Files
obitools4/pkg/obikmer/encodekmer_test.go

832 lines
21 KiB
Go
Raw Normal View History

package obikmer
import (
"bytes"
"testing"
)
// TestEncodeKmersBasic tests basic k-mer encoding
func TestEncodeKmersBasic(t *testing.T) {
tests := []struct {
name string
seq string
k int
expected []uint64
}{
{
name: "simple 4-mer ACGT",
seq: "ACGT",
k: 4,
expected: []uint64{0b00011011}, // A=00, C=01, G=10, T=11 -> 00 01 10 11 = 27
},
{
name: "simple 2-mer AC",
seq: "AC",
k: 2,
expected: []uint64{0b0001}, // A=00, C=01 -> 00 01 = 1
},
{
name: "sliding 2-mer ACGT",
seq: "ACGT",
k: 2,
expected: []uint64{0b0001, 0b0110, 0b1011}, // AC=1, CG=6, GT=11
},
{
name: "lowercase",
seq: "acgt",
k: 4,
expected: []uint64{0b00011011},
},
{
name: "with U instead of T",
seq: "ACGU",
k: 4,
expected: []uint64{0b00011011}, // U encodes same as T
},
{
name: "8-mer",
seq: "ACGTACGT",
k: 8,
expected: []uint64{0b0001101100011011}, // ACGTACGT
},
{
name: "32-mer max size",
seq: "ACGTACGTACGTACGTACGTACGTACGTACGT",
k: 32,
expected: []uint64{0x1B1B1B1B1B1B1B1B}, // ACGTACGT repeated 4 times
},
{
name: "longer sequence sliding",
seq: "AAACCCGGG",
k: 3,
expected: []uint64{
0b000000, // AAA = 0
0b000001, // AAC = 1
0b000101, // ACC = 5
0b010101, // CCC = 21
0b010110, // CCG = 22
0b011010, // CGG = 26
0b101010, // GGG = 42
},
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
result := EncodeKmers([]byte(tt.seq), tt.k, nil)
if len(result) != len(tt.expected) {
t.Errorf("length mismatch: got %d, want %d", len(result), len(tt.expected))
return
}
for i, v := range result {
if v != tt.expected[i] {
t.Errorf("position %d: got %d (0b%b), want %d (0b%b)",
i, v, v, tt.expected[i], tt.expected[i])
}
}
})
}
}
// TestEncodeKmersEdgeCases tests edge cases
func TestEncodeKmersEdgeCases(t *testing.T) {
// Empty sequence
result := EncodeKmers([]byte{}, 4, nil)
if result != nil {
t.Errorf("empty sequence should return nil, got %v", result)
}
// k > sequence length
result = EncodeKmers([]byte("ACG"), 4, nil)
if result != nil {
t.Errorf("k > seq length should return nil, got %v", result)
}
// k = 0
result = EncodeKmers([]byte("ACGT"), 0, nil)
if result != nil {
t.Errorf("k=0 should return nil, got %v", result)
}
// k > 32
result = EncodeKmers([]byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGT"), 33, nil)
if result != nil {
t.Errorf("k>32 should return nil, got %v", result)
}
// k = sequence length (single k-mer)
result = EncodeKmers([]byte("ACGT"), 4, nil)
if len(result) != 1 {
t.Errorf("k=seq_len should return 1 k-mer, got %d", len(result))
}
}
// TestEncodeKmersBuffer tests buffer reuse
func TestEncodeKmersBuffer(t *testing.T) {
seq := []byte("ACGTACGTACGT")
k := 4
// First call without buffer
result1 := EncodeKmers(seq, k, nil)
// Second call with buffer - pre-allocate with capacity
buffer := make([]uint64, 0, 100)
result2 := EncodeKmers(seq, k, &buffer)
if len(result1) != len(result2) {
t.Errorf("buffer reuse: length mismatch %d vs %d", len(result1), len(result2))
}
for i := range result1 {
if result1[i] != result2[i] {
t.Errorf("buffer reuse: position %d mismatch", i)
}
}
// Verify results are correct
if len(result2) == 0 {
t.Errorf("result should not be empty")
}
// Test multiple calls with same buffer to verify no memory issues
for i := 0; i < 10; i++ {
result3 := EncodeKmers(seq, k, &buffer)
if len(result3) != len(result1) {
t.Errorf("iteration %d: length mismatch", i)
}
}
}
// TestEncodeKmersVariousLengths tests encoding with various sequence lengths
func TestEncodeKmersVariousLengths(t *testing.T) {
lengths := []int{1, 4, 8, 15, 16, 17, 31, 32, 33, 63, 64, 65, 100, 256, 1000}
k := 8
for _, length := range lengths {
// Generate test sequence
seq := make([]byte, length)
for i := range seq {
seq[i] = "ACGT"[i%4]
}
if length < k {
continue
}
t.Run("length_"+string(rune('0'+length/100))+string(rune('0'+(length%100)/10))+string(rune('0'+length%10)), func(t *testing.T) {
result := EncodeKmers(seq, k, nil)
expectedLen := length - k + 1
if len(result) != expectedLen {
t.Errorf("length mismatch: got %d, want %d", len(result), expectedLen)
}
})
}
}
// TestEncodeKmersLongSequence tests with a longer realistic sequence
func TestEncodeKmersLongSequence(t *testing.T) {
// Simulate a realistic DNA sequence
seq := bytes.Repeat([]byte("ACGTACGTNNACGTACGT"), 100)
k := 16
result := EncodeKmers(seq, k, nil)
expectedLen := len(seq) - k + 1
if len(result) != expectedLen {
t.Fatalf("length mismatch: got %d, want %d", len(result), expectedLen)
}
}
// BenchmarkEncodeKmers benchmarks the encoding function
func BenchmarkEncodeKmers(b *testing.B) {
// Create test sequences of various sizes
sizes := []int{100, 1000, 10000, 100000}
kSizes := []int{8, 16, 32}
for _, k := range kSizes {
for _, size := range sizes {
seq := make([]byte, size)
for i := range seq {
seq[i] = "ACGT"[i%4]
}
name := "k" + string(rune('0'+k/10)) + string(rune('0'+k%10)) + "_size" + string(rune('0'+size/10000)) + string(rune('0'+(size%10000)/1000)) + string(rune('0'+(size%1000)/100)) + string(rune('0'+(size%100)/10)) + string(rune('0'+size%10))
b.Run(name, func(b *testing.B) {
buffer := make([]uint64, 0, size)
b.ResetTimer()
b.SetBytes(int64(size))
for i := 0; i < b.N; i++ {
EncodeKmers(seq, k, &buffer)
}
})
}
}
}
// TestEncodeNucleotide verifies nucleotide encoding
func TestEncodeNucleotide(t *testing.T) {
testCases := []struct {
nucleotide byte
expected byte
}{
{'A', 0},
{'a', 0},
{'C', 1},
{'c', 1},
{'G', 2},
{'g', 2},
{'T', 3},
{'t', 3},
{'U', 3},
{'u', 3},
}
for _, tc := range testCases {
result := EncodeNucleotide(tc.nucleotide)
if result != tc.expected {
t.Errorf("EncodeNucleotide('%c') = %d, want %d",
tc.nucleotide, result, tc.expected)
}
}
}
// TestReverseComplement tests the reverse complement function
func TestReverseComplement(t *testing.T) {
tests := []struct {
name string
seq string
k int
expected string // expected reverse complement sequence
}{
{
name: "ACGT -> ACGT (palindrome)",
seq: "ACGT",
k: 4,
expected: "ACGT",
},
{
name: "AAAA -> TTTT",
seq: "AAAA",
k: 4,
expected: "TTTT",
},
{
name: "TTTT -> AAAA",
seq: "TTTT",
k: 4,
expected: "AAAA",
},
{
name: "CCCC -> GGGG",
seq: "CCCC",
k: 4,
expected: "GGGG",
},
{
name: "AACG -> CGTT",
seq: "AACG",
k: 4,
expected: "CGTT",
},
{
name: "AC -> GT",
seq: "AC",
k: 2,
expected: "GT",
},
{
name: "ACGTACGT -> ACGTACGT (palindrome)",
seq: "ACGTACGT",
k: 8,
expected: "ACGTACGT",
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
// Encode the input sequence
kmers := EncodeKmers([]byte(tt.seq), tt.k, nil)
if len(kmers) != 1 {
t.Fatalf("expected 1 k-mer, got %d", len(kmers))
}
// Compute reverse complement
rc := ReverseComplement(kmers[0], tt.k)
// Encode the expected reverse complement
expectedKmers := EncodeKmers([]byte(tt.expected), tt.k, nil)
if len(expectedKmers) != 1 {
t.Fatalf("expected 1 k-mer for expected, got %d", len(expectedKmers))
}
if rc != expectedKmers[0] {
t.Errorf("ReverseComplement(%s) = %d (0b%b), want %d (0b%b) for %s",
tt.seq, rc, rc, expectedKmers[0], expectedKmers[0], tt.expected)
}
})
}
}
// TestReverseComplementInvolution tests that RC(RC(x)) = x
func TestReverseComplementInvolution(t *testing.T) {
testSeqs := []string{"ACGT", "AAAA", "TTTT", "ACGTACGT", "AACGTTGC", "AC", "ACGTACGTACGTACGT", "ACGTACGTACGTACGTACGTACGTACGTACGT"}
for _, seq := range testSeqs {
k := len(seq)
kmers := EncodeKmers([]byte(seq), k, nil)
if len(kmers) != 1 {
continue
}
original := kmers[0]
rc := ReverseComplement(original, k)
rcrc := ReverseComplement(rc, k)
if rcrc != original {
t.Errorf("RC(RC(%s)) != %s: got %d, want %d", seq, seq, rcrc, original)
}
}
}
// TestNormalizeKmer tests the normalization function
func TestNormalizeKmer(t *testing.T) {
tests := []struct {
name string
seq string
k int
}{
{"ACGT palindrome", "ACGT", 4},
{"AAAA vs TTTT", "AAAA", 4},
{"TTTT vs AAAA", "TTTT", 4},
{"AACG vs CGTT", "AACG", 4},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
kmers := EncodeKmers([]byte(tt.seq), tt.k, nil)
if len(kmers) != 1 {
t.Fatalf("expected 1 k-mer, got %d", len(kmers))
}
kmer := kmers[0]
rc := ReverseComplement(kmer, tt.k)
normalized := NormalizeKmer(kmer, tt.k)
// Normalized should be the minimum
expectedNorm := kmer
if rc < kmer {
expectedNorm = rc
}
if normalized != expectedNorm {
t.Errorf("NormalizeKmer(%d) = %d, want %d", kmer, normalized, expectedNorm)
}
// Normalizing the RC should give the same result
normalizedRC := NormalizeKmer(rc, tt.k)
if normalizedRC != normalized {
t.Errorf("NormalizeKmer(RC) = %d, want %d (same as NormalizeKmer(fwd))", normalizedRC, normalized)
}
})
}
}
// TestEncodeNormalizedKmersBasic tests basic normalized k-mer encoding
func TestEncodeNormalizedKmersBasic(t *testing.T) {
// Test that a sequence and its reverse complement produce the same normalized k-mers
seq := []byte("AACGTT")
revComp := []byte("AACGTT") // This is a palindrome!
k := 4
kmers1 := EncodeNormalizedKmers(seq, k, nil)
kmers2 := EncodeNormalizedKmers(revComp, k, nil)
if len(kmers1) != len(kmers2) {
t.Fatalf("length mismatch: %d vs %d", len(kmers1), len(kmers2))
}
// For a palindrome, forward and reverse should give the same k-mers
for i := range kmers1 {
if kmers1[i] != kmers2[len(kmers2)-1-i] {
t.Logf("Note: position %d differs (expected for non-palindromic sequences)", i)
}
}
}
// TestEncodeNormalizedKmersSymmetry tests that seq and its RC produce same normalized k-mers (reversed)
func TestEncodeNormalizedKmersSymmetry(t *testing.T) {
// Manually construct a sequence and its reverse complement
seq := []byte("ACGTAACCGG")
// Compute reverse complement manually
rcMap := map[byte]byte{'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A'}
revComp := make([]byte, len(seq))
for i, b := range seq {
revComp[len(seq)-1-i] = rcMap[b]
}
k := 4
kmers1 := EncodeNormalizedKmers(seq, k, nil)
kmers2 := EncodeNormalizedKmers(revComp, k, nil)
if len(kmers1) != len(kmers2) {
t.Fatalf("length mismatch: %d vs %d", len(kmers1), len(kmers2))
}
// The normalized k-mers should be the same but in reverse order
for i := range kmers1 {
j := len(kmers2) - 1 - i
if kmers1[i] != kmers2[j] {
t.Errorf("position %d vs %d: %d != %d", i, j, kmers1[i], kmers2[j])
}
}
}
// TestEncodeNormalizedKmersConsistency verifies normalized k-mers match manual normalization
func TestEncodeNormalizedKmersConsistency(t *testing.T) {
seq := []byte("ACGTACGTACGTACGT")
k := 8
// Get k-mers both ways
rawKmers := EncodeKmers(seq, k, nil)
normalizedKmers := EncodeNormalizedKmers(seq, k, nil)
if len(rawKmers) != len(normalizedKmers) {
t.Fatalf("length mismatch: %d vs %d", len(rawKmers), len(normalizedKmers))
}
// Verify each normalized k-mer matches manual normalization
for i, raw := range rawKmers {
expected := NormalizeKmer(raw, k)
if normalizedKmers[i] != expected {
t.Errorf("position %d: EncodeNormalizedKmers gave %d, NormalizeKmer gave %d",
i, normalizedKmers[i], expected)
}
}
}
// BenchmarkEncodeNormalizedKmers benchmarks the normalized encoding function
func BenchmarkEncodeNormalizedKmers(b *testing.B) {
sizes := []int{100, 1000, 10000, 100000}
kSizes := []int{8, 16, 32}
for _, k := range kSizes {
for _, size := range sizes {
seq := make([]byte, size)
for i := range seq {
seq[i] = "ACGT"[i%4]
}
name := "k" + string(rune('0'+k/10)) + string(rune('0'+k%10)) + "_size" + string(rune('0'+size/10000)) + string(rune('0'+(size%10000)/1000)) + string(rune('0'+(size%1000)/100)) + string(rune('0'+(size%100)/10)) + string(rune('0'+size%10))
b.Run(name, func(b *testing.B) {
buffer := make([]uint64, 0, size)
b.ResetTimer()
b.SetBytes(int64(size))
for i := 0; i < b.N; i++ {
EncodeNormalizedKmers(seq, k, &buffer)
}
})
}
}
}
// BenchmarkReverseComplement benchmarks the reverse complement function
func BenchmarkReverseComplement(b *testing.B) {
kmer := uint64(0x123456789ABCDEF0)
k := 32
b.ResetTimer()
for i := 0; i < b.N; i++ {
ReverseComplement(kmer, k)
}
}
// BenchmarkNormalizeKmer benchmarks the normalization function
func BenchmarkNormalizeKmer(b *testing.B) {
kmer := uint64(0x123456789ABCDEF0)
k := 32
b.ResetTimer()
for i := 0; i < b.N; i++ {
NormalizeKmer(kmer, k)
}
}
// TestExtractSuperKmersBasic tests basic super k-mer extraction
func TestExtractSuperKmersBasic(t *testing.T) {
tests := []struct {
name string
seq string
k int
m int
validate func(*testing.T, []SuperKmer)
}{
{
name: "simple sequence",
seq: "ACGTACGTACGT",
k: 5,
m: 3,
validate: func(t *testing.T, sks []SuperKmer) {
if len(sks) == 0 {
t.Error("expected at least one super k-mer")
}
// Verify all super k-mers cover the sequence
totalLen := 0
for _, sk := range sks {
totalLen += sk.End - sk.Start
if string(sk.Sequence) != string([]byte(t.Name())[len(t.Name())-len(sk.Sequence):]) {
// Just verify Start/End matches Sequence
if string(sk.Sequence) != string([]byte("ACGTACGTACGT")[sk.Start:sk.End]) {
t.Errorf("Sequence mismatch: seq[%d:%d] != %s", sk.Start, sk.End, sk.Sequence)
}
}
}
},
},
{
name: "single k-mer sequence",
seq: "ACGTACGT",
k: 8,
m: 4,
validate: func(t *testing.T, sks []SuperKmer) {
if len(sks) != 1 {
t.Errorf("expected exactly 1 super k-mer for len(seq)==k, got %d", len(sks))
}
if len(sks) > 0 {
if sks[0].Start != 0 || sks[0].End != 8 {
t.Errorf("expected [0:8], got [%d:%d]", sks[0].Start, sks[0].End)
}
}
},
},
{
name: "repeating sequence",
seq: "AAAAAAAAAA",
k: 5,
m: 3,
validate: func(t *testing.T, sks []SuperKmer) {
// Repeating A should have same minimizer (AAA) everywhere
if len(sks) != 1 {
t.Errorf("expected 1 super k-mer for repeating sequence, got %d", len(sks))
}
if len(sks) > 0 {
if sks[0].Start != 0 || sks[0].End != 10 {
t.Errorf("expected super k-mer to cover entire sequence [0:10], got [%d:%d]",
sks[0].Start, sks[0].End)
}
}
},
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
result := ExtractSuperKmers([]byte(tt.seq), tt.k, tt.m, nil)
tt.validate(t, result)
})
}
}
// TestExtractSuperKmersEdgeCases tests edge cases and error handling
func TestExtractSuperKmersEdgeCases(t *testing.T) {
tests := []struct {
name string
seq string
k int
m int
expectNil bool
}{
{"empty sequence", "", 5, 3, true},
{"seq shorter than k", "ACG", 5, 3, true},
{"m < 1", "ACGTACGT", 5, 0, true},
{"m >= k", "ACGTACGT", 5, 5, true},
{"m == k-1 (valid)", "ACGTACGT", 5, 4, false},
{"k < 2", "ACGTACGT", 1, 1, true},
{"k > 32", "ACGTACGTACGTACGTACGTACGTACGTACGTACGT", 33, 16, true},
{"k == 32 (valid)", "ACGTACGTACGTACGTACGTACGTACGTACGT", 32, 16, false},
{"seq == k (valid)", "ACGTACGT", 8, 4, false},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
result := ExtractSuperKmers([]byte(tt.seq), tt.k, tt.m, nil)
if tt.expectNil && result != nil {
t.Errorf("expected nil, got %v", result)
}
if !tt.expectNil && result == nil {
t.Errorf("expected non-nil result, got nil")
}
})
}
}
// TestExtractSuperKmersBoundaries verifies Start/End positions
func TestExtractSuperKmersBoundaries(t *testing.T) {
seq := []byte("ACGTACGTGGGGAAAA")
k := 6
m := 3
result := ExtractSuperKmers(seq, k, m, nil)
if result == nil {
t.Fatal("expected non-nil result")
}
// Verify each super k-mer
for i, sk := range result {
// Verify Start < End
if sk.Start >= sk.End {
t.Errorf("super k-mer %d: Start (%d) >= End (%d)", i, sk.Start, sk.End)
}
// Verify Sequence matches seq[Start:End]
expected := string(seq[sk.Start:sk.End])
actual := string(sk.Sequence)
if actual != expected {
t.Errorf("super k-mer %d: Sequence mismatch: got %s, want %s", i, actual, expected)
}
// Verify bounds are within sequence
if sk.Start < 0 || sk.End > len(seq) {
t.Errorf("super k-mer %d: bounds [%d:%d] outside sequence length %d",
i, sk.Start, sk.End, len(seq))
}
// Verify minimum length is k
if sk.End-sk.Start < k {
t.Errorf("super k-mer %d: length %d < k=%d", i, sk.End-sk.Start, k)
}
}
// Verify super k-mers can overlap (by up to k-1 bases) but must be ordered
// and the overlap should not exceed k-1
for i := 0; i < len(result)-1; i++ {
// Next super k-mer should start before or at the end of current one
// Overlap is allowed and expected
overlap := result[i].End - result[i+1].Start
if overlap > k-1 {
t.Errorf("super k-mers %d and %d overlap by %d bases (max allowed: %d): [%d:%d] and [%d:%d]",
i, i+1, overlap, k-1, result[i].Start, result[i].End, result[i+1].Start, result[i+1].End)
}
// But the start positions should be ordered
if result[i+1].Start < result[i].Start {
t.Errorf("super k-mers %d and %d are not ordered: [%d:%d] and [%d:%d]",
i, i+1, result[i].Start, result[i].End, result[i+1].Start, result[i+1].End)
}
}
}
// TestExtractSuperKmersBufferReuse tests buffer parameter
func TestExtractSuperKmersBufferReuse(t *testing.T) {
seq := []byte("ACGTACGTACGTACGT")
k := 6
m := 3
// First call without buffer
result1 := ExtractSuperKmers(seq, k, m, nil)
// Second call with buffer
buffer := make([]SuperKmer, 0, 100)
result2 := ExtractSuperKmers(seq, k, m, &buffer)
if len(result1) != len(result2) {
t.Errorf("buffer reuse: length mismatch %d vs %d", len(result1), len(result2))
}
for i := range result1 {
if result1[i].Minimizer != result2[i].Minimizer {
t.Errorf("position %d: minimizer mismatch", i)
}
if result1[i].Start != result2[i].Start || result1[i].End != result2[i].End {
t.Errorf("position %d: boundary mismatch", i)
}
}
// Test multiple calls with same buffer
for i := 0; i < 10; i++ {
result3 := ExtractSuperKmers(seq, k, m, &buffer)
if len(result3) != len(result1) {
t.Errorf("iteration %d: length mismatch", i)
}
}
}
// TestExtractSuperKmersCanonical verifies minimizers are canonical
func TestExtractSuperKmersCanonical(t *testing.T) {
seq := []byte("ACGTACGTACGT")
k := 6
m := 3
result := ExtractSuperKmers(seq, k, m, nil)
if result == nil {
t.Fatal("expected non-nil result")
}
for i, sk := range result {
// Verify the minimizer is indeed canonical (equal to its normalized form)
normalized := NormalizeKmer(sk.Minimizer, m)
if sk.Minimizer != normalized {
t.Errorf("super k-mer %d: minimizer %d is not canonical (normalized: %d)",
i, sk.Minimizer, normalized)
}
// The minimizer should be <= its reverse complement
rc := ReverseComplement(sk.Minimizer, m)
if sk.Minimizer > rc {
t.Errorf("super k-mer %d: minimizer %d > reverse complement %d (not canonical)",
i, sk.Minimizer, rc)
}
}
}
// TestExtractSuperKmersVariousKM tests various k and m combinations
func TestExtractSuperKmersVariousKM(t *testing.T) {
seq := []byte("ACGTACGTACGTACGTACGTACGT")
configs := []struct {
k int
m int
}{
{5, 3},
{8, 4},
{10, 5},
{16, 8},
{21, 11},
{6, 5}, // m = k-1
{4, 2},
}
for _, cfg := range configs {
t.Run("k"+string(rune('0'+cfg.k/10))+string(rune('0'+cfg.k%10))+"_m"+string(rune('0'+cfg.m/10))+string(rune('0'+cfg.m%10)), func(t *testing.T) {
if len(seq) < cfg.k {
t.Skip("sequence too short for this k")
}
result := ExtractSuperKmers(seq, cfg.k, cfg.m, nil)
if result == nil {
t.Fatal("expected non-nil result for valid parameters")
}
if len(result) == 0 {
t.Error("expected at least one super k-mer")
}
// Verify each super k-mer has minimum length k
for i, sk := range result {
length := sk.End - sk.Start
if length < cfg.k {
t.Errorf("super k-mer %d has length %d < k=%d", i, length, cfg.k)
}
}
})
}
}
// BenchmarkExtractSuperKmers benchmarks the super k-mer extraction
func BenchmarkExtractSuperKmers(b *testing.B) {
sizes := []int{100, 1000, 10000, 100000}
configs := []struct {
k int
m int
}{
{21, 11},
{31, 15},
{16, 8},
{10, 5},
}
for _, cfg := range configs {
for _, size := range sizes {
seq := make([]byte, size)
for i := range seq {
seq[i] = "ACGT"[i%4]
}
name := "k" + string(rune('0'+cfg.k/10)) + string(rune('0'+cfg.k%10)) +
"_m" + string(rune('0'+cfg.m/10)) + string(rune('0'+cfg.m%10)) +
"_size" + string(rune('0'+(size/10000)%10)) +
string(rune('0'+(size/1000)%10)) +
string(rune('0'+(size/100)%10)) +
string(rune('0'+(size/10)%10)) +
string(rune('0'+size%10))
b.Run(name, func(b *testing.B) {
buffer := make([]SuperKmer, 0, size/cfg.k)
b.ResetTimer()
b.SetBytes(int64(size))
for i := 0; i < b.N; i++ {
ExtractSuperKmers(seq, cfg.k, cfg.m, &buffer)
}
})
}
}
}