mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-04-30 03:50:39 +00:00
348 lines
14 KiB
Markdown
348 lines
14 KiB
Markdown
|
|
# NAME
|
||
|
|
|
||
|
|
obiuniq — dereplicate sequence data sets
|
||
|
|
|
||
|
|
---
|
||
|
|
|
||
|
|
# SYNOPSIS
|
||
|
|
|
||
|
|
```
|
||
|
|
obiuniq [--batch-mem <string>] [--batch-size <int>] [--batch-size-max <int>]
|
||
|
|
[--category-attribute|-c <CATEGORY>]... [--chunk-count <int>]
|
||
|
|
[--compress|-Z] [--csv] [--debug] [--ecopcr] [--embl]
|
||
|
|
[--fail-on-taxonomy] [--fasta] [--fasta-output] [--fastq]
|
||
|
|
[--fastq-output] [--genbank] [--help|-h|-?] [--in-memory]
|
||
|
|
[--input-OBI-header] [--input-json-header] [--json-output]
|
||
|
|
[--max-cpu <int>] [--merge|-m <KEY>]... [--na-value <NA_NAME>]
|
||
|
|
[--no-order] [--no-progressbar] [--no-singleton]
|
||
|
|
[--out|-o <FILENAME>] [--output-OBI-header|-O] [--output-json-header]
|
||
|
|
[--pprof] [--pprof-goroutine <int>] [--pprof-mutex <int>]
|
||
|
|
[--raw-taxid] [--silent-warning] [--skip-empty] [--solexa]
|
||
|
|
[--taxonomy|-t <string>] [--u-to-t] [--update-taxid] [--version]
|
||
|
|
[--with-leaves] [<args>]
|
||
|
|
```
|
||
|
|
|
||
|
|
---
|
||
|
|
|
||
|
|
# DESCRIPTION
|
||
|
|
|
||
|
|
`obiuniq` groups identical sequences together and replaces them with a single
|
||
|
|
representative, recording the total number of original occurrences as an
|
||
|
|
abundance count. This process — called dereplication — is a standard step in
|
||
|
|
amplicon sequencing workflows: it dramatically reduces the number of sequence
|
||
|
|
records to process, while preserving exact counts needed for downstream
|
||
|
|
statistical analyses.
|
||
|
|
|
||
|
|
By default, two sequences are considered identical if and only if their
|
||
|
|
nucleotide strings are the same. Using `--category-attribute` (repeatable),
|
||
|
|
additional metadata fields can be included in the identity criterion. For
|
||
|
|
example, grouping by sample name keeps the same sequence as separate records
|
||
|
|
when it occurs in different samples, enabling per-sample abundance tracking.
|
||
|
|
|
||
|
|
For each group of identical sequences, `obiuniq` emits one output record
|
||
|
|
carrying the merged metadata of all members. The `--merge` option (repeatable)
|
||
|
|
instructs the command to also record, in an attribute named `merged_<KEY>`, the
|
||
|
|
distribution of `KEY` attribute values across the sequences collapsed into each
|
||
|
|
group — useful for provenance tracking and quality control. <!-- corrected: actual attribute name is merged_KEY (not KEY); tracks attribute value distributions, not a list of sequence IDs -->
|
||
|
|
|
||
|
|
Sequences that appear only once in the entire dataset (singletons) can be
|
||
|
|
removed with `--no-singleton`. Singletons often represent sequencing errors
|
||
|
|
rather than genuine biological variants, so their removal is a common
|
||
|
|
noise-reduction step.
|
||
|
|
|
||
|
|
---
|
||
|
|
|
||
|
|
# INPUT
|
||
|
|
|
||
|
|
`obiuniq` accepts biological sequence data in FASTA, FASTQ, EMBL, GenBank,
|
||
|
|
ecoPCR, or CSV format (auto-detected by default, or forced with format flags
|
||
|
|
such as `--fasta`, `--fastq`, `--embl`, etc.). Input is read from one or more
|
||
|
|
files given as positional arguments, or from standard input when no files are
|
||
|
|
provided.
|
||
|
|
|
||
|
|
When multiple input files are provided, `obiuniq` assumes they are ordered
|
||
|
|
(e.g., paired-end reads in the same read order). If no such ordering exists,
|
||
|
|
use `--no-order` to signal that files can be consumed independently.
|
||
|
|
|
||
|
|
FASTA/FASTQ header annotations are parsed heuristically by default. Use
|
||
|
|
`--input-OBI-header` for OBI-formatted headers or `--input-json-header` for
|
||
|
|
JSON-formatted headers. RNA sequences can be normalised to DNA on the fly with
|
||
|
|
`--u-to-t`.
|
||
|
|
|
||
|
|
---
|
||
|
|
|
||
|
|
# OUTPUT
|
||
|
|
|
||
|
|
`obiuniq` writes dereplicated sequences to standard output or to the file
|
||
|
|
specified by `--out`. Each output record represents one group of identical
|
||
|
|
sequences (identical under the chosen grouping criterion). The output carries
|
||
|
|
the merged metadata from all input records in the group.
|
||
|
|
|
||
|
|
The output format defaults to FASTA. Even when the input contains quality
|
||
|
|
scores (FASTQ), quality information is not preserved across merged sequences,
|
||
|
|
so the output is written in FASTA format unless `--fastq-output` is explicitly
|
||
|
|
requested. <!-- corrected: actual output is always FASTA when dereplicating; quality scores are dropped during merging -->
|
||
|
|
Output annotations follow the OBI header format when `--output-OBI-header` is
|
||
|
|
set, or JSON when `--output-json-header` is set. The output can be
|
||
|
|
gzip-compressed with `--compress`.
|
||
|
|
|
||
|
|
For each output record:
|
||
|
|
- The abundance count reflects how many input sequences were merged into the
|
||
|
|
group.
|
||
|
|
- Attributes created by `--merge KEY` are named `merged_KEY` and map each
|
||
|
|
observed value of the `KEY` attribute to the count of input sequences
|
||
|
|
carrying that value within the group. <!-- corrected: attribute name is merged_KEY; value is a map not a list -->
|
||
|
|
- All other attributes are merged from the contributing records according to
|
||
|
|
the standard OBITools4 merging rules.
|
||
|
|
|
||
|
|
## Observed output example
|
||
|
|
|
||
|
|
```
|
||
|
|
>seq008 {"count":1,"primer":"p1"}
|
||
|
|
cccccccccccccccccccc
|
||
|
|
>seq001 {"count":4,"primer":"p1"}
|
||
|
|
atcgatcgatcgatcgatcg
|
||
|
|
>seq004 {"count":2,"primer":"p1","sample":"s1"}
|
||
|
|
gctagctagctagctagcta
|
||
|
|
>seq007 {"count":1,"primer":"p1","sample":"s2"}
|
||
|
|
tttttttttttttttttttt
|
||
|
|
```
|
||
|
|
|
||
|
|
---
|
||
|
|
|
||
|
|
# OPTIONS
|
||
|
|
|
||
|
|
## Dereplication Options
|
||
|
|
|
||
|
|
**`--category-attribute|-c <CATEGORY>`** (default: `[]`)
|
||
|
|
Adds one metadata attribute to the grouping criterion. Two sequences are
|
||
|
|
placed in the same group only when they are nucleotide-identical **and** share
|
||
|
|
the same value for every attribute listed with `-c`. This option can be
|
||
|
|
repeated to combine multiple attributes (e.g., `-c sample -c primer`).
|
||
|
|
Records that lack a listed attribute receive the value set by `--na-value`.
|
||
|
|
|
||
|
|
**`--chunk-count <int>`** (default: `100`)
|
||
|
|
Controls how many internal partitions the dataset is split into during
|
||
|
|
processing. A higher value reduces per-partition memory usage at the cost of
|
||
|
|
more temporary files; a lower value increases per-partition memory but reduces
|
||
|
|
I/O overhead. Tune this when processing very large or very small datasets.
|
||
|
|
|
||
|
|
**`--in-memory`** (default: `false`)
|
||
|
|
Stores intermediate data chunks in RAM rather than in temporary disk files.
|
||
|
|
Speeds up processing on datasets that fit comfortably in available memory;
|
||
|
|
omit this flag (the default) for large datasets that exceed available RAM.
|
||
|
|
|
||
|
|
**`--merge|-m <KEY>`** (default: `[]`)
|
||
|
|
Creates an output attribute named `merged_KEY` that maps each observed value
|
||
|
|
of the `KEY` attribute to the count of input sequences carrying that value
|
||
|
|
within the group. Repeat to track multiple attributes. <!-- corrected: actual attribute name is merged_KEY (not KEY); value is a map of attribute values to counts, not a list of sequence IDs -->
|
||
|
|
Useful for tracking which sample or category contributions were collapsed into each group.
|
||
|
|
|
||
|
|
**`--na-value <NA_NAME>`** (default: `"NA"`)
|
||
|
|
Value assigned to a category attribute when a sequence record does not carry
|
||
|
|
that attribute. All sequences lacking the attribute are grouped together under
|
||
|
|
this placeholder, rather than being treated as incomparable.
|
||
|
|
|
||
|
|
**`--no-singleton`** (default: `false`)
|
||
|
|
Discards all output records whose abundance count is exactly one — i.e.,
|
||
|
|
sequences that occur only once across the entire input. Removing singletons
|
||
|
|
is a standard heuristic for excluding sequencing errors from further analysis.
|
||
|
|
|
||
|
|
## Input Options
|
||
|
|
|
||
|
|
**`--batch-mem <string>`** (default: `""`, env: `OBIBATCHMEM`)
|
||
|
|
Maximum memory budget per processing batch (e.g. `128K`, `64M`, `1G`). Set
|
||
|
|
to `0` to disable the memory ceiling. Overrides `--batch-size-max` when
|
||
|
|
both are set.
|
||
|
|
|
||
|
|
**`--batch-size <int>`** (default: `10`, env: `OBIBATCHSIZE`)
|
||
|
|
Minimum number of sequences per batch (floor).
|
||
|
|
|
||
|
|
**`--batch-size-max <int>`** (default: `2000`, env: `OBIBATCHSIZEMAX`)
|
||
|
|
Maximum number of sequences per batch (ceiling).
|
||
|
|
|
||
|
|
**`--csv`** (default: `false`)
|
||
|
|
Parse input as CSV format.
|
||
|
|
|
||
|
|
**`--ecopcr`** (default: `false`)
|
||
|
|
Parse input as ecoPCR output format.
|
||
|
|
|
||
|
|
**`--embl`** (default: `false`)
|
||
|
|
Parse input as EMBL flatfile format.
|
||
|
|
|
||
|
|
**`--fasta`** (default: `false`)
|
||
|
|
Parse input as FASTA format.
|
||
|
|
|
||
|
|
**`--fastq`** (default: `false`)
|
||
|
|
Parse input as FASTQ format.
|
||
|
|
|
||
|
|
**`--genbank`** (default: `false`)
|
||
|
|
Parse input as GenBank flatfile format.
|
||
|
|
|
||
|
|
**`--input-OBI-header`** (default: `false`)
|
||
|
|
Treat FASTA/FASTQ title line annotations as OBI-format key=value pairs.
|
||
|
|
|
||
|
|
**`--input-json-header`** (default: `false`)
|
||
|
|
Treat FASTA/FASTQ title line annotations as JSON objects.
|
||
|
|
|
||
|
|
**`--no-order`** (default: `false`)
|
||
|
|
When multiple input files are provided, indicates that there is no ordering
|
||
|
|
relationship among them.
|
||
|
|
|
||
|
|
**`--skip-empty`** (default: `false`)
|
||
|
|
Suppress sequences of length zero from the output.
|
||
|
|
|
||
|
|
**`--solexa`** (default: `false`, env: `OBISOLEXA`)
|
||
|
|
Decode quality strings according to the Solexa specification rather than the
|
||
|
|
standard Phred encoding.
|
||
|
|
|
||
|
|
**`--u-to-t`** (default: `false`)
|
||
|
|
Convert uracil (U) to thymine (T) in all input sequences, normalising RNA to
|
||
|
|
DNA representation.
|
||
|
|
|
||
|
|
## Output Options
|
||
|
|
|
||
|
|
**`--compress|-Z`** (default: `false`)
|
||
|
|
Compress output using gzip.
|
||
|
|
|
||
|
|
**`--fasta-output`** (default: `false`)
|
||
|
|
Write output in FASTA format (default when no quality scores are available).
|
||
|
|
|
||
|
|
**`--fastq-output`** (default: `false`)
|
||
|
|
Write output in FASTQ format (default when quality scores are present).
|
||
|
|
|
||
|
|
**`--json-output`** (default: `false`)
|
||
|
|
Write output in JSON format.
|
||
|
|
|
||
|
|
**`--out|-o <FILENAME>`** (default: `"-"`)
|
||
|
|
Write output to the specified file instead of standard output.
|
||
|
|
|
||
|
|
**`--output-OBI-header|-O`** (default: `false`)
|
||
|
|
Write FASTA/FASTQ title line annotations in OBI format.
|
||
|
|
|
||
|
|
**`--output-json-header`** (default: `false`)
|
||
|
|
Write FASTA/FASTQ title line annotations in JSON format.
|
||
|
|
|
||
|
|
## Taxonomy Options
|
||
|
|
|
||
|
|
**`--fail-on-taxonomy`** (default: `false`)
|
||
|
|
Cause `obiuniq` to exit with an error if a taxid in the data is not a
|
||
|
|
currently valid taxon in the loaded taxonomy.
|
||
|
|
|
||
|
|
**`--raw-taxid`** (default: `false`)
|
||
|
|
Print taxids in output without supplementary information (taxon name and rank).
|
||
|
|
|
||
|
|
**`--taxonomy|-t <string>`** (default: `""`)
|
||
|
|
Path to the taxonomy database used to validate or update taxids.
|
||
|
|
|
||
|
|
**`--update-taxid`** (default: `false`)
|
||
|
|
Automatically replace merged taxids with the most recent valid taxid.
|
||
|
|
|
||
|
|
**`--with-leaves`** (default: `false`)
|
||
|
|
When taxonomy is extracted from a sequence file, add sequences as leaves of
|
||
|
|
their taxid annotation.
|
||
|
|
|
||
|
|
## Execution Options
|
||
|
|
|
||
|
|
**`--max-cpu <int>`** (default: `16`, env: `OBIMAXCPU`)
|
||
|
|
Number of parallel threads used to compute the result.
|
||
|
|
|
||
|
|
**`--debug`** (default: `false`, env: `OBIDEBUG`)
|
||
|
|
Enable debug mode by setting the log level to debug.
|
||
|
|
|
||
|
|
**`--no-progressbar`** (default: `false`)
|
||
|
|
Disable the progress bar.
|
||
|
|
|
||
|
|
**`--silent-warning`** (default: `false`, env: `OBIWARNING`)
|
||
|
|
Suppress warning messages.
|
||
|
|
|
||
|
|
**`--pprof`** (default: `false`)
|
||
|
|
Enable the pprof profiling server (address logged at startup).
|
||
|
|
|
||
|
|
**`--pprof-goroutine <int>`** (default: `6060`, env: `OBIPPROFGOROUTINE`)
|
||
|
|
Port for the goroutine blocking profile endpoint.
|
||
|
|
|
||
|
|
**`--pprof-mutex <int>`** (default: `10`, env: `OBIPPROFMUTEX`)
|
||
|
|
Rate for the mutex contention profile.
|
||
|
|
|
||
|
|
**`--version`** (default: `false`)
|
||
|
|
Print the version string and exit.
|
||
|
|
|
||
|
|
**`--help|-h|-?`** (default: `false`)
|
||
|
|
Print usage information and exit.
|
||
|
|
|
||
|
|
---
|
||
|
|
|
||
|
|
# EXAMPLES
|
||
|
|
|
||
|
|
```bash
|
||
|
|
# Dereplicate a FASTQ file of amplicon reads; write unique sequences to a FASTA output file.
|
||
|
|
obiuniq reads.fastq -o out_basic.fastq
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 4 sequences written to `out_basic.fastq`.
|
||
|
|
|
||
|
|
```bash
|
||
|
|
# Dereplicate keeping sequences separate per sample (category attribute),
|
||
|
|
# and discard singletons to remove likely sequencing errors.
|
||
|
|
obiuniq -c sample --no-singleton reads.fastq -o out_no_singleton.fastq
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 2 sequences written to `out_no_singleton.fastq`.
|
||
|
|
|
||
|
|
```bash
|
||
|
|
# Dereplicate per sample, recording the sample distribution in 'merged_sample',
|
||
|
|
# and use 'UNKNOWN' for reads missing the sample attribute.
|
||
|
|
obiuniq -c sample --merge sample --na-value UNKNOWN reads.fastq -o out_merge.fastq
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 5 sequences written to `out_merge.fastq`.
|
||
|
|
|
||
|
|
```bash
|
||
|
|
# Process a dataset entirely in memory using 200 internal partitions,
|
||
|
|
# writing gzip-compressed output.
|
||
|
|
obiuniq --in-memory --chunk-count 200 --compress -o out_inmemory.fastq.gz reads.fastq
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 4 sequences written to `out_inmemory.fastq.gz`.
|
||
|
|
|
||
|
|
```bash
|
||
|
|
# Dereplicate reads from two sample files with no assumed ordering between them,
|
||
|
|
# grouping by both sample and primer attributes.
|
||
|
|
obiuniq --no-order -c sample -c primer sample1.fastq sample2.fastq -o out_multifile.fastq
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 4 sequences written to `out_multifile.fastq`.
|
||
|
|
|
||
|
|
---
|
||
|
|
|
||
|
|
# SEE ALSO
|
||
|
|
|
||
|
|
- `obigrep` — filter dereplicated sequences by abundance, length, or annotation
|
||
|
|
- `obiannotate` — add or modify annotations on dereplicated records
|
||
|
|
- `obicount` — count sequences or groups in a dataset
|
||
|
|
- `obiclean` — remove sequencing artefacts from a dereplicated dataset
|
||
|
|
- `obisummary` — summarise annotation distributions across a sequence set
|
||
|
|
|
||
|
|
---
|
||
|
|
|
||
|
|
# NOTES
|
||
|
|
|
||
|
|
For datasets that do not fit in RAM, `obiuniq` uses temporary disk-backed
|
||
|
|
chunk files by default. The number of chunks is controlled by `--chunk-count`
|
||
|
|
(default 100). Increasing this value lowers per-chunk memory requirements;
|
||
|
|
decreasing it reduces I/O at the cost of higher peak memory. Use `--in-memory`
|
||
|
|
only when the full working set fits in available RAM, as exceeding memory will
|
||
|
|
degrade performance or cause out-of-memory failures.
|
||
|
|
|
||
|
|
Singletons (sequences with abundance = 1) are a common source of noise in
|
||
|
|
amplicon sequencing, often arising from PCR or sequencing errors. The
|
||
|
|
`--no-singleton` flag is therefore recommended for most metabarcoding
|
||
|
|
workflows, unless the study design requires retaining all observed variants.
|
||
|
|
|
||
|
|
When the `--category-attribute` option is used, records that lack the
|
||
|
|
specified attribute are grouped together under the `--na-value` placeholder
|
||
|
|
(default `"NA"`). This ensures that all records participate in dereplication
|
||
|
|
without being silently dropped, but users should be aware that heterogeneous
|
||
|
|
records with different missing attributes may be unintentionally merged.
|