Initial commit

2016-01-13 10:23:54 +01:00
commit 9e33d6a180
44 changed files with 4080 additions and 0 deletions
--- a/.gitignore
+++ b/.gitignore
@@ -0,0 +1 @@
+/man/
--- a/26
+++ b/26
@@ -0,0 +1,26 @@
+Package: ROBIBarcodes
+Type: Package
+Title: Metabarcoding barcode database
+Version: 0.1
+Date: 2013-10-24
+Author: LECA - Laboratoire d'ecologie alpine
+Maintainer: LECA OBITools team <obitools@metabarcoding.org>
+Description: More about what it does (maybe more than one line)
+License: CeCILL v2.0
+LazyLoad: yes
+RoxygenNote: 5.0.1
+Collate:
+    'ROBIBarcodes.R'
+    'xmlMods.R'
+    'bibliography.R'
+    'ecopcr.R'
+    'emptydb.R'
+    'logo.R'
+    'mismatchplot.R'
+    'piexy.R'
+    'primer_table.R'
+    'primers.R'
+    'resolution.R'
+    'taxonomy.R'
+    'taxonomy_table.R'
+    'xmlspare.R'
--- a/28
+++ b/28
@@ -0,0 +1,28 @@
+# Generated by roxygen2: do not edit by hand
+
+export(add.reference.barcodedb)
+export(add.taxon.barcodedb)
+export(addmodsnamespace)
+export(bezier3)
+export(bib2mods)
+export(dna.shanon)
+export(dnalogo)
+export(dnalogoplot)
+export(ecopcr.forward.frequencies)
+export(ecopcr.forward.shanon)
+export(ecopcr.reverse.frequencies)
+export(ecopcr.reverse.shanon)
+export(has.bibliography)
+export(metabarcodedb)
+export(metabarcodedb.taxonomy)
+export(mismatchplot)
+export(pie.xy)
+export(plotDNAletter)
+export(primers.data.frame)
+export(read.ecopcr.result)
+export(resolution)
+export(taxonomy.data.frame)
+export(whitepaper)
+import(ROBITaxonomy)
+import(XML)
+useDynLib(ROBIBarcodes)
--- a/R/ROBIBarcodes.R
+++ b/R/ROBIBarcodes.R
@@ -0,0 +1,25 @@
+#' A package to manipulate DNA metabarcoding data.
+#' 
+#' This package was written as a following of the OBITools. 
+#' 
+#' \tabular{ll}{
+#'  Package: \tab ROBIBarcodes\cr
+#'  Type: \tab Package\cr
+#'  Version: \tab 0.1\cr
+#'  Date: \tab 2013-06-27\cr
+#'  License: \tab CeCILL 2.0\cr
+#'  LazyLoad: \tab yes\cr
+#'}
+#' 
+#' @name ROBIBarcodes-package
+#' @aliases ROBIBarcodes
+#' @docType package
+#' @title  A package to manipulate DNA metabarcoding marker database.
+#' @author Frederic Boyer
+#' @author Aurelie Bonin
+#' @author Lucie Zinger
+#' @author Eric Coissac
+#' 
+#' @references http://metabarcoding.org/obitools
+#' 
+NULL
--- a/R/bibliography.R
+++ b/R/bibliography.R
@@ -0,0 +1,45 @@
+#'@include xmlMods.R
+#'@import XML
+#'
+NULL
+
+#' Tests if the metabarcode database has at least one bibliography reference
+#' 
+#' @export
+has.bibliography = function(barcodedb) {
+  length(getNodeSet(barcodedb,
+                    path='/obi:obimetabarcodedb/obi:bibliography',
+                    c(obi="http://metabarcoding.org/OBIMetabarcodes")))>0
+}
+
+#' @export
+add.reference.barcodedb  = function(barcodedb,bibfile,bibutils='bib2xml') {
+  
+  if (! has.bibliography(barcodedb)) {
+    # We create the bibliography node
+    
+    metabarcode = getNodeSet(barcodedb,
+                          path='/obi:obimetabarcodedb',
+                          c(obi="http://metabarcoding.org/OBIMetabarcodes"))[[1]]
+    
+    spare = sparexmltree()
+    
+    bibliography = getNodeSet(spare,
+                          path='/obi:obimetabarcodedb/obi:bibliography',
+                          c(obi="http://metabarcoding.org/OBIMetabarcodes"))[[1]]
+    
+    bibliography = xmlClone(bibliography)
+    
+    addChildren(metadata,bibliography,
+                at = NA)
+    
+
+  }
+
+  bibliography=getNodeSet(barcodedb,
+                          path='/obi:obimetabarcodedb/obi:bibliography',
+                          c(obi="http://metabarcoding.org/OBIMetabarcodes"))
+  
+  ref = bib2mods(bibfile,bibutils)
+  hidden=addChildren(bibliography[[1]],kids=ref) 
+}
--- a/R/ecopcr.R
+++ b/R/ecopcr.R
@@ -0,0 +1,162 @@
+#'@include ROBIBarcodes.R
+NULL
+
+#   column 1 : accession number
+#   column 2 : sequence length
+#   column 3 : taxonomic id
+#   column 4 : rank
+#   column 5 : species taxonomic id
+#   column 6 : scientific name
+#   column 7 : genus taxonomic id
+#   column 8 : genus name
+#   column 9 : family taxonomic id
+#   column 10 : family name
+#   column 11 : super kingdom taxonomic id
+#   column 12 : super kingdom name
+#   column 13 : strand (direct or reverse)
+#   column 14 : first oligonucleotide
+#   column 15 : number of errors for the first strand
+#   column 16 : Tm for hybridization of primer 1 at this site
+#   column 17 : second oligonucleotide
+#   column 18 : number of errors for the second strand
+#   column 19 : Tm for hybridization of primer 1 at this site
+#   column 20 : amplification length
+#   column 21 : sequence
+#   column 22 : definition  
+
+#' Read the result file produced by the ecoPCR program.
+#' 
+#' @export
+read.ecopcr.result = function(file) 
+{
+  
+  split.line = function(line) {
+    l = strsplit(line,split=" +\\| +")[[1]]
+    l = c(l[1:21],paste(l[-c(1:21)],sep="|"))
+    return(l)
+  }
+  
+  if (missing(file) && !missing(text)) {
+    file <- textConnection(text)
+    on.exit(close(file))
+  }
+  if (is.character(file)) {
+    file <- file(file, "rt")
+    on.exit(close(file))
+  }
+  if (!inherits(file, "connection")) 
+    stop("'file' must be a character string or connection")
+  if (!isOpen(file, "rt")) {
+    open(file, "rt")
+    on.exit(close(file))
+  }
+  
+  line = readLines(file,1)
+  while (length(grep('^#',line))==1) {
+    line = readLines(file,1)
+  }
+  
+  pushBack(line,file)
+  
+  lines = lapply(readLines(file),split.line)
+  nlines = length(lines)
+  AC                = sapply(1:nlines,function(x) lines[[x]][1])
+  seq_length        = as.integer(sapply(1:nlines,function(x) lines[[x]][2]))
+  taxid             = as.integer(sapply(1:nlines,function(x) lines[[x]][3]))
+  rank              = as.factor(sapply(1:nlines,function(x) lines[[x]][4]))
+  species           = type.convert(sapply(1:nlines,function(x) lines[[x]][5]),na.string="###")
+  species_name      = sapply(1:nlines,function(x) lines[[x]][6])
+  genus             = type.convert(sapply(1:nlines,function(x) lines[[x]][7]),na.string="###")
+  genus_name        = sapply(1:nlines,function(x) lines[[x]][8])
+  family            = type.convert(sapply(1:nlines,function(x) lines[[x]][9]),na.string="###")
+  family_name       = sapply(1:nlines,function(x) lines[[x]][10])
+  superkingdom      = type.convert(sapply(1:nlines,function(x) lines[[x]][11]),na.string="###")
+  superkingdom_name = sapply(1:nlines,function(x) lines[[x]][12])
+  strand            = as.factor(sapply(1:nlines,function(x) lines[[x]][13]))
+  forward_match     = sapply(1:nlines,function(x) lines[[x]][14])
+  forward_mismatch  = as.integer(sapply(1:nlines,function(x) lines[[x]][15]))
+  forward_tm        = as.double(sapply(1:nlines,function(x) lines[[x]][16]))
+  reverse_match     = sapply(1:nlines,function(x) lines[[x]][17])
+  reverse_mismatch  = as.integer(sapply(1:nlines,function(x) lines[[x]][18]))
+  reverse_tm        = as.double(sapply(1:nlines,function(x) lines[[x]][19]))
+  amplicon_length   = as.integer(sapply(1:nlines,function(x) lines[[x]][20]))
+  sequence          = sapply(1:nlines,function(x) lines[[x]][21])
+  definition        = sapply(1:nlines,function(x) lines[[x]][22])
+  
+  eco = data.frame(AC,seq_length,taxid,rank,
+                   species,species_name,
+                   genus,genus_name,
+                   family,family_name,
+                   superkingdom,superkingdom_name,
+                   strand,
+                   forward_match,forward_mismatch,forward_tm,
+                   reverse_match,reverse_mismatch,reverse_tm,
+                   amplicon_length,sequence,definition
+  )
+  
+  return(eco)
+}
+
+ecopcr.frequencies = function(matches,group=NULL) {
+  compute = function(matches) {
+    w = as.matrix(do.call(rbind,strsplit(as.character(matches),'')))
+    d = dim(w)
+    w=factor(w,levels=c('A','C','G','T'))
+    dim(w)=d
+    w=t(w)
+    freq = mapply(function(x) table(w[x,]),1:d[2])
+    freq = freq[c('A','C','G','T'),]
+    csum = colSums(freq)
+    freq = sweep(freq,2,csum,'/')
+    attr(freq,'count')=length(w)
+    return(freq)
+  }
+  if (is.null(group))
+    return(compute(matches))
+  else {
+    lmatches = aggregate(matches,by=list(group=as.factor(group)),as.character)
+    w = lmatches$x
+    names(w)=lmatches$group
+    lf = lapply(w,compute)
+    return(lf)
+  }
+}
+
+#' @export
+ecopcr.forward.frequencies = function(ecopcr,group=NULL) {
+  return(ecopcr.frequencies(ecopcr$forward_match,group))
+}
+
+#' @export
+ecopcr.reverse.frequencies = function(ecopcr,group=NULL) {
+  return(ecopcr.frequencies(ecopcr$reverse_match,group))
+}
+
+#' @export
+dna.shanon = function(freq,base=2) {
+  shanon = log(4)/log(base) - colSums(-freq *log(freq) / log(base),na.rm=TRUE)
+  return(sweep(freq,2,shanon,'*')) 
+}
+
+
+ecopcr.shanon = function(matches,group=NULL,base=2) {
+  
+  if (is.null(group)) {
+    freq = ecopcr.frequencies(matches)
+    return(dna.shanon(freq))
+  }
+  else {
+    lf = lapply(ecopcr.frequencies(matches,group),dna.shanon)
+    return(lf)
+  }
+}
+
+#' @export
+ecopcr.forward.shanon = function(ecopcr,group=NULL,base=2) {
+  return(ecopcr.shanon(ecopcr$forward_match,group,base))
+}
+
+#' @export
+ecopcr.reverse.shanon = function(ecopcr,group=NULL,base=2) {
+  return(ecopcr.shanon(ecopcr$reverse_match,group,base))
+}
--- a/R/emptydb.R
+++ b/R/emptydb.R
@@ -0,0 +1,18 @@
+#'@include ROBIBarcodes.R
+#'@import XML
+#'
+NULL
+
+#' Creates a new empty metabarcode database.
+#' 
+#' @export
+metabarcodedb = function() {
+  emptyfile = paste(system.file("extdata", 
+                                package="ROBIBarcodes"),
+                    'empty.xml',
+                    sep='/')
+
+ empty = xmlParseDoc(emptyfile)
+
+ return(empty)
+}
--- a/R/logo.R
+++ b/R/logo.R
@@ -0,0 +1,488 @@
+#'@include ROBIBarcodes.R
+NULL
+
+svg.A.path="m 53.417969,-13.28125 -29.394532,0 L 19.384766,0 0.48828125,0 27.490234,-72.900391 l 22.41211,0 L 76.904297,0 58.007812,0 53.417969,-13.28125 m -24.707032,-13.525391 19.970704,0 -9.960938,-29.003906 -10.009766,29.003906"
+svg.C.path="M 66.992187,-4.0039062 C 63.541603,-2.2135395 59.944602,-0.86262935 56.201172,0.04882812 52.45763,0.9602855 48.551384,1.4160142 44.482422,1.4160156 32.340462,1.4160142 22.721331,-1.9693991 15.625,-8.7402344 8.5286373,-15.543604 4.9804638,-24.755835 4.9804687,-36.376953 4.9804638,-48.030551 8.5286373,-57.242781 15.625,-64.013672 c 7.096331,-6.803314 16.715462,-10.205004 28.857422,-10.205078 4.068962,7.4e-5 7.975208,0.455803 11.71875,1.367188 3.74343,0.91153 7.340431,2.26244 10.791015,4.052734 l 0,15.087891 c -3.483136,-2.376246 -6.917377,-4.117781 -10.302734,-5.22461 -3.38547,-1.106711 -6.949919,-1.660096 -10.693359,-1.660156 -6.705769,6e-5 -11.979201,2.148496 -15.820313,6.445312 -3.841172,4.296925 -5.761743,10.221398 -5.761719,17.773438 -2.4e-5,7.51956 1.920547,13.427757 5.761719,17.724609 3.841112,4.29689 9.114544,6.445325 15.820313,6.445313 3.74344,1.2e-5 7.307889,-0.553373 10.693359,-1.660157 3.385357,-1.106755 6.819598,-2.84829 10.302734,-5.224609 l 0,15.0878908"
+svg.G.path="m 74.707031,-5.4199219 c -4.68757,2.278649 -9.554101,3.9876317 -14.599609,5.12695315 C 55.061794,0.84635332 49.853466,1.4160142 44.482422,1.4160156 32.340462,1.4160142 22.721331,-1.9693991 15.625,-8.7402344 8.5286373,-15.543604 4.9804638,-24.755835 4.9804687,-36.376953 c -4.9e-6,-11.751254 3.6132727,-20.996037 10.8398443,-27.734375 7.226539,-6.738211 17.122362,-10.107348 29.687499,-10.107422 4.850211,7.4e-5 9.488878,0.455803 13.916016,1.367188 4.459572,0.91153 8.658786,2.26244 12.597656,4.052734 l 0,15.087891 c -4.069078,-2.311142 -8.121808,-4.036401 -12.158203,-5.175782 -4.003962,-1.139263 -8.02414,-1.708924 -12.060547,-1.708984 -7.487019,6e-5 -13.265008,2.099668 -17.333984,6.298828 -4.036485,4.166717 -6.054712,10.140018 -6.054688,17.919922 -2.4e-5,7.714872 1.953099,13.671898 5.859375,17.871094 3.906216,4.199233 9.456341,6.29884 16.650391,6.298828 1.953076,1.2e-5 3.759715,-0.11392 5.419922,-0.341797 1.692654,-0.260404 3.206325,-0.651029 4.541016,-1.171875 l 0,-14.160156 -11.47461,0 0,-12.597657 29.296875,0 0,35.0585941"
+svg.T.path="m 0.48828125,-72.900391 l 67.18749975,0 0,14.208985 -24.169922,0 0,58.691406 -18.798828,0 0,-58.691406 -24.21874975,0 0,-14.208985"
+svg.R.path="m 35.888672,-40.576172 c 3.938762,4.1e-5 6.754515,-0.73238 8.447265,-2.197265 1.725215,-1.4648 2.587844,-3.873652 2.587891,-7.226563 -4.7e-5,-3.320259 -0.862676,-5.696559 -2.587891,-7.128906 -1.69275,-1.432233 -4.508503,-2.148378 -8.447265,-2.148438 l -7.910156,0 0,18.701172 7.910156,0 m -7.910156,12.988281 0,27.587891 -18.7988285,0 0,-72.900391 28.7109375,0 c 9.602817,7.3e-5 16.63406,1.6114 21.09375,4.833985 4.492124,3.222721 6.738216,8.317117 6.738281,15.283203 -6.5e-5,4.817756 -1.171939,8.77283 -3.515625,11.865234 -2.311258,3.092486 -5.810603,5.37113 -10.498047,6.835938 2.571561,0.585971 4.86648,1.920605 6.884766,4.003906 2.050721,2.050809 4.117776,5.175806 6.201172,9.375 L 75,0 54.980469,0 46.09375,-18.115234 c -1.790409,-3.645812 -3.613324,-6.136044 -5.46875,-7.470703 -1.822955,-1.334609 -4.264359,-2.001926 -7.324219,-2.001954 l -5.322265,0"
+svg.Y.path="m -0.9765625,-72.900391 20.5566405,0 16.601563,25.976563 16.601562,-25.976563 20.605469,0 -27.783203,42.1875 0,30.712891 -18.798828,0 0,-30.712891 -27.7832035,-42.1875"
+svg.M.path="m 9.1796875,-72.900391 23.9257815,0 16.601562,39.013672 16.699219,-39.013672 23.876953,0 0,72.900391 -17.773437,0 0,-53.320312 -16.796875,39.30664 -11.914063,0 -16.796875,-39.30664 0,53.320312 -17.8222655,0 0,-72.900391"
+svg.K.path="m 9.1796875,-72.900391 18.7988285,0 0,26.611329 27.099609,-26.611329 21.826172,0 L 41.796875,-38.378906 80.517578,0 56.982422,0 27.978516,-28.710937 27.978516,0 9.1796875,0 l 0,-72.900391"
+svg.W.path="m 2.9785156,-72.900391 18.0175784,0 12.597656,52.978516 12.5,-52.978516 18.115234,0 12.5,52.978516 12.597657,-52.978516 17.871089,0 L 89.990234,0 68.310547,0 55.078125,-55.419922 41.992187,0 20.3125,0 2.9785156,-72.900391"
+svg.S.path="m 59.912109,-70.605469 0,15.429688 c -4.003962,-1.790308 -7.910208,-3.141218 -11.71875,-4.052735 -3.808638,-0.911398 -7.405639,-1.367127 -10.791015,-1.367187 -4.492221,6e-5 -7.81253,0.618549 -9.960938,1.855469 -2.148463,1.237036 -3.22268,3.157607 -3.222656,5.761718 -2.4e-5,1.953176 0.716121,3.483123 2.148437,4.589844 1.464816,1.074266 4.101533,2.002 7.910157,2.783203 l 8.007812,1.611328 c 8.105419,1.627647 13.867132,4.101603 17.285156,7.421875 3.417906,3.320346 5.126889,8.040393 5.126954,14.160157 -6.5e-5,8.040379 -2.392641,14.0299559 -7.177735,17.9687496 -4.752657,3.90625056 -12.02804,5.8593736 -21.826172,5.859375 C 31.070932,1.4160142 26.432265,0.97656152 21.777344,0.09765625 17.122379,-0.78124922 12.467435,-2.0833313 7.8125,-3.8085938 l 0,-15.8691402 c 4.654935,2.473975 9.147118,4.345718 13.476562,5.615234 4.361954,1.236992 8.561169,1.855481 12.597657,1.855469 4.101524,1.2e-5 7.242797,-0.683581 9.423828,-2.050782 2.180944,-1.367171 3.271438,-3.320294 3.271484,-5.859374 -4.6e-5,-2.278624 -0.748744,-4.036435 -2.246094,-5.273438 -1.464886,-1.236953 -4.410847,-2.343722 -8.83789,-3.320312 l -7.275391,-1.611329 c -7.291687,-1.562468 -12.630224,-4.0527 -16.015625,-7.470703 -3.3528732,-3.417927 -5.0293038,-8.024042 -5.0292966,-13.818359 -7.2e-6,-7.259056 2.3437405,-12.841733 7.0312496,-16.748047 4.687481,-3.906178 11.425756,-5.859301 20.214844,-5.859375 4.003868,7.4e-5 8.121702,0.309319 12.353516,0.927734 4.23172,0.586011 8.60997,1.481192 13.134765,2.685547"
+svg.B.path="m 38.378906,-44.677734 c 2.962198,4.4e-5 5.20829,-0.650997 6.738281,-1.953125 1.529902,-1.302036 2.294875,-3.222607 2.294922,-5.761719 -4.7e-5,-2.506456 -0.76502,-4.410751 -2.294922,-5.712891 -1.529991,-1.334576 -3.776083,-2.001893 -6.738281,-2.001953 l -10.40039,0 0,15.429688 10.40039,0 m 0.634766,31.884765 c 3.775999,1.3e-5 6.608027,-0.797512 8.496094,-2.392578 1.920523,-1.595035 2.880809,-4.003887 2.880859,-7.226562 -5e-5,-3.157527 -0.94406,-5.517551 -2.832031,-7.080078 -1.888067,-1.595021 -4.736371,-2.392547 -8.544922,-2.392579 l -11.035156,0 0,19.091797 11.035156,0 m 17.480469,-26.220703 c 4.036397,1.171913 7.161394,3.336624 9.375,6.494141 2.213473,3.157581 3.320243,7.031275 3.320312,11.621094 -6.9e-5,7.031263 -2.376369,12.2721435 -7.128906,15.7226558 C 57.307885,-1.7252587 50.08133,0 40.380859,0 l -31.2011715,0 0,-72.900391 28.2226565,0 c 10.12365,7.3e-5 17.447862,1.53002 21.972656,4.589844 4.557228,3.059961 6.835871,7.959045 6.835937,14.697266 -6.6e-5,3.548227 -0.830143,6.575568 -2.490234,9.082031 -1.660218,2.474 -4.06907,4.313191 -7.226562,5.517578"
+svg.D.path="m 27.978516,-58.691406 0,44.482422 6.738281,0 c 7.682249,1.4e-5 13.541618,-1.904281 17.578125,-5.712891 4.068954,-3.80857 6.103457,-9.342419 6.103515,-16.601562 -5.8e-5,-7.226519 -2.018285,-12.727816 -6.054687,-16.503907 -4.036507,-3.775985 -9.912152,-5.664004 -17.626953,-5.664062 l -6.738281,0 m -18.7988285,-14.208985 19.8242185,0 c 11.067669,7.3e-5 19.303337,0.797599 24.707031,2.392579 5.436139,1.562568 10.091083,4.231837 13.964844,8.007812 3.417898,3.28782 5.956958,7.080134 7.617188,11.376953 1.660079,4.296922 2.490156,9.163454 2.490234,14.59961 -7.8e-5,5.501333 -0.830155,10.416692 -2.490234,14.746093 -1.66023,4.296893 -4.19929,8.089207 -7.617188,11.376953 -3.906314,3.7760487 -8.593809,6.4615929 -14.0625,8.056641 C 48.144483,-0.78124922 39.941366,0 29.003906,0 l -19.8242185,0 0,-72.900391"
+svg.H.path="m 9.1796875,-72.900391 18.7988285,0 0,27.783204 27.734375,0 0,-27.783204 18.798828,0 0,72.900391 -18.798828,0 0,-30.908203 -27.734375,0 0,30.908203 -18.7988285,0 0,-72.900391"
+svg.V.path="m 0.48828125,-72.900391 18.89648475,0 19.335937,53.808594 19.287109,-53.808594 18.896485,0 L 49.902344,0 27.490234,0 0.48828125,-72.900391"
+svg.N.path="m 9.1796875,-72.900391 20.9960935,0 26.513672,50 0,-50 17.822266,0 0,72.900391 -20.996094,0 -26.513672,-50 0,50 -17.8222655,0 0,-72.900391"
+
+svg.dash.path="m 5.4199219,-35.888672 l 30.6640621,0 0,14.208985 -30.6640621,0 0,-14.208985"
+
+#' Compute the cubic bezier function
+#' 
+#' The \code{bezier3} function computes the point of the cubic bezier
+#' curve linking the point P0 to P3 and using P1 and P2 as control points
+#' 
+#' @param t the position on the curve estimated as a float between 0 the
+#'          starting point and 1 the ending point
+#' 
+#' @param p0 a vector of numeric describing the coordinates of the p0 point,
+#'           the starting point of the curve.
+#'           
+#' @param p1 a vector of numeric describing the coordinates of the p1 point,
+#'           the first control point.
+#'           
+#' @param p2 a vector of numeric describing the coordinates of the p2 point,
+#'           the second control point.
+#'           
+#' @param p3 a vector of numeric describing the coordinates of the p3 point,
+#'           the final point of the curve.
+#'           
+#' @return a numric matrix containing the coordinates of the bezier curve/
+#'           
+#' @examples
+#' 
+#' bezier3((1:10)/10,c(1,1),c(1,2),c(2,2),c(2,1))
+#'           
+#' @author Eric Coissac
+#' @export
+bezier3 = function(t,p0,p1,p2,p3) {
+  outer((1-t)^3,p0) + outer(t*(1-t)^2,3*p1) + outer(t^2*(1-t),3*p2) + outer(t^3,p3) 
+}
+
+lmin = function(l) min(sapply(l,min))
+lmax = function(l) max(sapply(l,max))
+
+path.to.polygon = function(path,scalex=TRUE,scaley=TRUE) {
+  
+  x = strsplit(path," ")[[1]]
+  y = c()
+  for (c in x) {
+    if (length(grep(',',c))==0)
+      current=c
+    else {
+      y = c(y,current,c)
+      if (current=='m')
+        current='l'
+      if (current=='M')
+        current='L'
+      
+    }
+  }
+  
+  dim(y)=c(2,length(y)/2)
+  y=t(y)
+  operations = y[,1]
+  positions  = do.call(rbind,strsplit(y[,2],","))
+  positions  = apply(positions,2,as.numeric)
+  
+  positions  = data.frame(operations,x=positions[,1],y=positions[,2])
+
+  
+  relatives = positions$operations == tolower(positions$operations)
+  operations=toupper(operations)
+  
+  current.x=0
+  current.y=0
+  
+  n = dim(positions)[1]
+  
+  absolute.x=c()
+  absolute.y=c()
+  
+  remains=0
+  
+  for (i in 1:n) {
+    
+    if (remains==0) {
+      if (operations[i]=='C')
+        remains=3
+      else
+        remains=1
+    }
+    if (relatives[i]) {
+      new.x = current.x + positions$x[i]
+      new.y = current.y + positions$y[i]
+    }
+    else {
+      new.x = positions$x[i]
+      new.y = positions$y[i]      
+    }
+    
+    absolute.x = c(absolute.x,new.x)
+    absolute.y = c(absolute.y,new.y)  
+    
+    remains=remains-1
+    
+    if (remains==0) {
+      current.x=new.x
+      current.y=new.y
+    }
+    
+  }
+
+  c = (1:length(operations))[operations=='C']
+  
+  if (length(c)>0){
+  p0=c[0:(length(c)/3-1)*3+1]
+  operations[p0+1]="X"
+  operations[p0+2]="X"
+  }
+  
+  allpath.x=list()
+  allpath.y=list()
+  path.x = c()
+  path.y = c()
+  for (i in 1:length(operations)) {
+    if (operations[i]=='M' & length(path.x)>0) {
+      allpath.x[[length(allpath.x)+1]]=path.x
+      allpath.y[[length(allpath.y)+1]]=path.y
+      path.x = c()
+      path.y = c()
+    }
+    
+    
+    if (operations[i]=='M' | operations[i]=='L') {
+      path.x = append(path.x,absolute.x[i])
+      path.y = append(path.y,absolute.y[i])
+    }
+    if (operations[i]=='C') {
+      b = bezier3((0:10)/10,c(absolute.x[i-1],absolute.y[i-1]),
+                            c(absolute.x[i],absolute.y[i]),
+                            c(absolute.x[i+1],absolute.y[i+1]),
+                            c(absolute.x[i+2],absolute.y[i+2]))
+      path.x = c(path.x,b[-1,1])
+      path.y = c(path.y,b[-1,2])
+    }
+  }
+
+  allpath.x[[length(allpath.x)+1]]=path.x
+  allpath.y[[length(allpath.y)+1]]=path.y
+  
+  allpath.y=lapply(allpath.y,"-")
+  
+
+  if (scalex) {
+    xmin = lmin(allpath.x)
+    sx=lmax(allpath.x)-xmin
+    allpath.x=lapply(allpath.x,function(x) (x-xmin)/sx)
+  }  
+  else
+    allpath.x=lapply(allpath.x,function(x) x/100)
+  
+  if (scaley) {
+    ymin = lmin(allpath.y)
+    sy=lmax(allpath.y)-ymin
+    allpath.y=lapply(allpath.y,function(x) (x-ymin)/sy)
+  }  
+  else
+    allpath.y=lapply(allpath.y,function(x) x/100)
+  
+  o = order(-sapply(allpath.x,length))
+  
+  return(list(x=allpath.x[o],y=allpath.y[o]))
+}
+
+#' Draw an empy plot without axis
+#' 
+#' The \code{whitepaper} function open a new plot of the given size where
+#' you can add graphical elements. Coordinates on this plot range from
+#' 0 to \code{width} and 0 to \code{height}.
+#' 
+#' @param width a numeric value indicating the plot width
+#' 
+#' @param height a numeric value indicating the plot height
+#' 
+#' @examples
+#' 
+#' # open a new empty plot
+#' whitepaper(20,10)
+#' 
+#' # add two point on this plot
+#' points(c(10,15),c(3,8))
+#' 
+#' @author Eric Coissac
+#' 
+#' @export
+whitepaper= function(width,height,xmin=0,ymin=0,asp=NA) {
+  plot(c(xmin,xmin+width),c(ymin,ymin+height),
+       xlab="",
+       ylab="",xaxt="n",yaxt="n",type="n",asp=asp)
+}
+
+
+#
+# We just prepare the polygon coordinates for all the 16 DNA letters
+#
+
+letter.polygons = list(A=path.to.polygon(svg.A.path),
+                       C=path.to.polygon(svg.C.path),
+                       G=path.to.polygon(svg.G.path),
+                       T=path.to.polygon(svg.T.path),
+                       R=path.to.polygon(svg.R.path),
+                       Y=path.to.polygon(svg.Y.path),
+                       M=path.to.polygon(svg.M.path),
+                       K=path.to.polygon(svg.K.path),
+                       W=path.to.polygon(svg.W.path),
+                       S=path.to.polygon(svg.S.path),
+                       B=path.to.polygon(svg.B.path),
+                       D=path.to.polygon(svg.D.path),
+                       H=path.to.polygon(svg.H.path),
+                       V=path.to.polygon(svg.V.path),
+                       N=path.to.polygon(svg.N.path),
+                       dash=path.to.polygon(svg.dash.path,scaley=FALSE)
+                      )
+
+
+#' Draw a single DNA letter on a plot
+#' 
+#' The function \code{plotDNAletter} draws a single DNA letter on an existing
+#' plot. The alphabet is restricted to the IUPAC DNA characters plus the dash
+#' '-' allowing to indicate gaps.
+#' 
+#' @param x    an  value indicating the x coordinate for locating the letter
+#'             on the plot.
+#'             
+#' @param y    an  value indicating the y coordinate for locating the letter
+#'             on the plot.
+#'             
+#' @param cex  the X character expension factor. By default a letter width is of
+#'             one unit in the user coordinate system.
+#'             
+#' @param cey  the Y character expension factor. By default a letter height is of
+#'             one unit in the user coordinate system.
+#'             
+#' @param col  the color used to fill the letter.
+#' 
+#' @param background  the background color of the letter.
+#' 
+#' @param border the color of the border of the letter.
+#' 
+#' @examples
+#' 
+#' # open an empty plot
+#' whitepaper(10,10)
+#' 
+#' # plot some DNA letters
+#' plotDNAletter(5,5,'A',col='green')
+#' plotDNAletter(7,6,'C',cex=2,cey=1.5,col='blue')
+#' plotDNAletter(2,3,'-')
+#' plotDNAletter(2,7,'A',col='green',background="yellow",border="black")
+#'             
+#' @seealso \code{\link{whitepaper}}
+#' @author Eric Coissac
+#' @export
+plotDNAletter = function(x,y,c,cex=1,cey=1,col="black",background="white",border=col) {
+  if (cex > 0 & cey > 0){
+    if (c=="-")
+      p=letter.polygons[['dash']]
+    else
+      p=letter.polygons[[c]]
+    
+    px = lapply(p$x,function(a) a*cex+x)
+    py = lapply(p$y,function(a) a*cey+y)
+    color=c(col,rep(background,length(px)-1))
+    border=c(border,rep(background,length(px)-1))
+    polygon(c(x,x,x+cex,x+cex),c(y,y+cey,y+cey,y),col=background,border=background)
+    mapply(polygon,px,py,col=color,border=border)
+  }
+}
+
+#' Draw a DNA logo on a graph
+#' 
+#' The function \code{dnalogo} draws a DNA logo on an already existing plot.
+#' 
+#' @param data a matrix where each line represents a symbol and each column 
+#'             represents a position. The values stored in the matrice indicate 
+#'             the relative weight of a symbol at the considered position.
+#'             
+#' @param x    an  value indicating the x coordinate for locating the logo
+#'             on the plot.
+#'             
+#' @param y    an  value indicating the y coordinate for locating the logo
+#'             on the plot.
+#'             
+#' @param width a value indicating the total width of the logo
+#' 
+#' @param height a value indicating the total height of the logo
+#' 
+#' @param col a named character vector (e.g \code{(A="purple",T="yellow")})
+#'            or a matrix of the same size than data indicating the color 
+#'            for each letter.
+#'            
+#' @param cex a float between 0 and 1 indicating the relative width 
+#'                    of a letter column.
+#'                    
+#'
+#' @examples
+#' # Load the sample ecoPCR data file
+#' data(GH.ecopcr)
+#' 
+#' # create a blank plot
+#' whitepaper(25,10)
+#' 
+#' # computes the logo shape with the shanon formula 
+#' G.shanon = ecopcr.forward.shanon(GH.ecopcr)
+#'
+#' # plot the logo
+#' dnalogo(G.shanon,2,6,width=20,height=2)
+#' 
+#' # computes the logo shape with the shanon formula
+#' # by grouping matches according to their mismatches
+#' G.shanon.error = ecopcr.forward.shanon(GH.ecopcr,
+#'                                        group=GH.ecopcr$forward_mismatch>=1)
+#'                                        
+#' # Display the structure
+#' G.shanon.error
+#' 
+#' # Plot the logo corresponding only to matches with errors
+#' dnalogo(G.shanon.error$'TRUE',2,3,width=20,height=2)
+#' 
+#' @seealso \code{\link{dnalogoplot}}
+#' @author Eric Coissac
+#' @keywords metabarcodes
+#' 
+#' @export
+dnalogo = function(data,x=0,y=0,width=NULL,height=NULL,col=NULL,cex=0.8)
+{
+  computey = function(p) {
+    o = draworder[,p]
+    x = c(0,cumsum(data[o,p])[2:length(o) - 1])
+    names(x)=letters[o]
+    return(x[letters])
+  }
+  
+  ddata = dim(data)
+  ncol = ddata[2]
+  nrow = ddata[1]
+  letters = row.names(data)
+  
+  
+  if (is.character(col) | is.null(col)) {
+    dnacol = c(A='green',C='blue',G='orange',T='red')
+    name.color = names(col)
+    dnacol[name.color]=col
+    dnacol=dnacol[letters]
+    dnacol=sapply(dnacol,function(x) do.call(rgb,as.list(col2rgb(x)/255)))
+    dnacol=matrix(rep(dnacol,ncol),nrow=nrow)
+  } 
+   
+  draworder = apply(data,2,order)
+  ypos = sapply(1:ncol,computey)
+  xpos = matrix(rep(1:ncol,rep(nrow,ncol)),nrow=4) - 0.5
+  
+  
+  if (! is.null(width)) {
+    actualwidth = ncol + 1
+    xpos = xpos / actualwidth * width
+    cex = cex / actualwidth * width
+  }
+  
+  if (! is.null(height)) {
+    actualheight= max(colSums(data))
+    ypos = ypos / actualheight * height
+    data = data / actualheight * height
+  }
+
+  if (! is.null(x)) 
+    xpos = xpos + x
+  
+  if (! is.null(y)) 
+    ypos = ypos + y
+  
+  hide = mapply(plotDNAletter,
+                as.vector(xpos),as.vector(ypos),
+                rep(letters,ncol),
+                cex,as.vector(data),
+                as.vector(dnacol))
+}
+
+#' Plot a DNA logo
+#' 
+#' The function \code{dnalogoplot} draws a DNA logo.
+#' 
+#' @param data a matrix where each line represents a symbol and each column 
+#'             represents a position. The values stored in the matrice indicate 
+#'             the relative weight of a symbol at the considered position.
+#'             
+#' @param col a named character vector (e.g \code{(A="purple",T="yellow")})
+#'            or a matrix of the same size than data indicating the color 
+#'            for each letter.
+#'            
+#' @param primer the primer sequence. THe letters will be used to label the
+#'               X axis.
+#'               
+#' @param xlab X axis label using font and character expansion 
+#'               par("font.lab") and color par("col.lab")
+#'               
+#' @param ylab Y axis label, same font attributes as xlab.
+#' 
+#' @param main The main title (on top) using font and size (character expansion) 
+#'             \code{par("font.main")} and color \code{par("col.main")}.
+#'             
+#' @param sub Sub-title (at bottom) using font and size \code{par("font.sub")} 
+#'            and color \code{par("col.sub")}.
+#'            
+#' @param line specifying a value for line overrides the default placement of 
+#'             labels, and places them this many lines outwards 
+#'             from the plot edge.
+#'             
+#' @param outer a logical value. If \code{TRUE}, the titles are placed in the outer 
+#'              margins of the plot.
+#'            
+#' @param cex a float between 0 and 1 indicating the relative width 
+#'                    of a letter column.
+#'                                  
+#' @param cex.primer a float between 0 and 1 indicating the size 
+#'               of the primer axis.
+#'                    
+#' @examples
+#' # Load the sample ecoPCR data file
+#' data(GH.ecopcr)
+#' 
+#' # computes the logo shape with the shanon formula 
+#' G.shanon = ecopcr.forward.shanon(GH.ecopcr)
+#' 
+#' par(mfrow=c(2,1))
+#' 
+#' # plot the logo
+#' dnalogoplot(G.shanon,primer="GGGCAATCCTGAGCCAA",
+#'             xlab="Primer H",ylab='bits',
+#'             main="Primer conservation")
+#' 
+#' # computes the logo shape with the shanon formula
+#' # by grouping matches according to their mismatches
+#' G.shanon.error = ecopcr.forward.shanon(GH.ecopcr,
+#'                                        group=GH.ecopcr$forward_mismatch>=1)
+#'                                        
+#' # Display the structure
+#' G.shanon.error
+#' 
+#' # Plot the logo corresponding only to matches with errors
+#' dnalogoplot(G.shanon.error$'TRUE',ylab='bits')
+#' 
+#' @seealso \code{\link{dnalogo}}
+#' @author Eric Coissac
+#' @keywords metabarcodes
+#' 
+#' @export
+dnalogoplot = function(data,col=NULL,primer=NULL,cex=0.8,cex.lab=1.0,xlab=NULL,ylab=NULL,main=NULL,sub=NULL,line=NA,outer=FALSE) {
+  ddata = dim(data)
+  ncol = ddata[2]
+  nrow = ddata[1]
+  actualwidth = ncol + 1
+  actualheight= max(colSums(data))
+
+  whitepaper(actualwidth,actualheight)
+  if (is.null(primer))
+    labels= TRUE
+  else
+    labels = strsplit(primer,"")[[1]]
+  axis(1,at=1:ncol,labels=labels,cex.axis=cex.lab)
+  axis(2)
+  title(main=main,sub=sub,xlab=xlab,ylab=ylab,line=line,outer=outer)
+  dnalogo(data,col=col,cex=cex)
+}
+
+
--- a/R/mismatchplot.R
+++ b/R/mismatchplot.R
@@ -0,0 +1,106 @@
+#'@include ROBIBarcodes.R
+#'@include logo.R
+NULL
+
+#' Draw a scatter plot of the reverse mismatches as a function of forward mismatches.
+#' 
+#' The \code{mismatchplot} function draws a scatter plot of the number of mismatches
+#' observed in an ecoPCR result for the reverse primer as a function of the mismatches
+#' for the reverse primer. Each point for a pair (forward_mismatch,reverse_mismatch) is
+#' drawn as a circle having a surface proportional to the aboundance of this pair in the
+#' results. If a grouping factor is specified, then the circle is replaced by a pie chart.
+#' 
+#' @param ecopcr an ecoPCR result data.frame as returned by the \code{\link{read.ecopcr.result}}
+#'               function. 
+#'               
+#' @param group  a factor decribing classes amongst the amplicon described in the ecoPCR
+#'               result
+#'               
+#' @param col    a vector describing the colored used for the bubble or the pie charts
+#' 
+#' @param legend a character vector describing the legend for each modality of the
+#'               grouping factor. By default the factor levels are used for the legend
+#'               
+#' @param legend.cex the expension factor for the legend text
+#' 
+#' @param inset  the distance to the margin of the legend box (see the \code{\link{legend}} 
+#'               documentation)
+#'               
+#' @examples
+#' 
+#' # Load the ROBITools library
+#' library(ROBITools)
+#' 
+#' # Load the default taxonomy
+#' taxo = default.taxonomy()
+#' 
+#' # Load the sample ecoPCR data file
+#' data(GH.ecopcr)
+#' 
+#' # Computes classes associated to each taxid 
+#' orders = as.factor(taxonatrank(taxo,GH.ecopcr$taxid,'order',name=T))
+#' 
+#' # Plot the graph
+#' mismatchplot(GH.ecopcr,group=orders)
+#' 
+#' @seealso \code{\link{read.ecopcr.result}}
+#' @author Eric Coissac
+#' @export
+mismatchplot = function(ecopcr,group=NULL,
+                        col=NULL,legend=NULL,
+                        legend.cex=0.7,inset=c(0.02,0.02)) {
+  
+  maxforward_error = max(ecopcr$forward_mismatch)
+  maxreverse_error = max(ecopcr$reverse_mismatch)
+  maxerror=max(maxforward_error,maxreverse_error)
+
+  if (is.null(group))
+    group=factor(rep("all",dim(ecopcr)[1]))
+  else
+    group=as.factor(group)
+  
+  if (is.null(legend))
+    legend = levels(group)
+  
+  actualheight= maxerror + 1
+  actualwidth = maxerror + 1
+  
+  if (length(levels(group)) > 1)
+    actualwidth = actualwidth + 2
+  
+  whitepaper(actualwidth,actualheight,xmin=-0.5,ymin=-0.5,asp=1)
+  
+  axis(1,at=0:maxerror,
+       labels=0:maxerror)
+  
+  axis(2,at=0:maxerror,
+       labels=0:maxerror)
+  
+  
+  data = aggregate(group,by=list(forward=ecopcr$forward_mismatch,
+                            reverse=ecopcr$reverse_mismatch),
+                   table)
+  
+  data <- data[rowSums(data[,c(-1,-2),drop=FALSE])>0, , drop=FALSE]
+  
+  if (is.null(col)) 
+    col <- c("white", "lightblue", "mistyrose", "lightcyan", 
+             "lavender", "cornsilk")
+  
+  
+  value=data[,c(-1,-2),drop=FALSE]
+  x = as.integer(data[,1])
+  y = as.integer(data[,2])
+  diam = sqrt(rowSums(value))
+  radius = diam / max(diam) / 2
+  
+  hide = mapply(pie.xy,x,y,
+                data=lapply(1:(dim(value)[1]),function(y) value[y,]),
+                radius=radius,
+                label="",MoreArgs=list(col=col))
+  
+  
+  if (length(levels(group)) > 1)
+    legend('topright',legend=legend,fill=col, cex=legend.cex, inset=inset)
+  
+}
--- a/R/piexy.R
+++ b/R/piexy.R
@@ -0,0 +1,68 @@
+#'@include ROBIBarcodes.R
+NULL
+
+#' @export
+pie.xy = function (x,y,data, labels = names(x), edges = 200, radius = 0.8, clockwise = FALSE, 
+          init.angle = if (clockwise) 90 else 0, density = NULL, angle = 45, 
+          col = NULL, border = NULL, lty = NULL, ...) 
+{
+  if (!is.numeric(data) || any(is.na(data) | data < 0)) 
+    stop("'data' values must be positive.")
+  if (is.null(labels)) 
+    labels <- as.character(seq_along(data))
+  else labels <- as.graphicsAnnot(labels)
+  data <- c(0, cumsum(data)/sum(data))
+  dx <- diff(data)
+  nx <- length(dx)
+#  plot.new()
+#  pin <- par("pin")
+  xlim <- ylim <- c(-1, 1)
+#   if (pin[1L] > pin[2L]) 
+#     xlim <- (pin[1L]/pin[2L]) * xlim
+#   else ylim <- (pin[2L]/pin[1L]) * ylim
+#  dev.hold()
+#  on.exit(dev.flush())
+#  plot.window(xlim, ylim, "", asp = 1)
+  if (is.null(col)) 
+    col <- if (is.null(density)) 
+      c("white", "lightblue", "mistyrose", "lightcyan", 
+        "lavender", "cornsilk")
+  else par("fg")
+  if (!is.null(col)) 
+    col <- rep_len(col, nx)
+  if (!is.null(border)) 
+    border <- rep_len(border, nx)
+  if (!is.null(lty)) 
+    lty <- rep_len(lty, nx)
+  angle <- rep(angle, nx)
+  if (!is.null(density)) 
+    density <- rep_len(density, nx)
+  twopi <- if (clockwise) 
+    -2 * pi
+  else 2 * pi
+  t2xy <- function(t) {
+    t2p <- twopi * t + init.angle * pi/180
+    list(x = radius * cos(t2p) , y = radius * sin(t2p))
+  }
+  for (i in 1L:nx) {
+    n <- max(2, floor(edges * dx[i]))
+    P <- t2xy(seq.int(data[i], data[i + 1], length.out = n))
+    if (nx>1)
+      polygon(c(P$x + x, x), c(P$y + y , y), 
+              density = density[i], angle = angle[i], 
+              border = border[i], col = col[i], lty = lty[i])
+    else
+      polygon(P$x + x, P$y + y, 
+              density = density[i], angle = angle[i], 
+              border = border[i], col = col[i], lty = lty[i])
+    P <- t2xy(mean(data[i + 0:1]))
+    lab <- as.character(labels[i])
+    if (!is.na(lab) && nzchar(lab)) {
+      lines(c(1 , 1.05) * P$x + x, c(1, 1.05) * P$y + y)
+      text(1.1 * P$x + x , 1.1 * P$y + y, labels[i], xpd = TRUE, 
+           adj = ifelse(P$x < 0, 1, 0), ...)
+    }
+  }
+#  title(main = main, ...)
+  invisible(NULL)
+}
--- a/R/primer_table.R
+++ b/R/primer_table.R
@@ -0,0 +1,57 @@
+#Commentaires lus par roxygen
+#'@include ROBIBarcodes.R
+#'@import XML
+#'
+NULL
+
+#NULL termine le commentaire pour roxygen
+
+extractPrimers <-function(primer){
+  
+  id=xmlAttrs(primer)["ID"]
+  name=xmlValue(xmlChildren(xmlChildren(primer)$name)$text)
+  sequence=xmlValue(xmlChildren(xmlChildren(primer)$sequence)$text)
+  coding=as.logical(xmlValue(xmlChildren(xmlChildren(primer)$coding)$text))
+  
+  p=list(id=id, name=name, sequence=sequence, coding=coding)
+  
+  return(p)
+}
+
+#Export pour rendre publique la fonction
+
+#' Builds primer data frame from metabarcodedb
+#' 
+#' The \code{primers.data.frame} function extracts all the primer information
+#' from the \code{metabarcodedb} database.
+#' 
+#' @param barcodedb a xml document containing a metabarcodedb.
+#' 
+#' @return a \code{data.frame} describing primers.
+#' 
+#' @examples
+#' # load the XML library
+#' library(XML)
+#' 
+#' # load the example metabarcodedb database
+#' db = xmlParseDoc(system.file("extdata/barcodedb.xml", package="ROBIBarcodes"))
+#' 
+#' # extracts the primer table
+#' primers.data.frame(db)
+#' 
+#' @author Aurelie Bonin
+#' @keywords metabarcodes
+#' 
+#' @export
+primers.data.frame <-function(barcodedb){
+  p=getNodeSet(db, 
+               path="/obi:obimetabarcodedb/obi:primers/obi:primer" , 
+               namespaces=c(obi="http://metabarcoding.org/OBIMetabarcodes"))
+
+  primerTable=as.data.frame(do.call(rbind,lapply(p,extractPrimers)))
+
+  rownames(primerTable)=primerTable$id
+  primerTable=primerTable[,-1]
+  
+  return(primerTable)
+}
--- a/R/primers.R
+++ b/R/primers.R
@@ -0,0 +1,18 @@
+#'@include xmlMods.R
+#'@import XML
+#'
+NULL
+
+
+add.primer.barcodedb = function(barcodedb,
+                               name,
+                               sequence,
+                               coding,
+                               documentation) {
+'  <primer ID="PR.XXX">
+    <name>Xxx</name>
+    <sequence>CGATCGATGCTAGCTAGCTGAT</sequence>
+    <coding>false</coding>
+    </primer>'
+  
+}
--- a/R/resolution.R
+++ b/R/resolution.R
@@ -0,0 +1,15 @@
+#'@import ROBITaxonomy
+#'@include ROBIBarcodes.R
+NULL
+
+
+#'@export
+resolution = function(taxonomy,ecopcr) {
+  l = aggregate(ecopcr$taxid,
+                by=list(barcode=ecopcr$sequence),
+                function(x) lowest.common.ancestor(taxo,x))
+  r = taxonomicrank(taxo,l$x)
+  names(r)=as.character(l$barcode)
+  
+  return(r[as.character(ecopcr$sequence)])
+}
--- a/R/taxonomy.R
+++ b/R/taxonomy.R
@@ -0,0 +1,81 @@
+#'@include xmlMods.R
+#'@import XML
+#'@import ROBITaxonomy
+#'@include ROBIBarcodes.R
+NULL
+
+
+taxon.data.frame  = function(taxonomy,taxids,strict=TRUE,known.taxid=c()) {
+  taxids = as.integer(sub("TX.","",as.character(taxids)))
+  good.taxid =  validate(taxonomy,taxids)
+  
+  if (strict & any(is.na(good.taxid))) 
+    stop(sprintf("The following taxids are absent from the taxonomy : %s",
+                 toString(taxids[is.na(good.taxid)])))
+  
+  good.taxid = good.taxid[! is.na(good.taxid)]
+  all.path   = path(taxonomy,good.taxid)
+  all.taxid  = Reduce(union,all.path)
+  all.taxid  = sort(union(all.taxid,known.taxid))[-1]
+  all.parent = sprintf("TX.%d",parent(taxonomy,all.taxid))
+  all.rank   = taxonomicrank(taxonomy,all.taxid)
+  all.scientificname = scientificname(taxonomy,all.taxid)
+  
+  all.id = sprintf("TX.%d",all.taxid)
+  
+  rep = data.frame(taxid=all.id,
+                   name=all.scientificname,
+                   rank=all.rank,
+                   partof=all.parent,
+                   stringsAsFactors=FALSE)
+  
+  return(rep)
+}
+
+build.taxon.node = function(taxid,name,rank,partof) {
+  nodes = lapply(sprintf('\n<taxon ID="%s"><name>%s</name><rank>%s</rank><partof>%s</partof></taxon>',
+                     taxid,
+                     name,
+                     rank,
+                     partof),
+                 xmlParseString)
+  
+  
+  return(nodes)
+  
+}
+
+#'@export
+add.taxon.barcodedb = function(barcodedb,
+                                   taxonomy,
+                                   taxids) {
+  
+  taxonomy.node = getNodeSet(barcodedb,
+                        path='/obi:obimetabarcodedb/obi:taxonomy',
+                        c(obi="http://metabarcoding.org/OBIMetabarcodes"))[[1]]
+  
+  known.taxid = as.character(
+                  getNodeSet(
+                    taxonomy.node,
+                    path="./obi:taxon/@ID",
+                    c(obi="http://metabarcoding.org/OBIMetabarcodes")))
+    
+  known.taxid = as.integer(sub("TX.","",known.taxid))
+  
+  taxon = taxon.data.frame(taxonomy,taxids,strict=TRUE,known.taxid)
+  
+  taxon.nodes = c(xmlChildren(taxonomy.node)$root,
+                  build.taxon.node(taxon$taxid,
+                                 taxon$name,
+                                 taxon$rank,
+                                 taxon$partof))
+  spare = sparexmltree()
+  new.taxonomy.node =  getNodeSet(spare,
+                                  path='/obi:obimetabarcodedb/obi:taxonomy',
+                                  c(obi="http://metabarcoding.org/OBIMetabarcodes"))[[1]]
+  
+  replaceNodes(taxonomy.node,new.taxonomy.node)
+  
+  hidden = addChildren(new.taxonomy.node,kids=taxon.nodes,append=FALSE)
+}
+
--- a/R/taxonomy_table.R
+++ b/R/taxonomy_table.R
@@ -0,0 +1,97 @@
+#' @include ROBIBarcodes.R
+#' @import  ROBITaxonomy
+#' @import XML
+#' @useDynLib ROBIBarcodes
+#'
+NULL
+
+
+extractTaxa <-function(taxon){
+  
+  id=xmlAttrs(taxon)["ID"]
+  name=xmlValue(xmlChildren(xmlChildren(taxon)$name)$text)
+  rank=xmlValue(xmlChildren(xmlChildren(taxon)$rank)$text)
+  partof=xmlValue(xmlChildren(xmlChildren(taxon)$partof)$text)
+  
+  p=list(id=id, name=name, rank=rank, partof=partof)
+  
+  return(p)
+}
+
+#' Builds taxa data frame from metabarcodedb
+#' 
+#' The \code{taxonomy.data.frame} function extracts all the taxon information
+#' from the \code{metabarcodedb} database.
+#' 
+#' @param barcodedb a xml document containing a metabarcodedb.
+#' 
+#' @return a \code{data.frame} describing taxa.
+#' 
+#' @examples
+#' # load the XML library
+#' library(XML)
+#' 
+#' # load the example metabarcodedb database
+#' db = xmlParseDoc(system.file("extdata/barcodedb.xml", package="ROBIBarcodes"))
+#' 
+#' # extracts the taxonomy table
+#' taxonomy.data.frame(db)
+#' 
+#' @author Eric Coissac
+#' @keywords metabarcodes
+#' 
+#' @export
+taxonomy.data.frame = function(barcodedb) {
+  p=getNodeSet(db, 
+               path="/obi:obimetabarcodedb/obi:taxonomy/obi:taxon" , 
+               namespaces=c(obi="http://metabarcoding.org/OBIMetabarcodes"))
+  
+  taxonomyTable=as.data.frame(do.call(rbind,lapply(p,extractTaxa)))
+  
+  
+  rownames(taxonomyTable)=unlist(taxonomyTable$id)
+  taxonomyTable=taxonomyTable[,-1]
+  
+  taxonomyTable$name=unlist(taxonomyTable$name)
+  taxonomyTable$rank=unlist(taxonomyTable$rank)
+  taxonomyTable$partof=unlist(taxonomyTable$partof)
+
+  return(taxonomyTable)
+  
+}
+
+#' Builds a \code{taxonomy.obitools} from a metabarcodedb
+#' 
+#' The \code{metabarcodedb.taxonomy} function extracts all the taxon information
+#' from the \code{metabarcodedb} database and create a \code{taxonomy.obitools}
+#' instance with them.
+#' 
+#' @param barcodedb a xml document containing a metabarcodedb.
+#' 
+#' @return a \code{taxonomy.obitools} instance.
+#' 
+#' @examples
+#' # load the XML library
+#' library(XML)
+#' 
+#' # load the example metabarcodedb database
+#' db = xmlParseDoc(system.file("extdata/barcodedb.xml", package="ROBIBarcodes"))
+#' 
+#' # extracts the taxonomy table
+#' barcodetaxo = metabarcodedb.taxonomy(db)
+#' 
+#' # Look for the Verbrata taxid 
+#' ecofind(barcodetaxo,"vertebrata")
+#' 
+#' @author Eric Coissac
+#' @keywords metabarcodes
+#' 
+#' @export
+metabarcodedb.taxonomy = function(barcodedb) {
+  
+  table = taxonomy.data.frame(barcodedb)
+  
+  t <- .Call('R_buildbarcodetaxo',table,TRUE,PACKAGE="ROBIBarcodes")	
+  
+  return(ROBITools:::build.taxonomy.obitools(t,"barcodedb",getwd(),FALSE))
+}
--- a/R/xmlMods.R
+++ b/R/xmlMods.R
@@ -0,0 +1,88 @@
+#'@include ROBIBarcodes.R
+#'@import XML
+#'
+NULL
+
+
+#
+# Checks that bibutils is installed on the system
+#
+hasBibUtils = !system("bib2xml -h",
+                       intern=FALSE,
+                       ignore.stdout = TRUE, 
+                       ignore.stderr = TRUE)
+
+if (!hasBibUtils) {
+  message("\n============================================================\n",
+          "Bibutils are not installed on your system\n",
+          "or is not correctly setup\n",
+          "Consider to visit: http://sourceforge.net/projects/bibutils/\n",
+          "============================================================\n")
+}
+
+
+#'Qualify the elements of the `mods` elements with the \code{mods:} namespace.
+#'
+#' The \code{bibutils} programs generate XML file not qualified by a schema.
+#' To respect the OBIBarcodes schema the mods elements must be qualified.
+#' This function take a XML document produce by a \code{bibutils} program and
+#' add the \code{mods:} namespace.
+#' 
+#' @note This function modifies the document past in argument and returns 
+#'       nothing
+#'
+#' @note This is an internal function and consequently has not to be called by
+#'       end users. 
+#'       
+#' @param   modsdoc a XMLInternalDocument instance corresponding to a 
+#'                  modsCollectionDefinition element.
+#'                  
+#' @export
+addmodsnamespace = function(modsdoc) {
+  
+  root = xmlRoot(modsdoc)
+  xmlNamespaces(root,set=TRUE)=c(mods="http://www.loc.gov/mods/v3")
+  hiden=xpathApply(modsdoc,
+                   path='/.//*',
+                   fun= function(n) xmlNamespace(n,set=TRUE)="mods")
+
+}
+
+patchmodsID = function(modsdoc) {
+  hiden= xpathApply(modsdoc,'/.//*[attribute::ID]',
+                    function(n) xmlAttrs(n)=list(ID=paste('BI.',
+                                                  toupper(gsub('[^A-Za-z0-9_]',
+                                                               '_',
+                                                               xmlAttrs(n)['ID']
+                                                               )
+                                                          ),
+                                                          sep=""
+                                                  ))
+                   )
+}
+
+#'@export
+bib2mods = function(bibfile,bibutils='bib2xml') {
+  
+  tmp=tempfile()
+  xmlerr=system(paste(bibutils,bibfile,'>',tmp,sep=' '),
+                intern=FALSE,
+                ignore.stderr=TRUE)
+  
+  if (xmlerr!=0)
+    stop(paste("Cannot run ",bibutils))
+  xml = paste(tmp,collapse='\n')
+  xml = xmlParseDoc(tmp,asText=FALSE)
+  file.remove(tmp)
+  addmodsnamespace(xml)
+  patchmodsID(xml)
+  mods=getNodeSet(xml,'/.//mods:mods[attribute::ID]')
+  
+  return(mods)
+}
+
+if (!hasBibUtils) {
+  bib2mods = function(bibfile,bibutils) {  
+    stop("Bibutils not install visit: http://sourceforge.net/projects/bibutils/")
+  }
+}
--- a/R/xmlspare.R
+++ b/R/xmlspare.R
@@ -0,0 +1,23 @@
+#'@include ROBIBarcodes.R
+#'@import XML
+#'
+NULL
+
+.__spare_tree__ = NULL
+
+sparexmltree = function() {
+  
+  if (is.null(get(".__spare_tree__",envir = environment()))) {
+  
+    sparefile = paste(system.file("extdata", 
+                                  package="ROBIBarcodes"),
+                      'spare.xml',
+                      sep='/')
+    
+    spare = xmlParseDoc(sparefile)
+    
+    assign(".__spare_tree__",spare, envir=globalenv())
+  }
+  
+  return(get(".__spare_tree__",envir = globalenv()))
+}
--- a/ROBIBarcodes.Rproj
+++ b/ROBIBarcodes.Rproj
@@ -0,0 +1,17 @@
+Version: 1.0
+
+RestoreWorkspace: Default
+SaveWorkspace: Default
+AlwaysSaveHistory: Default
+
+EnableCodeIndexing: Yes
+UseSpacesForTab: Yes
+NumSpacesForTab: 2
+Encoding: LATIN1
+
+RnwWeave: Sweave
+LaTeX: pdfLaTeX
+
+BuildType: Package
+PackageInstallArgs: --no-multiarch
+PackageRoxygenize: rd,collate,namespace
--- a/data/GH.ecopcr.rda
+++ b/data/GH.ecopcr.rda
--- a/inst/extdata/OBIMetabarcodes.xsd
+++ b/inst/extdata/OBIMetabarcodes.xsd
@@ -0,0 +1,565 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<?xml-stylesheet type="text/xsl" href="xs3p.xsl"?>
+
+<!-- 
+    
+    The OBIMetabarcode schema
+
+
+ -->
+
+<xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema"
+	targetNamespace="http://metabarcoding.org/OBIMetabarcodes" xmlns:tns="http://metabarcoding.org/OBIMetabarcodes"
+	elementFormDefault="qualified" xmlns:mods="http://www.loc.gov/mods/v3">
+
+
+    <!-- ************************************************************* 
+    
+        We import the MODS schema which define the model
+        for bibliographic references produced by the library
+        of congress
+        
+        http://www.loc.gov/standards/mods/
+        
+        You can also check the CSL schema which can be use
+        for declaring way to present bibliography references
+        
+        http://citationstyles.org
+    
+      ************************************************************* -->
+
+	<xs:import namespace="http://www.loc.gov/mods/v3"
+		schemaLocation="mods-3-5.xsd" />
+		
+    <!-- ************************************************************* 
+	
+	    Declaration of the simple types
+	    
+      ************************************************************* -->
+     
+     <!-- documentation_t : subclass of xs:string for documentation elememts -->
+
+	<xs:simpleType name="documentation_t">
+        <xs:annotation>
+        	<xs:documentation>The documentation_t type is a string of characters allowing to document an instance in the database.</xs:documentation>
+        </xs:annotation>
+        <xs:restriction base="xs:string"></xs:restriction>
+	</xs:simpleType>
+
+     <!-- organelle_t : subclass of xs:string for documentation elememts -->
+
+	<xs:simpleType name="organelle_t">
+		<xs:annotation>
+			<xs:documentation>
+				The organelle_t type allows to specify a value
+				indicating on which organelle is located another element
+			</xs:documentation>
+		</xs:annotation>
+		<xs:restriction base="xs:string">
+			<xs:enumeration value="nucleus">
+				<xs:annotation>
+					<xs:documentation>
+						Indicates that the marker corresponds to a locus
+						belonging the nuclear genome
+					</xs:documentation>
+				</xs:annotation>
+			</xs:enumeration>
+			<xs:enumeration value="chloroplast">
+				<xs:annotation>
+					<xs:documentation>
+						Indicates that the marker corresponds to a locus
+						belonging the chloroplastic genome
+					</xs:documentation>
+				</xs:annotation>
+			</xs:enumeration>
+			<xs:enumeration value="mitochondria">
+				<xs:annotation>
+					<xs:documentation>
+						Indicates that the marker corresponds to a locus
+						belonging the mitochondrial genome
+					</xs:documentation>
+				</xs:annotation>
+			</xs:enumeration>
+		</xs:restriction>
+	</xs:simpleType>
+
+     <!-- identifier_t : subclass of xs:string for identifier -->
+     <!-- and its subclasses for each type of identifiers -->
+
+    <xs:simpleType name="identifier_t">
+        <xs:restriction base="xs:string">
+            <xs:pattern value="[A-Z]{2}\.[A-Z0-9_]+"></xs:pattern>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="locusid_t">
+        <xs:restriction base="tns:identifier_t">
+            <xs:pattern value="LO\..+"></xs:pattern>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="primerid_t">
+        <xs:restriction base="tns:identifier_t">
+            <xs:pattern value="PR\..+"></xs:pattern>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="biblioid_t">
+        <xs:restriction base="tns:identifier_t">
+            <xs:pattern value="BI\..+"></xs:pattern>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="taxid_t">
+        <xs:restriction base="tns:identifier_t">
+            <xs:pattern value="TX\.[0-9]+"></xs:pattern>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="metabarcodeid_t">
+        <xs:restriction base="tns:identifier_t">
+            <xs:pattern value="MB\..+"></xs:pattern>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="roottaxid_t">
+        <xs:restriction base="tns:taxid_t">
+            <xs:pattern value="TX\.1"></xs:pattern>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="rank_t">
+        <xs:restriction base="xs:string">
+            <xs:enumeration value="class"></xs:enumeration>
+            <xs:enumeration value="family"></xs:enumeration>
+            <xs:enumeration value="forma"></xs:enumeration>
+            <xs:enumeration value="genus"></xs:enumeration>
+            <xs:enumeration value="infraclass"></xs:enumeration>
+            <xs:enumeration value="infraorder"></xs:enumeration>
+            <xs:enumeration value="kingdom"></xs:enumeration>
+            <xs:enumeration value="no rank"></xs:enumeration>
+            <xs:enumeration value="order"></xs:enumeration>
+            <xs:enumeration value="parvorder"></xs:enumeration>
+            <xs:enumeration value="phylum"></xs:enumeration>
+            <xs:enumeration value="species"></xs:enumeration>
+            <xs:enumeration value="[species group"></xs:enumeration>
+            <xs:enumeration value="species subgroup"></xs:enumeration>
+            <xs:enumeration value="subclass"></xs:enumeration>
+            <xs:enumeration value="subfamily"></xs:enumeration>
+            <xs:enumeration value="subgenus"></xs:enumeration>
+            <xs:enumeration value="subkingdom"></xs:enumeration>
+            <xs:enumeration value="suborder"></xs:enumeration>
+            <xs:enumeration value="subphylum"></xs:enumeration>
+            <xs:enumeration value="subspecies"></xs:enumeration>
+            <xs:enumeration value="subtribe"></xs:enumeration>
+            <xs:enumeration value="superclass"></xs:enumeration>
+            <xs:enumeration value="superfamily"></xs:enumeration>
+            <xs:enumeration value="superkingdom"></xs:enumeration>
+            <xs:enumeration value="superorder"></xs:enumeration>
+            <xs:enumeration value="superphylum"></xs:enumeration>
+            <xs:enumeration value="tribe"></xs:enumeration>
+            <xs:enumeration value="varietas"></xs:enumeration>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="rootrank_t">
+        <xs:restriction base="tns:rank_t">
+            <xs:enumeration value="no rank"></xs:enumeration>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <xs:simpleType name="iupac_t">
+        <xs:annotation>
+            <xs:documentation>
+                The iupc_t type is a string of characters symbolizing
+                nucleotides in the iupac system, and thus belonging to
+                the folowing list of letters:
+                A,C,G,T,U,R,Y,M,K,W,S,B,D,H,V,N. The type also contrains
+                the sequence to be written in upper cases.
+            </xs:documentation>
+        </xs:annotation>
+        <xs:restriction base="xs:string">
+            <xs:pattern value="[ACGTRYMKWSBDHVN]+"></xs:pattern>
+            <xs:minLength value="15"></xs:minLength>
+            <xs:whiteSpace value="collapse"></xs:whiteSpace>
+        </xs:restriction>
+    </xs:simpleType>
+
+    <!-- ************************************************************* 
+    
+        Declaration of the complex types
+        
+      ************************************************************* -->
+     
+     <!-- obimetabarcodedb_t : the main type of the schema -->
+     
+	<xs:complexType name="obimetabarcodedb_t">
+		<xs:sequence>
+			<xs:element name="metadata" type="tns:metadata_t"
+				maxOccurs="1" minOccurs="1">
+			</xs:element>
+			<xs:element name="taxonomy" type="tns:taxa_t" maxOccurs="1" minOccurs="1"></xs:element>
+			<xs:element name="primers" type="tns:primers_t"
+				maxOccurs="1" minOccurs="1">
+			</xs:element>
+			<xs:element name="metabarcodes" type="tns:metabarcodes_t"
+				maxOccurs="1" minOccurs="1">
+			</xs:element>
+			<xs:element name="bibliography"
+				type="mods:modsCollectionDefinition" maxOccurs="1" minOccurs="0">
+			</xs:element>
+		</xs:sequence>
+	</xs:complexType>
+
+     <!-- metadata_t : contains the metadata related to the database -->
+
+	<xs:complexType name="metadata_t">
+		<xs:sequence>
+			<xs:element name="loci" type="tns:loci_t" maxOccurs="1"
+				minOccurs="1"></xs:element>
+		</xs:sequence>
+	</xs:complexType>
+
+     <!-- The metabarcode descriptions by themselves -->
+
+	<xs:complexType name="metabarcodes_t">
+		<xs:sequence>
+			<xs:element name="metabarcode" type="tns:metabarcode_t"
+				maxOccurs="unbounded" minOccurs="0">
+				
+			             <!-- insure that the same primer is not used twice -->
+                
+                <xs:unique name="uniqbarcodeprimer">
+                    <xs:selector xpath="tns:forward|tns:reverse" />
+                    <xs:field xpath="." />
+                </xs:unique>    
+			
+			</xs:element>
+		</xs:sequence>
+	</xs:complexType>
+
+	<xs:complexType name="metabarcode_t">
+		<xs:sequence>
+
+
+			<xs:element name="name" type="xs:string" maxOccurs="1"
+				minOccurs="1">
+			</xs:element>
+
+			<xs:element name="locus" type="tns:locusid_t" maxOccurs="1"
+				minOccurs="1">
+			</xs:element>
+
+			<xs:element name="forward" type="tns:primerid_t"
+				maxOccurs="unbounded" minOccurs="1">
+			</xs:element>
+
+			<xs:element name="reverse" type="tns:primerid_t"
+				maxOccurs="unbounded" minOccurs="1">
+			</xs:element>
+
+			<xs:element name="targettaxon" type="tns:taxid_t"
+				maxOccurs="unbounded" minOccurs="1">
+			</xs:element>
+
+			<xs:element name="excludedtaxon" type="tns:taxid_t"
+				maxOccurs="unbounded" minOccurs="0">
+			</xs:element>
+
+            <xs:element name="targetlength" type="tns:interval_t" maxOccurs="1" minOccurs="0"></xs:element>
+            <xs:element name="documentation" type="tns:documentation_t"
+				maxOccurs="1" minOccurs="0">
+			</xs:element>
+
+			<xs:element name="references" type="tns:references_t"
+				maxOccurs="1" minOccurs="0">
+
+				<!-- insure that the same bibliographic reference is not used twice -->
+
+				<xs:unique name="uniqbarcodereference">
+					<xs:selector xpath="tns:describedin|tns:usedin" />
+					<xs:field xpath="@biblioid" />
+				</xs:unique>
+
+			</xs:element>
+
+		</xs:sequence>
+
+		<xs:attribute name="ID" type="tns:metabarcodeid_t" use="required"></xs:attribute>
+
+	</xs:complexType>  <!-- end of metabarcode_t -->
+
+
+
+	<xs:complexType name="loci_t">
+		<xs:sequence>
+			<xs:element name="abstractlocus" type="tns:abstractlocus_t"
+				maxOccurs="unbounded" minOccurs="0">
+			</xs:element>
+			<xs:element name="locus" type="tns:locus_t" maxOccurs="unbounded" minOccurs="0"></xs:element>
+		</xs:sequence>
+	</xs:complexType>
+
+	<xs:complexType name="locus_t">
+		<xs:complexContent>
+			<xs:extension base="tns:abstractlocus_t">
+				<xs:sequence>
+					<xs:element name="organelle" type="tns:organelle_t" maxOccurs="1" minOccurs="1"></xs:element>
+				</xs:sequence>
+			</xs:extension>
+		</xs:complexContent>
+	</xs:complexType>
+
+
+
+	<xs:complexType name="primers_t">
+        <xs:annotation>
+        	<xs:documentation>The primers_t type gathers several (usually two) primer_t elements</xs:documentation>
+        </xs:annotation>
+		<xs:sequence>
+			<xs:element name="primer" type="tns:primer_t" maxOccurs="unbounded"
+				minOccurs="0">
+			</xs:element>
+		</xs:sequence>
+	</xs:complexType>
+
+	<xs:complexType name="primer_t">
+        <xs:annotation>
+        	<xs:documentation>
+        	This type describes a PCR primer. 
+            It has a mandatory attribut "name" containing a unique identifier.
+            Primer is described by ...
+            The primer_t type has an attribute name specifying its name, 
+            and includes a sequence element specifying its nucleotide sequence.
+            </xs:documentation>
+        </xs:annotation>
+        <xs:sequence>
+        	<xs:element name="name" type="xs:string" maxOccurs="1"
+        		minOccurs="1">
+        	</xs:element>
+        	<xs:element name="sequence" type="tns:iupac_t" maxOccurs="1"
+        		minOccurs="1">
+        		<xs:annotation>
+        			<xs:documentation>
+        				The nucleic sequence of the primer. The primer
+        				length must be greater than 15bp
+        			</xs:documentation>
+        		</xs:annotation>
+        	</xs:element>
+        	<xs:element name="coding" type="xs:boolean" maxOccurs="1"
+        		minOccurs="1">
+        	</xs:element>
+        	<xs:element name="documentation" type="tns:documentation_t"
+        		maxOccurs="1" minOccurs="0">
+        	</xs:element>
+        </xs:sequence>
+        <xs:attribute name="ID" type="tns:primerid_t" use="required">
+			<xs:annotation>
+				<xs:documentation>The name of the primer</xs:documentation>
+			</xs:annotation>
+		</xs:attribute>
+	</xs:complexType>
+
+	<xs:complexType name="references_t">
+		<xs:sequence>
+			<xs:element name="describedin" type="tns:reference_t"
+				maxOccurs="1" minOccurs="0">
+			</xs:element>
+			<xs:element name="usedin" type="tns:reference_t"
+				maxOccurs="unbounded" minOccurs="0"></xs:element>
+		</xs:sequence>
+	</xs:complexType>
+
+
+	<xs:complexType name="reference_t">
+		<xs:simpleContent>
+			<xs:extension base="tns:documentation_t">
+				<xs:attribute name="biblioid" type="tns:biblioid_t"></xs:attribute>
+			</xs:extension>
+		</xs:simpleContent>
+	</xs:complexType>
+
+    <xs:complexType name="taxa_t">
+        <xs:sequence>
+            <xs:element name="root" type="tns:roottaxon_t" maxOccurs="1" minOccurs="1"></xs:element>
+            <xs:element name="taxon" type="tns:taxon_t" maxOccurs="unbounded" minOccurs="0"></xs:element>
+        </xs:sequence>
+    </xs:complexType>
+    
+    <xs:complexType name="abstracttaxon_t" abstract="true">
+        <xs:sequence>
+            <xs:element name="name" type="xs:string"></xs:element>
+            <xs:element name="rank" type="tns:rank_t"></xs:element>
+        </xs:sequence>
+        <xs:attribute name="ID" type="tns:taxid_t"></xs:attribute>
+    </xs:complexType>
+
+    <xs:complexType name="taxon_t">
+        <xs:complexContent>
+            <xs:extension base="tns:abstracttaxon_t">
+                <xs:sequence>
+                    <xs:element name="partof" type="tns:taxid_t"></xs:element>
+                </xs:sequence>
+            </xs:extension>
+        </xs:complexContent>
+    </xs:complexType>
+
+    <xs:complexType name="roottaxon_t">
+        <xs:complexContent>
+            <xs:restriction base="tns:abstracttaxon_t">
+                <xs:sequence>
+                    <xs:element name="name">
+                        <xs:simpleType>
+                            <xs:restriction base="xs:string">
+                                <xs:pattern value="Root"></xs:pattern>
+                            </xs:restriction>
+                        </xs:simpleType>
+                    </xs:element>
+                    <xs:element name="rank" type="tns:rootrank_t"></xs:element>
+                </xs:sequence>
+                <xs:attribute name="ID" type="tns:roottaxid_t"></xs:attribute>
+            </xs:restriction>
+        </xs:complexContent>
+    </xs:complexType>
+    
+
+
+	<!-- The root xs:element of the library -->
+
+	<xs:element name="obimetabarcodedb" type="tns:obimetabarcodedb_t">
+
+		<!-- Unicity constraints -->
+
+		<xs:unique name="uniqprimer">
+			<xs:selector xpath="./tns:primers/tns:primer" />
+			<xs:field xpath="tns:sequence" />
+		</xs:unique>
+
+
+		<!-- Primary key constraints -->
+
+		<xs:key name="barcodeid">
+			<xs:selector xpath="./tns:metabarcodes/tns:metabarcode" />
+			<xs:field xpath="@ID" />
+		</xs:key>
+
+		<xs:key name="abstractlocusid">
+			<xs:selector xpath="./tns:metadata/tns:loci/tns:abstractlocus|./tns:metadata/tns:loci/tns:locus" />
+			<xs:field xpath="@ID" />
+		</xs:key>
+
+        <xs:key name="locusid">
+            <xs:selector xpath="./tns:metadata/tns:loci/tns:locus" />
+            <xs:field xpath="@ID" />
+        </xs:key>
+
+		<xs:key name="primerid">
+			<xs:selector xpath="./tns:primers/tns:primer" />
+			<xs:field xpath="@ID" />
+		</xs:key>
+
+		<xs:key name="biblioid">
+			<xs:selector xpath="./tns:bibliography/mods:mods" />
+			<xs:field xpath="@ID" />
+		</xs:key>
+
+        <xs:key name="roottaxid">
+            <xs:selector xpath="./tns:taxonomy/tns:taxon|./tns:taxonomy/tns:root" />
+            <xs:field xpath="@ID" />
+        </xs:key>
+
+        <xs:key name="taxid">
+            <xs:selector xpath="./tns:taxonomy/tns:taxon" />
+            <xs:field xpath="@ID" />
+        </xs:key>
+
+
+
+		<!-- Foreign key constaints -->
+
+		<!-- Constraint on forward and reverse primers -->
+
+		<xs:keyref name="forward_ref" refer="tns:primerid">
+			<xs:selector xpath="./tns:metabarcodes/tns:metabarcode"></xs:selector>
+			<xs:field xpath="tns:forward"></xs:field>
+		</xs:keyref>
+
+		<xs:keyref name="reverse_ref" refer="tns:primerid">
+			<xs:selector xpath="./tns:metabarcodes/tns:metabarcode"></xs:selector>
+			<xs:field xpath="tns:reverse"></xs:field>
+		</xs:keyref>
+
+        <xs:keyref name="target_ref" refer="tns:taxid">
+            <xs:selector xpath="./tns:metabarcodes/tns:metabarcode"></xs:selector>
+            <xs:field xpath="tns:targettaxon"></xs:field>
+        </xs:keyref>
+
+        <xs:keyref name="excluded_ref" refer="tns:taxid">
+            <xs:selector xpath="./tns:metabarcodes/tns:metabarcode"></xs:selector>
+            <xs:field xpath="tns:excludedtaxon"></xs:field>
+        </xs:keyref>
+
+		<xs:keyref name="describedin_ref" refer="tns:biblioid">
+			<xs:selector
+				xpath="./tns:metabarcodes/tns:metabarcode/tns:references/tns:describedin"></xs:selector>
+			<xs:field xpath="@biblioid"></xs:field>
+		</xs:keyref>
+
+		<xs:keyref name="usedin_ref" refer="tns:biblioid">
+			<xs:selector
+				xpath="./tns:metabarcodes/tns:metabarcode/tns:references/tns:usedin"></xs:selector>
+			<xs:field xpath="@biblioid"></xs:field>
+		</xs:keyref>
+
+        <xs:keyref name="partof_ref" refer="tns:abstractlocusid">
+            <xs:selector
+                xpath="./tns:metadata/tns:loci/tns:abstractlocus|./tns:metadata/tns:loci/tns:locus"></xs:selector>
+            <xs:field xpath="tns:partof"></xs:field>
+        </xs:keyref>
+
+        <xs:keyref name="barcodelocus_ref" refer="tns:locusid">
+            <xs:selector
+                xpath="./tns:metabarcodes/tns:metabarcode"></xs:selector>
+            <xs:field xpath="tns:locus"></xs:field>
+        </xs:keyref>
+
+        <xs:keyref name="taxopartof_ref" refer="tns:roottaxid">
+            <xs:selector xpath="./tns:metabarcodes/tns:taxonomy/tns:taxon"></xs:selector>
+            <xs:field xpath="@ID"></xs:field>
+        </xs:keyref>
+
+	</xs:element>
+
+    <!-- ************************************************************* 
+    
+        Declaration of the root element of the document
+        
+      ************************************************************* -->
+
+    <xs:complexType name="abstractlocus_t">
+        <xs:sequence>
+            <xs:element name="name" type="xs:string" maxOccurs="1" minOccurs="1"></xs:element>
+            <xs:element name="partof" type="tns:locusid_t" maxOccurs="1"
+                minOccurs="0">
+            </xs:element>
+            <xs:element name="documentation" type="tns:documentation_t"
+                maxOccurs="1" minOccurs="0">
+            </xs:element>
+        </xs:sequence>
+        <xs:attribute name="ID" type="tns:locusid_t" use="required"></xs:attribute>
+    </xs:complexType>
+
+
+    <xs:complexType name="computedproperties_t">
+    </xs:complexType>
+
+    <xs:complexType name="computedproperty_t"></xs:complexType>
+
+
+    <xs:complexType name="interval_t">
+    	<xs:sequence>
+    		<xs:element name="min" type="xs:positiveInteger" maxOccurs="1" minOccurs="1"></xs:element>
+    		<xs:element name="max" type="xs:positiveInteger" maxOccurs="1" minOccurs="1"></xs:element>
+    	</xs:sequence>
+    </xs:complexType>
+</xs:schema>
--- a/inst/extdata/barcodedb.xml
+++ b/inst/extdata/barcodedb.xml
@@ -0,0 +1,730 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<obimetabarcodedb xmlns="http://metabarcoding.org/OBIMetabarcodes" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:mods="http://www.loc.gov/mods/v3" xsi:schemaLocation="http://metabarcoding.org/OBIMetabarcodes OBIMetabarcodes.xsd">
+	<metadata>
+		<loci>
+			<abstractlocus ID="LO.RRNA">
+				<name>mRNA</name>
+			</abstractlocus>
+			<abstractlocus ID="LO.MRRNA">
+				<name>Mitochondrial mRNA</name>
+				<partof>LO.RRNA</partof>
+			</abstractlocus>
+			<abstractlocus ID="LO.ITS">
+				<name>Internal Transcribed Spacer (ITS)</name>
+			</abstractlocus>
+			<locus ID="LO.M16SRRNA">
+				<name>16S rRNA</name>
+				<partof>LO.MRRNA</partof>
+				<organelle>mitochondria</organelle>
+			</locus>
+			<locus ID="LO.M12SRRNA">
+				<name>12S rRNA</name>
+				<partof>LO.MRRNA</partof>
+				<organelle>mitochondria</organelle>
+			</locus>
+			<locus ID="LO.P6_LOOP">
+				<name>P6-Loop trnL</name>
+				<organelle>chloroplast</organelle>
+			</locus>
+			<locus ID="LO.ITS1">
+				<name>ITS1</name>
+				<partof>LO.ITS</partof>
+				<organelle>nucleus</organelle>
+			</locus>
+		</loci>
+	</metadata>
+	<taxonomy>
+    <root ID="TX.1">
+			<name>Root</name>
+			<rank>no rank</rank>
+		</root><taxon ID="TX.2759"><name>Eukaryota</name><rank>superkingdom</rank><partof>TX.131567</partof></taxon><taxon ID="TX.3193"><name>Embryophyta</name><rank>no rank</rank><partof>TX.131221</partof></taxon><taxon ID="TX.3208"><name>Bryophyta</name><rank>no rank</rank><partof>TX.3193</partof></taxon><taxon ID="TX.4751"><name>Fungi</name><rank>kingdom</rank><partof>TX.33154</partof></taxon><taxon ID="TX.6072"><name>Eumetazoa</name><rank>no rank</rank><partof>TX.33208</partof></taxon><taxon ID="TX.6340"><name>Annelida</name><rank>phylum</rank><partof>TX.193545</partof></taxon><taxon ID="TX.6381"><name>Oligochaeta</name><rank>subclass</rank><partof>TX.42113</partof></taxon><taxon ID="TX.6382"><name>Haplotaxida</name><rank>order</rank><partof>TX.6381</partof></taxon><taxon ID="TX.6383"><name>Tubificina</name><rank>suborder</rank><partof>TX.6382</partof></taxon><taxon ID="TX.6388"><name>Enchytraeidae</name><rank>family</rank><partof>TX.6383</partof></taxon><taxon ID="TX.6656"><name>Arthropoda</name><rank>phylum</rank><partof>TX.88770</partof></taxon><taxon ID="TX.6960"><name>Hexapoda</name><rank>superclass</rank><partof>TX.197562</partof></taxon><taxon ID="TX.7041"><name>Coleoptera</name><rank>order</rank><partof>TX.33392</partof></taxon><taxon ID="TX.7496"><name>Pterygota</name><rank>no rank</rank><partof>TX.85512</partof></taxon><taxon ID="TX.7711"><name>Chordata</name><rank>phylum</rank><partof>TX.33511</partof></taxon><taxon ID="TX.7742"><name>Vertebrata</name><rank>no rank</rank><partof>TX.89593</partof></taxon><taxon ID="TX.7776"><name>Gnathostomata</name><rank>superclass</rank><partof>TX.7742</partof></taxon><taxon ID="TX.8287"><name>Sarcopterygii</name><rank>no rank</rank><partof>TX.117571</partof></taxon><taxon ID="TX.8457"><name>Sauropsida</name><rank>no rank</rank><partof>TX.32524</partof></taxon><taxon ID="TX.8492"><name>Archosauria</name><rank>no rank</rank><partof>TX.32561</partof></taxon><taxon ID="TX.8782"><name>Aves</name><rank>class</rank><partof>TX.436492</partof></taxon><taxon ID="TX.32523"><name>Tetrapoda</name><rank>no rank</rank><partof>TX.8287</partof></taxon><taxon ID="TX.32524"><name>Amniota</name><rank>no rank</rank><partof>TX.32523</partof></taxon><taxon ID="TX.32561"><name>Sauria</name><rank>no rank</rank><partof>TX.8457</partof></taxon><taxon ID="TX.33090"><name>Viridiplantae</name><rank>kingdom</rank><partof>TX.2759</partof></taxon><taxon ID="TX.33154"><name>Opisthokonta</name><rank>no rank</rank><partof>TX.2759</partof></taxon><taxon ID="TX.33208"><name>Metazoa</name><rank>kingdom</rank><partof>TX.33154</partof></taxon><taxon ID="TX.33213"><name>Bilateria</name><rank>no rank</rank><partof>TX.6072</partof></taxon><taxon ID="TX.33316"><name>Coelomata</name><rank>no rank</rank><partof>TX.33213</partof></taxon><taxon ID="TX.33317"><name>Protostomia</name><rank>no rank</rank><partof>TX.33316</partof></taxon><taxon ID="TX.33340"><name>Neoptera</name><rank>subclass</rank><partof>TX.7496</partof></taxon><taxon ID="TX.33392"><name>Endopterygota</name><rank>infraclass</rank><partof>TX.33340</partof></taxon><taxon ID="TX.33511"><name>Deuterostomia</name><rank>no rank</rank><partof>TX.33316</partof></taxon><taxon ID="TX.35493"><name>Streptophyta</name><rank>phylum</rank><partof>TX.33090</partof></taxon><taxon ID="TX.42113"><name>Clitellata</name><rank>no rank</rank><partof>TX.6340</partof></taxon><taxon ID="TX.50557"><name>Insecta</name><rank>class</rank><partof>TX.6960</partof></taxon><taxon ID="TX.85512"><name>Dicondylia</name><rank>no rank</rank><partof>TX.50557</partof></taxon><taxon ID="TX.88770"><name>Panarthropoda</name><rank>no rank</rank><partof>TX.33317</partof></taxon><taxon ID="TX.89593"><name>Craniata</name><rank>subphylum</rank><partof>TX.7711</partof></taxon><taxon ID="TX.117570"><name>Teleostomi</name><rank>no rank</rank><partof>TX.7776</partof></taxon><taxon ID="TX.117571"><name>Euteleostomi</name><rank>no rank</rank><partof>TX.117570</partof></taxon><taxon ID="TX.131221"><name>Streptophytina</name><rank>no rank</rank><partof>TX.35493</partof></taxon><taxon ID="TX.131567"><name>cellular organisms</name><rank>no rank</rank><partof>TX.1</partof></taxon><taxon ID="TX.193545"><name>Annelida/Echiura/Pogonophora group</name><rank>no rank</rank><partof>TX.33317</partof></taxon><taxon ID="TX.197562"><name>Pancrustacea</name><rank>no rank</rank><partof>TX.197563</partof></taxon><taxon ID="TX.197563"><name>Mandibulata</name><rank>no rank</rank><partof>TX.6656</partof></taxon><taxon ID="TX.436486"><name>Dinosauria</name><rank>no rank</rank><partof>TX.8492</partof></taxon><taxon ID="TX.436489"><name>Saurischia</name><rank>no rank</rank><partof>TX.436486</partof></taxon><taxon ID="TX.436491"><name>Theropoda</name><rank>no rank</rank><partof>TX.436489</partof></taxon><taxon ID="TX.436492"><name>Coelurosauria</name><rank>no rank</rank><partof>TX.436491</partof></taxon></taxonomy>
+	<primers>
+		<primer ID="PR.G">
+			<name>G</name>
+			<sequence>GGGCAATCCTGAGCCAA</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.H">
+			<name>H</name>
+			<sequence>CCATTGAGTCTCTGCACCTATC</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.ITS5">
+			<name>ITS5</name>
+			<sequence>GGAAGTAAAAGTCGTAACAAGG</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.58S_FUNGI">
+			<name>5.8S_fungi</name>
+			<sequence>CAAGAGATCCGTTGTTGAAAGTT</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.BRYO_P6F">
+			<name>bryo_P6F</name>
+			<sequence>GATTCAGGGAAACTTAGGTTG</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.BRYO_P6R">
+			<name>bryo_P6R</name>
+			<sequence>CCATTGAGTCTCTGCACC</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.ENCH_12SA">
+			<name>Ench_12Sa</name>
+			<sequence>GCTGCACTTTGACTTGAC</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.ENCH_12SC">
+			<name>Ench_12Sc</name>
+			<sequence>AGCCTGTGTACTGCTGTC</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.COLEOP_16SC">
+			<name>Coleop_16Sc</name>
+			<sequence>TGCAAAGGTAGCATAATMATTAG</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.COLEOP_16SD">
+			<name>Coleop_16Sd</name>
+			<sequence>TCCATAGGGTCTTCTCGTC</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.AVES_12SA">
+			<name>Aves_12Sa</name>
+			<sequence>GATTAGATACCCCACTATGC</sequence>
+			<coding>false</coding>
+		</primer>
+		<primer ID="PR.AVES_12SC">
+			<name>Aves_12Sc</name>
+			<sequence>GTTTTAAGCGTTTGTGCTCG</sequence>
+			<coding>false</coding>
+		</primer>
+	</primers>
+	<metabarcodes>
+		<metabarcode ID="MB.GH_P6_LOOP">
+			<name>GH</name>
+			<locus>LO.P6_LOOP</locus>
+			<forward>PR.G</forward>
+			<reverse>PR.H</reverse>
+			<targettaxon>TX.35493</targettaxon>
+			<targetlength>
+				<min>8</min>
+				<max>150</max>
+			</targetlength>
+			<references>
+				<describedin biblioid="BI.TABERLET_07_00"/>
+				<usedin biblioid="BI.YOCCOZ_12_00"/>
+			</references>
+		</metabarcode>
+		<metabarcode ID="MB.FUNGI_ITS1">
+			<name>Fungi_ITS1</name>
+			<locus>LO.ITS1</locus>
+			<forward>PR.ITS5</forward>
+			<reverse>PR.58S_FUNGI</reverse>
+			<targettaxon>TX.4751</targettaxon>
+			<references>
+				<describedin>BI.BELLEMAIN_10_00</describedin>
+				<usedin>BI.EPP_12_00</usedin></references>
+		</metabarcode>
+		<metabarcode ID="MB.BRYO_P6_LOOP">
+			<name>Bryophytes_GH</name>
+			<locus>LO.P6_LOOP</locus>
+			<forward>PR.BRYO_P6F</forward>
+			<reverse>PR.BRYO_P6R</reverse>
+			<targettaxon>TX.3208</targettaxon>
+			<references>
+				<describedin>BI.EPP_12_00</describedin></references>
+		</metabarcode>
+		<metabarcode ID="MB.ENCH_12S">
+			<name>Enchytraeids_12S</name>
+			<locus>LO.M12SRRNA</locus>
+			<forward>PR.ENCH_12SA</forward>
+			<reverse>PR.ENCH_12SC</reverse>
+			<targettaxon>TX.6388</targettaxon>
+			<references>
+				<describedin>BI.EPP_12_00</describedin></references>
+		</metabarcode>
+		<metabarcode ID="MB.COLEO_16S">
+			<name>Coleopters_16S</name>
+			<locus>LO.M16SRRNA</locus>
+			<forward>PR.COLEOP_16SC</forward>
+			<reverse>PR.COLEOP_16SD</reverse>
+			<targettaxon>TX.7041</targettaxon>
+			<references>
+				<describedin>BI.EPP_12_00</describedin></references>
+		</metabarcode>
+		<metabarcode ID="MB.AVES_12S">
+			<name>Birds_12S</name>
+			<locus>LO.M12SRRNA</locus>
+			<forward>PR.AVES_12SA</forward>
+			<reverse>PR.AVES_12SC</reverse>
+			<targettaxon>TX.8782</targettaxon>
+			<references>
+				<describedin>BI.EPP_12_00</describedin></references>
+		</metabarcode>
+	</metabarcodes>
+	<bibliography>
+		<mods:mods ID="BI.TABERLET_07_00">
+			<mods:titleInfo>
+				<mods:title>Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding.</mods:title>
+			</mods:titleInfo>
+			<mods:name type="personal">
+				<mods:namePart type="given">Pierre</mods:namePart>
+				<mods:namePart type="family">Taberlet</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Eric</mods:namePart>
+				<mods:namePart type="family">Coissac</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Francois</mods:namePart>
+				<mods:namePart type="family">Pompanon</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Ludovic</mods:namePart>
+				<mods:namePart type="family">Gielly</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Christian</mods:namePart>
+				<mods:namePart type="family">Miquel</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Alice</mods:namePart>
+				<mods:namePart type="family">Valentini</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Thierry</mods:namePart>
+				<mods:namePart type="family">Vermat</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Gerard</mods:namePart>
+				<mods:namePart type="family">Corthier</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Christian</mods:namePart>
+				<mods:namePart type="family">Brochmann</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Eske</mods:namePart>
+				<mods:namePart type="family">Willerslev</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:originInfo>
+				<mods:dateIssued>2007</mods:dateIssued>
+			</mods:originInfo>
+			<mods:typeOfResource>text</mods:typeOfResource>
+			<mods:genre>journal article</mods:genre>
+			<mods:relatedItem type="host">
+				<mods:titleInfo>
+					<mods:title>Nucleic Acids Research</mods:title>
+				</mods:titleInfo>
+				<mods:originInfo>
+					<mods:issuance>continuing</mods:issuance>
+				</mods:originInfo>
+				<mods:genre authority="marcgt">periodical</mods:genre>
+				<mods:genre>academic journal</mods:genre>
+			</mods:relatedItem>
+			<mods:identifier type="citekey">Taberlet:07:00</mods:identifier>
+			<mods:part>
+				<mods:date>2007</mods:date>
+				<mods:detail type="volume">
+					<mods:number>35</mods:number>
+				</mods:detail>
+				<mods:detail type="issue">
+					<mods:number>3</mods:number>
+				</mods:detail>
+				<mods:detail type="page">
+					<mods:number>e14</mods:number>
+				</mods:detail>
+			</mods:part>
+		</mods:mods>
+		<mods:mods ID="BI.YOCCOZ_12_00">
+			<mods:titleInfo>
+				<mods:title>DNA from soil mirrors plant taxonomic and growth form diversity</mods:title>
+			</mods:titleInfo>
+			<mods:name type="personal">
+				<mods:namePart type="given">N</mods:namePart>
+				<mods:namePart type="given">G</mods:namePart>
+				<mods:namePart type="family">Yoccoz</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">K</mods:namePart>
+				<mods:namePart type="given">A</mods:namePart>
+				<mods:namePart type="family">Bråthen</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">L</mods:namePart>
+				<mods:namePart type="family">Gielly</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">J</mods:namePart>
+				<mods:namePart type="family">Haile</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">M</mods:namePart>
+				<mods:namePart type="given">E</mods:namePart>
+				<mods:namePart type="family">Edwards</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">T</mods:namePart>
+				<mods:namePart type="family">Goslar</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">H</mods:namePart>
+				<mods:namePart type="family">Von Stedingk</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">A</mods:namePart>
+				<mods:namePart type="given">K</mods:namePart>
+				<mods:namePart type="family">Brysting</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">E</mods:namePart>
+				<mods:namePart type="family">Coissac</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">F</mods:namePart>
+				<mods:namePart type="family">Pompanon</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">J</mods:namePart>
+				<mods:namePart type="given">H</mods:namePart>
+				<mods:namePart type="family">Sønstebø</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">C</mods:namePart>
+				<mods:namePart type="family">Miquel</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">A</mods:namePart>
+				<mods:namePart type="family">Valentini</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">F</mods:namePart>
+				<mods:namePart type="family">De Bello</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">J</mods:namePart>
+				<mods:namePart type="family">Chave</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">W</mods:namePart>
+				<mods:namePart type="family">Thuiller</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">P</mods:namePart>
+				<mods:namePart type="family">Wincker</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">C</mods:namePart>
+				<mods:namePart type="family">Cruaud</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">F</mods:namePart>
+				<mods:namePart type="family">Gavory</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">M</mods:namePart>
+				<mods:namePart type="family">Rasmussen</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">M</mods:namePart>
+				<mods:namePart type="given">T</mods:namePart>
+				<mods:namePart type="given">P</mods:namePart>
+				<mods:namePart type="family">Gilbert</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">L</mods:namePart>
+				<mods:namePart type="family">Orlando</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">C</mods:namePart>
+				<mods:namePart type="family">Brochmann</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">E</mods:namePart>
+				<mods:namePart type="family">Willerslev</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">P</mods:namePart>
+				<mods:namePart type="family">Taberlet</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:originInfo>
+				<mods:dateIssued>2012-Aug</mods:dateIssued>
+			</mods:originInfo>
+			<mods:typeOfResource>text</mods:typeOfResource>
+			<mods:genre>journal article</mods:genre>
+			<mods:relatedItem type="host">
+				<mods:titleInfo>
+					<mods:title>Mol Ecol</mods:title>
+				</mods:titleInfo>
+				<mods:originInfo>
+					<mods:issuance>continuing</mods:issuance>
+				</mods:originInfo>
+				<mods:genre authority="marcgt">periodical</mods:genre>
+				<mods:genre>academic journal</mods:genre>
+			</mods:relatedItem>
+			<mods:identifier type="citekey">Yoccoz:12:00</mods:identifier>
+			<mods:part>
+				<mods:date>2012-Aug</mods:date>
+				<mods:detail type="volume">
+					<mods:number>21</mods:number>
+				</mods:detail>
+				<mods:detail type="issue">
+					<mods:number>15</mods:number>
+				</mods:detail>
+				<mods:extent unit="page">
+					<mods:start>3647</mods:start>
+					<mods:end>55</mods:end>
+				</mods:extent>
+			</mods:part>
+		</mods:mods>
+		<mods:mods xmlns:mods="http://www.loc.gov/mods/v3" ID="BI.EPP_12_00">
+			<mods:titleInfo>
+				<mods:title>New environmental metabarcodes for analysing soil DNA</mods:title>
+				<mods:subTitle>potential for studying past and present ecosystems</mods:subTitle>
+			</mods:titleInfo>
+			<mods:name type="personal">
+				<mods:namePart type="given">Laura</mods:namePart>
+				<mods:namePart type="given">S</mods:namePart>
+				<mods:namePart type="family">Epp</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Sanne</mods:namePart>
+				<mods:namePart type="family">Boessenkool</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Eva</mods:namePart>
+				<mods:namePart type="given">P</mods:namePart>
+				<mods:namePart type="family">Bellemain</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">James</mods:namePart>
+				<mods:namePart type="family">Haile</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Alfonso</mods:namePart>
+				<mods:namePart type="family">Esposito</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Tiayyba</mods:namePart>
+				<mods:namePart type="family">Riaz</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Christer</mods:namePart>
+				<mods:namePart type="family">Erséus</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Vladimir</mods:namePart>
+				<mods:namePart type="given">I</mods:namePart>
+				<mods:namePart type="family">Gusarov</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Mary</mods:namePart>
+				<mods:namePart type="given">E</mods:namePart>
+				<mods:namePart type="family">Edwards</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Arild</mods:namePart>
+				<mods:namePart type="family">Johnsen</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Hans</mods:namePart>
+				<mods:namePart type="given">K</mods:namePart>
+				<mods:namePart type="family">Stenøien</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Kristian</mods:namePart>
+				<mods:namePart type="family">Hassel</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Håvard</mods:namePart>
+				<mods:namePart type="family">Kauserud</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Nigel</mods:namePart>
+				<mods:namePart type="given">G</mods:namePart>
+				<mods:namePart type="family">Yoccoz</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Kari</mods:namePart>
+				<mods:namePart type="given">Anne</mods:namePart>
+				<mods:namePart type="family">Bråthen</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Eske</mods:namePart>
+				<mods:namePart type="family">Willerslev</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Pierre</mods:namePart>
+				<mods:namePart type="family">Taberlet</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Eric</mods:namePart>
+				<mods:namePart type="family">Coissac</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:name type="personal">
+				<mods:namePart type="given">Christian</mods:namePart>
+				<mods:namePart type="family">Brochmann</mods:namePart>
+				<mods:role>
+					<mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+				</mods:role>
+			</mods:name>
+			<mods:originInfo>
+				<mods:dateIssued>2012-Apr</mods:dateIssued>
+			</mods:originInfo>
+			<mods:typeOfResource>text</mods:typeOfResource>
+			<mods:genre>journal article</mods:genre>
+			<mods:relatedItem type="host">
+				<mods:titleInfo>
+					<mods:title>Molecular Ecology</mods:title>
+				</mods:titleInfo>
+				<mods:originInfo>
+					<mods:issuance>continuing</mods:issuance>
+				</mods:originInfo>
+				<mods:genre authority="marcgt">periodical</mods:genre>
+				<mods:genre>academic journal</mods:genre>
+			</mods:relatedItem>
+			<mods:identifier type="citekey">Epp:12:00</mods:identifier>
+			<mods:part>
+				<mods:date>2012-Apr</mods:date>
+				<mods:detail type="volume">
+					<mods:number>21</mods:number>
+				</mods:detail>
+				<mods:detail type="issue">
+					<mods:number>8</mods:number>
+				</mods:detail>
+				<mods:extent unit="page">
+					<mods:start>1821</mods:start>
+					<mods:end>1833</mods:end>
+				</mods:extent>
+			</mods:part>
+		</mods:mods>
+	<mods:mods xmlns:mods="http://www.loc.gov/mods/v3" ID="BI.BELLEMAIN_10_00">
+    <mods:titleInfo>
+        <mods:title>ITS as an environmental DNA barcode for fungi</mods:title>
+        <mods:subTitle>an in silico approach reveals potential PCR biases</mods:subTitle>
+    </mods:titleInfo>
+    <mods:name type="personal">
+        <mods:namePart type="given">Eva</mods:namePart>
+        <mods:namePart type="family">Bellemain</mods:namePart>
+        <mods:role>
+            <mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+        </mods:role>
+    </mods:name>
+    <mods:name type="personal">
+        <mods:namePart type="given">Tor</mods:namePart>
+        <mods:namePart type="family">Carlsen</mods:namePart>
+        <mods:role>
+            <mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+        </mods:role>
+    </mods:name>
+    <mods:name type="personal">
+        <mods:namePart type="given">Christian</mods:namePart>
+        <mods:namePart type="family">Brochmann</mods:namePart>
+        <mods:role>
+            <mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+        </mods:role>
+    </mods:name>
+    <mods:name type="personal">
+        <mods:namePart type="given">Eric</mods:namePart>
+        <mods:namePart type="family">Coissac</mods:namePart>
+        <mods:role>
+            <mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+        </mods:role>
+    </mods:name>
+    <mods:name type="personal">
+        <mods:namePart type="given">Pierre</mods:namePart>
+        <mods:namePart type="family">Taberlet</mods:namePart>
+        <mods:role>
+            <mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+        </mods:role>
+    </mods:name>
+    <mods:name type="personal">
+        <mods:namePart type="given">Håvard</mods:namePart>
+        <mods:namePart type="family">Kauserud</mods:namePart>
+        <mods:role>
+            <mods:roleTerm authority="marcrelator" type="text">author</mods:roleTerm>
+        </mods:role>
+    </mods:name>
+    <mods:originInfo>
+        <mods:dateIssued>2010</mods:dateIssued>
+    </mods:originInfo>
+    <mods:typeOfResource>text</mods:typeOfResource>
+    <mods:genre>journal article</mods:genre>
+    <mods:relatedItem type="host">
+        <mods:titleInfo>
+            <mods:title>BMC Microbiology</mods:title>
+        </mods:titleInfo>
+        <mods:originInfo>
+            <mods:issuance>continuing</mods:issuance>
+        </mods:originInfo>
+        <mods:genre authority="marcgt">periodical</mods:genre>
+        <mods:genre>academic journal</mods:genre>
+    </mods:relatedItem>
+    <mods:identifier type="citekey">Bellemain:10:00</mods:identifier>
+    <mods:part>
+        <mods:date>2010</mods:date>
+        <mods:detail type="volume"><mods:number>10</mods:number></mods:detail>
+        <mods:detail type="page"><mods:number>189</mods:number></mods:detail>
+    </mods:part>
+</mods:mods></bibliography>
+</obimetabarcodedb>
--- a/inst/extdata/empty.xml
+++ b/inst/extdata/empty.xml
@@ -0,0 +1,22 @@
+<?xml version="1.0" encoding="UTF-8"?>
+
+<obimetabarcodedb 
+    xmlns="http://metabarcoding.org/OBIMetabarcodes"
+    xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" 
+    xmlns:mods="http://www.loc.gov/mods/v3"
+    xsi:schemaLocation="http://metabarcoding.org/OBIMetabarcodes OBIMetabarcodes.xsd">
+    <metadata>
+    	<loci>
+    	</loci>
+    </metadata>
+    <taxonomy>
+       <root ID="TX.1">
+           <name>Root</name>
+           <rank>no rank</rank>
+       </root>
+    </taxonomy>
+    <primers>
+    </primers>
+    <metabarcodes>
+    </metabarcodes>
+</obimetabarcodedb>
--- a/inst/extdata/mods-3-5.xsd
+++ b/inst/extdata/mods-3-5.xsd
--- a/inst/extdata/spare.xml
+++ b/inst/extdata/spare.xml
@@ -0,0 +1,24 @@
+<?xml version="1.0" encoding="UTF-8"?>
+
+<obimetabarcodedb 
+    xmlns="http://metabarcoding.org/OBIMetabarcodes"
+    xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" 
+    xmlns:mods="http://www.loc.gov/mods/v3"
+    xsi:schemaLocation="http://metabarcoding.org/OBIMetabarcodes OBIMetabarcodes.xsd">
+    <metadata>
+    	<loci>
+    	</loci>
+    </metadata>
+    <taxonomy>
+       <root ID="TX.1">
+           <name>Root</name>
+           <rank>no rank</rank>
+       </root>
+    </taxonomy>
+    <primers>
+    </primers>
+    <metabarcodes>
+    </metabarcodes>
+    <bibliography>
+    </bibliography>
+</obimetabarcodedb>
--- a/inst/extdata/taberlet2007.bib
+++ b/inst/extdata/taberlet2007.bib
@@ -0,0 +1,9 @@
+
+@article{Taberlet:07:00,
+	Author = {Taberlet, Pierre and Coissac, E and Pompanon, Francois and Gielly, Ludovic and Miquel, Christian and Valentini, Alice and Vermat, Thierry and Corthier, Gerard and Brochmann, Christian and Willerslev, Eske},
+	Journal = {Nucleic Acids Res},
+	Number = {3},
+	Pages = {e14},
+	Title = {Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding.},
+	Volume = {35},
+	Year = {2007}}
--- a/inst/extdata/taberlet2007.xml
+++ b/inst/extdata/taberlet2007.xml
@@ -0,0 +1,100 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<modsCollection xmlns="http://www.loc.gov/mods/v3">
+<mods ID="Taberlet:07:00">
+    <titleInfo>
+        <title>Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding.</title>
+    </titleInfo>
+    <name type="personal">
+        <namePart type="given">Pierre</namePart>
+        <namePart type="family">Taberlet</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">E</namePart>
+        <namePart type="family">Coissac</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">Francois</namePart>
+        <namePart type="family">Pompanon</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">Ludovic</namePart>
+        <namePart type="family">Gielly</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">Christian</namePart>
+        <namePart type="family">Miquel</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">Alice</namePart>
+        <namePart type="family">Valentini</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">Thierry</namePart>
+        <namePart type="family">Vermat</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">Gerard</namePart>
+        <namePart type="family">Corthier</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">Christian</namePart>
+        <namePart type="family">Brochmann</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <name type="personal">
+        <namePart type="given">Eske</namePart>
+        <namePart type="family">Willerslev</namePart>
+        <role>
+            <roleTerm authority="marcrelator" type="text">author</roleTerm>
+        </role>
+    </name>
+    <originInfo>
+        <dateIssued>2007</dateIssued>
+    </originInfo>
+    <typeOfResource>text</typeOfResource>
+    <genre>journal article</genre>
+    <relatedItem type="host">
+        <titleInfo>
+            <title>Nucleic Acids Res</title>
+        </titleInfo>
+        <originInfo>
+            <issuance>continuing</issuance>
+        </originInfo>
+        <genre authority="marcgt">periodical</genre>
+        <genre>academic journal</genre>
+    </relatedItem>
+    <identifier type="citekey">Taberlet:07:00</identifier>
+    <part>
+        <date>2007</date>
+        <detail type="volume"><number>35</number></detail>
+        <detail type="issue"><number>3</number></detail>
+        <detail type="page"><number>e14</number></detail>
+    </part>
+</mods>
+</modsCollection>
--- a/inst/extdata/yoccoz_2012.bib
+++ b/inst/extdata/yoccoz_2012.bib
@@ -0,0 +1,10 @@
+
+@article{Yoccoz:12:00,
+	Author = {Yoccoz, N G and Br{\aa}then, K A and Gielly, L and Haile, J and Edwards, M E and Goslar, T and Von Stedingk, H and Brysting, A K and Coissac, E and Pompanon, F and S{\o}nsteb{\o}, J H and Miquel, C and Valentini, A and De Bello, F and Chave, J and Thuiller, W and Wincker, P and Cruaud, C and Gavory, F and Rasmussen, M and Gilbert, M T P and Orlando, L and Brochmann, C and Willerslev, E and Taberlet, P},
+	Journal = {Mol Ecol},
+	Month = {Aug},
+	Number = {15},
+	Pages = {3647-55},
+	Title = {DNA from soil mirrors plant taxonomic and growth form diversity},
+	Volume = {21},
+	Year = {2012}}
--- a/src/ROBIBarcodes.so
+++ b/src/ROBIBarcodes.so
--- a/src/ecoError.c
+++ b/src/ecoError.c
@@ -0,0 +1,26 @@
+#include "ecoPCR.h"
+#include <stdio.h>
+#include <stdlib.h>
+
+/*
+ * print the message given as argument and exit the program
+ * @param error		error number	
+ * @param message 	the text explaining what's going on
+ * @param filename	the file source where the program failed
+ * @param linenumber	the line where it has failed
+ * filename and linenumber are written at pre-processing 
+ * time by a macro
+ */
+void ecoError(int32_t error,
+              const char* message,
+              const char * filename,
+              int linenumber)
+{
+	fprintf(stderr,"Error %d in file %s line %d : %s\n",
+	               error,
+	               filename,
+	               linenumber,
+	               message);
+	
+	abort();
+}
--- a/src/ecoError.o
+++ b/src/ecoError.o
--- a/src/ecoIOUtils.c
+++ b/src/ecoIOUtils.c
@@ -0,0 +1,122 @@
+#include "ecoPCR.h"
+#include <stdio.h>
+#include <stdlib.h>
+
+#define SWAPINT32(x)     ((((x) << 24) & 0xFF000000) | (((x) <<  8) & 0xFF0000) | \
+                         (((x) >>  8) & 0xFF00)     | (((x) >> 24) & 0xFF))
+
+
+int32_t is_big_endian()
+{
+	int32_t i=1;
+	
+	return (int32_t)((char*)&i)[0];
+}
+
+
+
+
+int32_t swap_int32_t(int32_t i)
+{
+	return SWAPINT32(i);
+}
+
+
+/**
+ * Read part of the file
+ * @param	*f	the database
+ * @param	recordSize the size to be read
+ * 
+ * @return	buffer
+ */
+void *read_ecorecord(FILE *f,int32_t *recordSize)
+{
+	static void *buffer    =NULL;
+	int32_t      buffersize=0;
+	int32_t      read;
+	
+	if (!recordSize)
+		ECOERROR(ECO_ASSERT_ERROR,
+		         "recordSize cannot be NULL");
+		
+	read = fread(recordSize,
+	      		 1,
+	      		 sizeof(int32_t),
+	             f);
+	             
+	if (feof(f))
+		return NULL;
+	             
+	if (read != sizeof(int32_t))
+		ECOERROR(ECO_IO_ERROR,"Reading record size error");
+		
+	if (is_big_endian())
+		*recordSize=swap_int32_t(*recordSize);
+		
+	if (buffersize < *recordSize)
+	{
+		if (buffer)
+			buffer = ECOREALLOC(buffer,*recordSize,
+			                    "Increase size of record buffer");
+		else
+			buffer = ECOMALLOC(*recordSize,
+			                    "Allocate record buffer");
+	}
+	
+	read = fread(buffer,
+	             1,
+				 *recordSize,
+				 f);
+				 
+	if (read != *recordSize)
+		ECOERROR(ECO_IO_ERROR,"Reading record data error");
+		
+	return buffer;	 
+};
+
+
+
+
+
+/**
+ * Open the database and check it's readable
+ * @param 	filename 		name of the database (.sdx, .rdx, .tbx)
+ * @param 	sequencecount	buffer - pointer to variable storing the number of occurence    
+ * @param 	abort_on_open_error		 	boolean to define the behaviour in case of error 
+ * 										while opening the database
+ * @return 	FILE type
+ **/
+FILE *open_ecorecorddb(const char *filename,
+                       int32_t    *sequencecount,
+                       int32_t    abort_on_open_error)
+{
+    FILE        *f;
+	int32_t      read;
+	
+	f = fopen(filename,"rb");
+	
+	if (!f)
+		{
+			if (abort_on_open_error)
+		 		ECOERROR(ECO_IO_ERROR,"Cannot open file");
+		 	else
+		 	{
+		 		*sequencecount=0;
+		 		return NULL;
+		 	}
+		}
+		
+	read = fread(sequencecount,
+	      		 1,
+	      		 sizeof(int32_t),
+	      		 f);
+	             
+	if (read != sizeof(int32_t))
+		ECOERROR(ECO_IO_ERROR,"Reading record size error");
+
+	if (is_big_endian())
+		*sequencecount=swap_int32_t(*sequencecount);
+		
+	return f;                  
+}
+
--- a/src/ecoIOUtils.o
+++ b/src/ecoIOUtils.o
--- a/src/ecoMalloc.c
+++ b/src/ecoMalloc.c
@@ -0,0 +1,79 @@
+#include "ecoPCR.h"
+#include <stdlib.h>
+
+static int eco_log_malloc = 0;
+
+void    eco_trace_memory_allocation()
+{
+	eco_log_malloc=1;
+}
+
+void    eco_untrace_memory_allocation()
+{
+	eco_log_malloc=0;
+}
+
+
+void   *eco_malloc(int32_t chunksize,
+                   const char *error_message,
+                   const char *filename,
+                   int32_t    line)
+{
+	void * chunk;
+	
+	chunk = calloc(1,chunksize);
+	
+	if (!chunk)
+		ecoError(ECO_MEM_ERROR,error_message,filename,line);
+		
+	if (eco_log_malloc)
+		fprintf(stderr,
+			    "Memory segment located at %p of size %d is allocated (file : %s [%d])",
+			    chunk,
+			    chunksize,
+			    filename,
+			    line);
+		
+	return chunk;
+}
+
+void   *eco_realloc(void *chunk,
+                    int32_t newsize,
+                    const char *error_message,
+                    const char *filename,
+                    int32_t    line)
+{
+	void *newchunk;
+	
+	newchunk = realloc(chunk,newsize);
+	
+	if (!newchunk)
+		ecoError(ECO_MEM_ERROR,error_message,filename,line);
+
+	if (eco_log_malloc)
+		fprintf(stderr,
+			    "Old memory segment %p is reallocated at %p with a size of %d (file : %s [%d])",
+			    chunk,
+			    newchunk,
+			    newsize,
+			    filename,
+			    line);
+		
+	return newchunk;	
+}
+
+void    eco_free(void *chunk,
+                 const char *error_message,
+                 const char *filename,
+                 int32_t    line)
+{
+	free(chunk);
+	
+	if (eco_log_malloc)
+		fprintf(stderr,
+			    "Memory segment %p is released => %s (file : %s [%d])",
+			    chunk,
+			    error_message,
+			    filename,
+			    line);
+}
--- a/src/ecoMalloc.o
+++ b/src/ecoMalloc.o
--- a/src/ecoPCR.h
+++ b/src/ecoPCR.h
@@ -0,0 +1,283 @@
+#ifndef ECOPCR_H_
+#define ECOPCR_H_
+
+#include <stdio.h>
+#include <inttypes.h>
+
+#include <R.h>
+#include <Rinternals.h>
+#include <Rdefines.h>
+
+
+//#ifndef H_apat
+//#include "../libapat/apat.h"
+//#endif
+
+/*****************************************************
+ * 
+ *  Data type declarations
+ * 
+ *****************************************************/
+
+/*
+ * 
+ *  Sequence types
+ * 
+ */
+
+typedef struct {
+	
+	int32_t  taxid;
+	char     AC[20];
+	int32_t  DE_length;
+	int32_t  SQ_length;
+	int32_t  CSQ_length;
+	
+	char     data[1];
+	
+} ecoseqformat_t;
+
+typedef struct {
+	int32_t taxid;
+	int32_t SQ_length;
+	char    *AC;
+	char    *DE;
+	char    *SQ;
+} ecoseq_t;
+
+/*
+ * 
+ * Taxonomy taxon types
+ * 
+ */
+
+
+typedef struct {
+	int32_t  taxid;
+	int32_t  rank;
+	int32_t	 parent;
+	int32_t  namelength;
+	char     name[1];
+	
+} ecotxformat_t;
+
+typedef struct ecotxnode {
+	int32_t           taxid;
+	int32_t           rank;
+	int32_t  		      farest;
+	struct ecotxnode  *parent;
+	char              *name;
+} ecotx_t;
+
+typedef struct {
+	int32_t count;
+	int32_t maxtaxid;
+  int32_t buffersize;
+	ecotx_t taxon[1];
+} ecotxidx_t;
+ 
+	
+/*
+ * 
+ * Taxonomy rank types
+ * 
+ */
+	
+typedef struct {
+	int32_t count;
+	char*   label[1];
+} ecorankidx_t;
+
+/*
+ * 
+ * Taxonomy name types
+ * 
+ */
+
+typedef struct {
+ 	int32_t is_scientificname;
+	int32_t  namelength;
+	int32_t  classlength;
+	int32_t  taxid;
+	char     names[1];	
+} econameformat_t;
+ 
+ 
+ typedef struct {
+ 	char 	*name;
+ 	char 	*classname;
+ 	int32_t is_scientificname;
+ 	struct ecotxnode  *taxon;
+} econame_t;
+
+ 
+typedef struct {
+	int32_t count;
+	econame_t   names[1];
+} econameidx_t;
+
+
+ typedef struct {
+	ecorankidx_t *ranks;
+	econameidx_t *names;
+	ecotxidx_t   *taxons;
+} ecotaxonomy_t;
+
+ 
+/*****************************************************
+ * 
+ *  Function declarations
+ * 
+ *****************************************************/
+
+/*
+ * 
+ * Low level system functions
+ * 
+ */
+
+int32_t is_big_endian();
+int32_t swap_int32_t(int32_t);
+
+void   *eco_malloc(int32_t chunksize,
+                   const char *error_message,
+                   const char *filename,
+                   int32_t    line);
+                   
+                   
+void   *eco_realloc(void *chunk,
+                    int32_t chunksize,
+                    const char *error_message,
+                    const char *filename,
+                    int32_t    line);
+                    
+void    eco_free(void *chunk,
+                 const char *error_message,
+                 const char *filename,
+                 int32_t    line);
+                 
+void    eco_trace_memory_allocation();
+void    eco_untrace_memory_allocation();
+
+#define ECOMALLOC(size,error_message) \
+	    eco_malloc((size),(error_message),__FILE__,__LINE__)
+	   
+#define ECOREALLOC(chunk,size,error_message) \
+        eco_realloc((chunk),(size),(error_message),__FILE__,__LINE__)
+        
+#define ECOFREE(chunk,error_message) \
+        eco_free((chunk),(error_message),__FILE__,__LINE__)
+        
+        
+
+
+/*
+ * 
+ * Error managment
+ * 
+ */
+ 
+  
+void ecoError(int32_t,const char*,const char *,int);
+
+#define ECOERROR(code,message) ecoError((code),(message),__FILE__,__LINE__)
+
+#define ECO_IO_ERROR       (1)
+#define ECO_MEM_ERROR      (2)
+#define ECO_ASSERT_ERROR   (3)
+#define ECO_NOTFOUND_ERROR (4)
+
+
+/*
+ * 
+ * Low level Disk access functions
+ * 
+ */
+
+FILE *open_ecorecorddb(const char *filename,
+                       int32_t    *sequencecount,
+                       int32_t    abort_on_open_error);
+                       
+void *read_ecorecord(FILE *,int32_t *recordSize);
+
+
+
+/* 
+ *   Read function in internal binary format
+ */
+
+FILE             *open_ecoseqdb(const char *filename,
+                                int32_t    *sequencecount);
+                                                                
+ecoseq_t         *readnext_ecoseq(FILE *);
+
+ecorankidx_t     *read_rankidx(const char *filename);
+
+econameidx_t     *read_nameidx(const char *filename,ecotaxonomy_t *taxonomy);
+
+
+
+	/**
+	 * Read taxonomy data as formated by the ecoPCRFormat.py script.
+	 * 
+	 * This function is normaly uses internaly by the read_taxonomy
+	 * function and should not be called directly.
+	 * 
+	 * @arg filename  path to the *.tdx file of the reformated db
+	 * 
+	 * @return pointer to a taxonomy index structure
+	 */
+ 
+ecotxidx_t       *read_taxonomyidx(const char *filename,const char *filename2);
+
+ecotaxonomy_t    *read_taxonomy(const char *prefix,int32_t readAlternativeName);
+
+ecotx_t *eco_findtaxonatrank(ecotx_t *taxon, int32_t rankidx);
+
+ecotx_t *eco_findtaxonbytaxid(ecotaxonomy_t *taxonomy, int32_t taxid);
+
+int eco_isundertaxon(ecotx_t *taxon, int other_taxid);
+
+ecoseq_t *ecoseq_iterator(const char *prefix);
+
+
+
+ecoseq_t *new_ecoseq();
+int32_t   delete_ecoseq(ecoseq_t *);
+ecoseq_t *new_ecoseq_with_data( char *AC,
+								char *DE,
+								char *SQ,
+								int32_t   taxid
+								);
+
+
+int32_t delete_taxon(ecotx_t *taxon);
+int32_t delete_taxonomy(ecotxidx_t *index);
+int32_t delete_ecotaxonomy(ecotaxonomy_t *taxonomy);
+
+
+int32_t rank_index(const char* label,ecorankidx_t* ranks);
+
+//int32_t  delete_apatseq(SeqPtr pseq);
+//PatternPtr buildPattern(const char *pat, int32_t error_max);
+//PatternPtr complementPattern(PatternPtr pat);
+//
+//SeqPtr ecoseq2apatseq(ecoseq_t *in,SeqPtr out,int32_t circular);
+
+//char *ecoComplementPattern(char *nucAcSeq);
+//char *ecoComplementSequence(char *nucAcSeq);
+//char *getSubSequence(char* nucAcSeq,int32_t begin,int32_t end);
+
+ecotx_t *eco_getspecies(ecotx_t *taxon,ecotaxonomy_t *taxonomy);
+ecotx_t *eco_getgenus(ecotx_t *taxon,ecotaxonomy_t *taxonomy);
+ecotx_t *eco_getfamily(ecotx_t *taxon,ecotaxonomy_t *taxonomy);
+ecotx_t *eco_getkingdom(ecotx_t *taxon,ecotaxonomy_t *taxonomy);
+ecotx_t *eco_getsuperkingdom(ecotx_t *taxon,ecotaxonomy_t *taxonomy);
+
+//int eco_is_taxid_ignored(int32_t *ignored_taxid, int32_t tab_len, int32_t taxid);
+//int eco_is_taxid_included(ecotaxonomy_t *taxonomy, int32_t *included_taxid, int32_t tab_len, int32_t taxid);
+
+
+ecotaxonomy_t *getTaxPointer(SEXP Rtaxonomy);
+
+#endif /*ECOPCR_H_*/
--- a/src/econame.c
+++ b/src/econame.c
@@ -0,0 +1,64 @@
+#include "ecoPCR.h"
+#include <string.h>
+#include <stdlib.h>
+
+static econame_t *readnext_econame(FILE *f,econame_t *name,ecotaxonomy_t *taxonomy);
+
+econameidx_t *read_nameidx(const char *filename,ecotaxonomy_t *taxonomy)
+{
+
+	int32_t      		count;
+	FILE         		*f;
+	econameidx_t		*indexname;
+	int32_t      		i;
+	
+	f = open_ecorecorddb(filename,&count,0);
+	
+	if (f==NULL)
+		return NULL;
+
+	indexname = (econameidx_t*) ECOMALLOC(sizeof(econameidx_t) + sizeof(econame_t) * (count-1),"Allocate names");
+	
+	indexname->count=count;
+	                                    
+	for (i=0; i < count; i++){
+		readnext_econame(f,(indexname->names)+i,taxonomy);
+	}
+
+	return indexname;
+}
+
+econame_t *readnext_econame(FILE *f,econame_t *name,ecotaxonomy_t *taxonomy)
+{
+	
+	econameformat_t *raw;
+	int32_t  rs;
+	
+	raw = read_ecorecord(f,&rs);
+	
+	if (!raw)
+		return NULL;
+
+	if (is_big_endian())
+	{
+		raw->is_scientificname 	= swap_int32_t(raw->is_scientificname);
+		raw->namelength 	    = swap_int32_t(raw->namelength);
+		raw->classlength        = swap_int32_t(raw->classlength);
+		raw->taxid  	        = swap_int32_t(raw->taxid); 
+	}
+	
+	name->is_scientificname=raw->is_scientificname;
+	
+	name->name   	= ECOMALLOC((raw->namelength+1) * sizeof(char),"Allocate name");
+	strncpy(name->name,raw->names,raw->namelength);
+	name->name[raw->namelength]=0;
+	
+	name->classname = ECOMALLOC((raw->classlength+1) * sizeof(char),"Allocate classname");
+	strncpy(name->classname,(raw->names+raw->namelength),raw->classlength);
+	name->classname[raw->classlength]=0;
+	
+	name->taxon = taxonomy->taxons->taxon + raw->taxid;
+
+	return name;
+}
+
--- a/src/econame.o
+++ b/src/econame.o
--- a/src/ecorank.c
+++ b/src/ecorank.c
@@ -0,0 +1,55 @@
+#include "ecoPCR.h"
+#include <string.h>
+#include <stdlib.h>
+
+static int compareRankLabel(const void *label1, const void *label2);
+
+ecorankidx_t     *read_rankidx(const char *filename)
+{
+	int32_t      count;
+	FILE         *f;
+	ecorankidx_t *index;
+	int32_t      i;
+	int32_t      rs;
+	char         *buffer;
+	
+	f = open_ecorecorddb(filename,&count,0);
+	
+	if (f==NULL)
+		return NULL;
+
+	index = (ecorankidx_t*) ECOMALLOC(sizeof(ecorankidx_t) + sizeof(char*) * (count-1),
+	                                  "Allocate rank index");
+	 
+	index->count=count;                                 
+	          
+	for (i=0; i < count; i++)
+		{
+			buffer = read_ecorecord(f,&rs);
+			index->label[i]=(char*) ECOMALLOC(rs+1,
+			                                  "Allocate rank label");
+			strncpy(index->label[i],buffer,rs);
+		}
+		
+	return index;
+}
+
+int32_t rank_index(const char* label,ecorankidx_t* ranks)
+{
+	char **rep;
+	
+	rep = bsearch(label,ranks->label,ranks->count,sizeof(char*),compareRankLabel);
+	
+	if (rep)
+		return rep-ranks->label;
+//	else
+//		ECOERROR(ECO_NOTFOUND_ERROR,"Rank label not found");
+		
+	return -1;
+}
+
+
+int compareRankLabel(const void *label1, const void *label2)
+{
+	return strcmp((const char*)label1,*(const char**)label2);
+}
--- a/src/ecorank.o
+++ b/src/ecorank.o
--- a/src/ecotax.c
+++ b/src/ecotax.c
@@ -0,0 +1,422 @@
+#include "ecoPCR.h"
+#include <string.h>
+#include <stdlib.h>
+#include <stdio.h>
+
+#include <R.h>
+
+#ifndef MAX
+#define MAX(x,y) (((x)>(y)) ? (x):(y))
+#endif
+
+static ecotx_t *readnext_ecotaxon(FILE *f,ecotx_t *taxon);
+
+ /** 
+ * Open the taxonomy database 
+ * @param	pointer to the database (.tdx file) 
+ * @return	a ecotxidx_t structure 
+ */
+ecotxidx_t     *read_taxonomyidx(const char *filename,const char *filename2)
+{
+	int32_t      count;
+	int32_t      count2;
+	FILE         *f;
+	FILE         *f2;
+	ecotxidx_t *index;
+	struct ecotxnode  *t;
+	int32_t      i;
+	int32_t      j;
+	
+	f  = open_ecorecorddb(filename,&count,0);
+
+	if (f==NULL) return NULL;
+
+	f2 = open_ecorecorddb(filename2,&count2,0);
+
+	index = (ecotxidx_t*) ECOMALLOC(sizeof(ecotxidx_t) + sizeof(ecotx_t) * (count+count2-1),
+	                                  "Allocate taxonomy");
+	 
+	index->count=count+count2;
+  index->buffersize = index->count;
+
+	index->maxtaxid=0;
+	REprintf("Readind %d taxa...\n",count);
+	for (i=0; i < count; i++){
+		readnext_ecotaxon(f,&(index->taxon[i]));
+		index->taxon[i].parent=index->taxon + (size_t)index->taxon[i].parent;
+		index->taxon[i].parent->farest=0;
+		if (index->taxon[i].taxid > index->maxtaxid)
+			index->maxtaxid=index->taxon[i].taxid;
+	}					
+
+
+	if (count2>0)
+		REprintf("Readind %d local taxa...\n",count2);
+	else
+		REprintf("No local taxon\n");
+
+	count = index->count;
+
+	for (; i < count; i++){
+		readnext_ecotaxon(f2,&(index->taxon[i]));
+		index->taxon[i].parent=index->taxon + (size_t)index->taxon[i].parent;
+		index->taxon[i].parent->farest=0;
+		if (index->taxon[i].taxid > index->maxtaxid)
+			index->maxtaxid=index->taxon[i].taxid;
+	}
+
+	REprintf("Computing longest branches...\n",count);
+
+	for (i=0; i < count; i++){
+		t=index->taxon+i;
+		if (t->farest==-1)
+		{
+			t->farest=0;
+            while(t->parent != t)
+            {
+            	j = t->farest + 1;
+            	if (j > t->parent->farest)
+            	{
+            		t->parent->farest = j;
+            		t=t->parent;
+            	}
+            	else
+            		t=index->taxon;
+            }
+		}
+	}
+
+	return index;
+}
+
+
+int32_t delete_taxonomy(ecotxidx_t *index)
+{
+	int32_t i;
+	
+	if (index)
+	{
+		for (i=0; i< index->count; i++)
+			if (index->taxon[i].name)
+				ECOFREE(index->taxon[i].name,"Free scientific name");
+				
+		ECOFREE(index,"Free Taxonomy");
+		
+		return 0;
+	}
+	
+	return 1;
+}
+
+
+
+int32_t delete_taxon(ecotx_t *taxon)
+{
+	if (taxon)
+	{
+		if (taxon->name)
+			ECOFREE(taxon->name,"Free scientific name");
+			
+		ECOFREE(taxon,"Free Taxon");
+		
+		return 0;
+	}
+		
+	return 1;
+}
+
+
+/**
+ * Read the database for a given taxon a save the data 
+ * into the taxon structure(if any found)
+ * @param	*f	pointer to FILE type returned by fopen
+ * @param	*taxon	pointer to the structure
+ * 
+ * @return	a ecotx_t structure if any taxon found else NULL 
+ */
+ecotx_t *readnext_ecotaxon(FILE *f,ecotx_t *taxon)
+{
+	
+	ecotxformat_t *raw;
+	int32_t  rs;
+	
+	raw = read_ecorecord(f,&rs);
+	
+	if (!raw)
+		return NULL;
+
+	if (is_big_endian())
+	{
+		raw->namelength = swap_int32_t(raw->namelength);
+		raw->parent     = swap_int32_t(raw->parent);
+		raw->rank       = swap_int32_t(raw->rank);
+		raw->taxid      = swap_int32_t(raw->taxid); 
+	}
+	
+	taxon->parent = (ecotx_t*)((size_t)raw->parent);
+	taxon->taxid  = raw->taxid;
+	taxon->rank   = raw->rank;
+	taxon->farest = -1;
+	
+	taxon->name   = ECOMALLOC((raw->namelength+1) * sizeof(char),
+	                          "Allocate taxon scientific name");
+	                          
+	strncpy(taxon->name,raw->name,raw->namelength);
+		
+	return taxon;
+}
+
+
+ecotaxonomy_t    *read_taxonomy(const char *prefix,int32_t readAlternativeName)
+{
+	ecotaxonomy_t *tax;
+	char          *filename;
+	char          *filename2;
+	int           buffsize;
+	
+	tax = ECOMALLOC(sizeof(ecotaxonomy_t),
+	                "Allocate taxonomy structure");
+	
+	tax->ranks =NULL;
+	tax->taxons=NULL;
+	tax->names =NULL;
+
+	buffsize = strlen(prefix)+10;
+	
+	filename = ECOMALLOC(buffsize,
+	                     "Allocate filename");
+	filename2= ECOMALLOC(buffsize,
+	                     "Allocate filename");
+	
+	snprintf(filename,buffsize,"%s.rdx",prefix);
+	
+	tax->ranks = read_rankidx(filename);
+
+	if (tax->ranks == NULL)
+	{
+		ECOFREE(filename,"Desallocate filename 1");
+		ECOFREE(filename2,"Desallocate filename 2");
+
+		delete_ecotaxonomy(tax);
+		return NULL;
+	}
+	
+	snprintf(filename,buffsize,"%s.tdx",prefix);
+	snprintf(filename2,buffsize,"%s.ldx",prefix);
+	
+	tax->taxons = read_taxonomyidx(filename,filename2);
+	
+	if (tax->taxons == NULL)
+	{
+		ECOFREE(filename,"Desallocate filename 1");
+		ECOFREE(filename,"Desallocate filename 2");
+
+		delete_ecotaxonomy(tax);
+		return NULL;
+	}
+
+	if (readAlternativeName)
+	{
+  	   snprintf(filename,buffsize,"%s.ndx",prefix);
+	   tax->names=read_nameidx(filename,tax);
+	}
+	else
+	   tax->names=NULL;
+
+	ECOFREE(filename,"Desallocate filename 1");
+	ECOFREE(filename2,"Desallocate filename 2");
+
+	return tax;
+	
+}
+
+
+
+int32_t delete_ecotaxonomy(ecotaxonomy_t *taxonomy)
+{
+	if (taxonomy)
+	{
+		if (taxonomy->ranks)
+			ECOFREE(taxonomy->ranks,"Free rank index");
+			
+		if (taxonomy->names)
+			ECOFREE(taxonomy->names,"Free names index");
+
+		if (taxonomy->taxons)
+			ECOFREE(taxonomy->taxons,"Free taxon index");
+			
+		ECOFREE(taxonomy,"Free taxonomy structure");
+		
+		return 0;
+	}
+	
+	return 1;
+}
+
+ecotx_t *eco_findtaxonatrank(ecotx_t *taxon,
+                                int32_t rankidx)
+{
+	ecotx_t *current_taxon;
+	ecotx_t *next_taxon;
+	
+	current_taxon = taxon;
+	next_taxon    = current_taxon->parent;
+	
+	while ((current_taxon!=next_taxon) &&  // I' am the root node
+		   (current_taxon->rank!=rankidx))
+		   {
+		   	current_taxon = next_taxon;
+		   	next_taxon    = current_taxon->parent;
+		   }
+		   
+	if (current_taxon->rank==rankidx)
+		return current_taxon;
+	else
+		return NULL;
+}
+
+/**
+ * Get back information concerning a taxon from a taxonomic id
+ * @param 	*taxonomy 	the taxonomy database
+ * @param	taxid		the taxonomic id 
+ * 
+ * @result	a ecotx_t structure containing the taxonimic information  
+ **/
+ecotx_t *eco_findtaxonbytaxid(ecotaxonomy_t *taxonomy, 
+							  int32_t taxid)
+{
+	ecotx_t    *current_taxon;
+	int32_t     taxoncount;
+	int32_t     i;
+	
+	taxoncount=taxonomy->taxons->count;
+	
+	for (current_taxon=taxonomy->taxons->taxon,
+	     i=0;
+	     i < taxoncount;
+	     i++,
+	     current_taxon++){
+	     if (current_taxon->taxid==taxid){
+	     	return current_taxon;
+	     }
+	 }
+	
+	return (ecotx_t*)NULL;	
+}
+
+/**
+ * Find out if taxon is son of other taxon (identified by its taxid)
+ * @param	*taxon son 		taxon
+ * @param	parent_taxid 	taxonomic id of the other taxon
+ * 
+ * @return 	1 is the other taxid math a parent taxid, else 0
+ **/
+int eco_isundertaxon(ecotx_t *taxon, 
+						int other_taxid)
+{
+	ecotx_t *next_parent;
+	
+	next_parent = taxon->parent;	
+	
+	while ( (other_taxid != next_parent->taxid) && 
+			(strcmp(next_parent->name, "root")) )
+	{
+		next_parent = next_parent->parent;
+	}
+		
+	if (other_taxid == next_parent->taxid)
+		return 1;
+	else
+		return 0;
+}
+
+ecotx_t *eco_getspecies(ecotx_t *taxon,
+						ecotaxonomy_t *taxonomy)
+{
+	static ecotaxonomy_t *tax=NULL;
+	static int32_t		 rankindex=-1;
+	
+	if (taxonomy && tax!=taxonomy)
+	{
+		rankindex = rank_index("species",taxonomy->ranks);
+		tax=taxonomy;
+	}
+		
+	if (!tax || rankindex < 0)
+		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
+		
+	return eco_findtaxonatrank(taxon,rankindex);
+}
+
+ecotx_t *eco_getgenus(ecotx_t *taxon,
+						ecotaxonomy_t *taxonomy)
+{
+	static ecotaxonomy_t *tax=NULL;
+	static int32_t		 rankindex=-1;
+	
+	if (taxonomy && tax!=taxonomy)
+	{
+		rankindex = rank_index("genus",taxonomy->ranks);
+		tax=taxonomy;
+	}
+		
+	if (!tax || rankindex < 0)
+		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
+		
+	return eco_findtaxonatrank(taxon,rankindex);
+}
+
+
+ecotx_t *eco_getfamily(ecotx_t *taxon,
+						ecotaxonomy_t *taxonomy)
+{
+	static ecotaxonomy_t *tax=NULL;
+	static int32_t		 rankindex=-1;
+	
+	if (taxonomy && tax!=taxonomy)
+	{
+		rankindex = rank_index("family",taxonomy->ranks);
+		tax=taxonomy;
+	}
+		
+	if (!tax || rankindex < 0)
+		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
+		
+	return eco_findtaxonatrank(taxon,rankindex);
+}
+
+ecotx_t *eco_getkingdom(ecotx_t *taxon,
+						ecotaxonomy_t *taxonomy)
+{
+	static ecotaxonomy_t *tax=NULL;
+	static int32_t		 rankindex=-1;
+	
+	if (taxonomy && tax!=taxonomy)
+	{
+		rankindex = rank_index("kingdom",taxonomy->ranks);
+		tax=taxonomy;
+	}
+		
+	if (!tax || rankindex < 0)
+		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
+		
+	return eco_findtaxonatrank(taxon,rankindex);
+}
+
+ecotx_t *eco_getsuperkingdom(ecotx_t *taxon,
+						ecotaxonomy_t *taxonomy)
+{
+	static ecotaxonomy_t *tax=NULL;
+	static int32_t		 rankindex=-1;
+	
+	if (taxonomy && tax!=taxonomy)
+	{
+		rankindex = rank_index("superkingdom",taxonomy->ranks);
+		tax=taxonomy;
+	}
+		
+	if (!tax || rankindex < 0)
+		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
+		
+	return eco_findtaxonatrank(taxon,rankindex);
+}
--- a/src/ecotax.o
+++ b/src/ecotax.o
--- a/src/robitax.h
+++ b/src/robitax.h
@@ -0,0 +1,6 @@
+#include "ecoPCR.h"
+
+
+ecotaxonomy_t *getTaxPointer(SEXP Rtaxonomy);
+SEXP R_delete_taxonomy(SEXP Rtaxonomy);
+
--- a/src/taxonomy.c
+++ b/src/taxonomy.c
@@ -0,0 +1,199 @@
+/*
+ * taxonomy.c
+ *
+ *  Created on: 17 janv. 2013
+ *      Author: coissac
+ */
+
+#include "robitax.h"
+
+
+static ecorankidx_t *new_bdbecorankidx(void);
+static ecotxidx_t *new_bdbecotxidx(int nbtaxa, int rootrank);
+
+static ecorankidx_t *new_bdbecorankidx(void)
+{
+  ecorankidx_t *index;
+  int i;
+  size_t size;
+  char* rank[]={"class",      "family",         "forma",
+                "genus",      "infraclass",     "infraorder",
+                "kingdom",    "motu",           "no rank",
+                "order",      "parvorder",      "phylum",
+                "species",    "species group",  "species subgroup",
+                "subclass",   "subfamily",      "subgenus",
+                "subkingdom", "suborder",       "subphylum",
+                "subspecies", "subtribe",       "superclass",
+                "superfamily","superkingdom",   "superorder",
+                "superphylum","tribe",          "varietas"};
+
+
+
+  index = (ecorankidx_t*) ECOMALLOC(sizeof(ecorankidx_t) + sizeof(char*) * (29),
+	                                  "Allocate rank index");
+
+  index->count=30;
+  for (i=0; i < index->count; i++)
+		{
+			size = strlen(rank[i]);
+			index->label[i]=(char*) ECOMALLOC(size+1,
+			                                  "Allocate rank label");
+			strcpy(index->label[i],rank[i]);
+		}
+
+	return index;
+}
+
+static ecotxidx_t *new_bdbecotxidx(int nbtaxa, int rootrank) {
+
+	  ecotxidx_t *index;
+	  int rootnamelen = 4; // "rootname="root"
+
+	  index = (ecotxidx_t*) ECOMALLOC(sizeof(ecotxidx_t) + sizeof(ecotx_t) * (nbtaxa),
+	                                    "Allocate taxonomy");
+
+	  //initialize the taxonomy with the root taxon
+	  index->count=nbtaxa+1;
+	  index->maxtaxid=1;
+	  index->buffersize=nbtaxa+1;
+
+	  // Create the root taxon
+	  index->taxon[0].taxid=1;
+	  index->taxon[0].rank=rootrank;
+	  index->taxon[0].farest=0;
+	  index->taxon[0].parent=(ecotx_t*)1;
+
+	  index->taxon[0].name= (char*) ECOMALLOC(sizeof(char) * rootnamelen +1,
+	                                          "Allocate taxonomy root name");
+
+	  strcpy(index->taxon[0].name, "root");
+
+	  return index;
+
+}
+
+static int cmptaxid(const void* t1, const void* t2) {
+	int et1 = ((ecotx_t*)t1)->taxid;
+	int et2 = ((ecotx_t*)t2)->taxid;
+
+	if (et1 < et2)
+		return -1;
+
+	if (et2 < et1)
+		return 1;
+
+	return 0;
+}
+
+static int findparentcmp(const void* p, const void* t) {
+	int parent = (int)p;
+	int et = ((ecotx_t*)t)->taxid;
+
+	if (parent < et)
+		return -1;
+
+	if (et < parent)
+		return 1;
+
+	return 0;
+}
+
+SEXP R_buildbarcodetaxo(SEXP rdata) {
+	SEXP names;
+	SEXP taxids;
+	SEXP ranks;
+	SEXP partofs;
+	SEXP Rtax;
+
+	int nbtaxa;
+	int rootrank;
+	int i;
+
+	int taxid;
+	char *name;
+	int rank;
+	int partof;
+
+	ecotxidx_t* parent;
+
+	taxids = getAttrib(rdata, R_RowNamesSymbol);
+	names  = VECTOR_ELT(rdata, 0);
+	ranks  = VECTOR_ELT(rdata, 1);
+	partofs= VECTOR_ELT(rdata, 2);
+
+	nbtaxa = GET_LENGTH(taxids);
+
+	ecotaxonomy_t *tax;
+
+	tax = ECOMALLOC(sizeof(ecotaxonomy_t),
+					"Allocate taxonomy structure");
+
+	tax->ranks =new_bdbecorankidx();
+
+	rootrank = rank_index("no rank",tax->ranks);
+
+	tax->taxons=new_bdbecotxidx(nbtaxa,rootrank);
+	tax->names =NULL;
+
+
+	for (i=0; i< nbtaxa; i++) {
+		taxid = atol(CHAR(STRING_ELT(taxids, i)) + 3);
+		name  = (char*) CHAR(STRING_ELT(names, i));
+		rank  = rank_index(CHAR(STRING_ELT(ranks, i)),tax->ranks);
+		partof = atol(CHAR(STRING_ELT(partofs, i)) + 3);
+
+    if (taxid > tax->taxons->maxtaxid)
+      tax->taxons->maxtaxid=taxid;
+
+		tax->taxons->taxon[i+1].taxid=taxid;
+		tax->taxons->taxon[i+1].rank=rootrank;
+		tax->taxons->taxon[i+1].farest=0;
+		tax->taxons->taxon[i+1].parent=(ecotx_t*)((size_t)partof);
+
+		tax->taxons->taxon[i+1].name= (char*) ECOMALLOC(sizeof(char) * strlen(name) +1,
+		                                          "Allocate taxonomy root name");
+
+		strcpy(tax->taxons->taxon[i+1].name, name);
+	}
+
+	qsort((void*)tax->taxons->taxon,nbtaxa+1,sizeof(ecotx_t),cmptaxid);
+
+	for (i=0; i< nbtaxa+1; i++) {
+		parent = (ecotxidx_t*) bsearch((void*)(tax->taxons->taxon[i].parent),
+				                       (void*)(tax->taxons->taxon),
+				                       nbtaxa+1,
+                               sizeof(ecotx_t),
+				                       findparentcmp);
+                               
+           
+		if (parent==NULL)
+			error("Error during taxonomy indexing");
+
+		tax->taxons->taxon[i].parent=(struct ecotxnode *)parent;
+	} 
+
+	Rtax = PROTECT(R_MakeExternalPtr(tax, mkString("ROBITools NCBI Taxonomy pointer"), R_NilValue));
+	R_RegisterCFinalizerEx(Rtax, (R_CFinalizer_t)R_delete_taxonomy,TRUE);
+
+	UNPROTECT(1);
+
+	return Rtax;
+
+}
+
+
+SEXP R_delete_taxonomy(SEXP Rtaxonomy)
+{
+	ecotaxonomy_t *ptax;
+	SEXP pointer;
+
+    ptax = (ecotaxonomy_t *) R_ExternalPtrAddr(Rtaxonomy);
+
+    (void) delete_ecotaxonomy(ptax);
+
+    // Clear the external pointer
+    R_ClearExternalPtr(Rtaxonomy);
+
+    return R_NilValue;
+
+}
--- a/src/taxonomy.o
+++ b/src/taxonomy.o