 5420 5064 8353 7888 11274 10747 5.03891 4.10478 -1.941 -1.73711 -1.32528
813001 11140 11457 5407 5069 8350 7879 11307 10700 5.36967 4.42606 -1.72509 -1.73407 -1.80566
814001 11108 11559 5367 5078 8324 7929 11283 10688 5.75123 4.7434 -1.64163 -1.61871 -2.29382
815001 11096 11608 5357 5101 8304 7937 11298 10673 6.02489 4.95201 -1.44885 -1.56571 -2.68818
816001 11038 11648 5398 5123 8252 7940 11310 10671 6.54716 5.34999 -1.79593 -1.35382 -3.03064
817001 11024 11660 5435 5104 8260 7922 11291 10655 6.88842 5.63518 -2.26179 -1.46439 -2.90431
818001 10984 11647 5440 5125 8239 7878 11261 10666 6.91818 5.6913 -2.18746 -1.76016 -2.75448
819001 10961 11587 5441 5202 8252 7829 11241 10719 6.47403 5.34534 -1.50857 -2.34237 -2.36175
820001 10976 11576 5439 5245 8257 7760 11228 10739 6.40876 5.21854 -1.03513 -2.89647 -2.09236
821001 10990 11570 5441 5265 8254 7745 11225 10749 6.29075 5.08667 -0.857144 -2.99264 -2.00219
822001 10992 11499 5443 5351 8238 7696 11238 10783 5.94124 4.60602 -0.036746 -3.26261 -1.85388
823001 10991 11460 5418 5403 8233 7635 11242 10815 6.00362 4.33191 0.690098 -3.73708 -1.68407
824001 10971 11493 5429 5397 8229 7618 11235 10825 6.28047 4.60075 0.468471 -3.91488 -1.65277
825001 10981 11483 5449 5421 8203 7573 11235 10863 6.22881 4.46081 0.504523 -4.08461 -1.40025
826001 11012 11451 5430 5487 8217 7522 11237 10879 6.40383 4.10112 1.36256 -4.55901 -1.2445
827001 11026 11472 5430 5495 8294 7449 11145 10900 7.25272 4.19317 1.47177 -5.71463 -0.442901
828001 11045 11507 5403 5487 8370 7404 11072 10915 8.10678 4.29353 1.65064 -6.67387 0.142795
829001 11107 11484 5366 5539 8401 7372 11096 10886 8.45672 3.96188 2.66659 -6.97915 0.0173064
830001 11078 11452 5347 5590 8383 7317 11127 10944 8.93888 3.82346 3.2515 -7.39628 0.0862012
831001 11052 11426 5362 5643 8355 7293 11162 10944 9.06346 3.81008 3.59914 -7.39254 -0.161784
832001 11022 11396 5375 5681 8314 7279 11236 10922 9.03222 3.90441 3.89799 -7.11592 -0.711291
833001 11052 11360 5371 5746 8327 7216 11249 10949 9.63968 3.58675 4.63387 -7.63834 -0.491706
834001 11047 11329 5366 5796 8297 7173 11289 10975 9.94127 3.40911 5.14649 -7.77038 -0.58451
835001 11060 11295 5360 5865 8263 7116 11323 10997 10.3909 3.10946 5.85632 -7.97423 -0.645764
836001 11048 11259 5358 5915 8284 7055 11315 11041 11.1256 2.95306 6.34131 -8.64653 -0.290697
837001 11058 11237 5341 5948 8271 6987 11345 11041 11.715 2.88022 6.90972 -9.00455 -0.347186
838001 11092 11258 5308 5970 8317 6951 11307 11037 12.5069 2.80617 7.43861 -9.65419 -0.110894
839001 11111 11222 5316 6024 8293 6907 11326 11058 12.829 2.49412 7.89695 -9.7979 -0.0381048
840001 11088 11205 5317 6082 8264 6857 11311 11115 13.3157 2.29486 8.24618 -10.198 0.206819
841001 11105 11158 5321 6134 8244 6800 11297 11167 13.79 1.83846 8.66045 -10.5543 0.622502
842001 11094 11129 5325 6172 8237 6745 11305 11213 14.3008 1.70426 8.95667 -10.9835 0.866064
843001 11107 11111 5327 6209 8211 6733 11293 11194 14.4 1.47381 9.25488 -10.9043 0.795486
844001 11111 11037 5338 6213 8233 6641 11253 11213 15.0767 1.24374 9.39926 -11.6277 1.48658
845001 11180 11015 5317 6209 8289 6593 11207 11250 15.8619 0.833933 9.70841 -12.3139 2.23995
846001 11189 10998 5330 6229 8306 6522 11192 11319 16.562 0.706331 9.79799 -13.026 2.84973
847001 11167 10997 5336 6235 8335 6447 11179 11329 17.2921 0.973171 9.8866 -13.8029 3.13145
848001 11184 10947 5342 6315 8352 6384 11192 11364 18.2252 0.62545 10.6232 -14.4033 3.38532
849001 11157 10916 5329 6426 8331 6339 11183 11399 19.1236 0.300857 11.5223 -14.8801 3.38267
850001 11158 10859 5345 6491 8342 6271 11172 11453 19.9895 -0.0468506 11.9779 -15.53 3.86372
851001 11141 10801 5346 6560 8362 6176 11171 11514 21.2087 -0.275717 12.6148 -16.4876 4.33125
852001 11147 10781 5339 6632 8351 6109 11182 11529 22.0362 -0.454738 13.3092 -17.0083 4.35558
853001 11164 10735 5352 6700 8360 6068 11230 11541 22.6227 -0.690225 13.9191 -17.2905 4.31382
854001 11152 10681 5363 6750 8341 6040 11252 11544 22.8957 -0.916975 14.2954 -17.3468 4.25477
855001 11178 10674 5362 6761 8333 6014 11253 11533 23.0885 -1.03136 14.4794 -17.4359 4.28399
856001 11231 10611 5348 6810 8358 5970 11188 11561 24.0483 -1.75635 15.0809 -17.977 4.96284
857001 11261 10578 5330 6872 8379 5941 11176 11562 24.8598 -2.14237 15.8152 -18.368 5.09074
858001 11245 10540 5344 6934 8367 5895 11190 11579 25.3738 -2.28968 16.2189 -18.6897 5.12139
859001 11278 10508 5360 7002 8416 5845 11191 11602 26.3279 -2.54718 16.7822 -19.3721 5.45425
860001 11238 10525 5406 7018 8376 5840 11272 11546 25.7364 -2.01028 16.5984 -18.9913 4.70561
861001 11220 10574 5400 7028 8340 5877 11284 11488 25.2634 -1.72878 16.6052 -18.5215 4.05861
862001 11211 10585 5409 7032 8314 5912 11313 11440 24.7639 -1.59109 16.5552 -18.0012 3.54942
863001 11220 10588 5401 7039 8281 5916 11339 11423 24.6098 -1.63572 16.6858 -17.7181 3.25871
864001 11219 10624 5382 7046 8271 5871 11375 11421 24.9681 -1.35909 16.9408 -18.0386 3.02973
865001 11273 10647 5382 7053 8291 5850 11425 11410 25.2217 -1.29977 17.1941 -18.1784 2.89047
866001 11290 10672 5390 7057 8303 5810 11388 11422 25.5629 -1.24105 17.1505 -18.6406 3.21111
867001 11300 10692 5378 7065 8269 5762 11416 11451 25.8181 -1.20415 17.3051 -18.855 3.18507
868001 11289 10698 5391 7054 8236 5808 11433 11410 25.1291 -1.11882 17.0674 -18.2002 2.77071
869001 11251 10797 5410 7031 8225 5823 11438 11350 24.6429 -0.303341 16.6048 -18.0705 2.21752
870001 11200 10878 5420 7005 8148 5877 11559 11226 23.5471 0.627109 16.3184 -16.9524 0.632508
871001 11146 10986 5452 6976 8094 5917 11586 11138 22.6492 1.55602 15.6447 -16.3007 -0.305721
872001 11116 11078 5504 6924 8063 5948 11649 11044 21.7433 2.54001 14.8315 -15.6503 -1.19048
873001 11052 11206 5541 6866 8011 5969 11728 10967 21.0222 3.80173 13.9651 -15.0786 -2.256
874001 10985 11323 5588 6816 7972 5991 11788 10879 20.4884 5.03574 13.0952 -14.5742 -3.24411
875001 10892 11401 5652 6787 7939 5977 11846 10840 20.2974 6.18137 12.2488 -14.4449 -3.88421
876001 10887 11384 5657 6828 7961 5936 11793 10884 20.7388 5.97995 12.4651 -15.0878 -3.36411
877001 10889 11391 5663 6844 7987 5890 11792 10858 21.2817 6.1857 12.6764 -15.5773 -3.36183
878001 10889 11382 5665 6843 7963 5877 11813 10812 21.2741 6.27085 12.7583 -15.3964 -3.66602
879001 10899 11390 5664 6848 7944 5894 11826 10783 21.1334 6.26135 12.8137 -15.0886 -3.94476
880001 10902 11401 5654 6877 7940 5853 11839 10781 21.6231 6.32536 13.1637 -15.4276 -4.03151
881001 10892 11365 5629 6930 7922 5836 11892 10746 22.124 6.2263 13.9065 -15.386 -4.53711
882001 10909 11383 5608 6962 7922 5844 11902 10685 22.476 6.25166 14.3894 -15.2973 -5.00285
883001 10921 11379 5593 6968 7919 5831 11908 10644 22.7079 6.25597 14.6641 -15.307 -5.21263
884001 10934 11408 5618 6960 7925 5821 11890 10608 22.6704 6.47035 14.4437 -15.3627 -5.23921
885001 10938 11445 5603 6964 7916 5831 11909 10557 22.8503 6.68903 14.6158 -15.2015 -5.71685
886001 10944 11486 5612 6961 7924 5826 11889 10524 22.9481 6.92888 14.5111 -15.3054 -5.81209
887001 10944 11495 5588 6958 7911 5834 11919 10520 23.0323 6.95295 14.682 -15.158 -6.06781
888001 10935 11495 5575 7000 7906 5845 11946 10467 23.4147 7.01314 15.1613 -15.017 -6.60963
889001 10932 11477 5589 7071 7936 5807 11954 10482 24.0549 6.94947 15.6609 -15.5748 -6.51985
890001 10975 11439 5594 7117 7988 5741 11921 10513 24.6885 6.60406 16.151 -16.4401 -5.89752
891001 11041 11373 5569 7178 8021 5670 11868 10560 25.4357 5.82766 16.9773 -17.2774 -5.12595
892001 11031 11328 5589 7216 8029 5597 11860 10604 25.9173 5.6898 17.1847 -17.95 -4.67097
893001 11035 11281 5577 7269 8041 5532 11856 10664 26.6322 5.3445 17.7382 -18.6591 -4.23147
894001 11056 11257 5575 7300 8040 5459 11854 10718 27.1852 5.10156 18.0601 -19.3005 -3.78637
895001 11047 11232 5582 7356 8027 5411 11869 10736 27.683 4.99035 18.4593 -19.6611 -3.76029
896001 11087 11210 5571 7387 8058 5383 11869 10703 28.2417 4.81054 18.9979 -19.9862 -3.75266
897001 11094 11268 5513 7419 8074 5438 11809 10703 28.5055 4.6497 19.416 -19.9735 -3.87588
898001 11069 11338 5538 7408 8001 5448 11884 10646 28.0743 5.26517 19.0754 -19.3338 -4.7729
899001 11028 11326 5566 7432 7953 5433 11956 10588 28.072 5.61083 19.1301 -18.9882 -5.48132
900001 10987 11316 5572 7510 7923 5397 11963 10601 28.5788 5.6012 19.5506 -19.2667 -5.65201
901001 10992 11266 5570 7588 7939 5340 11957 10654 29.3381 5.20645 20.1876 -19.9572 -5.2715
902001 10976 11254 5563 7637 7931 5259 11979 10708 30.113 5.1925 20.6204 -20.7083 -5.07893
903001 10978 11234 5567 7697 7965 5186 12005 10750 31.0471 5.15989 21.159 -21.5913 -4.83832
904001 10914 11260 5551 7768 7920 5203 11946 10833 31.1313 4.96694 21.2615 -21.6882 -4.69675
905001 10879 11284 5578 7797 7920 5196 11920 10821 31.2175 5.22133 21.1323 -21.8649 -4.75588
906001 10827 11354 5546 7812 7894 5227 11834 10858 31.161 5.31308 20.9843 -21.92 -4.68489
907001 10739 11440 5511 7871 7805 5283 11783 10945 30.8868 5.33094 20.8858 -21.5659 -4.92708
908001 10653 11503 5465 7968 7744 5314 11689 11064 31.099 5.08928 21.1125 -21.7423 -4.77304
909001 10654 11487 5416 8027 7779 5285 11580 11149 31.9224 4.51634 21.677 -22.6519 -3.95515
910001 10681 11456 5339 8100 7792 5254 11481 11224 32.9158 3.66336 22.6137 -23.4083 -3.27116
+927
View File
@@ -0,0 +1,927 @@
# input : borbu1.fst
# include : borbu1.lst
# selector : count
# mixer : basic
# distance : chi
# phase : 2
# alphabet : ACGT
# excluded : X
# seqname : borbu1
# seqlength : 910724
# unmasked : 284101
# valid : 284087
# window : 227680
# step : 1000
#
# pos LeftA RightA LeftC
1 12255 13322 4686 5089
1001 12213 13363 4707 5081
2001 12233 13341 4717 5090
3001 12265 13363 4727 5077
4001 12290 13274 4726 5055
5001 12309 13238 4742 5057
6001 12269 13241 4763 5044
7001 12318 13175 4768 5032
8001 12349 13177 4776 5031
9001 12344 13178 4778 5019
10001 12357 13159 4805 5016
11001 12394 13131 4838 5020
12001 12408 13102 4857 5013
13001 12461 13061 4865 5022
14001 12495 13019 4874 5025
15001 12520 13002 4883 4999
16001 12528 13008 4903 4998
17001 12565 13031 4943 4978
18001 12600 13013 4968 4974
19001 12627 13037 4982 4969
20001 12646 13053 4977 4979
21001 12600 13104 4959 5020
22001 12600 13125 4979 5022
23001 12598 13144 4984 5022
24001 12635 13125 4990 5000
25001 12615 13093 5000 4979
26001 12599 13127 5009 4970
27001 12622 13143 5023 4953
28001 12640 13123 5026 4947
29001 12641 13113 5030 4943
30001 12668 13106 5004 4931
31001 12691 13065 5004 4913
32001 12683 13052 5011 4920
33001 12676 13094 5003 4923
34001 12678 13081 5008 4916
35001 12668 13048 5015 4916
36001 12638 13048 5036 4905
37001 12632 13008 5051 4894
38001 12609 13013 5042 4925
39001 12615 13017 5013 4958
40001 12585 13024 5006 4979
41001 12612 12983 4991 4992
42001 12616 12965 4968 5003
43001 12617 12955 4971 5010
44001 12592 12991 4955 5014
45001 12599 12964 4921 5024
46001 12593 12978 4942 5032
47001 12514 13062 4931 5041
48001 12431 13109 4946 5026
49001 12402 13103 4932 5010
50001 12410 13092 4913 5009
51001 12397 13107 4900 4998
52001 12407 13157 4916 4995
53001 12394 13173 4896 4988
54001 12397 13173 4879 4992
55001 12364 13168 4883 5008
56001 12364 13151 4872 5017
57001 12356 13194 4859 5037
58001 12378 13183 4860 5022
59001 12384 13180 4845 5017
60001 12416 13191 4829 5015
61001 12438 13201 4819 5024
62001 12427 13223 4804 5018
63001 12437 13257 4822 5012
64001 12501 13242 4826 5017
65001 12570 13215 4817 5009
66001 12561 13229 4838 4980
67001 12561 13199 4841 4984
68001 12588 13170 4841 4991
69001 12583 13159 4858 4980
70001 12548 13203 4865 4973
71001 12554 13215 4882 4978
72001 12642 13159 4867 5015
73001 12662 13154 4890 5032
74001 12712 13135 4922 5025
75001 12784 13071 4923 5020
76001 12789 13035 4932 5029
77001 12825 12991 4958 5029
78001 12842 13016 4970 5029
79001 12847 13008 4974 5032
80001 12832 12954 4967 5017
81001 12766 13006 4979 5019
82001 12738 13022 4992 5014
83001 12750 13047 4993 5006
84001 12741 13077 4991 5028
85001 12735 13119 5007 5035
86001 12728 13157 4998 5055
87001 12734 13183 4980 5070
88001 12766 13162 4998 5058
89001 12794 13119 4999 5057
90001 12806 13103 5019 5080
91001 12821 13125 5028 5081
92001 12819 13146 5020 5091
93001 12811 13119 5012 5070
94001 12794 13152 4994 5083
95001 12778 13191 4976 5086
96001 12776 13240 4960 5090
97001 12754 13269 4943 5099
98001 12742 13306 4933 5097
99001 12707 13369 4900 5111
100001 12748 13406 4923 5116
101001 12797 13448 4930 5136
102001 12791 13498 4934 5161
103001 12804 13547 4958 5148
104001 12805 13602 4956 5133
105001 12807 13633 4920 5143
106001 12860 13602 4889 5133
107001 12936 13619 4892 5153
108001 12956 13568 4914 5158
109001 13036 13517 4938 5171
110001 13133 13497 4982 5192
111001 13241 13523 5021 5198
112001 13240 13526 5026 5206
113001 13211 13549 5048 5207
114001 13346 13520 5098 5191
115001 13356 13516 5084 5191
116001 13342 13526 5088 5192
117001 13346 13522 5072 5222
118001 13270 13588 5053 5242
119001 13236 13639 5053 5240
120001 13237 13688 5044 5239
121001 13185 13734 5032 5248
122001 13167 13737 5022 5261
123001 13179 13736 5013 5267
124001 13154 13713 5013 5268
125001 13123 13719 5020 5245
126001 13097 13730 5004 5248
127001 13056 13722 5021 5237
128001 13013 13725 5022 5238
129001 12995 13689 5003 5258
130001 13019 13693 5001 5286
131001 13030 13693 4980 5284
132001 13027 13644 4977 5274
133001 13031 13592 4979 5299
134001 13058 13584 4981 5331
135001 13108 13576 5022 5306
136001 13138 13572 5019 5314
137001 13145 13564 5018 5308
138001 13126 13553 5003 5334
139001 13096 13597 4975 5335
140001 13128 13602 4970 5344
141001 13147 13597 4946 5365
142001 13128 13566 4947 5390
143001 13118 13542 4940 5396
144001 13099 13569 4933 5415
145001 13059 13591 4916 5433
146001 13065 13578 4921 5438
147001 13092 13547 4927 5468
148001 13071 13557 4917 5507
149001 13050 13590 4913 5509
150001 13048 13583 4900 5498
151001 13006 13604 4896 5499
152001 13006 13627 4931 5497
153001 13019 13648 4963 5490
154001 13016 13672 4977 5491
155001 12977 13697 4998 5472
156001 12968 13756 4997 5453
157001 12958 13788 5009 5445
158001 12992 13747 5017 5456
159001 12973 13782 5027 5448
160001 13002 13731 5028 5415
161001 13078 13747 5044 5421
162001 13106 13761 5021 5430
163001 13106 13768 5009 5427
164001 13105 13784 5012 5418
165001 13109 13765 4995 5439
166001 13165 13718 4997 5428
167001 13174 13717 4987 5455
168001 13170 13727 4995 5449
169001 13169 13730 5010 5451
170001 13151 13734 5021 5447
171001 13196 13709 5032 5449
172001 13191 13744 5022 5461
173001 13191 13767 5019 5468
174001 13182 13826 5015 5450
175001 13205 13850 5025 5431
176001 13224 13836 5018 5414
177001 13272 13800 5014 5424
178001 13236 13790 5018 5419
179001 13213 13787 5005 5422
180001 13221 13779 4986 5435
181001 13194 13779 4991 5435
182001 13166 13768 4992 5420
183001 13163 13771 4978 5405
184001 13210 13753 4977 5389
185001 13200 13731 4988 5378
186001 13157 13704 5016 5349
187001 13161 13683 5028 5315
188001 13127 13637 5026 5326
189001 13067 13665 5030 5329
190001 13023 13674 5026 5325
191001 12994 13682 5028 5315
192001 13009 13663 5029 5318
193001 13007 13656 5031 5320
194001 12966 13684 5011 5334
195001 13003 13645 5019 5346
196001 13029 13618 5009 5357
197001 13052 13624 5009 5330
198001 13095 13639 5027 5318
199001 13114 13664 5038 5315
200001 13170 13646 5056 5303
201001 13186 13640 5063 5306
202001 13161 13642 5057 5298
203001 13115 13696 5060 5297
204001 13111 13710 5082 5271
205001 13133 13704 5085 5257
206001 13154 13714 5093 5240
207001 13122 13752 5071 5265
208001 13176 13745 5089 5269
209001 13200 13767 5083 5277
210001 13247 13769 5093 5284
211001 13280 13746 5097 5283
212001 13310 13716 5094 5286
213001 13371 13673 5107 5262
214001 13416 13614 5122 5225
215001 13458 13566 5139 5211
216001 13502 13545 5161 5203
217001 13556 13495 5146 5195
218001 13616 13431 5132 5199
219001 13633 13411 5137 5199
220001 13606 13412 5137 5193
221001 13615 13385 5151 5168
222001 13547 13464 5151 5178
223001 13504 13503 5179 5177
224001 13502 13516 5194 5191
225001 13523 13501 5204 5201
226001 13529 13541 5202 5221
227001 13552 13523 5205 5226
228001 13512 13511 5191 5245
229001 13525 13480 5185 5266
230001 13527 13481 5196 5280
231001 13542 13487 5230 5266
232001 13597 13476 5238 5299
233001 13643 13438 5240 5315
234001 13694 13382 5240 5319
235001 13730 13361 5256 5312
236001 13731 13362 5266 5323
237001 13736 13356 5265 5332
238001 13713 13376 5261 5328
239001 13726 13365 5248 5325
240001 13732 13359 5244 5308
241001 13724 13379 5231 5305
242001 13721 13378 5240 5282
243001 13686 13463 5260 5278
244001 13697 13456 5297 5271
245001 13693 13480 5292 5293
246001 13626 13527 5279 5310
247001 13595 13558 5301 5275
248001 13583 13595 5330 5237
249001 13580 13628 5310 5227
250001 13575 13617 5324 5184
251001 13559 13660 5309 5182
252001 13561 13687 5330 5176
253001 13595 13690 5329 5185
254001 13611 13653 5345 5171
255001 13597 13613 5370 5153
256001 13564 13635 5388 5153
257001 13547 13646 5403 5162
258001 13570 13662 5426 5144
259001 13599 13659 5425 5147
260001 13561 13657 5449 5127
261001 13532 13659 5477 5104
262001 13562 13677 5507 5104
263001 13589 13694 5504 5104
264001 13567 13738 5493 5132
265001 13608 13708 5497 5132
266001 13634 13687 5495 5113
267001 13652 13658 5496 5117
268001 13678 13635 5488 5130
269001 13695 13629 5471 5133
270001 13762 13558 5453 5162
271001 13778 13565 5450 5152
272001 13750 13591 5457 5175
273001 13778 13598 5438 5212
274001 13725 13646 5418 5250
275001 13749 13610 5421 5252
276001 13764 13648 5434 5235
277001 13786 13628 5423 5234
278001 13779 13611 5423 5237
279001 13755 13599 5436 5233
280001 13713 13586 5434 5239
281001 13719 13587 5453 5223
282001 13722 13559 5452 5206
283001 13734 13537 5451 5214
284001 13721 13515 5448 5225
285001 13715 13509 5451 5231
286001 13752 13462 5461 5245
287001 13773 13441 5464 5251
288001 13822 13365 5445 5273
289001 13825 13309 5428 5288
290001 13815 13284 5415 5313
291001 13799 13277 5420 5321
292001 13784 13270 5421 5305
293001 13787 13267 5420 5309
294001 13782 13260 5433 5300
295001 13783 13240 5437 5273
296001 13768 13237 5418 5289
297001 13772 13186 5401 5280
298001 13749 13203 5392 5284
299001 13730 13201 5375 5267
300001 13704 13179 5339 5286
301001 13672 13169 5324 5313
302001 13633 13169 5323 5311
303001 13669 13148 5324 5304
304001 13679 13156 5327 5317
305001 13672 13151 5316 5321
306001 13662 13164 5320 5313
307001 13664 13184 5319 5335
308001 13674 13172 5339 5329
309001 13641 13164 5348 5316
310001 13626 13158 5350 5310
311001 13623 13143 5330 5296
312001 13638 13114 5321 5308
313001 13671 13098 5311 5320
314001 13643 13094 5306 5338
315001 13641 13099 5306 5336
316001 13648 13088 5297 5360
317001 13705 13074 5287 5372
318001 13711 13065 5270 5367
319001 13712 13054 5257 5371
320001 13729 13057 5245 5363
321001 13746 13064 5267 5351
322001 13739 12952 5270 5307
323001 13777 12790 5270 5265
324001 13767 12633 5283 5215
325001 13743 12506 5285 5172
326001 13709 12395 5283 5132
327001 13667 12266 5260 5100
328001 13587 12187 5212 5073
329001 13560 12141 5212 5045
330001 13538 12081 5204 5023
331001 13495 12008 5194 5015
332001 13422 11907 5193 4981
333001 13408 11862 5194 4973
334001 13410 11868 5190 4985
335001 13382 11903 5162 4992
336001 13484 11885 5192 4975
337001 13506 11943 5179 4961
338001 13516 11906 5199 4919
339001 13498 11896 5209 4909
340001 13553 11870 5218 4889
341001 13514 11897 5229 4878
342001 13499 11907 5248 4875
343001 13472 11920 5273 4851
344001 13474 11951 5284 4839
345001 13487 11949 5258 4838
346001 13476 11953 5301 4803
347001 13422 11972 5317 4776
348001 13374 11987 5316 4783
349001 13353 11988 5310 4777
350001 13363 12011 5324 4777
351001 13357 12009 5332 4782
352001 13379 11964 5328 4766
353001 13352 11951 5321 4770
354001 13357 11922 5304 4767
355001 13374 11950 5301 4759
356001 13385 11969 5287 4757
357001 13460 11916 5268 4753
358001 13461 11938 5285 4703
359001 13481 11930 5293 4680
360001 13535 11923 5306 4673
361001 13557 11907 5271 4678
362001 13599 11896 5236 4687
363001 13628 11848 5220 4686
364001 13627 11830 5187 4691
365001 13661 11787 5175 4697
366001 13680 11779 5177 4716
367001 13702 11786 5191 4724
368001 13645 11755 5174 4702
369001 13614 11711 5153 4686
370001 13652 11713 5147 4678
371001 13637 11739 5167 4649
372001 13667 11668 5142 4650
373001 13666 11697 5148 4641
374001 13658 11729 5121 4647
375001 13666 11733 5102 4652
376001 13682 11692 5101 4627
377001 13691 11674 5106 4630
378001 13738 11628 5128 4646
379001 13705 11550 5132 4619
380001 13674 11504 5121 4623
381001 13654 11454 5119 4594
382001 13632 11448 5129 4599
383001 13631 11441 5141 4610
384001 13551 11447 5162 4623
385001 13568 11420 5161 4642
386001 13595 11397 5180 4649
387001 13599 11388 5224 4640
388001 13641 11365 5246 4628
389001 13613 11358 5249 4633
390001 13643 11326 5236 4648
391001 13626 11333 5242 4654
392001 13604 11350 5230 4675
393001 13594 11331 5238 4693
394001 13588 11339 5231 4704
395001 13593 11343 5222 4725
396001 13552 11387 5211 4735
397001 13537 11398 5217 4742
398001 13516 11437 5227 4742
399001 13503 11439 5233 4727
400001 13466 11440 5247 4704
401001 13441 11454 5253 4700
402001 13350 11474 5281 4700
403001 13310 11494 5296 4687
404001 13282 11560 5314 4665
405001 13279 11613 5325 4655
406001 13277 11684 5307 4661
407001 13258 11745 5308 4647
408001 13265 11797 5295 4641
409001 13239 11894 5274 4643
410001 13230 11914 5290 4643
411001 13191 11939 5281 4685
412001 13206 11940 5286 4682
413001 13196 11930 5269 4701
414001 13176 11954 5293 4693
415001 13165 11942 5310 4680
416001 13169 11918 5311 4674
417001 13157 11911 5304 4676
418001 13155 11880 5320 4658
419001 13154 11834 5321 4633
420001 13175 11787 5315 4627
421001 13180 11738 5337 4610
422001 13171 11736 5331 4598
423001 13174 11762 5314 4601
424001 13163 11769 5304 4608
425001 13134 11755 5299 4612
426001 13115 11724 5310 4602
427001 13104 11672 5324 4571
428001 13084 11646 5337 4536
429001 13097 11614 5336 4533
430001 13081 11622 5360 4515
431001 13067 11652 5371 4510
432001 13069 11674 5369 4525
433001 13055 11696 5373 4536
434001 13056 11652 5359 4533
435001 13052 11638 5351 4537
436001 12932 11746 5299 4573
437001 12764 11845 5253 4622
438001 12614 11939 5209 4660
439001 12489 12025 5162 4689
440001 12377 12112 5127 4747
441001 12245 12209 5094 4798
442001 12189 12287 5067 4842
443001 12141 12290 5042 4841
444001 12074 12337 5032 4822
445001 11989 12421 5013 4850
446001 11895 12526 4976 4868
447001 11863 12560 4973 4867
448001 11866 12568 4984 4844
449001 11903 12569 4991 4839
450001 11887 12558 4972 4844
451001 11935 12499 4955 4830
452001 11895 12464 4915 4816
453001 11883 12473 4911 4801
454001 11875 12463 4890 4807
455001 11911 12490 4875 4802
456001 11917 12497 4866 4790
457001 11928 12506 4852 4803
458001 11947 12466 4838 4815
459001 11956 12463 4839 4812
460001 11945 12458 4794 4808
461001 11988 12448 4775 4818
462001 11978 12457 4781 4822
463001 11991 12435 4773 4839
464001 12000 12423 4772 4810
465001 12005 12438 4785 4797
466001 11957 12494 4762 4830
467001 11947 12488 4773 4835
468001 11918 12514 4770 4870
469001 11953 12485 4765 4888
470001 11953 12489 4754 4898
471001 11914 12454 4747 4885
472001 11946 12400 4695 4906
473001 11919 12402 4680 4924
474001 11923 12387 4671 4926
475001 11917 12373 4683 4933
476001 11901 12362 4680 4937
477001 11851 12396 4686 4927
478001 11825 12388 4689 4934
479001 11772 12388 4695 4937
480001 11779 12378 4713 4934
481001 11795 12372 4727 4951
482001 11761 12443 4698 4977
483001 11717 12475 4684 4988
484001 11721 12453 4677 5001
485001 11733 12450 4654 5009
486001 11676 12435 4647 5009
487001 11704 12358 4648 5018
488001 11730 12302 4649 5029
489001 11736 12264 4644 5038
490001 11689 12298 4630 5053
491001 11659 12306 4635 5034
492001 11626 12322 4643 5010
493001 11541 12383 4620 5031
494001 11496 12409 4623 5016
495001 11441 12462 4590 5062
496001 11448 12452 4602 5029
497001 11453 12493 4607 5000
498001 11433 12479 4625 4976
499001 11415 12476 4643 4964
500001 11395 12460 4647 4954
501001 11384 12462 4636 4919
502001 11358 12448 4627 4913
503001 11345 12462 4638 4885
504001 11332 12448 4647 4873
505001 11333 12426 4652 4840
506001 11350 12431 4678 4840
507001 11336 12480 4692 4844
508001 11333 12497 4711 4823
509001 11339 12497 4726 4804
510001 11382 12501 4737 4803
511001 11409 12520 4741 4798
512001 11434 12511 4739 4813
513001 11438 12500 4719 4838
514001 11439 12484 4706 4851
515001 11453 12445 4706 4848
516001 11475 12427 4702 4829
517001 11505 12426 4688 4829
518001 11569 12374 4664 4871
519001 11623 12323 4652 4889
520001 11692 12296 4659 4891
521001 11758 12247 4647 4896
522001 11816 12207 4637 4905
523001 11893 12113 4642 4891
524001 11916 12135 4655 4881
525001 11939 12139 4682 4881
526001 11939 12149 4686 4882
527001 11942 12197 4709 4874
528001 11962 12206 4683 4889
529001 11939 12222 4688 4888
530001 11919 12243 4678 4882
531001 11909 12255 4677 4868
532001 11869 12291 4652 4876
533001 11822 12345 4638 4896
534001 11761 12375 4617 4896
535001 11732 12381 4616 4879
536001 11735 12380 4595 4903
537001 11765 12348 4598 4886
538001 11757 12344 4608 4878
539001 11755 12346 4608 4877
540001 11715 12342 4603 4848
541001 11651 12408 4561 4878
542001 11657 12439 4529 4895
543001 11623 12478 4532 4900
544001 11623 12459 4509 4901
545001 11656 12405 4513 4893
546001 11677 12389 4525 4889
547001 11694 12367 4541 4890
548001 11649 12390 4530 4904
549001 11638 12385 4539 4918
550001 11764 12340 4581 4895
551001 11861 12354 4628 4879
552001 11939 12383 4660 4871
553001 12050 12387 4700 4859
554001 12113 12425 4747 4833
555001 12224 12383 4805 4784
556001 12276 12376 4846 4750
557001 12281 12377 4829 4753
558001 12347 12380 4825 4749
559001 12437 12373 4853 4755
560001 12535 12381 4870 4777
561001 12559 12392 4862 4793
562001 12569 12323 4844 4823
563001 12567 12283 4841 4830
564001 12551 12238 4843 4845
565001 12499 12246 4829 4840
566001 12456 12341 4814 4851
567001 12470 12361 4804 4853
568001 12466 12355 4808 4846
569001 12494 12314 4795 4838
570001 12502 12294 4789 4864
571001 12505 12237 4806 4865
572001 12478 12223 4818 4848
573001 12452 12221 4809 4837
574001 12456 12215 4808 4825
575001 12440 12189 4818 4814
576001 12434 12208 4820 4835
577001 12434 12190 4837 4820
578001 12430 12197 4811 4851
579001 12436 12149 4798 4867
580001 12490 12121 4834 4866
581001 12504 12159 4842 4865
582001 12508 12129 4878 4835
583001 12481 12129 4891 4812
584001 12474 12117 4891 4815
585001 12443 12157 4885 4833
586001 12395 12125 4902 4841
587001 12413 12110 4915 4822
588001 12379 12129 4923 4831
589001 12374 12125 4931 4811
590001 12364 12122 4938 4808
591001 12388 12133 4929 4834
592001 12396 12138 4941 4830
593001 12384 12142 4935 4846
594001 12372 12152 4939 4824
595001 12386 12148 4959 4808
596001 12449 12144 4977 4814
597001 12480 12177 4982 4819
598001 12449 12169 5006 4814
599001 12446 12194 5004 4798
600001 12434 12240 5017 4783
601001 12339 12293 5008 4769
602001 12296 12313 5029 4742
603001 12273 12319 5041 4716
604001 12296 12278 5052 4728
605001 12306 12223 5028 4760
606001 12337 12227 5019 4785
607001 12391 12247 5025 4807
608001 12418 12269 5020 4819
609001 12462 12282 5063 4831
610001 12455 12283 5021 4849
611001 12492 12229 4988 4886
612001 12473 12267 4968 4893
613001 12472 12273 4962 4893
614001 12463 12279 4946 4900
615001 12454 12278 4922 4930
616001 12453 12267 4909 4952
617001 12454 12245 4885 4970
618001 12445 12253 4870 4972
619001 12428 12279 4839 5010
620001 12442 12270 4841 5002
621001 12487 12228 4840 4979
622001 12489 12237 4815 4983
623001 12501 12220 4805 4987
624001 12501 12220 4804 4981
625001 12526 12192 4795 4985
626001 12516 12186 4812 4948
627001 12501 12198 4842 4931
628001 12474 12248 4851 4925
629001 12441 12262 4841 4914
630001 12437 12288 4836 4921
631001 12414 12280 4842 4910
632001 12366 12231 4863 4875
633001 12317 12238 4889 4879
634001 12295 12221 4889 4886
635001 12239 12253 4899 4874
636001 12188 12270 4912 4876
637001 12113 12340 4895 4884
638001 12148 12273 4874 4872
639001 12137 12285 4882 4868
640001 12160 12262 4881 4864
641001 12188 12235 4879 4856
642001 12212 12249 4906 4850
643001 12227 12247 4892 4862
644001 12234 12208 4880 4886
645001 12266 12223 4862 4915
646001 12296 12236 4879 4924
647001 12343 12245 4893 4933
648001 12383 12263 4900 4944
649001 12370 12255 4882 4947
650001 12373 12236 4903 4963
651001 12345 12239 4883 4994
652001 12344 12241 4878 4991
653001 12347 12248 4869 5025
654001 12350 12245 4849 5038
655001 12428 12231 4884 5027
656001 12445 12220 4904 5013
657001 12471 12203 4898 5009
658001 12444 12201 4898 4999
659001 12391 12202 4890 5011
660001 12380 12160 4892 5003
661001 12359 12124 4886 4984
662001 12400 12107 4908 4987
663001 12373 12120 4912 4972
664001 12337 12142 4895 5012
665001 12356 12150 4878 5031
666001 12378 12177 4865 5062
667001 12399 12180 4863 5093
668001 12421 12201 4831 5111
669001 12376 12233 4778 5129
670001 12371 12228 4747 5142
671001 12389 12254 4757 5159
672001 12373 12250 4750 5194
673001 12383 12266 4756 5189
674001 12384 12300 4774 5201
675001 12369 12362 4786 5209
676001 12336 12381 4828 5178
677001 12272 12460 4837 5159
678001 12236 12523 4838 5131
679001 12257 12546 4842 5140
680001 12343 12532 4854 5149
681001 12361 12491 4853 5133
682001 12352 12502 4844 5141
683001 12314 12552 4842 5139
684001 12286 12608 4858 5098
685001 12243 12641 4861 5073
686001 12232 12618 4849 5073
687001 12226 12610 4838 5091
688001 12212 12635 4823 5104
689001 12194 12677 4815 5079
690001 12203 12662 4829 5058
691001 12179 12652 4821 5059
692001 12188 12653 4855 5033
693001 12145 12686 4871 5000
694001 12129 12698 4862 4965
695001 12155 12705 4861 4957
696001 12133 12710 4826 4957
697001 12119 12696 4815 4969
698001 12140 12706 4826 4975
699001 12162 12696 4836 4952
700001 12116 12674 4842 4919
701001 12100 12671 4825 4916
702001 12143 12644 4833 4894
703001 12128 12632 4808 4910
704001 12119 12614 4809 4909
705001 12157 12593 4838 4905
706001 12131 12600 4840 4890
707001 12135 12585 4845 4886
708001 12159 12568 4817 4889
709001 12144 12577 4811 4874
710001 12165 12543 4814 4876
711001 12179 12549 4818 4867
712001 12163 12575 4813 4853
713001 12198 12541 4798 4894
714001 12249 12540 4778 4931
715001 12275 12589 4757 4941
716001 12323 12580 4733 4938
717001 12303 12600 4721 4936
718001 12266 12647 4738 4905
719001 12216 12727 4761 4878
720001 12221 12766 4783 4857
721001 12271 12771 4817 4824
722001 12277 12766 4821 4831
723001 12292 12772 4833 4787
724001 12268 12789 4853 4798
725001 12222 12806 4890 4788
726001 12266 12792 4896 4781
727001 12277 12821 4893 4771
728001 12282 12819 4903 4780
729001 12285 12830 4932 4748
730001 12259 12872 4961 4729
731001 12247 12927 4968 4730
732001 12252 12939 4983 4760
733001 12280 12937 5009 4778
734001 12257 12968 4993 4778
735001 12226 12955 4984 4767
736001 12236 12958 4983 4783
737001 12222 12940 4983 4799
738001 12218 12966 4987 4781
739001 12178 12982 4979 4786
740001 12187 12991 4940 4793
741001 12206 12962 4935 4796
742001 12254 12938 4922 4812
743001 12282 12914 4922 4842
744001 12281 12881 4918 4853
745001 12264 12915 4897 4889
746001 12234 12940 4874 4885
747001 12228 12888 4881 4864
748001 12215 12831 4885 4877
749001 12264 12792 4870 4894
750001 12273 12786 4882 4888
751001 12314 12785 4880 4913
752001 12284 12795 4867 4927
753001 12280 12815 4869 4912
754001 12265 12827 4864 4903
755001 12237 12818 4857 4905
756001 12248 12798 4849 4880
757001 12246 12815 4864 4841
758001 12208 12850 4888 4827
759001 12219 12835 4918 4807
760001 12232 12826 4918 4792
761001 12247 12800 4935 4771
762001 12265 12795 4939 4763
763001 12258 12851 4948 4767
764001 12232 12936 4970 4737
765001 12243 12985 4990 4717
766001 12244 12973 4995 4732
767001 12248 12978 5029 4717
768001 12244 12990 5036 4711
769001 12232 12958 5023 4717
770001 12216 12935 5008 4729
771001 12205 12936 5006 4723
772001 12199 12938 4998 4730
773001 12194 12955 5014 4702
774001 12156 12954 5000 4700
775001 12123 12966 4994 4714
776001 12107 12995 4981 4732
777001 12134 13020 4990 4746
778001 12140 13029 5022 4741
779001 12143 13022 5032 4749
780001 12177 13029 5065 4738
781001 12188 13021 5099 4743
782001 12203 13053 5113 4772
783001 12221 13061 5125 4794
784001 12229 13031 5147 4793
785001 12252 12998 5166 4780
786001 12251 12990 5201 4753
787001 12264 12971 5185 4778
788001 12310 12924 5200 4786
789001 12368 12852 5210 4807
790001 12385 12790 5175 4806
791001 12474 12721 5147 4807
792001 12528 12624 5133 4788
793001 12548 12528 5142 4759
794001 12519 12403 5147 4721
795001 12499 12378 5135 4720
796001 12502 12385 5142 4713
797001 12554 12236 5134 4683
798001 12618 12214 5099 4705
799001 12642 12238 5080 4711
800001 12620 12269 5072 4730
801001 12616 12289 5095 4727
802001 12626 12312 5098 4749
803001 12672 12272 5078 4762
804001 12668 12319 5059 4762
805001 12648 12354 5053 4779
806001 12654 12343 5031 4784
807001 12695 12359 4990 4811
808001 12689 12401 4962 4847
809001 12701 12406 4957 4862
810001 12704 12464 4960 4869
811001 12689 12504 4971 4876
812001 12701 12531 4965 4885
813001 12691 12526 4950 4906
814001 12679 12564 4920 4947
815001 12668 12600 4914 4965
816001 12641 12636 4892 4979
817001 12631 12635 4908 4971
818001 12606 12605 4908 4959
819001 12597 12595 4903 4981
820001 12593 12603 4893 4986
821001 12581 12634 4890 4986
822001 12572 12610 4888 5005
823001 12576 12599 4876 5011
824001 12540 12622 4878 5026
825001 12551 12640 4861 5026
826001 12579 12645 4859 5028
827001 12534 12666 4900 5005
828001 12545 12690 4934 5002
829001 12587 12682 4939 5010
830001 12579 12678 4945 4996
831001 12608 12674 4931 5013
832001 12659 12661 4891 5023
833001 12733 12633 4870 5039
834001 12768 12627 4854 5052
835001 12770 12618 4828 5039
836001 12773 12616 4822 5011
837001 12777 12590 4787 5008
838001 12792 12618 4801 4984
839001 12808 12608 4784 4977
840001 12800 12615 4776 4973
841001 12827 12589 4772 4950
842001 12830 12590 4764 4923
843001 12838 12583 4745 4946
844001 12869 12506 4731 4929
845001 12933 12419 4737 4950
846001 12944 12396 4761 4931
847001 12936 12398 4776 4907
848001 12976 12395 4784 4904
849001 12945 12409 4777 4908
850001 12961 12393 4782 4892
851001 12946 12390 4794 4881
852001 12972 12364 4779 4882
853001 12998 12359 4794 4873
854001 12986 12353 4793 4861
855001 12960 12377 4794 4855
856001 12947 12367 4814 4840
857001 12906 12424 4845 4830
858001 12881 12437 4860 4819
859001 12935 12432 4892 4807
860001 12940 12429 4872 4823
861001 12877 12509 4867 4820
862001 12824 12568 4879 4822
863001 12788 12566 4899 4833
864001 12778 12570 4895 4837
865001 12807 12593 4920 4841
866001 12790 12583 4922 4858
867001 12829 12545 4905 4865
868001 12823 12566 4901 4881
869001 12808 12646 4909 4868
870001 12805 12655 4870 4898
871001 12826 12722 4841 4922
872001 12847 12776 4824 4923
873001 12830 12793 4805 4934
874001 12833 12826 4786 4960
875001 12797 12849 4765 4969
876001 12797 12844 4768 4974
877001 12867 12829 4760 4967
878001 12951 12763 4734 4977
879001 12990 12730 4717 4996
880001 12973 12747 4729 4993
881001 12982 12736 4715 4990
882001 12991 12735 4705 5013
883001 12950 12725 4721 4992
884001 12932 12733 4728 4984
885001 12931 12772 4727 5001
886001 12939 12795 4734 5001
887001 12957 12807 4701 5016
888001 12944 12822 4696 5028
889001 12964 12819 4712 5023
890001 12989 12819 4741 5006
891001 13026 12783 4742 4991
892001 13031 12773 4743 4976
893001 13017 12773 4753 4957
894001 13024 12757 4741 4942
895001 13029 12738 4744 4929
896001 13062 12704 4781 4902
897001 13047 12762 4790 4927
898001 13024 12797 4797 4932
899001 13004 12794 4776 4936
900001 12982 12805 4761 4956
901001 12970 12802 4778 4952
902001 12908 12806 4789 4918
903001 12862 12865 4819 4882
904001 12772 12942 4803 4897
905001 12711 12970 4806 4919
906001 12630 13041 4789 4944
907001 12499 13147 4752 4987
908001 12395 13244 4724 5017
909001 12385 13230 4723 5028
910001 12367 13224 4709 5052
+927
View File
@@ -0,0 +1,927 @@
# input : borbu1.fst
# include : borbu1.lst
# selector : count
# mixer : basic
# distance : chi
# phase : 7
# alphabet : ACGT
# excluded : X
# seqname : borbu1
# seqlength : 910724
# unmasked : 849408
# valid : 849367
# window : 227680
# step : 1000
#
# pos LeftA RightA LeftC
1 33401 42069 12563 18275
1001 33398 42133 12544 18312
2001 33527 42158 12573 18285
3001 33656 42179 12640 18272
4001 33781 41887 12627 18205
5001 33914 41776 12674 18264
6001 33937 41760 12733 18283
7001 34058 41589 12793 18251
8001 34178 41618 12871 18245
9001 34278 41568 12834 18281
10001 34470 41433 12833 18374
11001 34641 41316 12853 18448
12001 34784 41230 12868 18468
13001 35025 41076 12871 18543
14001 35196 40931 12868 18625
15001 35342 40865 12836 18647
16001 35424 40868 12886 18681
17001 35664 40831 12955 18712
18001 35814 40796 13016 18690
19001 35974 40847 13095 18623
20001 36056 40878 13110 18638
21001 35998 41046 13082 18697
22001 35998 41205 13190 18628
23001 36018 41226 13266 18664
24001 36116 41165 13319 18658
25001 36070 41094 13450 18538
26001 36047 41144 13553 18547
27001 36161 41151 13570 18579
28001 36241 41084 13613 18611
29001 36263 41009 13713 18629
30001 36354 40982 13707 18629
31001 36456 40902 13719 18660
32001 36496 40858 13778 18715
33001 36511 40947 13839 18721
34001 36540 40883 13912 18703
35001 36535 40854 13983 18694
36001 36547 40829 14074 18710
37001 36591 40759 14151 18715
38001 36624 40746 14204 18716
39001 36673 40756 14251 18717
40001 36670 40764 14291 18776
41001 36766 40670 14317 18835
42001 36822 40637 14378 18863
43001 36880 40620 14467 18865
44001 36852 40717 14535 18823
45001 36869 40737 14569 18774
46001 36899 40759 14645 18752
47001 36728 40994 14672 18746
48001 36638 41131 14683 18775
49001 36635 41113 14699 18774
50001 36682 41088 14709 18798
51001 36648 41134 14787 18775
52001 36681 41225 14941 18708
53001 36663 41324 15037 18669
54001 36670 41358 15099 18631
55001 36689 41320 15198 18644
56001 36734 41300 15266 18591
57001 36720 41410 15330 18576
58001 36813 41324 15356 18581
59001 36832 41373 15398 18562
60001 36884 41405 15451 18553
61001 36945 41458 15548 18538
62001 36975 41481 15617 18539
63001 37055 41543 15690 18501
64001 37226 41519 15710 18562
65001 37372 41411 15732 18638
66001 37392 41389 15770 18643
67001 37445 41292 15834 18678
68001 37595 41148 15862 18759
69001 37667 41076 15911 18808
70001 37691 41119 15963 18791
71001 37722 41153 15995 18794
72001 37968 41086 15993 18824
73001 38156 41028 15995 18867
74001 38377 40982 16017 18882
75001 38617 40791 15999 18894
76001 38774 40630 15946 18986
77001 38988 40518 15945 18980
78001 39163 40542 15930 18981
79001 39229 40555 15995 18989
80001 39251 40426 16010 18971
81001 39190 40561 16031 19006
82001 39217 40583 16072 18998
83001 39307 40609 16122 18988
84001 39327 40734 16208 18959
85001 39413 40873 16264 18875
86001 39429 41045 16268 18859
87001 39535 41048 16241 18894
88001 39659 41050 16317 18861
89001 39797 40946 16333 18833
90001 39875 41034 16387 18805
91001 39954 41116 16453 18717
92001 39995 41231 16542 18652
93001 39981 41165 16613 18529
94001 39932 41266 16699 18468
95001 39890 41409 16725 18461
96001 39884 41541 16778 18417
97001 39879 41630 16802 18401
98001 39940 41698 16868 18348
99001 39900 41835 16886 18353
100001 40077 41867 16950 18418
101001 40288 41886 16981 18471
102001 40311 42061 17023 18450
103001 40374 42207 17164 18377
104001 40388 42356 17260 18279
105001 40461 42417 17278 18259
106001 40549 42351 17333 18245
107001 40761 42433 17445 18201
108001 40840 42380 17480 18116
109001 41075 42310 17566 18088
110001 41382 42335 17713 18097
111001 41723 42370 17883 18122
112001 41776 42381 17984 18139
113001 41731 42457 18105 18163
114001 42132 42354 18308 18133
115001 42125 42393 18307 18132
116001 42172 42362 18276 18111
117001 42117 42411 18248 18145
118001 41871 42614 18211 18236
119001 41744 42737 18271 18189
120001 41755 42867 18287 18113
121001 41600 43039 18250 18098
122001 41588 43025 18233 18092
123001 41553 43033 18303 18085
124001 41416 43026 18379 18073
125001 41296 43057 18450 18013
126001 41207 43081 18468 18021
127001 41059 43085 18558 17988
128001 40899 43147 18638 17961
129001 40849 43100 18655 17932
130001 40879 43137 18692 17908
131001 40833 43179 18717 17905
132001 40819 43040 18686 17887
133001 40847 42970 18630 17884
134001 40893 43016 18645 17881
135001 41070 42948 18693 17843
136001 41226 42919 18625 17857
137001 41223 42919 18666 17798
138001 41176 42916 18640 17871
139001 41100 43047 18524 17859
140001 41147 43089 18557 17792
141001 41149 43086 18580 17779
142001 41077 43131 18604 17739
143001 41020 43110 18621 17666
144001 40972 43172 18644 17644
145001 40891 43213 18681 17631
146001 40881 43286 18725 17570
147001 40940 43320 18742 17551
148001 40872 43391 18699 17596
149001 40836 43453 18698 17616
150001 40831 43378 18717 17578
151001 40742 43444 18706 17541
152001 40744 43520 18720 17512
153001 40760 43576 18720 17499
154001 40739 43628 18780 17488
155001 40653 43668 18843 17470
156001 40650 43790 18860 17398
157001 40621 43822 18861 17390
158001 40738 43743 18818 17452
159001 40746 43784 18769 17490
160001 40803 43664 18728 17525
161001 41048 43685 18750 17531
162001 41117 43676 18774 17544
163001 41127 43666 18762 17513
164001 41126 43717 18820 17477
165001 41139 43690 18760 17526
166001 41250 43580 18698 17530
167001 41325 43551 18665 17590
168001 41344 43542 18622 17648
169001 41318 43520 18644 17647
170001 41323 43500 18582 17710
171001 41402 43427 18572 17755
172001 41351 43473 18578 17819
173001 41407 43461 18565 17866
174001 41411 43557 18555 17836
175001 41472 43570 18538 17815
176001 41492 43538 18536 17789
177001 41592 43421 18517 17838
178001 41499 43365 18583 17822
179001 41403 43390 18631 17822
180001 41370 43368 18645 17874
181001 41277 43368 18698 17885
182001 41129 43357 18772 17864
183001 41079 43346 18799 17858
184001 41133 43264 18797 17864
185001 41139 43193 18801 17938
186001 41072 43040 18828 18005
187001 41044 42924 18863 18060
188001 40951 42808 18906 18119
189001 40788 42871 18920 18177
190001 40584 42928 18976 18180
191001 40530 42824 18985 18263
192001 40537 42733 18985 18331
193001 40568 42709 18983 18340
194001 40449 42814 18961 18415
195001 40564 42653 19002 18518
196001 40576 42533 18991 18617
197001 40616 42502 18981 18610
198001 40788 42454 18946 18629
199001 40885 42427 18870 18697
200001 41054 42316 18847 18747
201001 41066 42274 18867 18745
202001 41047 42292 18869 18719
203001 40950 42433 18827 18742
204001 41060 42414 18797 18735
205001 41150 42369 18714 18753
206001 41262 42264 18629 18788
207001 41172 42409 18521 18862
208001 41339 42426 18479 18865
209001 41450 42468 18444 18866
210001 41559 42468 18421 18883
211001 41639 42390 18403 18933
212001 41710 42323 18340 19006
213001 41835 42220 18353 18987
214001 41873 42156 18432 18907
215001 41903 42075 18460 18835
216001 42082 41969 18444 18838
217001 42227 41853 18365 18851
218001 42394 41692 18269 18925
219001 42421 41639 18244 18982
220001 42368 41694 18232 18999
221001 42438 41563 18189 18994
222001 42321 41733 18083 19028
223001 42294 41775 18095 19037
224001 42342 41760 18095 19038
225001 42373 41760 18123 18961
226001 42385 41854 18135 18936
227001 42452 41826 18157 18852
228001 42339 41905 18134 18810
229001 42390 41916 18126 18810
230001 42367 41955 18102 18847
231001 42475 41953 18173 18818
232001 42629 41940 18226 18827
233001 42756 41871 18177 18850
234001 42886 41751 18102 18887
235001 43026 41678 18102 18934
236001 43020 41694 18102 18964
237001 43047 41737 18080 18957
238001 43027 41789 18054 18949
239001 43086 41774 18013 18961
240001 43083 41784 18020 18929
241001 43091 41841 17969 18925
242001 43151 41823 17960 18847
243001 43103 41990 17925 18832
244001 43180 41940 17922 18802
245001 43189 42035 17913 18760
246001 43016 42164 17890 18828
247001 42985 42202 17876 18837
248001 43003 42237 17883 18777
249001 42952 42323 17850 18793
250001 42936 42284 17858 18778
251001 42910 42435 17809 18740
252001 42937 42483 17879 18703
253001 43062 42477 17838 18765
254001 43103 42407 17789 18819
255001 43086 42332 17772 18840
256001 43139 42368 17720 18837
257001 43113 42417 17663 18869
258001 43179 42473 17648 18853
259001 43252 42479 17605 18864
260001 43272 42406 17576 18844
261001 43318 42324 17545 18838
262001 43397 42386 17586 18782
263001 43430 42424 17612 18746
264001 43329 42551 17556 18808
265001 43458 42436 17542 18855
266001 43538 42342 17507 18890
267001 43596 42248 17508 18930
268001 43630 42223 17486 18985
269001 43674 42227 17464 18959
270001 43812 42109 17388 19014
271001 43800 42125 17407 18953
272001 43743 42168 17459 18928
273001 43778 42213 17502 18937
274001 43662 42309 17525 18951
275001 43682 42228 17535 18982
276001 43669 42252 17545 18988
277001 43711 42170 17504 19031
278001 43707 42162 17484 19043
279001 43663 42136 17528 19046
280001 43578 42088 17531 19061
281001 43548 42101 17594 19019
282001 43534 42004 17649 18951
283001 43519 41993 17649 18978
284001 43477 41926 17717 18969
285001 43448 41908 17765 18991
286001 43482 41818 17826 19024
287001 43461 41777 17863 19033
288001 43549 41626 17830 19099
289001 43545 41509 17813 19162
290001 43495 41503 17795 19207
291001 43420 41514 17835 19209
292001 43353 41484 17823 19215
293001 43395 41457 17827 19204
294001 43371 41409 17874 19202
295001 43371 41326 17891 19112
296001 43360 41332 17858 19112
297001 43340 41227 17861 19048
298001 43256 41306 17882 19022
299001 43173 41303 17948 18980
300001 43019 41377 18006 18899
301001 42879 41441 18094 18846
302001 42791 41439 18125 18849
303001 42881 41436 18179 18780
304001 42919 41501 18196 18742
305001 42792 41534 18274 18681
306001 42733 41565 18336 18655
307001 42734 41545 18334 18729
308001 42784 41500 18433 18679
309001 42625 41533 18528 18558
310001 42529 41584 18621 18467
311001 42474 41539 18622 18406
312001 42445 41520 18652 18369
313001 42410 41540 18707 18333
314001 42318 41602 18756 18299
315001 42292 41639 18741 18247
316001 42306 41615 18716 18237
317001 42444 41528 18730 18274
318001 42422 41489 18745 18302
319001 42370 41472 18762 18348
320001 42308 41523 18804 18330
321001 42397 41531 18869 18334
322001 42411 41154 18864 18246
323001 42490 40666 18854 18103
324001 42445 40219 18895 17938
325001 42380 39834 18945 17768
326001 42325 39475 19011 17577
327001 42208 39096 18994 17447
328001 42089 38839 18868 17351
329001 42058 38715 18838 17361
330001 41956 38511 18846 17311
331001 41849 38269 18856 17233
332001 41659 37916 18925 17066
333001 41643 37747 18978 17001
334001 41677 37707 19009 16997
335001 41544 37793 18982 17027
336001 41796 37757 19054 17001
337001 41772 37872 19034 16990
338001 41760 37755 19036 16949
339001 41763 37712 18960 16995
340001 41849 37621 18918 17034
341001 41846 37626 18846 17114
342001 41898 37558 18808 17182
343001 41917 37496 18818 17198
344001 41935 37541 18854 17189
345001 41953 37511 18798 17112
346001 41936 37503 18824 17047
347001 41833 37517 18859 16960
348001 41746 37482 18889 16907
349001 41650 37498 18936 16805
350001 41706 37485 18953 16717
351001 41756 37381 18948 16637
352001 41816 37220 18947 16538
353001 41748 37130 18958 16525
354001 41795 36961 18922 16485
355001 41844 36901 18918 16446
356001 41839 36811 18843 16478
357001 41964 36632 18811 16498
358001 41945 36535 18808 16442
359001 42037 36405 18745 16423
360001 42170 36345 18830 16357
361001 42199 36234 18833 16321
362001 42259 36195 18782 16297
363001 42320 36021 18786 16267
364001 42320 35880 18795 16269
365001 42464 35690 18719 16242
366001 42464 35649 18706 16192
367001 42514 35618 18794 16136
368001 42390 35511 18838 16014
369001 42329 35318 18840 15929
370001 42399 35216 18829 15908
371001 42416 35181 18880 15812
372001 42495 34932 18844 15766
373001 42498 34876 18855 15720
374001 42387 34928 18849 15684
375001 42343 34888 18835 15661
376001 42394 34790 18767 15593
377001 42428 34733 18750 15497
378001 42552 34666 18804 15451
379001 42419 34445 18858 15299
380001 42318 34372 18910 15224
381001 42236 34186 18951 15101
382001 42216 34145 18979 14995
383001 42221 34096 18968 14941
384001 42101 34064 19009 14880
385001 42138 34006 18951 14876
386001 42171 33926 18927 14870
387001 42217 33869 18937 14817
388001 42288 33811 18945 14765
389001 42227 33804 18987 14698
390001 42229 33777 19001 14608
391001 42178 33814 19053 14541
392001 42129 33845 19018 14500
393001 42117 33818 19049 14428
394001 42095 33882 19047 14328
395001 42112 33866 19015 14243
396001 42000 33998 18957 14185
397001 41988 34001 18977 14096
398001 41920 34124 18985 14018
399001 41888 34124 18996 13906
400001 41825 34100 19024 13773
401001 41768 34140 19041 13655
402001 41596 34158 19127 13545
403001 41513 34174 19170 13422
404001 41504 34241 19211 13276
405001 41535 34316 19220 13176
406001 41494 34468 19217 13075
407001 41422 34582 19213 12950
408001 41415 34688 19193 12840
409001 41337 34886 19105 12786
410001 41331 34904 19115 12700
411001 41254 34939 19041 12751
412001 41305 34881 19018 12696
413001 41313 34846 18979 12627
414001 41398 34769 18878 12615
415001 41433 34646 18852 12574
416001 41440 34570 18840 12568
417001 41462 34454 18771 12637
418001 41509 34288 18734 12646
419001 41552 34119 18683 12533
420001 41567 33996 18670 12406
421001 41537 33864 18742 12237
422001 41515 33815 18671 12171
423001 41547 33831 18536 12182
424001 41613 33767 18459 12138
425001 41527 33733 18398 12160
426001 41533 33608 18357 12173
427001 41557 33392 18329 12152
428001 41598 33214 18282 12086
429001 41633 33086 18240 12058
430001 41596 33051 18233 11993
431001 41508 33085 18279 11904
432001 41521 33097 18313 11828
433001 41483 33097 18339 11741
434001 41518 32930 18320 11645
435001 41504 32819 18346 11638
436001 41082 33083 18222 11774
437001 40592 33344 18067 11969
438001 40159 33581 17914 12131
439001 39790 33798 17729 12185
440001 39419 34057 17551 12292
441001 39026 34362 17425 12396
442001 38846 34568 17357 12457
443001 38708 34586 17355 12405
444001 38499 34687 17315 12393
445001 38210 34888 17207 12505
446001 37862 35164 17039 12629
447001 37728 35205 16986 12633
448001 37704 35152 16985 12583
449001 37790 35100 17019 12535
450001 37760 35046 16993 12516
451001 37851 34876 16978 12505
452001 37717 34791 16941 12476
453001 37689 34769 17010 12351
454001 37634 34737 17055 12261
455001 37633 34757 17123 12162
456001 37564 34746 17186 12044
457001 37509 34737 17205 11998
458001 37536 34601 17178 11976
459001 37535 34528 17112 12049
460001 37479 34494 17035 12118
461001 37525 34477 16945 12138
462001 37463 34478 16896 12164
463001 37490 34387 16783 12235
464001 37436 34355 16700 12206
465001 37371 34368 16629 12187
466001 37200 34519 16528 12223
467001 37112 34536 16523 12178
468001 36942 34668 16473 12209
469001 36880 34714 16446 12174
470001 36780 34786 16480 12134
471001 36601 34724 16491 12090
472001 36525 34668 16431 12070
473001 36371 34689 16409 12082
474001 36322 34694 16351 12050
475001 36260 34683 16324 12045
476001 36202 34646 16281 12077
477001 36008 34724 16270 12039
478001 35850 34708 16265 11991
479001 35675 34701 16230 12003
480001 35640 34694 16183 12010
481001 35627 34687 16128 12034
482001 35512 34857 16003 12067
483001 35312 34994 15923 12093
484001 35223 34969 15896 12126
485001 35163 34988 15811 12164
486001 34927 35000 15760 12205
487001 34899 34881 15731 12214
488001 34922 34756 15671 12207
489001 34890 34704 15643 12236
490001 34781 34756 15583 12266
491001 34732 34719 15486 12290
492001 34655 34672 15432 12305
493001 34423 34844 15293 12407
494001 34345 34835 15211 12398
495001 34134 35003 15070 12448
496001 34140 34939 14990 12438
497001 34094 34983 14922 12409
498001 34043 34903 14874 12383
499001 33987 34883 14883 12365
500001 33914 34822 14861 12357
501001 33844 34777 14814 12373
502001 33796 34666 14750 12440
503001 33798 34595 14684 12452
504001 33801 34479 14586 12493
505001 33826 34340 14523 12482
506001 33856 34322 14485 12473
507001 33842 34380 14421 12469
508001 33876 34310 14328 12505
509001 33853 34272 14231 12491
510001 33989 34251 14165 12505
511001 34034 34255 14085 12484
512001 34115 34201 13997 12502
513001 34107 34193 13883 12519
514001 34102 34162 13753 12574
515001 34140 34073 13645 12643
516001 34164 33978 13536 12640
517001 34192 33936 13403 12700
518001 34246 33895 13267 12739
519001 34335 33804 13159 12771
520001 34485 33749 13059 12786
521001 34599 33663 12935 12795
522001 34732 33579 12824 12820
523001 34877 33351 12773 12798
524001 34890 33371 12710 12780
525001 34929 33372 12749 12777
526001 34889 33399 12686 12775
527001 34882 33474 12640 12772
528001 34755 33538 12605 12782
529001 34646 33565 12579 12752
530001 34542 33569 12576 12677
531001 34422 33596 12653 12603
532001 34258 33694 12630 12599
533001 34087 33870 12525 12646
534001 33938 33942 12368 12693
535001 33840 33952 12229 12712
536001 33808 33953 12175 12776
537001 33815 33863 12177 12786
538001 33736 33806 12133 12845
539001 33723 33780 12166 12876
540001 33566 33755 12184 12836
541001 33316 33900 12128 12851
542001 33218 33973 12081 12879
543001 33092 34068 12059 12888
544001 33045 33992 11974 12940
545001 33073 33899 11890 12984
546001 33099 33844 11815 12989
547001 33088 33749 11728 13078
548001 32902 33822 11637 13158
549001 32823 33831 11641 13131
550001 33125 33741 11804 13041
551001 33390 33730 11995 12972
552001 33581 33835 12131 12954
553001 33865 33837 12207 12987
554001 34060 33894 12292 13007
555001 34412 33716 12413 12973
556001 34549 33667 12442 12974
557001 34561 33648 12380 13011
558001 34711 33660 12404 12999
559001 34927 33655 12525 13002
560001 35188 33671 12648 12979
561001 35200 33711 12612 12941
562001 35131 33646 12585 12915
563001 35096 33616 12534 12925
564001 35015 33538 12509 12962
565001 34873 33557 12517 12979
566001 34764 33739 12460 13003
567001 34761 33726 12341 13071
568001 34735 33677 12244 13121
569001 34769 33567 12139 13141
570001 34748 33549 12019 13182
571001 34728 33466 11999 13191
572001 34618 33432 11986 13219
573001 34508 33425 12053 13168
574001 34479 33433 12114 13128
575001 34462 33359 12139 13130
576001 34422 33421 12154 13136
577001 34394 33428 12235 13052
578001 34375 33473 12211 13105
579001 34361 33449 12192 13111
580001 34515 33423 12218 13092
581001 34593 33472 12187 13108
582001 34675 33378 12212 13095
583001 34719 33331 12174 13087
584001 34748 33289 12110 13132
585001 34692 33397 12081 13164
586001 34660 33352 12052 13252
587001 34695 33271 12069 13270
588001 34663 33293 12037 13292
589001 34681 33236 12045 13303
590001 34644 33230 12080 13293
591001 34706 33297 12029 13316
592001 34738 33317 11998 13305
593001 34699 33320 12005 13320
594001 34685 33364 12015 13294
595001 34728 33403 12053 13261
596001 34879 33389 12069 13277
597001 34994 33419 12084 13266
598001 34968 33398 12135 13240
599001 34987 33405 12168 13224
600001 34996 33466 12210 13222
601001 34826 33536 12191 13263
602001 34748 33573 12212 13233
603001 34712 33611 12244 13202
604001 34745 33576 12273 13210
605001 34709 33544 12292 13204
606001 34725 33599 12332 13194
607001 34840 33662 12414 13167
608001 34848 33715 12401 13199
609001 34993 33755 12450 13219
610001 34940 33756 12423 13243
611001 34967 33682 12392 13294
612001 34890 33753 12369 13317
613001 34873 33762 12364 13304
614001 34821 33782 12352 13302
615001 34757 33836 12392 13258
616001 34652 33880 12439 13237
617001 34571 33875 12469 13218
618001 34460 33909 12503 13179
619001 34332 34045 12482 13219
620001 34330 34053 12472 13207
621001 34377 33964 12467 13191
622001 34286 34019 12493 13149
623001 34270 34044 12496 13150
624001 34255 34055 12501 13142
625001 34255 34025 12478 13146
626001 34204 34019 12508 13078
627001 34200 34022 12522 13048
628001 34152 34096 12584 13003
629001 34054 34111 12641 12949
630001 34003 34199 12656 12927
631001 33919 34240 12718 12862
632001 33883 34079 12729 12815
633001 33786 34088 12778 12808
634001 33745 34051 12788 12805
635001 33646 34104 12806 12790
636001 33560 34151 12830 12805
637001 33344 34341 12806 12845
638001 33389 34169 12767 12820
639001 33378 34210 12770 12804
640001 33410 34180 12781 12822
641001 33466 34134 12785 12817
642001 33561 34143 12798 12818
643001 33568 34216 12751 12792
644001 33557 34192 12666 12781
645001 33631 34239 12583 12802
646001 33711 34291 12604 12795
647001 33865 34310 12647 12793
648001 33958 34381 12716 12771
649001 33922 34382 12717 12772
650001 33947 34407 12783 12743
651001 33852 34484 12806 12727
652001 33797 34523 12857 12661
653001 33779 34572 12871 12657
654001 33780 34567 12840 12716
655001 33956 34488 12866 12773
656001 34002 34397 12893 12782
657001 34042 34349 12885 12838
658001 33962 34333 12945 12820
659001 33863 34323 12973 12865
660001 33830 34230 13008 12902
661001 33726 34212 13083 12814
662001 33844 34155 13151 12791
663001 33803 34142 13107 12804
664001 33741 34227 13038 12834
665001 33742 34312 12958 12829
666001 33832 34342 12951 12834
667001 33860 34389 13004 12837
668001 33868 34462 13019 12807
669001 33703 34558 12972 12848
670001 33657 34537 12980 12844
671001 33665 34602 13024 12828
672001 33655 34622 12989 12835
673001 33660 34690 13007 12766
674001 33683 34761 12967 12776
675001 33661 34902 12920 12805
676001 33690 34897 12931 12737
677001 33601 34983 12936 12744
678001 33520 35067 12958 12742
679001 33562 35089 12972 12706
680001 33736 35073 13016 12675
681001 33722 35042 13091 12647
682001 33670 35080 13125 12652
683001 33562 35163 13150 12660
684001 33531 35199 13174 12672
685001 33481 35177 13183 12701
686001 33451 35143 13216 12671
687001 33435 35115 13160 12694
688001 33416 35138 13134 12664
689001 33374 35158 13126 12664
690001 33428 35109 13111 12661
691001 33416 35035 13049 12690
692001 33455 34998 13111 12730
693001 33448 34938 13111 12773
694001 33437 34893 13092 12769
695001 33457 34863 13113 12786
696001 33372 34852 13082 12793
697001 33307 34808 13108 12829
698001 33344 34830 13155 12889
699001 33412 34803 13185 12864
700001 33321 34683 13264 12770
701001 33236 34677 13276 12759
702001 33306 34583 13297 12771
703001 33232 34580 13299 12813
704001 33229 34490 13296 12831
705001 33356 34436 13325 12833
706001 33310 34462 13313 12821
707001 33307 34460 13316 12822
708001 33396 34417 13280 12830
709001 33392 34398 13266 12783
710001 33415 34327 13272 12795
711001 33414 34354 13263 12806
712001 33387 34423 13240 12780
713001 33414 34394 13217 12824
714001 33474 34417 13227 12844
715001 33488 34546 13244 12821
716001 33593 34499 13219 12800
717001 33594 34499 13206 12805
718001 33574 34514 13210 12803
719001 33544 34636 13190 12778
720001 33602 34664 13188 12748
721001 33714 34658 13185 12727
722001 33732 34671 13203 12728
723001 33764 34651 13216 12673
724001 33738 34702 13257 12650
725001 33664 34738 13301 12625
726001 33773 34683 13318 12616
727001 33763 34758 13305 12610
728001 33808 34744 13298 12631
729001 33854 34770 13245 12596
730001 33871 34843 13249 12569
731001 33882 34938 13213 12568
732001 33913 35008 13188 12618
733001 34049 34985 13217 12645
734001 34018 35047 13196 12653
735001 33969 35033 13190 12617
736001 34021 35018 13150 12643
737001 34059 34971 13146 12674
738001 34049 34999 13152 12650
739001 33994 35011 13138 12676
740001 34019 35038 13065 12703
741001 34040 35021 13053 12723
742001 34094 35012 12996 12745
743001 34161 35017 12969 12770
744001 34206 34963 12916 12776
745001 34187 35024 12839 12826
746001 34080 35072 12812 12883
747001 34079 34963 12818 12857
748001 34040 34893 12804 12883
749001 34115 34878 12786 12914
750001 34170 34849 12816 12886
751001 34284 34866 12833 12913
752001 34189 34926 12813 12941
753001 34202 34942 12810 12918
754001 34187 34986 12820 12902
755001 34132 34921 12821 12917
756001 34153 34852 12811 12915
757001 34228 34807 12781 12919
758001 34197 34840 12782 12966
759001 34230 34763 12807 12982
760001 34282 34694 12791 13022
761001 34329 34565 12789 13068
762001 34371 34536 12766 13071
763001 34395 34596 12779 13088
764001 34422 34675 12747 13054
765001 34490 34774 12713 13032
766001 34541 34768 12652 13045
767001 34572 34765 12665 13005
768001 34560 34771 12725 12982
769001 34472 34771 12770 12971
770001 34389 34771 12783 13005
771001 34356 34748 12839 12983
772001 34332 34743 12815 13003
773001 34301 34751 12885 12948
774001 34227 34746 12884 12933
775001 34211 34787 12823 12954
776001 34153 34864 12778 12990
777001 34182 35018 12836 12952
778001 34242 35031 12837 12965
779001 34297 35044 12829 12976
780001 34359 35074 12831 12969
781001 34421 35047 12831 12974
782001 34457 35128 12807 12997
783001 34516 35143 12836 12986
784001 34533 35058 12845 12978
785001 34600 34978 12826 12986
786001 34633 34937 12834 12962
787001 34680 34932 12756 12989
788001 34777 34861 12780 13001
789001 34915 34753 12803 13019
790001 34893 34614 12729 13014
791001 35006 34507 12745 13059
792001 35074 34261 12738 12989
793001 35092 34050 12702 12910
794001 35062 33729 12670 12813
795001 35052 33678 12637 12749
796001 35076 33709 12657 12661
797001 35167 33357 12665 12547
798001 35203 33412 12683 12539
799001 35176 33528 12713 12570
800001 35139 33673 12669 12652
801001 35127 33789 12687 12632
802001 35107 33947 12648 12681
803001 35145 33950 12677 12735
804001 35113 34070 12668 12798
805001 35019 34200 12694 12874
806001 34989 34294 12745 12830
807001 34941 34483 12767 12842
808001 34865 34665 12774 12867
809001 34867 34809 12791 12867
810001 34839 35043 12803 12864
811001 34815 35223 12823 12861
812001 34814 35365 12880 12848
813001 34790 35424 12854 12890
814001 34700 35674 12774 12965
815001 34668 35832 12754 13023
816001 34581 35984 12776 13100
817001 34567 36027 12831 13082
818001 34488 36004 12831 13089
819001 34450 35995 12833 13201
820001 34454 36036 12824 13271
821001 34450 36113 12826 13327
822001 34420 36070 12824 13466
823001 34395 36048 12784 13552
824001 34334 36164 12801 13578
825001 34359 36244 12801 13627
826001 34425 36278 12785 13714
827001 34399 36352 12829 13714
828001 34435 36457 12843 13718
829001 34546 36493 12815 13788
830001 34481 36514 12806 13833
831001 34493 36541 12806 13932
832001 34530 36530 12782 14006
833001 34639 36545 12766 14086
834001 34660 36595 12747 14157
835001 34668 36639 12730 14211
836001 34664 36692 12715 14256
837001 34667 36684 12668 14300
838001 34708 36786 12644 14320
839001 34749 36803 12622 14405
840001 34707 36879 12612 14475
841001 34765 36852 12611 14536
842001 34749 36877 12615 14576
843001 34789 36888 12586 14665
844001 34818 36712 12579 14665
845001 34971 36625 12582 14682
846001 35010 36630 12619 14703
847001 34980 36647 12647 14697
848001 35067 36643 12664 14803
849001 35008 36690 12631 14951
850001 35020 36668 12654 15035
851001 34978 36664 12671 15107
852001 35002 36704 12652 15202
853001 35058 36728 12694 15278
854001 35020 36732 12711 15337
855001 35018 36813 12721 15357
856001 35027 36805 12743 15395
857001 35005 36897 12772 15461
858001 34957 36948 12785 15553
859001 35073 36989 12843 15628
860001 35063 37034 12877 15682
861001 34948 37239 12867 15703
862001 34893 37362 12888 15743
863001 34856 37403 12913 15781
864001 34830 37472 12894 15831
865001 34930 37607 12925 15868
866001 34923 37666 12937 15913
867001 34977 37695 12905 15966
868001 34972 37749 12911 15993
869001 34913 37992 12935 15985
870001 34848 38155 12911 16005
871001 34813 38413 12929 16012
872001 34811 38613 12972 15987
873001 34756 38801 12990 15944
874001 34696 39013 13019 15938
875001 34552 39180 13067 15936
876001 34544 39226 13077 16000
877001 34610 39260 13082 16015
878001 34694 39207 13056 16030
879001 34779 39215 13035 16085
880001 34778 39307 13038 16137
881001 34785 39307 12996 16212
882001 34786 39409 12971 16275
883001 34766 39444 12970 16263
884001 34762 39548 13010 16254
885001 34750 39676 12985 16322
886001 34742 39811 13010 16331
887001 34766 39874 12946 16386
888001 34732 39955 12918 16466
889001 34777 39992 12947 16565
890001 34880 39984 12983 16620
891001 35028 39895 12950 16696
892001 35021 39881 12975 16732
893001 35027 39886 12981 16782
894001 35082 39900 12972 16804
895001 35073 39925 12980 16875
896001 35147 39917 13009 16887
897001 35106 40119 12954 16970
898001 35048 40294 12989 16986
899001 34991 40318 12992 17036
900001 34926 40392 12969 17169
901001 34940 40382 12990 17263
902001 34833 40464 13002 17290
903001 34800 40553 13040 17338
904001 34589 40772 13006 17458
905001 34480 40881 13052 17504
906001 34272 41103 12988 17577
907001 33991 41422 12892 17731
908001 33703 41733 12803 17898
909001 33693 41764 12737 18004
910001 33657 41779 12642 18125
+927
View File
@@ -0,0 +1,927 @@
# input : borbu1.fst
# exclude : borbu1.lst
# selector : count
# mixer : basic
# distance : chi
# phase : 7
# alphabet : ACGT
# excluded : X
# seqname : borbu1
# seqlength : 910724
# unmasked : 61316
# valid : 61314
# window : 227680
# step : 1000
#
# pos LeftA RightA LeftC
1 3196 2425 788 676
1001 3288 2409 804 679
2001 3286 2409 800 679
3001 3233 2421 784 681
4001 3292 2677 795 800
5001 3259 2678 784 800
6001 3263 2666 774 804
7001 3243 2757 773 848
8001 3203 2763 762 852
9001 3243 2746 771 851
10001 3246 2743 771 851
11001 3246 2743 772 850
12001 3246 2743 768 850
13001 3189 2748 753 852
14001 3189 2751 753 854
15001 3189 2751 753 854
16001 3226 2696 753 843
17001 3101 2707 698 851
18001 3039 2778 684 874
19001 2972 2795 670 881
20001 2973 2789 671 876
21001 3094 2667 727 822
22001 3058 2667 720 822
23001 3103 2602 735 807
24001 3098 2626 733 818
25001 3098 2794 733 877
26001 3107 2734 736 868
27001 3093 2729 730 868
28001 3093 2729 730 868
29001 3093 2738 730 876
30001 3125 2709 741 868
31001 3123 2725 740 871
32001 3158 2695 751 864
33001 3158 2669 753 858
34001 3158 2734 753 882
35001 3152 2750 753 892
36001 3159 2743 757 888
37001 3159 2749 757 893
38001 3159 2797 757 895
39001 3163 2802 759 897
40001 3245 2745 781 878
41001 3245 2745 781 878
42001 3247 2743 784 875
43001 3201 2761 778 876
44001 3201 2770 778 878
45001 3201 2838 778 894
46001 3240 2802 780 889
47001 3376 2685 840 835
48001 3462 2599 865 810
49001 3462 2599 865 810
50001 3503 2575 875 808
51001 3546 2534 887 799
52001 3469 2570 875 804
53001 3474 2565 879 800
54001 3504 2572 891 796
55001 3500 2587 891 803
56001 3500 2656 891 817
57001 3536 2624 902 807
58001 3569 2650 915 812
59001 3579 2640 918 809
60001 3599 2620 932 795
61001 3608 2611 935 792
62001 3608 2611 935 792
63001 3597 2611 933 792
64001 3597 2558 943 776
65001 3601 2558 943 778
66001 3608 2561 944 780
67001 3608 2561 944 780
68001 3611 2558 945 779
69001 3609 2579 945 783
70001 3597 2602 944 785
71001 3613 2575 944 780
72001 3589 2575 938 781
73001 3607 2558 942 777
74001 3577 2559 935 777
75001 3577 2639 935 813
76001 3612 2615 940 817
77001 3612 2668 940 829
78001 3616 2700 942 831
79001 3583 2700 939 831
80001 3653 2791 943 876
81001 3747 2697 955 864
82001 3747 2698 955 865
83001 3752 2687 957 859
84001 3785 2649 966 849
85001 3803 2631 974 841
86001 3861 2573 1001 814
87001 3904 2537 1005 812
88001 3905 2538 1005 810
89001 3905 2643 1005 848
90001 3899 2648 1004 849
91001 3899 2671 1004 855
92001 3860 2664 1006 848
93001 3885 2823 1026 894
94001 3889 2819 1028 892
95001 3984 2748 1055 867
96001 3984 2748 1055 867
97001 3984 2748 1055 867
98001 3984 2762 1055 868
99001 4063 2683 1065 858
100001 3975 2683 1035 858
101001 3918 2668 1017 856
102001 4004 2584 1046 828
103001 3958 2573 1039 828
104001 3944 2574 1036 833
105001 3935 2608 1035 856
106001 3952 2659 1035 876
107001 3748 2665 998 871
108001 3733 2748 995 899
109001 3547 2844 939 945
110001 3296 2842 874 944
111001 2894 2864 775 951
112001 2744 2847 759 941
113001 2702 2781 755 918
114001 2371 2781 671 918
115001 2409 2712 679 905
116001 2409 2742 679 915
117001 2475 2670 720 874
118001 2677 2415 800 782
119001 2690 2410 808 775
120001 2666 2407 804 775
121001 2757 2316 848 731
122001 2786 2313 860 730
123001 2746 2313 851 730
124001 2743 2347 851 740
125001 2743 2356 850 744
126001 2743 2367 850 744
127001 2748 2380 852 748
128001 2751 2377 854 746
129001 2751 2449 854 765
130001 2696 2449 843 765
131001 2707 2461 851 764
132001 2778 2607 874 772
133001 2795 2610 881 767
134001 2772 2553 866 753
135001 2667 2615 822 768
136001 2645 2613 817 768
137001 2602 2650 807 781
138001 2643 2604 827 761
139001 2795 2552 879 737
140001 2734 2605 868 747
141001 2729 2605 868 747
142001 2738 2600 876 741
143001 2741 2671 879 763
144001 2709 2671 868 763
145001 2719 2655 871 760
146001 2666 2656 857 757
147001 2669 2653 858 756
148001 2734 2588 882 732
149001 2750 2572 892 722
150001 2743 2632 888 733
151001 2797 2646 895 743
152001 2793 2646 893 743
153001 2802 2637 897 739
154001 2745 2622 878 742
155001 2745 2622 878 742
156001 2743 2622 875 742
157001 2761 2601 876 740
158001 2770 2592 878 738
159001 2838 2524 894 722
160001 2795 2586 889 740
161001 2630 2570 817 736
162001 2599 2575 810 737
163001 2605 2594 811 743
164001 2530 2589 796 738
165001 2570 2549 804 730
166001 2570 2569 804 736
167001 2565 2569 800 736
168001 2587 2520 803 722
169001 2587 2523 803 725
170001 2656 2454 817 711
171001 2624 2452 807 710
172001 2640 2384 809 692
173001 2620 2387 795 694
174001 2620 2387 795 694
175001 2611 2396 792 697
176001 2611 2401 792 700
177001 2558 2421 776 706
178001 2558 2451 778 714
179001 2577 2432 782 710
180001 2561 2445 780 713
181001 2561 2448 780 713
182001 2558 2450 779 718
183001 2598 2411 785 712
184001 2579 2407 784 712
185001 2575 2414 780 715
186001 2575 2420 781 718
187001 2559 2423 777 722
188001 2559 2423 777 722
189001 2603 2346 808 690
190001 2659 2310 827 685
191001 2668 2301 829 683
192001 2700 2267 831 684
193001 2700 2272 831 684
194001 2791 2111 876 635
195001 2698 2111 865 634
196001 2698 2111 865 634
197001 2687 2128 859 642
198001 2631 2133 841 642
199001 2631 2140 841 647
200001 2580 2133 816 645
201001 2537 2141 812 651
202001 2538 2135 810 650
203001 2648 2025 849 611
204001 2648 2033 849 620
205001 2664 2062 848 625
206001 2664 2076 848 629
207001 2823 1907 894 572
208001 2754 1907 875 572
209001 2748 1884 867 570
210001 2748 1884 867 570
211001 2748 1884 867 570
212001 2762 1870 868 569
213001 2683 1918 858 583
214001 2683 1953 858 592
215001 2668 2037 856 605
216001 2584 2093 828 617
217001 2566 2120 828 627
218001 2574 2112 833 622
219001 2608 2078 856 599
220001 2659 2016 876 583
221001 2665 2123 871 622
222001 2816 2020 927 569
223001 2844 1990 945 541
224001 2842 1990 944 541
225001 2861 2027 951 542
226001 2847 2027 941 542
227001 2781 2122 918 568
228001 2781 2128 918 569
229001 2712 2126 905 563
230001 2742 2096 915 553
231001 2601 2103 845 554
232001 2415 2105 782 554
233001 2410 2132 775 557
234001 2407 2153 775 571
235001 2309 2153 726 571
236001 2313 2114 730 557
237001 2313 2114 730 557
238001 2352 2080 743 546
239001 2356 2076 744 545
240001 2367 2065 744 545
241001 2380 2052 748 541
242001 2377 2132 746 564
243001 2449 2060 765 545
244001 2441 2102 759 554
245001 2444 2084 750 552
246001 2607 1884 772 528
247001 2610 1860 767 526
248001 2553 1909 753 545
249001 2615 1847 768 530
250001 2613 1847 768 530
251001 2650 1816 781 518
252001 2578 1835 752 522
253001 2552 1736 737 496
254001 2605 1685 747 486
255001 2609 1707 749 492
256001 2600 1708 741 493
257001 2671 1634 763 468
258001 2671 1646 763 471
259001 2661 1640 761 470
260001 2656 1711 757 482
261001 2653 1769 756 494
262001 2588 1772 732 495
263001 2572 1776 722 500
264001 2700 1648 750 472
265001 2646 1648 743 472
266001 2646 1654 743 475
267001 2606 1654 736 475
268001 2622 1638 742 469
269001 2622 1647 742 471
270001 2622 1652 742 476
271001 2601 1708 740 484
272001 2592 1721 738 486
273001 2524 1721 722 486
274001 2570 1644 736 466
275001 2570 1657 736 469
276001 2575 1662 737 470
277001 2583 1660 736 470
278001 2589 1663 738 474
279001 2549 1709 730 483
280001 2569 1725 736 489
281001 2569 1741 736 497
282001 2520 1880 722 540
283001 2523 1896 725 543
284001 2456 1925 711 561
285001 2428 1925 699 561
286001 2387 1922 694 559
287001 2387 1922 694 559
288001 2392 1927 695 562
289001 2401 1918 700 557
290001 2423 1896 706 551
291001 2421 1896 706 551
292001 2451 1917 714 570
293001 2432 1917 710 570
294001 2445 1920 713 578
295001 2448 2018 713 649
296001 2450 2018 718 649
297001 2411 2187 712 702
298001 2407 2194 712 702
299001 2414 2187 715 699
300001 2420 2224 718 710
301001 2423 2226 722 708
302001 2423 2248 722 716
303001 2340 2315 690 724
304001 2302 2301 683 714
305001 2301 2324 683 721
306001 2267 2322 684 716
307001 2272 2317 684 716
308001 2111 2395 635 738
309001 2111 2473 634 769
310001 2111 2473 634 769
311001 2128 2560 642 794
312001 2133 2573 642 796
313001 2140 2575 647 792
314001 2133 2575 645 792
315001 2135 2597 650 791
316001 2135 2606 650 792
317001 2025 2606 611 792
318001 2010 2598 614 783
319001 2062 2546 625 772
320001 2023 2532 620 768
321001 1907 2517 572 759
322001 1907 2731 572 948
323001 1884 2983 570 1222
324001 1884 3213 570 1503
325001 1884 3510 570 1732
326001 1870 3752 569 2012
327001 1918 3947 583 2279
328001 2026 4088 603 2456
329001 2037 4146 605 2463
330001 2093 4319 617 2513
331001 2120 4500 627 2645
332001 2112 4733 622 2937
333001 2078 4863 599 3023
334001 2016 4931 583 3035
335001 2171 4805 625 3005
336001 1941 4860 542 3013
337001 1990 4796 541 3010
338001 1990 4862 541 3024
339001 2027 4858 542 3036
340001 2034 4851 542 3036
341001 2122 4767 568 3014
342001 2128 4761 569 3013
343001 2121 4846 560 3035
344001 2096 4846 553 3035
345001 2127 4938 563 3058
346001 2105 4939 554 3058
347001 2137 4919 562 3057
348001 2153 4903 571 3048
349001 2153 4923 571 3050
350001 2114 4923 557 3050
351001 2109 4988 553 3057
352001 2080 5109 546 3081
353001 2065 5109 545 3081
354001 2065 5172 545 3120
355001 2052 5167 541 3118
356001 2132 5089 564 3097
357001 2100 5049 553 3089
358001 2102 5050 554 3092
359001 2084 5067 552 3093
360001 1884 5050 528 3086
361001 1860 5066 526 3095
362001 1881 5017 539 3076
363001 1847 5042 530 3077
364001 1815 5042 522 3077
365001 1816 5059 518 3081
366001 1835 5040 522 3077
367001 1685 5037 486 3075
368001 1685 5131 486 3122
369001 1708 5263 493 3184
370001 1708 5263 493 3184
371001 1634 5321 468 3192
372001 1646 5396 471 3207
373001 1640 5396 470 3207
374001 1711 5325 482 3195
375001 1769 5267 494 3183
376001 1776 5266 500 3178
377001 1776 5280 500 3183
378001 1648 5280 472 3183
379001 1648 5487 472 3208
380001 1654 5481 475 3205
381001 1650 5605 475 3229
382001 1647 5659 471 3236
383001 1647 5692 471 3240
384001 1652 5689 476 3235
385001 1708 5639 484 3224
386001 1721 5632 486 3223
387001 1721 5633 486 3223
388001 1644 5634 466 3222
389001 1667 5616 471 3218
390001 1662 5622 470 3218
391001 1654 5607 468 3211
392001 1709 5558 483 3196
393001 1716 5540 489 3186
394001 1725 5543 489 3185
395001 1741 5527 497 3177
396001 1880 5418 540 3140
397001 1896 5399 543 3134
398001 1925 5368 561 3116
399001 1925 5368 561 3116
400001 1922 5397 559 3122
401001 1922 5397 559 3122
402001 1927 5387 562 3118
403001 1918 5428 557 3129
404001 1896 5428 551 3129
405001 1881 5428 548 3129
406001 1917 5372 570 3100
407001 1917 5372 570 3100
408001 1930 5346 582 3085
409001 2018 5255 649 3018
410001 2018 5253 649 3013
411001 2187 5083 702 2960
412001 2194 5076 702 2960
413001 2187 5101 699 2965
414001 2224 5073 710 2951
415001 2226 5081 708 2955
416001 2250 5057 716 2947
417001 2315 4988 724 2931
418001 2301 5037 714 2951
419001 2324 5149 721 2983
420001 2322 5237 716 3016
421001 2317 5373 716 3034
422001 2395 5336 738 3025
423001 2473 5257 769 2994
424001 2473 5257 769 2994
425001 2560 5159 794 2961
426001 2573 5141 796 2959
427001 2575 5198 792 2983
428001 2585 5271 791 3013
429001 2597 5337 791 3024
430001 2606 5340 792 3025
431001 2606 5340 792 3025
432001 2556 5340 774 3025
433001 2546 5340 772 3025
434001 2532 5491 768 3110
435001 2517 5493 759 3110
436001 2765 5259 999 2874
437001 3020 5004 1272 2601
438001 3263 4798 1537 2348
439001 3547 4635 1781 2137
440001 3798 4424 2056 1871
441001 3980 4250 2326 1595
442001 4077 4034 2454 1445
443001 4146 3965 2463 1436
444001 4319 3734 2513 1373
445001 4531 3495 2692 1184
446001 4782 3244 2975 901
447001 4906 3120 3033 843
448001 4938 3084 3035 839
449001 4805 3098 3005 835
450001 4860 3043 3013 827
451001 4827 3018 3017 819
452001 4901 2998 3035 816
453001 4858 3001 3036 813
454001 4822 3001 3028 813
455001 4767 2997 3014 809
456001 4761 3056 3013 818
457001 4846 2966 3035 796
458001 4846 2966 3035 796
459001 4905 2856 3052 769
460001 4959 2802 3066 755
461001 4919 2806 3057 756
462001 4903 2821 3048 762
463001 4923 2870 3050 780
464001 4961 2900 3056 793
465001 4988 2881 3057 794
466001 5109 2755 3081 768
467001 5109 2788 3081 770
468001 5172 2726 3120 731
469001 5167 2726 3118 731
470001 5089 2738 3097 730
471001 5047 2862 3088 775
472001 5050 2924 3092 789
473001 5067 2917 3093 784
474001 5050 2921 3086 784
475001 5034 2966 3077 785
476001 5017 2967 3076 786
477001 5042 2983 3077 789
478001 5036 3079 3076 803
479001 5059 3086 3081 800
480001 5039 3086 3075 800
481001 5037 3086 3075 800
482001 5131 2992 3122 753
483001 5263 2839 3184 683
484001 5263 2839 3184 683
485001 5309 2781 3189 675
486001 5396 2746 3207 660
487001 5349 2746 3199 660
488001 5320 2790 3194 675
489001 5268 2797 3183 677
490001 5266 2792 3178 676
491001 5280 2781 3183 673
492001 5302 2759 3185 671
493001 5487 2574 3208 648
494001 5496 2607 3208 659
495001 5664 2471 3237 634
496001 5659 2467 3236 633
497001 5692 2449 3240 631
498001 5692 2486 3235 639
499001 5639 2482 3224 639
500001 5632 2476 3223 638
501001 5633 2485 3223 641
502001 5638 2475 3223 639
503001 5618 2477 3218 642
504001 5628 2467 3218 642
505001 5607 2562 3211 660
506001 5558 2556 3196 660
507001 5533 2545 3184 660
508001 5527 2536 3177 659
509001 5533 2548 3179 660
510001 5418 2522 3140 656
511001 5391 2522 3128 656
512001 5368 2522 3116 656
513001 5368 2530 3116 659
514001 5397 2518 3122 663
515001 5397 2518 3122 663
516001 5388 2615 3118 677
517001 5428 2606 3129 673
518001 5428 2606 3129 673
519001 5428 2606 3129 673
520001 5372 2606 3100 673
521001 5372 2655 3100 678
522001 5325 2655 3069 678
523001 5255 2777 3018 759
524001 5253 2777 3013 759
525001 5083 2786 2960 760
526001 5076 2786 2960 760
527001 5058 2761 2950 755
528001 5073 2746 2951 754
529001 5081 2771 2955 756
530001 5057 2824 2947 789
531001 4988 2861 2931 801
532001 5050 2825 2952 790
533001 5163 2689 2996 739
534001 5285 2567 3024 711
535001 5373 2556 3034 733
536001 5336 2544 3025 723
537001 5257 2544 2994 723
538001 5257 2544 2994 723
539001 5159 2538 2961 723
540001 5141 2554 2959 726
541001 5244 2452 2998 689
542001 5271 2407 3013 669
543001 5337 2329 3024 658
544001 5340 2344 3025 670
545001 5340 2347 3025 673
546001 5340 2370 3025 680
547001 5340 2370 3025 680
548001 5493 2247 3110 600
549001 5476 2263 3102 607
550001 5207 2340 2836 652
551001 4966 2340 2557 652
552001 4818 2251 2323 626
553001 4599 2182 2094 607
554001 4439 2086 1834 590
555001 4205 2185 1563 621
556001 4034 2188 1445 622
557001 3965 2188 1436 622
558001 3697 2190 1356 622
559001 3447 2190 1140 622
560001 3219 2231 866 634
561001 3120 2255 843 635
562001 3101 2295 844 655
563001 3098 2268 835 645
564001 3043 2268 827 645
565001 2983 2272 812 646
566001 3001 2204 813 629
567001 3001 2204 813 629
568001 3001 2230 813 642
569001 2997 2282 809 648
570001 3056 2234 818 640
571001 2966 2234 796 640
572001 2915 2231 785 636
573001 2856 2262 769 646
574001 2806 2258 756 645
575001 2806 2324 756 656
576001 2863 2262 776 636
577001 2870 2267 780 636
578001 2875 2213 793 617
579001 2869 2207 791 616
580001 2755 2216 768 618
581001 2762 2183 749 616
582001 2726 2223 731 628
583001 2726 2223 731 628
584001 2796 2200 740 628
585001 2903 2116 788 584
586001 2924 2092 789 579
587001 2917 2104 784 584
588001 2962 2100 790 584
589001 2966 2083 785 580
590001 2967 2100 786 579
591001 3012 2030 790 574
592001 3056 2002 798 563
593001 3086 2001 800 566
594001 3086 2001 800 566
595001 3042 2001 782 566
596001 2960 2000 743 567
597001 2839 2001 683 567
598001 2839 2034 683 570
599001 2781 2034 675 570
600001 2746 1982 660 567
601001 2790 1957 675 560
602001 2790 2018 675 567
603001 2797 2010 677 565
604001 2792 2010 676 565
605001 2781 2045 673 571
606001 2714 2045 666 571
607001 2575 2044 652 567
608001 2615 1978 658 555
609001 2467 1973 633 553
610001 2482 1971 635 556
611001 2449 2003 631 564
612001 2486 1961 639 556
613001 2478 1956 639 556
614001 2482 1950 639 555
615001 2485 1946 641 553
616001 2475 1946 639 553
617001 2477 1975 642 576
618001 2467 2011 642 589
619001 2562 1914 660 571
620001 2556 1916 660 571
621001 2544 1966 660 575
622001 2553 1962 662 576
623001 2548 1967 660 576
624001 2522 1966 656 576
625001 2522 1995 656 579
626001 2522 2048 656 590
627001 2527 2072 658 590
628001 2518 2055 663 580
629001 2533 2065 668 577
630001 2583 1982 666 568
631001 2606 1952 673 562
632001 2606 2073 673 627
633001 2606 2075 673 627
634001 2606 2075 673 627
635001 2655 2031 678 623
636001 2655 2031 678 623
637001 2777 1927 759 551
638001 2781 2048 759 604
639001 2786 2043 760 603
640001 2786 2043 760 603
641001 2761 2043 755 603
642001 2731 2043 748 603
643001 2771 2003 756 595
644001 2824 2002 789 570
645001 2854 1965 796 558
646001 2808 1937 784 548
647001 2689 1937 739 548
648001 2532 1937 707 548
649001 2555 1901 733 520
650001 2544 1872 723 517
651001 2544 1876 723 517
652001 2544 1886 723 518
653001 2538 1891 723 519
654001 2522 1865 712 513
655001 2409 1866 671 515
656001 2366 1890 661 524
657001 2349 1863 671 510
658001 2344 1868 670 513
659001 2362 1850 677 506
660001 2370 1842 680 503
661001 2370 1923 680 519
662001 2247 1943 600 531
663001 2292 1918 613 524
664001 2340 1879 652 482
665001 2340 1880 652 483
666001 2248 1880 626 483
667001 2153 1880 599 483
668001 2086 1914 590 491
669001 2188 1839 622 468
670001 2188 1917 622 484
671001 2188 1917 622 484
672001 2190 1926 622 487
673001 2190 1955 622 491
674001 2231 1919 634 480
675001 2301 1849 660 454
676001 2245 1938 646 512
677001 2268 1906 645 510
678001 2278 1900 646 509
679001 2276 1922 650 510
680001 2204 1947 629 518
681001 2204 1948 629 518
682001 2230 1922 642 505
683001 2274 1873 648 499
684001 2234 1862 640 498
685001 2244 1854 642 500
686001 2231 1907 636 516
687001 2262 1931 646 522
688001 2258 1949 645 526
689001 2324 1921 656 536
690001 2262 1941 636 537
691001 2283 1951 637 544
692001 2213 1951 617 544
693001 2207 1951 616 544
694001 2216 1942 618 542
695001 2183 1942 616 546
696001 2223 1958 628 549
697001 2223 1958 628 549
698001 2142 1909 604 538
699001 2092 1904 579 545
700001 2103 2019 581 598
701001 2127 2023 588 604
702001 2080 2094 580 616
703001 2098 2081 580 620
704001 2100 2136 579 632
705001 1973 2172 564 639
706001 2002 2155 563 637
707001 2001 2136 566 634
708001 2001 2136 566 634
709001 2001 2188 566 642
710001 2000 2207 567 646
711001 2001 2201 567 646
712001 2034 2168 570 643
713001 2034 2168 570 643
714001 1982 2170 567 644
715001 2015 2093 566 630
716001 2018 2119 567 634
717001 2010 2119 565 634
718001 2010 2125 565 634
719001 2045 2087 571 626
720001 2045 2087 571 626
721001 1997 2087 557 626
722001 1973 2079 553 626
723001 1973 2085 553 626
724001 1971 2072 556 621
725001 2003 2040 564 613
726001 1956 2095 556 623
727001 1956 2095 556 623
728001 1946 2095 553 623
729001 1946 2106 553 628
730001 1946 2109 553 628
731001 1975 2075 576 602
732001 2011 2039 589 589
733001 1914 2039 571 589
734001 1938 2017 575 585
735001 1965 2066 575 597
736001 1961 2052 576 593
737001 1967 2046 576 593
738001 1966 2050 576 592
739001 2006 2010 583 585
740001 2048 1968 590 578
741001 2055 1936 580 575
742001 2055 1945 580 575
743001 1996 1920 569 573
744001 1982 1920 568 573
745001 1996 1875 587 547
746001 2073 1809 627 509
747001 2075 1862 627 515
748001 2080 1858 628 514
749001 2031 1867 623 515
750001 2020 1867 621 515
751001 1986 1790 575 482
752001 2048 1726 604 453
753001 2043 1738 603 454
754001 2043 1749 603 459
755001 2043 1773 603 465
756001 2043 1773 603 465
757001 1989 1803 589 472
758001 2002 1751 570 464
759001 1965 1752 558 464
760001 1937 1749 548 464
761001 1937 1749 548 464
762001 1937 1782 548 467
763001 1877 1741 517 463
764001 1872 1741 517 463
765001 1876 1737 517 463
766001 1886 1733 518 466
767001 1891 1733 519 466
768001 1865 1733 513 466
769001 1866 1732 515 464
770001 1890 1708 524 455
771001 1863 1712 510 458
772001 1868 1707 513 455
773001 1850 1713 506 456
774001 1842 1713 503 456
775001 1923 1678 519 445
776001 1943 1628 531 428
777001 1868 1601 481 422
778001 1879 1584 482 421
779001 1880 1583 483 420
780001 1880 1583 483 420
781001 1880 1583 483 420
782001 1914 1549 491 412
783001 1890 1548 477 418
784001 1917 1604 484 437
785001 1917 1604 484 437
786001 1926 1650 487 441
787001 1960 1637 492 439
788001 1919 1646 480 440
789001 1851 1631 455 437
790001 1939 1765 512 425
791001 1906 1797 510 434
792001 1900 2045 509 504
793001 1922 2259 510 559
794001 1948 2634 518 652
795001 1948 2814 518 682
796001 1922 2912 505 706
797001 1873 3250 499 793
798001 1862 3288 498 804
799001 1854 3286 500 800
800001 1907 3233 516 784
801001 1931 3292 522 795
802001 1975 3248 544 773
803001 1921 3263 536 774
804001 1934 3243 532 773
805001 1951 3203 544 762
806001 1951 3243 544 771
807001 1951 3246 544 771
808001 1942 3246 546 768
809001 1942 3246 546 768
810001 1958 3189 549 753
811001 1958 3189 549 753
812001 1909 3189 538 753
813001 1904 3226 545 753
814001 2002 3101 594 698
815001 2031 3039 604 684
816001 2094 2972 616 670
817001 2078 3028 620 686
818001 2152 3078 635 724
819001 2174 3064 639 722
820001 2155 3103 637 735
821001 2136 3098 634 733
822001 2136 3098 634 733
823001 2188 3107 642 736
824001 2207 3093 646 730
825001 2201 3093 646 730
826001 2168 3093 643 730
827001 2168 3125 643 741
828001 2170 3129 644 740
829001 2090 3169 629 757
830001 2119 3158 634 753
831001 2125 3152 634 753
832001 2125 3152 634 753
833001 2087 3159 626 757
834001 2087 3159 626 757
835001 2079 3159 626 757
836001 2079 3163 626 759
837001 2072 3245 621 781
838001 2062 3245 618 781
839001 2040 3247 613 784
840001 2095 3201 623 778
841001 2095 3201 623 778
842001 2095 3201 623 778
843001 2109 3244 628 780
844001 2109 3409 628 855
845001 2057 3462 596 865
846001 2039 3462 589 865
847001 2039 3548 589 887
848001 1989 3546 585 887
849001 2066 3469 597 875
850001 2052 3474 593 879
851001 2050 3500 593 891
852001 2050 3500 592 891
853001 1968 3500 578 891
854001 1968 3536 578 902
855001 1945 3579 575 918
856001 1945 3599 575 932
857001 1920 3599 573 932
858001 1920 3608 573 935
859001 1853 3597 519 933
860001 1809 3638 509 944
861001 1862 3602 515 943
862001 1858 3601 514 943
863001 1867 3608 515 944
864001 1863 3608 514 944
865001 1736 3611 456 945
866001 1726 3609 453 945
867001 1738 3597 454 944
868001 1749 3613 459 944
869001 1773 3589 465 938
870001 1773 3607 465 942
871001 1803 3577 472 935
872001 1751 3613 464 940
873001 1752 3612 464 940
874001 1749 3612 464 940
875001 1749 3616 464 942
876001 1779 3583 467 939
877001 1741 3653 463 943
878001 1741 3747 463 955
879001 1737 3747 463 955
880001 1733 3752 466 957
881001 1733 3803 466 974
882001 1732 3803 464 974
883001 1732 3861 464 1001
884001 1708 3904 455 1005
885001 1708 3905 455 1005
886001 1707 3905 455 1005
887001 1713 3899 456 1004
888001 1713 3900 456 1004
889001 1678 3860 445 1006
890001 1628 3885 428 1026
891001 1601 3932 422 1040
892001 1584 3984 421 1055
893001 1583 3984 420 1055
894001 1583 3984 420 1055
895001 1583 3984 420 1055
896001 1525 4063 403 1065
897001 1597 3937 435 1024
898001 1604 3918 437 1017
899001 1593 4004 434 1046
900001 1650 3965 441 1039
901001 1637 3944 439 1036
902001 1646 3935 440 1035
903001 1579 3952 396 1035
904001 1797 3733 434 995
905001 1828 3702 448 981
906001 2045 3547 504 939
907001 2320 3248 582 857
908001 2663 2881 664 767
909001 2814 2744 682 759
910001 2954 2670 718 746
+927
View File
@@ -0,0 +1,927 @@
# input : borbu1.fst
# include : <none>
# selector : cumul
# mixer : basic
# distance : chi
# phase : 7
# alphabet : GC
# excluded : X
# seqname : borbu1
# seqlength : 910724
# unmasked : 910724
# valid : 260406
# window : 227680
# step : 1000
#
# pos G-C/G+C
1 -0.0131973
1001 -0.0271626
2001 -0.041181
3001 -0.0566452
4001 -0.0739519
5001 -0.0937391
6001 -0.115266
7001 -0.138618
8001 -0.163833
9001 -0.190044
10001 -0.218113
11001 -0.248402
12001 -0.280177
13001 -0.31381
14001 -0.349193
15001 -0.385367
16001 -0.423263
17001 -0.462602
18001 -0.503178
19001 -0.544475
20001 -0.58725
21001 -0.631494
22001 -0.677426
23001 -0.727306
24001 -0.779324
25001 -0.833779
26001 -0.890698
27001 -0.950176
28001 -1.01161
29001 -1.07601
30001 -1.14239
31001 -1.21137
32001 -1.28293
33001 -1.35671
34001 -1.43248
35001 -1.50889
36001 -1.58832
37001 -1.66917
38001 -1.75101
39001 -1.83431
40001 -1.92052
41001 -2.00927
42001 -2.10023
43001 -2.19319
44001 -2.2871
45001 -2.3821
46001 -2.47837
47001 -2.57673
48001 -2.6782
49001 -2.78169
50001 -2.88799
51001 -2.99698
52001 -3.10867
53001 -3.22322
54001 -3.34097
55001 -3.46201
56001 -3.58429
57001 -3.70745
58001 -3.83238
59001 -3.95946
60001 -4.08804
61001 -4.21914
62001 -4.35289
63001 -4.48783
64001 -4.62468
65001 -4.76293
66001 -4.90319
67001 -5.04565
68001 -5.1909
69001 -5.33903
70001 -5.48814
71001 -5.63755
72001 -5.78723
73001 -5.93694
74001 -6.08738
75001 -6.23924
76001 -6.3923
77001 -6.54679
78001 -6.70215
79001 -6.85952
80001 -7.01926
81001 -7.17986
82001 -7.34095
83001 -7.50369
84001 -7.6678
85001 -7.83239
86001 -7.99843
87001 -8.16523
88001 -8.333
89001 -8.50148
90001 -8.6698
91001 -8.83788
92001 -9.00605
93001 -9.1757
94001 -9.34679
95001 -9.5196
96001 -9.69379
97001 -9.86967
98001 -10.0466
99001 -10.2239
100001 -10.4031
101001 -10.5831
102001 -10.7637
103001 -10.9459
104001 -11.1298
105001 -11.3165
106001 -11.5065
107001 -11.6968
108001 -11.8864
109001 -12.0763
110001 -12.2671
111001 -12.4592
112001 -12.6531
113001 -12.8494
114001 -13.0472
115001 -13.2445
116001 -13.4407
117001 -13.6363
118001 -13.8329
119001 -14.0304
120001 -14.2266
121001 -14.4216
122001 -14.6161
123001 -14.8112
124001 -15.0079
125001 -15.206
126001 -15.4054
127001 -15.6053
128001 -15.8063
129001 -16.0076
130001 -16.2085
131001 -16.4102
132001 -16.6122
133001 -16.8115
134001 -17.0086
135001 -17.2051
136001 -17.4002
137001 -17.5948
138001 -17.7902
139001 -17.9845
140001 -18.1783
141001 -18.3724
142001 -18.5659
143001 -18.7574
144001 -18.9472
145001 -19.1365
146001 -19.3255
147001 -19.5139
148001 -19.7022
149001 -19.891
150001 -20.0792
151001 -20.2667
152001 -20.4535
153001 -20.6395
154001 -20.825
155001 -21.0113
156001 -21.1969
157001 -21.3821
158001 -21.567
159001 -21.752
160001 -21.9377
161001 -22.1226
162001 -22.308
163001 -22.4928
164001 -22.6773
165001 -22.8616
166001 -23.046
167001 -23.232
168001 -23.4181
169001 -23.6042
170001 -23.7906
171001 -23.9768
172001 -24.1632
173001 -24.3502
174001 -24.5364
175001 -24.7213
176001 -24.906
177001 -25.0904
178001 -25.2765
179001 -25.464
180001 -25.6532
181001 -25.8421
182001 -26.0319
183001 -26.2223
184001 -26.4128
185001 -26.6059
186001 -26.8004
187001 -26.9965
188001 -27.1937
189001 -27.3916
190001 -27.5905
191001 -27.7911
192001 -27.9923
193001 -28.1937
194001 -28.3955
195001 -28.599
196001 -28.8042
197001 -29.0103
198001 -29.2155
199001 -29.4211
200001 -29.6267
201001 -29.8331
202001 -30.0397
203001 -30.2467
204001 -30.4536
205001 -30.6604
206001 -30.8673
207001 -31.0736
208001 -31.2787
209001 -31.4832
210001 -31.6881
211001 -31.8934
212001 -32.0989
213001 -32.305
214001 -32.5127
215001 -32.7187
216001 -32.9236
217001 -33.1282
218001 -33.3326
219001 -33.5371
220001 -33.7417
221001 -33.9464
222001 -34.1497
223001 -34.3522
224001 -34.5539
225001 -34.7542
226001 -34.9533
227001 -35.1509
228001 -35.3467
229001 -35.5412
230001 -35.7354
231001 -35.929
232001 -36.1208
233001 -36.3113
234001 -36.5011
235001 -36.6905
236001 -36.8796
237001 -37.0674
238001 -37.2548
239001 -37.4417
240001 -37.6276
241001 -37.8135
242001 -37.9987
243001 -38.1825
244001 -38.3648
245001 -38.5452
246001 -38.7268
247001 -38.908
248001 -39.0887
249001 -39.2698
250001 -39.4513
251001 -39.6324
252001 -39.814
253001 -39.9954
254001 -40.1771
255001 -40.3595
256001 -40.541
257001 -40.7212
258001 -40.9014
259001 -41.0809
260001 -41.2594
261001 -41.4366
262001 -41.6123
263001 -41.7882
264001 -41.9649
265001 -42.1423
266001 -42.3211
267001 -42.5009
268001 -42.6809
269001 -42.8606
270001 -43.0403
271001 -43.2196
272001 -43.3988
273001 -43.5785
274001 -43.7576
275001 -43.9376
276001 -44.1173
277001 -44.297
278001 -44.4763
279001 -44.6556
280001 -44.8352
281001 -45.0156
282001 -45.1964
283001 -45.3775
284001 -45.5592
285001 -45.7421
286001 -45.9266
287001 -46.1109
288001 -46.2954
289001 -46.4794
290001 -46.663
291001 -46.8469
292001 -47.0311
293001 -47.2155
294001 -47.4006
295001 -47.5865
296001 -47.7717
297001 -47.9575
298001 -48.1446
299001 -48.3328
300001 -48.522
301001 -48.7127
302001 -48.9036
303001 -49.0943
304001 -49.283
305001 -49.4712
306001 -49.6592
307001 -49.8476
308001 -50.0362
309001 -50.2254
310001 -50.4158
311001 -50.6067
312001 -50.7976
313001 -50.9873
314001 -51.1763
315001 -51.3637
316001 -51.5501
317001 -51.7368
318001 -51.9249
319001 -52.1147
320001 -52.306
321001 -52.4986
322001 -52.6919
323001 -52.886
324001 -53.0813
325001 -53.2775
326001 -53.4749
327001 -53.6733
328001 -53.8713
329001 -54.0699
330001 -54.269
331001 -54.4685
332001 -54.6687
333001 -54.8697
334001 -55.0713
335001 -55.2738
336001 -55.476
337001 -55.678
338001 -55.881
339001 -56.0843
340001 -56.288
341001 -56.4917
342001 -56.6958
343001 -56.9003
344001 -57.1051
345001 -57.3084
346001 -57.5099
347001 -57.7098
348001 -57.9084
349001 -58.1052
350001 -58.299
351001 -58.4904
352001 -58.6792
353001 -58.8664
354001 -59.053
355001 -59.2381
356001 -59.4219
357001 -59.6053
358001 -59.7882
359001 -59.969
360001 -60.149
361001 -60.3294
362001 -60.5101
363001 -60.69
364001 -60.8703
365001 -61.0481
366001 -61.2242
367001 -61.3992
368001 -61.5729
369001 -61.7456
370001 -61.9171
371001 -62.088
372001 -62.2579
373001 -62.4265
374001 -62.5929
375001 -62.7581
376001 -62.9203
377001 -63.0797
378001 -63.2368
379001 -63.3921
380001 -63.546
381001 -63.6994
382001 -63.8505
383001 -63.9987
384001 -64.1437
385001 -64.2859
386001 -64.4253
387001 -64.5617
388001 -64.6946
389001 -64.8254
390001 -64.9533
391001 -65.0786
392001 -65.2018
393001 -65.3229
394001 -65.4402
395001 -65.5538
396001 -65.6641
397001 -65.7711
398001 -65.8758
399001 -65.9787
400001 -66.0791
401001 -66.1771
402001 -66.2736
403001 -66.3683
404001 -66.4597
405001 -66.549
406001 -66.6357
407001 -66.7195
408001 -66.8002
409001 -66.8783
410001 -66.953
411001 -67.0255
412001 -67.0954
413001 -67.1621
414001 -67.2257
415001 -67.2881
416001 -67.3501
417001 -67.4111
418001 -67.4717
419001 -67.5291
420001 -67.5837
421001 -67.6362
422001 -67.6862
423001 -67.7338
424001 -67.7789
425001 -67.8226
426001 -67.8657
427001 -67.9079
428001 -67.9477
429001 -67.9854
430001 -68.02
431001 -68.0523
432001 -68.0821
433001 -68.1101
434001 -68.1365
435001 -68.1627
436001 -68.1883
437001 -68.2134
438001 -68.2379
439001 -68.2597
440001 -68.2793
441001 -68.2968
442001 -68.3124
443001 -68.327
444001 -68.3395
445001 -68.3514
446001 -68.362
447001 -68.3712
448001 -68.3796
449001 -68.3862
450001 -68.3918
451001 -68.3972
452001 -68.4024
453001 -68.4067
454001 -68.4092
455001 -68.411
456001 -68.4116
457001 -68.411
458001 -68.4085
459001 -68.4056
460001 -68.404
461001 -68.4002
462001 -68.3953
463001 -68.3898
464001 -68.3823
465001 -68.372
466001 -68.3588
467001 -68.3431
468001 -68.3258
469001 -68.3065
470001 -68.2854
471001 -68.2642
472001 -68.2421
473001 -68.2192
474001 -68.1939
475001 -68.1667
476001 -68.1377
477001 -68.1071
478001 -68.0743
479001 -68.0398
480001 -68.0025
481001 -67.9631
482001 -67.9214
483001 -67.8773
484001 -67.8326
485001 -67.7864
486001 -67.7395
487001 -67.6911
488001 -67.6414
489001 -67.5915
490001 -67.541
491001 -67.4886
492001 -67.4346
493001 -67.3794
494001 -67.3213
495001 -67.2609
496001 -67.1982
497001 -67.1333
498001 -67.0668
499001 -66.999
500001 -66.9292
501001 -66.8596
502001 -66.7899
503001 -66.7187
504001 -66.6458
505001 -66.5714
506001 -66.4951
507001 -66.4167
508001 -66.3369
509001 -66.2538
510001 -66.1678
511001 -66.079
512001 -65.9875
513001 -65.8935
514001 -65.7973
515001 -65.7001
516001 -65.6008
517001 -65.4996
518001 -65.3966
519001 -65.2908
520001 -65.1821
521001 -65.0706
522001 -64.9556
523001 -64.8386
524001 -64.7188
525001 -64.5967
526001 -64.472
527001 -64.3452
528001 -64.2164
529001 -64.0858
530001 -63.9536
531001 -63.8205
532001 -63.688
533001 -63.5531
534001 -63.4159
535001 -63.2768
536001 -63.1368
537001 -62.9963
538001 -62.8556
539001 -62.7152
540001 -62.5743
541001 -62.4325
542001 -62.29
543001 -62.1466
544001 -62.0028
545001 -61.8577
546001 -61.7104
547001 -61.5621
548001 -61.4128
549001 -61.2618
550001 -61.1086
551001 -60.953
552001 -60.7953
553001 -60.6355
554001 -60.4731
555001 -60.308
556001 -60.1407
557001 -59.9727
558001 -59.8033
559001 -59.6325
560001 -59.4588
561001 -59.2818
562001 -59.1035
563001 -58.9231
564001 -58.7417
565001 -58.56
566001 -58.3767
567001 -58.1915
568001 -58.0055
569001 -57.8176
570001 -57.6268
571001 -57.434
572001 -57.2406
573001 -57.0474
574001 -56.855
575001 -56.6635
576001 -56.4719
577001 -56.2801
578001 -56.0885
579001 -55.8967
580001 -55.7046
581001 -55.5119
582001 -55.3194
583001 -55.1257
584001 -54.9314
585001 -54.737
586001 -54.543
587001 -54.3504
588001 -54.1571
589001 -53.964
590001 -53.7711
591001 -53.5771
592001 -53.3816
593001 -53.1866
594001 -52.9911
595001 -52.7949
596001 -52.5982
597001 -52.4004
598001 -52.2032
599001 -52.0071
600001 -51.8116
601001 -51.6175
602001 -51.4235
603001 -51.229
604001 -51.0352
605001 -50.8422
606001 -50.65
607001 -50.4574
608001 -50.2647
609001 -50.0721
610001 -49.8805
611001 -49.6902
612001 -49.5004
613001 -49.3105
614001 -49.1203
615001 -48.9308
616001 -48.7421
617001 -48.5546
618001 -48.368
619001 -48.1823
620001 -47.9958
621001 -47.8088
622001 -47.6221
623001 -47.4352
624001 -47.2482
625001 -47.0608
626001 -46.8729
627001 -46.6839
628001 -46.4956
629001 -46.3077
630001 -46.1194
631001 -45.9315
632001 -45.7443
633001 -45.558
634001 -45.3718
635001 -45.1852
636001 -44.9986
637001 -44.8126
638001 -44.6264
639001 -44.4396
640001 -44.2533
641001 -44.0677
642001 -43.8816
643001 -43.6936
644001 -43.5036
645001 -43.3118
646001 -43.1189
647001 -42.9268
648001 -42.735
649001 -42.5434
650001 -42.3519
651001 -42.1602
652001 -41.9675
653001 -41.774
654001 -41.5807
655001 -41.3875
656001 -41.195
657001 -41.004
658001 -40.8151
659001 -40.6278
660001 -40.4422
661001 -40.2565
662001 -40.0701
663001 -39.8828
664001 -39.6948
665001 -39.5047
666001 -39.3133
667001 -39.1221
668001 -38.931
669001 -38.7408
670001 -38.5511
671001 -38.3623
672001 -38.1719
673001 -37.98
674001 -37.7867
675001 -37.5922
676001 -37.3969
677001 -37.2025
678001 -37.0089
679001 -36.8141
680001 -36.6191
681001 -36.4254
682001 -36.2329
683001 -36.041
684001 -35.8505
685001 -35.662
686001 -35.4745
687001 -35.2863
688001 -35.0967
689001 -34.9082
690001 -34.7188
691001 -34.5287
692001 -34.3408
693001 -34.1552
694001 -33.97
695001 -33.7865
696001 -33.6033
697001 -33.4214
698001 -33.2414
699001 -33.0611
700001 -32.8819
701001 -32.7035
702001 -32.5259
703001 -32.3498
704001 -32.1742
705001 -31.9984
706001 -31.8216
707001 -31.6447
708001 -31.468
709001 -31.2904
710001 -31.1126
711001 -30.9347
712001 -30.7562
713001 -30.5773
714001 -30.3981
715001 -30.2191
716001 -30.0388
717001 -29.8587
718001 -29.679
719001 -29.4977
720001 -29.3161
721001 -29.1335
722001 -28.9514
723001 -28.7685
724001 -28.5852
725001 -28.402
726001 -28.2188
727001 -28.0358
728001 -27.8535
729001 -27.6692
730001 -27.4836
731001 -27.2961
732001 -27.1084
733001 -26.9204
734001 -26.7315
735001 -26.5418
736001 -26.3505
737001 -26.1593
738001 -25.9675
739001 -25.7761
740001 -25.5847
741001 -25.3932
742001 -25.2007
743001 -25.0077
744001 -24.8141
745001 -24.6193
746001 -24.4258
747001 -24.2323
748001 -24.0396
749001 -23.8475
750001 -23.6552
751001 -23.4627
752001 -23.2705
753001 -23.0783
754001 -22.8865
755001 -22.6955
756001 -22.5053
757001 -22.3151
758001 -22.1253
759001 -21.936
760001 -21.7469
761001 -21.5594
762001 -21.3713
763001 -21.183
764001 -20.9932
765001 -20.802
766001 -20.609
767001 -20.4147
768001 -20.2211
769001 -20.0281
770001 -19.8365
771001 -19.6462
772001 -19.4557
773001 -19.2661
774001 -19.0763
775001 -18.886
776001 -18.6947
777001 -18.5025
778001 -18.3099
779001 -18.1163
780001 -17.9216
781001 -17.7263
782001 -17.5309
783001 -17.3357
784001 -17.1411
785001 -16.9458
786001 -16.7502
787001 -16.5527
788001 -16.3549
789001 -16.1568
790001 -15.9583
791001 -15.7621
792001 -15.5665
793001 -15.3698
794001 -15.1727
795001 -14.9744
796001 -14.7746
797001 -14.5747
798001 -14.3769
799001 -14.1819
800001 -13.9884
801001 -13.7954
802001 -13.6022
803001 -13.4115
804001 -13.2235
805001 -13.0389
806001 -12.8561
807001 -12.6747
808001 -12.4939
809001 -12.3136
810001 -12.1335
811001 -11.9546
812001 -11.7769
813001 -11.6
814001 -11.4233
815001 -11.2477
816001 -11.0751
817001 -10.9039
818001 -10.7346
819001 -10.5681
820001 -10.4045
821001 -10.2426
822001 -10.0839
823001 -9.92776
824001 -9.7727
825001 -9.62004
826001 -9.46954
827001 -9.32056
828001 -9.17234
829001 -9.025
830001 -8.87994
831001 -8.73758
832001 -8.59697
833001 -8.45889
834001 -8.3232
835001 -8.19003
836001 -8.05847
837001 -7.92891
838001 -7.7995
839001 -7.67252
840001 -7.5485
841001 -7.42736
842001 -7.30856
843001 -7.19243
844001 -7.07855
845001 -6.96517
846001 -6.85438
847001 -6.74539
848001 -6.63987
849001 -6.53748
850001 -6.43794
851001 -6.34213
852001 -6.24945
853001 -6.16003
854001 -6.07333
855001 -5.98908
856001 -5.90644
857001 -5.82624
858001 -5.74908
859001 -5.6741
860001 -5.60186
861001 -5.53028
862001 -5.45992
863001 -5.39177
864001 -5.32623
865001 -5.26266
866001 -5.20101
867001 -5.14201
868001 -5.08347
869001 -5.02581
870001 -4.9691
871001 -4.91389
872001 -4.85983
873001 -4.80686
874001 -4.75492
875001 -4.70474
876001 -4.65606
877001 -4.60877
878001 -4.56261
879001 -4.51743
880001 -4.47457
881001 -4.4337
882001 -4.39383
883001 -4.35545
884001 -4.3178
885001 -4.28119
886001 -4.24533
887001 -4.21051
888001 -4.17654
889001 -4.14544
890001 -4.11702
891001 -4.09076
892001 -4.06695
893001 -4.04528
894001 -4.026
895001 -4.00913
896001 -3.99324
897001 -3.9769
898001 -3.96318
899001 -3.95229
900001 -3.94465
901001 -3.93979
902001 -3.93766
903001 -3.93744
904001 -3.93928
905001 -3.9432
906001 -3.94814
907001 -3.95509
908001 -3.96367
909001 -3.97366
910001 -3.98531
+927
View File
@@ -0,0 +1,927 @@
# input : borbu1.fst
# include : borbu1.lst
# selector : codon
# mixer : basic
# distance : chi
# phase : 7
# alphabet : ACGT
# excluded : X
# seqname : borbu1
# seqlength : 910724
# unmasked : 284128
# valid : 284088
# window : 227680
# step : 1000
#
# pos LeftTotalCodon RightTotalCodon LeftA0
1 35051 36273 10243 11968
1001 34984 36282 10218 11960
2001 34991 36278 10180 12054
3001 35055 36271 10195 12127
4001 35031 36073 10190 12174
5001 35042 36071 10173 12237
6001 35053 36080 10185 12283
7001 35074 36008 10142 12359
8001 35115 36004 10132 12429
9001 35083 36022 10104 12459
10001 35081 36024 10077 12516
11001 35080 36031 10058 12565
12001 35082 36035 10072 12613
13001 35136 36026 10088 12692
14001 35128 36021 10098 12745
15001 35127 36020 10092 12786
16001 35105 36059 10049 12838
17001 35253 36048 10064 12937
18001 35319 35986 10062 13024
19001 35382 35974 10075 13126
20001 35379 35980 10067 13179
21001 35290 36086 10033 13190
22001 35340 36074 10045 13245
23001 35319 36111 10050 13291
24001 35330 36089 10079 13335
25001 35328 35956 10055 13384
26001 35313 35995 10034 13422
27001 35333 35997 10072 13476
28001 35340 35989 10050 13546
29001 35338 35983 10002 13609
30001 35316 36003 10001 13654
31001 35317 35994 10022 13698
32001 35290 36017 9951 13762
33001 35302 36037 9942 13814
34001 35301 35987 9906 13872
35001 35278 35970 9904 13896
36001 35272 35976 9852 13970
37001 35272 35969 9786 14061
38001 35274 35943 9746 14152
39001 35270 35939 9740 14232
40001 35214 35985 9712 14280
41001 35217 35983 9707 14329
42001 35212 35986 9677 14410
43001 35259 35974 9676 14497
44001 35259 35965 9673 14550
45001 35260 35914 9705 14616
46001 35247 35936 9677 14668
47001 35129 36043 9661 14646
48001 35067 36107 9640 14656
49001 35068 36107 9654 14693
50001 35041 36120 9669 14731
51001 35009 36147 9657 14767
52001 35080 36127 9687 14824
53001 35073 36133 9681 14874
54001 35049 36131 9666 14940
55001 35052 36117 9616 15028
56001 35044 36071 9578 15112
57001 35015 36094 9538 15167
58001 34991 36073 9514 15227
59001 34982 36082 9478 15297
60001 34952 36121 9450 15363
61001 34947 36130 9439 15437
62001 34949 36147 9418 15523
63001 34956 36161 9409 15580
64001 34968 36197 9394 15640
65001 34968 36196 9372 15702
66001 34965 36195 9355 15730
67001 34961 36195 9363 15747
68001 34958 36203 9352 15822
69001 34962 36190 9342 15870
70001 34969 36171 9335 15910
71001 34969 36186 9333 15933
72001 35000 36179 9335 16004
73001 34985 36191 9305 16073
74001 35016 36191 9297 16141
75001 35015 36122 9288 16200
76001 35007 36116 9282 16249
77001 35008 36079 9262 16314
78001 35004 36063 9242 16374
79001 35029 36064 9225 16447
80001 34983 35992 9213 16482
81001 34912 36062 9177 16488
82001 34914 36074 9169 16529
83001 34911 36084 9163 16590
84001 34889 36115 9132 16648
85001 34874 36128 9103 16724
86001 34820 36181 9083 16754
87001 34797 36199 9058 16833
88001 34796 36199 9026 16895
89001 34795 36113 9008 16973
90001 34805 36108 8995 17034
91001 34805 36092 8972 17099
92001 34836 36098 8983 17157
93001 34808 35965 8970 17193
94001 34806 35969 8993 17228
95001 34744 36014 8967 17249
96001 34743 36019 8975 17299
97001 34732 36015 8971 17359
98001 34733 36004 8928 17439
99001 34682 36058 8889 17475
100001 34787 36059 8898 17565
101001 34839 36065 8918 17632
102001 34777 36125 8888 17671
103001 34828 36133 8894 17718
104001 34847 36129 8881 17778
105001 34856 36091 8873 17869
106001 34865 36036 8884 17956
107001 35048 36033 8950 18077
108001 35063 35965 8899 18127
109001 35256 35893 8968 18225
110001 35498 35895 9041 18342
111001 35832 35880 9127 18513
112001 35945 35891 9171 18584
113001 35993 35942 9193 18611
114001 36308 35949 9238 18803
115001 36281 35999 9203 18815
116001 36278 35987 9208 18807
117001 36221 36048 9197 18773
118001 36072 36232 9148 18698
119001 36060 36239 9169 18678
120001 36080 36240 9191 18691
121001 36007 36312 9199 18629
122001 35991 36304 9201 18634
123001 36023 36303 9241 18636
124001 36024 36277 9248 18640
125001 36030 36264 9247 18633
126001 36032 36254 9239 18647
127001 36025 36248 9231 18640
128001 36021 36252 9249 18613
129001 36020 36204 9270 18614
130001 36059 36203 9278 18649
131001 36048 36220 9286 18648
132001 35986 36142 9279 18590
133001 35973 36145 9284 18573
134001 35991 36187 9295 18579
135001 36074 36146 9307 18616
136001 36085 36149 9311 18656
137001 36111 36125 9292 18681
138001 36076 36162 9252 18693
139001 35953 36221 9226 18645
140001 35995 36182 9220 18682
141001 35998 36181 9180 18713
142001 35982 36185 9196 18681
143001 35980 36120 9212 18659
144001 36003 36121 9237 18675
145001 35997 36130 9227 18682
146001 36039 36130 9251 18680
147001 36038 36130 9215 18713
148001 35986 36185 9216 18673
149001 35970 36201 9211 18663
150001 35977 36158 9225 18672
151001 35943 36142 9243 18633
152001 35948 36141 9252 18592
153001 35939 36157 9263 18537
154001 35986 36153 9277 18560
155001 35983 36153 9265 18568
156001 35986 36155 9258 18582
157001 35974 36169 9260 18547
158001 35964 36179 9238 18533
159001 35915 36251 9194 18518
160001 35939 36195 9202 18519
161001 36082 36206 9249 18591
162001 36107 36201 9239 18643
163001 36102 36186 9223 18670
164001 36153 36186 9248 18694
165001 36127 36222 9247 18697
166001 36127 36209 9228 18719
167001 36134 36209 9239 18751
168001 36117 36246 9248 18737
169001 36118 36242 9268 18703
170001 36070 36288 9258 18684
171001 36094 36292 9274 18670
172001 36082 36345 9266 18663
173001 36103 36343 9261 18698
174001 36120 36325 9275 18695
175001 36131 36312 9261 18710
176001 36147 36294 9267 18722
177001 36197 36267 9259 18772
178001 36196 36243 9264 18779
179001 36184 36255 9253 18772
180001 36195 36248 9266 18804
181001 36195 36246 9230 18828
182001 36202 36237 9225 18823
183001 36176 36263 9203 18843
184001 36182 36274 9196 18854
185001 36186 36267 9203 18864
186001 36179 36264 9192 18862
187001 36190 36259 9203 18842
188001 36192 36256 9181 18855
189001 36144 36323 9156 18850
190001 36088 36343 9167 18792
191001 36079 36350 9160 18790
192001 36063 36376 9144 18790
193001 36061 36374 9126 18830
194001 35992 36485 9100 18807
195001 36060 36484 9095 18862
196001 36074 36470 9107 18872
197001 36084 36459 9112 18874
198001 36128 36453 9124 18886
199001 36128 36449 9153 18849
200001 36176 36454 9170 18859
201001 36199 36449 9166 18870
202001 36199 36457 9167 18893
203001 36111 36547 9138 18841
204001 36108 36538 9088 18856
205001 36098 36516 9099 18832
206001 36099 36518 9076 18836
207001 35966 36664 9047 18757
208001 36010 36664 9065 18773
209001 36015 36679 9073 18799
210001 36020 36675 9078 18779
211001 36015 36677 9091 18758
212001 36005 36685 9093 18735
213001 36059 36648 9125 18750
214001 36059 36621 9104 18735
215001 36065 36558 9105 18715
216001 36125 36520 9113 18762
217001 36138 36503 9144 18772
218001 36129 36510 9148 18785
219001 36092 36547 9138 18754
220001 36036 36587 9119 18715
221001 36033 36508 9099 18701
222001 35912 36604 9070 18637
223001 35893 36627 9020 18649
224001 35893 36628 9000 18664
225001 35881 36594 8965 18676
226001 35891 36595 8954 18683
227001 35941 36527 8950 18720
228001 35949 36515 9013 18688
229001 36010 36508 9029 18734
230001 35988 36529 9038 18689
231001 36101 36525 9060 18745
232001 36231 36530 9106 18806
233001 36239 36512 9106 18818
234001 36240 36489 9110 18805
235001 36317 36492 9147 18829
236001 36304 36528 9143 18818
237001 36303 36528 9107 18851
238001 36271 36566 9095 18838
239001 36263 36569 9097 18848
240001 36253 36574 9096 18843
241001 36248 36581 9081 18836
242001 36252 36521 9039 18885
243001 36203 36569 9024 18856
244001 36231 36518 9040 18839
245001 36235 36527 9050 18848
246001 36143 36645 9016 18822
247001 36145 36659 8999 18809
248001 36187 36625 8999 18816
249001 36145 36667 8999 18778
250001 36150 36666 8998 18763
251001 36124 36688 9024 18747
252001 36186 36693 9034 18775
253001 36221 36759 9051 18805
254001 36181 36796 9064 18759
255001 36177 36780 9098 18719
256001 36186 36777 9106 18727
257001 36121 36845 9101 18679
258001 36121 36838 9085 18674
259001 36126 36843 9086 18669
260001 36129 36796 9088 18656
261001 36130 36756 9093 18637
262001 36185 36750 9106 18658
263001 36200 36743 9119 18677
264001 36110 36838 9089 18619
265001 36141 36838 9099 18639
266001 36141 36835 9098 18652
267001 36178 36830 9094 18681
268001 36153 36848 9067 18664
269001 36153 36843 9059 18694
270001 36154 36837 9049 18714
271001 36170 36801 9026 18730
272001 36177 36794 9010 18773
273001 36251 36773 9046 18819
274001 36206 36854 9026 18824
275001 36207 36845 9034 18825
276001 36201 36842 9018 18806
277001 36195 36841 9024 18801
278001 36185 36844 9014 18800
279001 36222 36804 9027 18808
280001 36209 36787 9050 18789
281001 36209 36774 9039 18780
282001 36246 36672 9074 18775
283001 36242 36663 9060 18778
284001 36287 36633 9076 18810
285001 36312 36633 9070 18832
286001 36343 36635 9058 18857
287001 36342 36636 9075 18819
288001 36315 36634 9049 18845
289001 36290 36640 9052 18830
290001 36266 36653 9065 18798
291001 36267 36652 9080 18763
292001 36244 36630 9078 18733
293001 36255 36635 9088 18753
294001 36248 36623 9072 18747
295001 36247 36523 9064 18748
296001 36237 36523 9071 18750
297001 36264 36411 9107 18752
298001 36273 36402 9099 18759
299001 36267 36408 9086 18776
300001 36263 36378 9135 18748
301001 36259 36379 9150 18735
302001 36257 36363 9170 18705
303001 36326 36315 9177 18750
304001 36349 36332 9160 18782
305001 36350 36314 9175 18765
306001 36377 36308 9189 18769
307001 36373 36311 9190 18766
308001 36484 36254 9225 18824
309001 36485 36200 9232 18792
310001 36470 36205 9225 18779
311001 36458 36134 9207 18787
312001 36452 36126 9176 18817
313001 36449 36122 9147 18845
314001 36455 36122 9144 18861
315001 36454 36108 9156 18834
316001 36457 36099 9163 18847
317001 36548 36097 9187 18914
318001 36554 36107 9193 18955
319001 36515 36145 9165 18971
320001 36558 36142 9196 18978
321001 36664 36158 9222 19028
322001 36665 35912 9217 19049
323001 36679 35581 9201 19069
324001 36676 35246 9183 19085
325001 36677 34913 9167 19102
326001 36683 34579 9160 19138
327001 36648 34281 9139 19139
328001 36568 34070 9114 19159
329001 36557 34036 9097 19166
330001 36520 33904 9091 19119
331001 36504 33708 9074 19131
332001 36509 33375 9068 19121
333001 36539 33244 9079 19130
334001 36586 33198 9083 19178
335001 36483 33280 9063 19138
336001 36657 33244 9118 19224
337001 36627 33284 9132 19204
338001 36629 33232 9153 19188
339001 36595 33240 9151 19153
340001 36588 33246 9171 19121
341001 36527 33304 9136 19104
342001 36516 33307 9093 19117
343001 36511 33255 9089 19108
344001 36530 33254 9076 19133
345001 36508 33196 9073 19131
346001 36530 33181 9058 19118
347001 36505 33197 9022 19112
348001 36489 33211 8996 19131
349001 36492 33190 8993 19141
350001 36528 33186 8984 19174
351001 36534 33130 8980 19201
352001 36566 32993 8986 19242
353001 36574 32994 9004 19223
354001 36574 32912 8998 19246
355001 36581 32916 9008 19269
356001 36520 32972 9006 19214
357001 36539 33006 8994 19228
358001 36518 33002 8973 19200
359001 36526 32979 8988 19182
360001 36645 32992 9032 19231
361001 36660 32973 9022 19282
362001 36642 33008 9059 19260
363001 36666 32989 9047 19312
364001 36691 32989 9055 19349
365001 36687 32971 9013 19398
366001 36693 32968 9031 19387
367001 36797 32969 9038 19442
368001 36796 32861 9020 19449
369001 36779 32703 9011 19449
370001 36777 32703 8986 19466
371001 36845 32655 9007 19481
372001 36839 32567 9010 19490
373001 36843 32591 9007 19494
374001 36797 32639 9008 19466
375001 36756 32679 8994 19451
376001 36743 32683 9001 19434
377001 36742 32669 8976 19440
378001 36838 32664 8997 19498
379001 36839 32444 8980 19499
380001 36829 32447 8971 19501
381001 36834 32315 8967 19518
382001 36843 32264 8999 19505
383001 36842 32236 9004 19497
384001 36838 32236 9031 19472
385001 36801 32269 9026 19451
386001 36794 32270 9034 19400
387001 36773 32267 9007 19370
388001 36854 32245 9036 19377
389001 36839 32262 9009 19393
390001 36841 32254 9013 19391
391001 36851 32262 9005 19406
392001 36813 32296 9011 19368
393001 36796 32310 8990 19357
394001 36788 32308 8974 19348
395001 36774 32323 8971 19361
396001 36672 32396 8929 19313
397001 36662 32411 8929 19304
398001 36633 32449 8910 19270
399001 36633 32450 8914 19267
400001 36636 32424 8945 19250
401001 36635 32426 8932 19255
402001 36634 32433 8971 19202
403001 36640 32395 8965 19194
404001 36652 32396 8950 19214
405001 36664 32396 8944 19236
406001 36630 32446 8948 19216
407001 36634 32442 8968 19182
408001 36616 32466 8982 19156
409001 36524 32559 8970 19106
410001 36524 32565 8955 19093
411001 36407 32685 8904 19052
412001 36402 32689 8917 19038
413001 36408 32665 8929 19044
414001 36378 32682 8884 19059
415001 36378 32667 8878 19065
416001 36361 32685 8879 19052
417001 36315 32739 8864 19033
418001 36332 32684 8874 19011
419001 36304 32559 8854 19012
420001 36309 32447 8858 19005
421001 36311 32325 8845 18983
422001 36253 32341 8846 18930
423001 36200 32396 8857 18892
424001 36204 32394 8889 18879
425001 36135 32469 8896 18822
426001 36125 32489 8921 18792
427001 36122 32427 8937 18771
428001 36117 32325 8914 18770
429001 36109 32269 8924 18735
430001 36097 32263 8943 18671
431001 36097 32270 8959 18639
432001 36137 32271 8962 18655
433001 36128 32270 8979 18634
434001 36142 32118 8988 18660
435001 36158 32118 8979 18700
436001 35860 32397 8894 18539
437001 35528 32730 8839 18336
438001 35193 33025 8762 18145
439001 34860 33231 8674 17971
440001 34526 33509 8589 17780
441001 34227 33792 8523 17599
442001 34081 34029 8493 17526
443001 34035 34079 8470 17518
444001 33904 34256 8434 17431
445001 33655 34528 8362 17279
446001 33322 34861 8286 17100
447001 33217 34967 8273 17025
448001 33194 34998 8275 16988
449001 33280 34973 8312 17009
450001 33244 35009 8295 16988
451001 33254 35031 8297 16991
452001 33206 35026 8279 16976
453001 33240 35006 8302 17012
454001 33266 35011 8295 17048
455001 33303 35017 8309 17068
456001 33307 34964 8336 17053
457001 33254 35021 8326 17022
458001 33254 35020 8337 17015
459001 33217 35087 8352 16970
460001 33157 35147 8350 16935
461001 33196 35134 8381 16900
462001 33209 35118 8423 16803
463001 33189 35072 8411 16760
464001 33147 35042 8433 16666
465001 33118 35050 8436 16573
466001 32994 35179 8415 16468
467001 32994 35158 8422 16409
468001 32912 35239 8409 16305
469001 32916 35238 8397 16224
470001 32975 35223 8424 16198
471001 33007 35106 8462 16149
472001 33002 35046 8464 16131
473001 32978 35056 8437 16089
474001 32991 35053 8459 16022
475001 33000 35010 8477 15953
476001 33007 35005 8475 15929
477001 32989 34985 8508 15827
478001 32993 34901 8531 15745
479001 32957 34893 8573 15628
480001 32971 34890 8600 15550
481001 32969 34891 8629 15483
482001 32861 34999 8622 15406
483001 32703 35173 8586 15307
484001 32702 35173 8607 15243
485001 32662 35220 8601 15200
486001 32568 35276 8593 15107
487001 32622 35253 8615 15071
488001 32642 35200 8628 15041
489001 32676 35195 8668 15005
490001 32684 35198 8678 14950
491001 32664 35210 8693 14880
492001 32639 35235 8686 14813
493001 32444 35430 8638 14685
494001 32435 35392 8637 14610
495001 32261 35535 8612 14492
496001 32264 35544 8589 14462
497001 32235 35560 8558 14377
498001 32235 35527 8551 14314
499001 32268 35526 8541 14276
500001 32268 35532 8528 14239
501001 32267 35523 8511 14194
502001 32241 35544 8481 14152
503001 32259 35535 8495 14114
504001 32248 35546 8488 14058
505001 32263 35462 8478 14025
506001 32296 35466 8468 13990
507001 32317 35473 8472 13940
508001 32323 35478 8466 13898
509001 32315 35469 8461 13825
510001 32396 35492 8460 13854
511001 32421 35489 8443 13823
512001 32449 35483 8470 13796
513001 32449 35474 8479 13751
514001 32425 35480 8465 13693
515001 32426 35480 8482 13633
516001 32431 35397 8494 13586
517001 32396 35409 8497 13515
518001 32396 35410 8539 13442
519001 32395 35408 8549 13414
520001 32447 35407 8561 13404
521001 32441 35369 8566 13376
522001 32488 35369 8569 13379
523001 32561 35211 8583 13374
524001 32565 35211 8593 13323
525001 32685 35194 8634 13324
526001 32689 35205 8657 13265
527001 32701 35239 8647 13209
528001 32681 35258 8637 13148
529001 32667 35243 8645 13090
530001 32684 35189 8676 13040
531001 32738 35148 8702 13017
532001 32670 35192 8707 12971
533001 32527 35353 8677 12862
534001 32401 35478 8665 12760
535001 32326 35478 8658 12673
536001 32340 35499 8673 12658
537001 32395 35498 8704 12644
538001 32394 35496 8717 12589
539001 32469 35503 8749 12576
540001 32488 35478 8766 12539
541001 32374 35596 8752 12454
542001 32326 35659 8757 12413
543001 32269 35724 8741 12359
544001 32263 35703 8754 12317
545001 32271 35687 8789 12260
546001 32270 35661 8799 12212
547001 32269 35663 8823 12143
548001 32116 35790 8807 12013
549001 32125 35774 8828 11960
550001 32450 35695 8911 12072
551001 32784 35695 8996 12191
552001 33025 35788 9057 12278
553001 33284 35863 9130 12365
554001 33512 35968 9198 12432
555001 33846 35860 9279 12551
556001 34029 35859 9352 12565
557001 34080 35853 9395 12534
558001 34288 35846 9468 12605
559001 34581 35841 9556 12707
560001 34899 35798 9655 12819
561001 34966 35776 9666 12812
562001 34987 35724 9712 12785
563001 34973 35754 9710 12749
564001 35009 35754 9742 12711
565001 35054 35750 9776 12695
566001 35006 35830 9779 12642
567001 35006 35830 9813 12569
568001 35010 35800 9836 12500
569001 35017 35746 9885 12428
570001 34964 35784 9863 12361
571001 35021 35784 9884 12324
572001 35049 35787 9877 12285
573001 35087 35756 9892 12268
574001 35138 35758 9939 12267
575001 35134 35694 9924 12267
576001 35075 35759 9881 12277
577001 35072 35758 9846 12290
578001 35055 35815 9827 12297
579001 35060 35825 9834 12276
580001 35179 35817 9849 12307
581001 35198 35839 9832 12316
582001 35238 35804 9851 12327
583001 35238 35805 9869 12332
584001 35170 35830 9835 12327
585001 35066 35911 9786 12300
586001 35045 35937 9819 12267
587001 35055 35928 9831 12264
588001 35013 35931 9839 12252
589001 35010 35949 9818 12255
590001 35005 35942 9780 12262
591001 34963 36014 9762 12261
592001 34921 36056 9738 12240
593001 34893 36063 9716 12231
594001 34891 36063 9704 12221
595001 34938 36063 9693 12239
596001 35030 36064 9707 12282
597001 35173 36064 9753 12329
598001 35172 36037 9726 12346
599001 35220 36038 9743 12370
600001 35275 36079 9736 12404
601001 35202 36107 9720 12365
602001 35201 36051 9725 12325
603001 35194 36061 9705 12323
604001 35198 36073 9699 12341
605001 35210 36023 9714 12347
606001 35288 36023 9762 12355
607001 35425 36029 9801 12419
608001 35390 36089 9790 12409
609001 35538 36096 9817 12443
610001 35532 36088 9840 12445
611001 35560 36058 9854 12466
612001 35527 36107 9883 12451
613001 35529 36128 9898 12450
614001 35526 36139 9904 12431
615001 35524 36147 9932 12439
616001 35545 36140 9984 12425
617001 35535 36105 10000 12407
618001 35545 36065 10048 12375
619001 35462 36153 10048 12337
620001 35465 36152 10078 12329
621001 35474 36099 10097 12329
622001 35463 36100 10126 12316
623001 35469 36098 10173 12283
624001 35492 36098 10217 12255
625001 35488 36083 10255 12237
626001 35483 36019 10253 12216
627001 35478 36000 10249 12188
628001 35481 36028 10258 12205
629001 35462 36026 10225 12211
630001 35426 36091 10183 12211
631001 35410 36112 10147 12205
632001 35409 35961 10133 12216
633001 35407 35961 10125 12179
634001 35408 35960 10142 12158
635001 35369 35994 10119 12139
636001 35369 35993 10124 12124
637001 35211 36130 10086 12058
638001 35209 36015 10095 12049
639001 35194 36031 10074 12042
640001 35216 36008 10048 12063
641001 35239 36009 10052 12081
642001 35276 36010 10055 12077
643001 35244 36062 10038 12060
644001 35188 36062 9996 12035
645001 35157 36100 9989 12043
646001 35214 36127 9995 12055
647001 35353 36131 10021 12123
648001 35507 36140 10054 12187
649001 35481 36185 10043 12186
650001 35499 36208 10024 12213
651001 35499 36205 10028 12210
652001 35496 36196 10003 12225
653001 35503 36191 10029 12225
654001 35509 36222 10028 12226
655001 35652 36205 10071 12248
656001 35690 36179 10094 12219
657001 35699 36211 10094 12228
658001 35703 36205 10075 12235
659001 35669 36232 10039 12237
660001 35662 36240 10015 12224
661001 35662 36153 9980 12213
662001 35789 36111 10011 12264
663001 35747 36142 9984 12230
664001 35695 36192 9985 12224
665001 35695 36191 9979 12216
666001 35790 36189 10023 12265
667001 35900 36190 10065 12311
668001 35967 36155 10098 12338
669001 35858 36235 10083 12299
670001 35859 36169 10094 12303
671001 35853 36169 10097 12305
672001 35841 36158 10106 12290
673001 35840 36129 10093 12284
674001 35798 36165 10077 12273
675001 35719 36240 10057 12234
676001 35777 36147 10058 12228
677001 35754 36174 10040 12213
678001 35743 36183 10033 12187
679001 35745 36164 10005 12196
680001 35830 36141 9969 12252
681001 35831 36140 9932 12273
682001 35800 36180 9915 12284
683001 35754 36228 9870 12285
684001 35784 36244 9889 12276
685001 35774 36252 9887 12279
686001 35789 36187 9883 12292
687001 35756 36162 9847 12293
688001 35758 36167 9852 12298
689001 35695 36184 9815 12295
690001 35758 36163 9818 12289
691001 35743 36148 9841 12275
692001 35814 36151 9842 12301
693001 35825 36145 9830 12324
694001 35817 36155 9861 12324
695001 35839 36152 9896 12329
696001 35805 36137 9889 12311
697001 35804 36146 9909 12293
698001 35884 36191 9941 12321
699001 35937 36198 9954 12346
700001 35927 36059 9932 12344
701001 35904 36054 9932 12331
702001 35952 35992 9934 12342
703001 35938 36002 9952 12340
704001 35954 35933 9983 12328
705001 36071 35890 10026 12372
706001 36056 35894 10028 12378
707001 36063 35903 10035 12373
708001 36063 35905 10032 12429
709001 36063 35879 10021 12433
710001 36065 35858 10030 12417
711001 36064 35862 10032 12406
712001 36037 35890 10037 12392
713001 36037 35889 10044 12385
714001 36079 35885 10050 12399
715001 36053 35962 10042 12415
716001 36051 35929 10008 12457
717001 36060 35930 9998 12467
718001 36072 35941 9991 12476
719001 36023 35994 9956 12462
720001 36024 35993 9943 12477
721001 36074 35992 9930 12496
722001 36095 36000 9945 12496
723001 36091 35993 9924 12503
724001 36088 36009 9931 12493
725001 36057 36040 9949 12454
726001 36115 35974 9956 12488
727001 36128 35962 9975 12495
728001 36143 35956 9989 12520
729001 36147 35936 9994 12512
730001 36141 35929 9977 12502
731001 36106 35970 9944 12500
732001 36064 36012 9944 12480
733001 36154 36011 9949 12524
734001 36125 36038 9918 12521
735001 36103 35994 9909 12511
736001 36102 36011 9886 12506
737001 36097 36015 9842 12535
738001 36099 36013 9824 12552
739001 36067 36053 9784 12551
740001 36020 36101 9785 12559
741001 36019 36129 9789 12562
742001 36028 36111 9809 12565
743001 36079 36139 9835 12589
744001 36091 36141 9876 12584
745001 36060 36194 9907 12551
746001 35961 36286 9870 12513
747001 35960 36238 9872 12527
748001 35956 36239 9875 12520
749001 35993 36235 9887 12537
750001 36006 36239 9853 12559
751001 36076 36312 9868 12603
752001 36015 36372 9872 12577
753001 36031 36358 9868 12586
754001 36009 36342 9877 12568
755001 36010 36318 9917 12548
756001 36009 36321 9928 12563
757001 36072 36272 9947 12600
758001 36062 36327 9959 12577
759001 36100 36327 9966 12563
760001 36127 36328 9971 12564
761001 36132 36323 9987 12569
762001 36140 36292 10029 12542
763001 36203 36328 10050 12555
764001 36208 36326 10048 12551
765001 36205 36329 10016 12547
766001 36197 36331 10018 12518
767001 36190 36331 9986 12511
768001 36221 36334 9982 12534
769001 36204 36337 9950 12524
770001 36179 36362 9935 12528
771001 36211 36358 9942 12547
772001 36204 36365 9952 12543
773001 36233 36357 9958 12528
774001 36240 36358 9984 12523
775001 36153 36408 9961 12516
776001 36111 36475 9951 12492
777001 36195 36495 9988 12494
778001 36192 36505 9982 12490
779001 36189 36506 10007 12476
780001 36190 36521 9996 12451
781001 36190 36521 10006 12435
782001 36154 36556 9981 12421
783001 36190 36540 9991 12447
784001 36169 36488 9960 12442
785001 36168 36489 9956 12433
786001 36158 36441 9943 12414
787001 36123 36455 9963 12394
788001 36166 36446 9956 12425
789001 36236 36459 9949 12470
790001 36143 36357 9937 12443
791001 36174 36328 9927 12490
792001 36184 36082 9915 12529
793001 36164 35888 9930 12487
794001 36141 35579 9963 12466
795001 36154 35426 9975 12478
796001 36180 35343 9985 12485
797001 36228 35016 9970 12520
798001 36245 34984 10007 12537
799001 36252 34992 10030 12534
800001 36187 35055 10025 12519
801001 36164 35030 10020 12490
802001 36133 35060 10013 12462
803001 36184 35052 10017 12489
804001 36170 35075 10073 12486
805001 36148 35115 10076 12461
806001 36150 35082 10096 12481
807001 36146 35079 10115 12468
808001 36151 35083 10117 12460
809001 36152 35081 10090 12482
810001 36138 35136 10082 12483
811001 36147 35127 10054 12498
812001 36191 35127 10073 12513
813001 36198 35105 10086 12510
814001 36076 35254 10063 12475
815001 36049 35319 10042 12472
816001 35992 35382 10014 12464
817001 36004 35341 10004 12476
818001 35918 35316 9971 12449
819001 35889 35337 9938 12433
820001 35894 35320 9932 12434
821001 35904 35329 9928 12427
822001 35905 35329 9940 12392
823001 35878 35313 9954 12377
824001 35858 35333 9910 12380
825001 35862 35340 9929 12392
826001 35890 35339 9950 12405
827001 35889 35316 9930 12400
828001 35884 35313 9917 12397
829001 35964 35281 9976 12412
830001 35929 35303 10003 12385
831001 35925 35306 10020 12393
832001 35941 35278 10053 12399
833001 35993 35271 10116 12410
834001 35993 35273 10157 12386
835001 36000 35273 10204 12377
836001 35999 35270 10212 12380
837001 36009 35213 10245 12369
838001 36018 35216 10260 12361
839001 36040 35211 10270 12366
840001 35974 35259 10258 12346
841001 35961 35259 10268 12339
842001 35955 35259 10275 12315
843001 35932 35247 10254 12328
844001 35929 35104 10246 12309
845001 35987 35067 10276 12337
846001 36011 35068 10249 12355
847001 36011 35008 10237 12351
848001 36064 35010 10250 12379
849001 35994 35080 10204 12383
850001 36011 35074 10228 12378
851001 36014 35051 10229 12361
852001 36013 35051 10268 12351
853001 36100 35044 10320 12362
854001 36102 35015 10339 12340
855001 36120 34982 10352 12340
856001 36119 34952 10358 12319
857001 36140 34953 10365 12299
858001 36140 34948 10358 12291
859001 36239 34957 10387 12324
860001 36286 34928 10404 12357
861001 36238 34966 10397 12326
862001 36241 34968 10391 12331
863001 36235 34965 10404 12323
864001 36241 34961 10437 12313
865001 36365 34959 10499 12338
866001 36365 34960 10486 12329
867001 36357 34969 10524 12340
868001 36343 34969 10504 12343
869001 36318 35000 10478 12343
870001 36321 34985 10499 12343
871001 36272 35016 10497 12322
872001 36326 34993 10526 12337
873001 36327 35007 10498 12365
874001 36328 35008 10504 12371
875001 36324 35004 10512 12341
876001 36294 35031 10496 12332
877001 36327 34982 10511 12335
878001 36326 34913 10531 12334
879001 36329 34914 10525 12371
880001 36331 34911 10514 12384
881001 36331 34876 10515 12390
882001 36337 34873 10537 12383
883001 36337 34821 10561 12384
884001 36363 34796 10575 12389
885001 36362 34796 10578 12376
886001 36365 34795 10572 12357
887001 36358 34805 10618 12367
888001 36358 34805 10624 12351
889001 36407 34835 10650 12372
890001 36474 34808 10646 12412
891001 36495 34779 10629 12463
892001 36505 34743 10621 12464
893001 36505 34744 10589 12483
894001 36521 34732 10587 12523
895001 36521 34733 10593 12525
896001 36582 34681 10631 12528
897001 36487 34826 10609 12484
898001 36489 34838 10609 12488
899001 36500 34777 10613 12491
900001 36442 34822 10579 12496
901001 36455 34846 10563 12518
902001 36446 34856 10585 12482
903001 36512 34865 10601 12487
904001 36328 35062 10532 12428
905001 36294 35096 10577 12403
906001 36098 35249 10534 12314
907001 35835 35537 10454 12245
908001 35548 35847 10356 12138
909001 35426 35946 10320 12108
910001 35290 36032 10287 12059
+927
View File
@@ -0,0 +1,927 @@
# input : borbu1.fst
# include : borbu1.lst
# selector : genes
# mixer : basic
# distance : chi
# phase : 7
# alphabet : DR
# excluded : X
# seqname : borbu1
# seqlength : 910724
# unmasked : 850
# valid : 850
# window : 227680
# step : 1000
#
# pos LeftDirect RightDirect LeftReverse
1 63 42 36 73
1001 64 42 35 74
2001 64 42 35 73
3001 64 42 34 74
4001 64 41 34 73
5001 63 41 34 74
6001 63 41 33 76
7001 62 41 33 76
8001 62 41 33 77
9001 63 40 33 77
10001 64 39 33 77
11001 66 37 32 79
12001 67 36 30 80
13001 69 34 29 81
14001 69 34 28 82
15001 69 34 27 82
16001 70 33 28 80
17001 70 33 27 81
18001 70 34 27 81
19001 70 34 27 80
20001 70 34 27 79
21001 69 35 26 80
22001 67 35 27 79
23001 65 34 29 77
24001 64 34 29 78
25001 63 34 30 79
26001 62 33 31 78
27001 61 32 31 78
28001 60 32 32 77
29001 59 32 33 77
30001 60 31 34 77
31001 59 32 34 78
32001 60 31 34 79
33001 59 31 35 79
34001 59 31 35 80
35001 58 32 34 80
36001 58 32 35 79
37001 58 32 36 79
38001 58 33 36 80
39001 58 34 37 79
40001 58 33 38 79
41001 59 32 38 79
42001 58 32 39 78
43001 57 33 41 77
44001 57 34 41 77
45001 56 36 41 77
46001 56 36 42 76
47001 55 37 44 74
48001 56 35 45 73
49001 56 35 45 73
50001 57 35 46 73
51001 55 35 47 73
52001 53 35 48 72
53001 53 35 49 72
54001 53 35 50 72
55001 52 35 50 72
56001 51 36 51 72
57001 50 36 53 70
58001 50 36 54 70
59001 50 36 54 70
60001 49 36 55 70
61001 48 36 57 69
62001 48 36 58 69
63001 48 36 58 70
64001 47 35 58 70
65001 47 34 58 71
66001 48 32 58 73
67001 47 32 58 73
68001 48 31 58 74
69001 47 31 58 75
70001 45 32 58 75
71001 45 31 58 75
72001 45 31 57 75
73001 46 31 56 75
74001 47 31 55 76
75001 48 30 55 78
76001 50 28 54 80
77001 51 30 54 81
78001 51 30 54 81
79001 50 30 53 82
80001 50 30 55 81
81001 51 29 55 81
82001 52 30 55 81
83001 51 30 55 81
84001 51 31 56 80
85001 51 31 55 80
86001 51 31 56 79
87001 51 31 57 78
88001 51 31 57 78
89001 51 31 57 79
90001 51 32 58 77
91001 51 33 58 77
92001 50 34 58 76
93001 50 35 59 75
94001 49 35 60 74
95001 49 36 62 73
96001 49 37 62 73
97001 48 37 63 72
98001 48 38 64 71
99001 49 38 65 70
100001 49 38 65 70
101001 50 37 64 70
102001 50 38 65 69
103001 49 38 65 68
104001 48 39 66 67
105001 47 39 66 67
106001 47 40 68 67
107001 47 41 69 66
108001 47 41 69 66
109001 46 41 68 65
110001 44 42 68 65
111001 44 42 68 66
112001 42 42 71 63
113001 42 42 73 62
114001 41 42 73 63
115001 42 41 74 63
116001 42 42 73 65
117001 42 42 73 64
118001 41 43 73 65
119001 41 44 75 63
120001 41 44 76 62
121001 41 44 76 61
122001 41 44 77 60
123001 40 44 77 59
124001 39 44 77 61
125001 37 44 79 61
126001 35 44 80 61
127001 34 44 81 61
128001 34 44 82 60
129001 34 45 82 61
130001 33 45 80 61
131001 33 45 81 61
132001 34 45 81 61
133001 34 46 80 61
134001 35 45 80 60
135001 35 47 79 60
136001 35 47 78 60
137001 34 47 77 61
138001 34 47 78 61
139001 34 48 79 60
140001 33 49 78 60
141001 32 49 78 60
142001 32 51 78 59
143001 32 52 78 58
144001 31 52 77 58
145001 31 51 78 57
146001 31 52 78 56
147001 31 52 79 55
148001 31 52 79 54
149001 32 51 80 53
150001 32 51 79 54
151001 33 51 80 52
152001 33 51 79 52
153001 34 51 79 52
154001 33 52 79 51
155001 32 52 79 51
156001 32 52 78 52
157001 33 51 77 52
158001 34 50 77 52
159001 36 48 77 53
160001 36 47 76 54
161001 37 47 73 54
162001 35 47 73 54
163001 36 47 74 54
164001 35 47 73 54
165001 35 47 73 54
166001 35 47 73 55
167001 35 47 72 55
168001 35 47 72 56
169001 35 47 72 57
170001 36 46 72 56
171001 36 46 70 57
172001 36 45 70 56
173001 36 45 69 57
174001 36 45 69 57
175001 36 45 69 58
176001 36 45 69 59
177001 35 45 70 58
178001 34 45 71 59
179001 34 45 72 59
180001 32 45 73 60
181001 32 45 73 61
182001 31 45 74 61
183001 32 44 75 61
184001 32 43 75 63
185001 31 43 75 64
186001 31 42 75 65
187001 32 40 75 66
188001 31 40 76 65
189001 29 40 78 65
190001 29 39 81 64
191001 30 37 81 64
192001 30 37 81 66
193001 30 37 81 66
194001 30 36 81 66
195001 30 35 81 67
196001 30 34 81 68
197001 30 34 81 69
198001 31 33 80 70
199001 31 33 80 71
200001 31 33 79 71
201001 31 33 78 73
202001 31 33 78 73
203001 32 32 79 73
204001 32 32 77 74
205001 33 31 76 76
206001 34 30 76 78
207001 35 30 75 79
208001 35 31 73 79
209001 36 30 73 78
210001 37 29 73 80
211001 37 29 72 80
212001 38 28 71 81
213001 38 27 70 84
214001 38 27 70 85
215001 37 28 70 85
216001 38 28 69 85
217001 38 28 68 86
218001 39 27 67 86
219001 39 27 67 86
220001 40 26 67 85
221001 41 25 66 86
222001 41 26 66 86
223001 41 26 65 86
224001 42 25 65 86
225001 42 26 65 85
226001 42 26 63 85
227001 42 27 62 85
228001 42 28 63 84
229001 41 29 64 82
230001 42 29 65 81
231001 42 29 64 81
232001 43 29 65 81
233001 44 28 63 81
234001 44 28 62 83
235001 44 28 60 84
236001 44 28 60 84
237001 44 28 59 84
238001 44 28 61 83
239001 44 28 61 82
240001 44 28 61 82
241001 44 28 61 82
242001 44 29 60 83
243001 45 28 61 82
244001 45 29 60 82
245001 45 30 60 81
246001 45 29 61 81
247001 46 28 61 81
248001 45 29 60 82
249001 47 27 60 82
250001 47 27 60 82
251001 47 27 61 82
252001 47 27 60 83
253001 48 26 60 84
254001 49 25 60 85
255001 50 25 60 86
256001 51 25 59 86
257001 52 25 58 86
258001 52 26 58 86
259001 52 25 57 86
260001 52 26 56 86
261001 52 27 55 87
262001 52 28 54 87
263001 51 28 53 87
264001 52 27 54 87
265001 51 27 52 87
266001 51 27 52 88
267001 51 26 52 89
268001 52 25 51 89
269001 52 25 51 90
270001 52 25 52 90
271001 51 26 52 90
272001 49 27 52 90
273001 48 28 53 89
274001 47 28 54 88
275001 47 28 54 89
276001 47 28 54 90
277001 47 27 54 90
278001 47 27 54 91
279001 47 27 54 90
280001 47 27 55 89
281001 47 27 55 90
282001 47 27 56 89
283001 47 27 57 89
284001 46 27 57 90
285001 46 27 56 90
286001 45 27 57 89
287001 45 27 57 89
288001 45 27 57 88
289001 45 27 58 86
290001 45 27 59 84
291001 45 27 58 84
292001 45 27 59 84
293001 45 27 59 84
294001 45 27 60 84
295001 45 27 61 86
296001 45 27 61 86
297001 44 28 61 86
298001 43 28 63 84
299001 43 28 64 83
300001 42 29 65 83
301001 40 29 66 82
302001 40 29 65 83
303001 40 30 64 82
304001 38 32 64 80
305001 37 32 64 80
306001 37 32 66 79
307001 37 32 66 78
308001 36 33 66 78
309001 35 35 67 77
310001 34 36 68 76
311001 34 37 69 76
312001 33 38 70 75
313001 33 39 71 74
314001 33 39 71 74
315001 33 41 72 72
316001 33 41 73 71
317001 32 41 73 71
318001 31 41 74 70
319001 30 41 76 68
320001 30 41 78 66
321001 30 40 79 65
322001 31 39 79 66
323001 30 39 79 65
324001 29 39 80 64
325001 29 39 80 64
326001 27 39 81 63
327001 27 39 84 60
328001 27 39 85 59
329001 28 38 85 60
330001 28 37 85 61
331001 28 38 86 61
332001 27 38 86 61
333001 27 38 85 62
334001 26 38 85 63
335001 26 39 86 63
336001 26 40 86 63
337001 26 40 86 63
338001 25 40 86 64
339001 26 39 85 65
340001 26 39 85 65
341001 27 38 85 65
342001 28 37 84 65
343001 29 37 81 66
344001 29 36 81 66
345001 29 37 82 65
346001 29 37 81 65
347001 28 40 82 64
348001 28 40 83 63
349001 28 42 84 62
350001 28 42 84 61
351001 28 43 83 61
352001 28 43 83 59
353001 28 43 81 59
354001 28 43 82 59
355001 28 43 82 58
356001 29 42 83 59
357001 28 42 82 60
358001 29 41 82 62
359001 30 41 81 63
360001 29 41 81 62
361001 28 42 81 63
362001 28 42 82 62
363001 27 42 82 62
364001 27 42 82 62
365001 27 43 82 62
366001 27 44 83 60
367001 25 44 85 57
368001 25 44 85 57
369001 26 43 86 57
370001 25 43 86 57
371001 25 44 86 57
372001 26 44 86 57
373001 25 46 86 57
374001 26 46 86 57
375001 27 46 87 56
376001 28 48 87 56
377001 28 49 87 56
378001 27 49 87 55
379001 27 50 87 55
380001 26 50 88 54
381001 25 51 89 54
382001 25 52 90 53
383001 25 54 90 53
384001 25 55 90 52
385001 26 56 90 51
386001 27 58 90 51
387001 28 58 89 51
388001 28 60 88 51
389001 28 63 90 49
390001 28 65 90 49
391001 27 68 90 48
392001 27 70 91 47
393001 27 70 90 46
394001 27 74 89 46
395001 27 74 90 45
396001 27 76 89 44
397001 27 77 89 43
398001 27 78 90 41
399001 27 78 90 41
400001 27 79 89 42
401001 27 80 88 42
402001 27 81 88 41
403001 27 83 86 41
404001 27 83 84 41
405001 27 83 83 41
406001 27 83 84 39
407001 27 83 85 37
408001 27 83 85 35
409001 27 83 86 33
410001 27 84 86 32
411001 28 84 85 31
412001 28 84 84 31
413001 28 85 83 31
414001 29 84 83 30
415001 29 84 82 31
416001 29 84 83 31
417001 30 83 82 30
418001 32 81 80 32
419001 32 82 79 33
420001 32 83 79 32
421001 32 85 78 32
422001 33 85 78 32
423001 35 83 77 32
424001 36 83 76 32
425001 37 82 76 31
426001 38 82 75 32
427001 39 81 74 34
428001 40 80 73 34
429001 41 80 72 35
430001 41 82 70 35
431001 41 83 71 34
432001 41 83 69 34
433001 41 83 67 34
434001 41 83 66 34
435001 40 83 65 35
436001 39 83 66 36
437001 39 83 65 36
438001 39 83 64 37
439001 39 85 64 37
440001 39 86 63 37
441001 39 87 60 37
442001 38 88 59 37
443001 38 88 60 36
444001 37 88 61 36
445001 38 87 61 36
446001 38 87 61 36
447001 38 87 63 35
448001 39 86 63 36
449001 39 86 63 36
450001 40 85 63 36
451001 40 84 63 36
452001 40 84 65 35
453001 39 85 65 35
454001 39 86 65 35
455001 38 87 65 34
456001 37 89 65 34
457001 37 88 66 33
458001 36 89 66 33
459001 36 88 65 33
460001 38 86 65 33
461001 40 85 64 34
462001 40 85 62 35
463001 42 83 62 36
464001 42 84 61 37
465001 43 85 60 37
466001 43 85 59 37
467001 43 86 59 37
468001 43 87 59 36
469001 43 87 58 36
470001 42 88 60 33
471001 41 88 60 33
472001 41 89 62 32
473001 41 89 63 31
474001 41 90 62 31
475001 42 90 62 30
476001 42 89 62 30
477001 42 90 62 31
478001 42 91 61 31
479001 43 91 62 30
480001 44 90 59 30
481001 44 90 57 30
482001 44 90 57 30
483001 43 91 57 29
484001 42 91 57 29
485001 43 89 57 29
486001 44 89 57 30
487001 45 87 57 30
488001 46 87 56 30
489001 47 86 56 30
490001 48 84 56 30
491001 49 83 55 31
492001 49 83 55 31
493001 50 82 55 31
494001 51 82 54 32
495001 51 83 54 31
496001 52 82 53 31
497001 54 80 53 32
498001 56 79 52 33
499001 56 79 51 33
500001 57 76 51 33
501001 58 75 51 33
502001 61 71 51 34
503001 64 68 49 35
504001 66 66 49 35
505001 68 65 48 36
506001 70 63 47 36
507001 71 62 46 36
508001 74 59 45 36
509001 75 59 45 37
510001 76 59 44 37
511001 77 58 42 37
512001 78 58 41 37
513001 78 59 41 37
514001 79 58 42 36
515001 80 57 42 36
516001 81 56 41 37
517001 83 55 41 38
518001 83 55 41 38
519001 83 57 40 38
520001 83 57 39 38
521001 83 58 37 38
522001 83 58 34 38
523001 84 58 33 39
524001 84 58 32 39
525001 84 59 31 39
526001 84 60 31 39
527001 84 59 30 39
528001 84 59 30 39
529001 84 60 31 38
530001 84 60 31 38
531001 82 61 30 39
532001 81 62 33 37
533001 83 60 33 37
534001 84 59 32 37
535001 85 59 32 38
536001 85 58 32 37
537001 82 58 32 38
538001 83 57 32 38
539001 82 57 31 38
540001 82 56 32 38
541001 81 58 34 36
542001 80 58 34 36
543001 80 57 35 35
544001 82 55 35 36
545001 83 54 34 37
546001 83 55 34 37
547001 83 55 34 37
548001 83 56 34 38
549001 83 56 35 36
550001 83 56 36 36
551001 83 56 36 36
552001 83 56 37 36
553001 85 54 37 36
554001 87 52 37 36
555001 87 52 37 37
556001 88 51 37 37
557001 88 51 36 37
558001 87 51 35 37
559001 87 51 36 36
560001 87 52 36 37
561001 87 52 35 36
562001 86 53 37 33
563001 86 53 36 33
564001 85 53 36 33
565001 84 53 35 33
566001 85 52 35 34
567001 85 52 35 35
568001 86 51 35 36
569001 87 51 34 37
570001 89 50 34 37
571001 88 50 33 37
572001 89 49 33 37
573001 88 49 33 39
574001 86 48 34 38
575001 85 49 34 39
576001 84 49 35 38
577001 83 51 36 37
578001 84 50 37 36
579001 85 50 37 36
580001 85 51 37 36
581001 86 50 36 36
582001 87 50 36 37
583001 87 50 36 37
584001 88 50 33 38
585001 88 50 34 37
586001 89 49 32 37
587001 89 48 31 38
588001 90 50 31 39
589001 90 49 30 39
590001 89 50 30 40
591001 90 50 31 39
592001 90 51 30 39
593001 91 51 30 39
594001 90 51 30 39
595001 90 51 30 39
596001 91 51 29 39
597001 91 51 29 39
598001 91 52 29 39
599001 89 52 29 40
600001 88 51 30 40
601001 88 50 30 42
602001 87 51 30 42
603001 86 51 30 42
604001 84 52 30 42
605001 83 53 31 41
606001 83 53 31 41
607001 82 53 32 40
608001 82 53 32 40
609001 82 52 31 40
610001 82 52 32 39
611001 80 53 32 40
612001 79 53 33 39
613001 78 53 33 39
614001 76 54 33 39
615001 74 55 33 39
616001 71 56 34 38
617001 68 56 35 37
618001 66 58 35 38
619001 64 57 36 37
620001 63 58 36 37
621001 61 59 36 37
622001 59 60 37 36
623001 59 60 37 36
624001 59 62 37 36
625001 58 63 37 36
626001 58 65 37 36
627001 59 67 36 36
628001 58 67 36 36
629001 57 68 37 36
630001 55 68 37 36
631001 55 68 38 35
632001 56 68 38 35
633001 57 68 38 35
634001 57 68 38 35
635001 58 69 38 35
636001 58 69 38 35
637001 58 69 39 34
638001 59 69 39 34
639001 59 69 39 34
640001 60 69 39 34
641001 59 71 39 34
642001 59 71 38 34
643001 60 71 38 34
644001 60 72 38 33
645001 61 71 38 32
646001 61 71 37 31
647001 60 72 37 31
648001 59 72 37 31
649001 59 72 38 31
650001 58 73 37 31
651001 58 74 38 30
652001 57 75 38 30
653001 57 75 38 30
654001 57 74 37 29
655001 58 73 36 30
656001 58 73 35 31
657001 56 73 35 31
658001 55 73 36 32
659001 55 72 37 31
660001 55 72 37 31
661001 55 73 37 32
662001 56 72 38 31
663001 56 73 37 31
664001 56 75 36 31
665001 56 76 36 31
666001 55 76 36 30
667001 53 76 36 30
668001 52 76 36 30
669001 52 76 37 31
670001 51 77 37 32
671001 51 77 37 32
672001 51 78 36 31
673001 51 78 36 31
674001 52 78 37 30
675001 52 78 35 30
676001 53 78 33 30
677001 53 77 33 31
678001 53 77 33 32
679001 53 78 34 32
680001 52 79 34 31
681001 52 79 35 30
682001 51 79 36 30
683001 51 78 37 30
684001 50 77 37 31
685001 50 77 37 32
686001 49 77 38 32
687001 49 78 39 32
688001 48 79 38 32
689001 49 78 39 32
690001 49 79 38 33
691001 52 76 37 34
692001 50 76 36 35
693001 50 75 36 35
694001 51 74 36 36
695001 50 74 36 38
696001 50 73 37 38
697001 50 73 37 39
698001 50 72 38 39
699001 49 72 37 40
700001 49 72 38 40
701001 47 72 39 40
702001 49 69 39 41
703001 49 69 40 41
704001 51 68 40 42
705001 51 69 39 42
706001 51 71 39 42
707001 51 71 39 42
708001 51 72 39 42
709001 51 74 39 42
710001 51 75 39 42
711001 51 75 39 42
712001 52 75 39 42
713001 52 75 40 41
714001 51 76 40 40
715001 50 76 42 38
716001 51 76 42 38
717001 51 75 42 38
718001 52 75 42 40
719001 53 74 41 40
720001 53 74 41 40
721001 52 74 40 40
722001 52 73 40 40
723001 52 74 40 40
724001 52 74 39 40
725001 53 74 40 39
726001 52 74 39 39
727001 53 73 39 39
728001 54 73 39 39
729001 55 73 39 39
730001 56 73 38 39
731001 56 74 37 39
732001 58 72 38 38
733001 57 72 37 38
734001 58 73 37 38
735001 59 74 37 38
736001 59 73 36 38
737001 61 71 36 38
738001 62 70 36 38
739001 63 69 36 38
740001 65 68 36 38
741001 67 65 36 38
742001 67 66 36 38
743001 68 66 36 37
744001 68 67 36 37
745001 68 66 35 37
746001 68 65 35 37
747001 68 66 35 38
748001 69 66 35 38
749001 69 66 35 38
750001 69 67 34 38
751001 69 66 34 38
752001 69 66 34 38
753001 69 68 34 38
754001 69 68 34 38
755001 71 67 34 39
756001 71 67 34 40
757001 71 66 33 41
758001 72 65 33 41
759001 71 65 32 42
760001 71 64 31 42
761001 72 63 31 42
762001 72 64 31 43
763001 72 64 31 42
764001 73 63 31 42
765001 74 62 30 42
766001 75 62 30 42
767001 75 62 30 42
768001 74 62 29 43
769001 73 62 30 42
770001 73 62 31 41
771001 73 62 31 42
772001 73 62 32 40
773001 72 62 31 41
774001 72 62 31 41
775001 73 62 32 41
776001 72 62 31 41
777001 73 62 31 40
778001 75 60 31 40
779001 76 59 30 40
780001 76 60 30 40
781001 76 60 30 40
782001 76 60 30 40
783001 76 60 31 38
784001 77 59 32 38
785001 77 59 32 38
786001 78 59 31 39
787001 79 59 31 39
788001 78 60 30 39
789001 77 60 30 39
790001 78 59 30 39
791001 77 59 31 38
792001 77 61 32 38
793001 78 62 32 38
794001 79 61 31 38
795001 79 63 31 37
796001 79 63 30 37
797001 78 64 30 36
798001 77 64 31 35
799001 77 64 32 35
800001 77 64 32 34
801001 79 63 32 34
802001 79 63 32 34
803001 78 63 32 33
804001 78 62 33 33
805001 76 62 34 33
806001 76 63 35 33
807001 75 64 36 32
808001 74 66 37 31
809001 74 67 38 30
810001 73 69 38 29
811001 73 69 39 28
812001 72 69 39 27
813001 72 70 40 28
814001 72 70 40 27
815001 71 70 40 27
816001 69 70 41 27
817001 68 70 41 27
818001 68 69 42 27
819001 70 66 42 28
820001 71 65 42 29
821001 71 64 42 29
822001 72 63 42 30
823001 74 62 42 31
824001 75 61 42 31
825001 75 60 42 32
826001 75 59 42 33
827001 75 60 41 34
828001 76 60 39 34
829001 75 60 38 35
830001 76 59 38 35
831001 75 59 39 35
832001 75 58 40 34
833001 74 58 40 35
834001 74 58 40 36
835001 73 58 40 36
836001 73 58 40 37
837001 74 58 40 38
838001 74 59 39 38
839001 74 58 39 39
840001 74 57 39 41
841001 73 57 39 41
842001 73 56 39 41
843001 73 56 39 42
844001 73 55 39 45
845001 73 56 38 45
846001 72 56 38 45
847001 72 57 38 46
848001 72 55 38 47
849001 74 53 38 48
850001 73 53 38 49
851001 72 52 38 50
852001 70 52 38 50
853001 68 51 38 51
854001 68 50 38 53
855001 66 50 38 54
856001 67 49 38 55
857001 66 49 37 56
858001 67 48 37 57
859001 66 48 37 58
860001 65 48 37 59
861001 66 48 38 58
862001 65 47 38 58
863001 66 48 38 58
864001 66 47 38 58
865001 66 48 38 58
866001 66 46 38 58
867001 68 45 38 58
868001 67 45 38 58
869001 67 45 39 57
870001 67 46 40 56
871001 66 47 41 55
872001 65 49 41 55
873001 65 50 42 54
874001 64 51 42 54
875001 63 51 42 54
876001 64 50 42 54
877001 64 50 42 55
878001 63 51 42 55
879001 62 52 42 55
880001 62 51 42 55
881001 62 51 42 56
882001 62 51 42 55
883001 62 51 42 56
884001 62 51 41 57
885001 62 51 41 57
886001 62 51 40 57
887001 62 51 41 58
888001 62 51 41 59
889001 62 50 41 58
890001 62 50 41 59
891001 62 49 40 61
892001 60 49 40 62
893001 59 49 40 62
894001 60 48 40 63
895001 60 48 40 64
896001 60 49 39 65
897001 60 49 38 65
898001 59 50 38 64
899001 58 50 38 65
900001 59 49 39 65
901001 59 48 39 66
902001 60 47 39 66
903001 60 47 39 68
904001 59 47 39 69
905001 59 47 39 68
906001 62 45 39 68
907001 62 44 38 68
908001 62 43 38 69
909001 63 42 37 71
910001 63 42 37 73
+52
View File
@@ -0,0 +1,52 @@
#!/bin/csh -f
set path = (. ../src $path); rehash
set out = "tst"
#set out = "ref" # for recording
echo borbu1.0.$out
kimono borbu1.fst | awk '{print $1, $2, $3, $4, $5}' > borbu1.0.$out
diff borbu1.0.$out ref/borbu1.0.ref
if (($out != "ref") && ($status != 0)) exit $status
echo borbu1.1.$out
kimono -i borbu1.lst -p 1 borbu1.fst | awk '{print $1, $2, $3, $4, $5}' > borbu1.1.$out
diff borbu1.1.$out ref/borbu1.1.ref
if (($out != "ref") && ($status != 0)) exit $status
echo borbu1.2.$out
kimono -i borbu1.lst -p 2 borbu1.fst | awk '{print $1, $2, $3, $4, $5}' > borbu1.2.$out
diff borbu1.2.$out ref/borbu1.2.ref
if (($out != "ref") && ($status != 0)) exit $status
echo borbu1.3.$out
kimono -i borbu1.lst -p 123 borbu1.fst | awk '{print $1, $2, $3, $4, $5}' > borbu1.3.$out
diff borbu1.3.$out ref/borbu1.3.ref
if (($out != "ref") && ($status != 0)) exit $status
echo borbu1.4.$out
kimono -x borbu1.lst borbu1.fst | awk '{print $1, $2, $3, $4, $5}' > borbu1.4.$out
diff borbu1.4.$out ref/borbu1.4.ref
if (($out != "ref") && ($status != 0)) exit $status
echo borbu1.5.$out
kimono -a gc -c cumul borbu1.fst | awk '{print $1, $2, $3, $4, $5}' > borbu1.5.$out
diff borbu1.5.$out ref/borbu1.5.ref
if (($out != "ref") && ($status != 0)) exit $status
echo borbu1.6.$out
kimono -c codon -e 0 -i borbu1.lst borbu1.fst | awk '{print $1, $2, $3, $4, $5}' > borbu1.6.$out
diff borbu1.6.$out ref/borbu1.6.ref
if (($out != "ref") && ($status != 0)) exit $status
echo borbu1.7.$out
kimono -c genes -i borbu1.lst borbu1.fst | awk '{print $1, $2, $3, $4, $5}' > borbu1.7.$out
diff borbu1.7.$out ref/borbu1.7.ref
if (($out != "ref") && ($status != 0)) exit $status
echo "+ all test ok"
if ($out != "ref") \rm -f *.$out
exit 0
BIN
View File
Binary file not shown.

Some files were not shown because too many files have changed in this diff Show More