mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-04-30 12:00:39 +00:00
322 lines
10 KiB
Markdown
322 lines
10 KiB
Markdown
|
|
# obidemerge
|
||
|
|
|
||
|
|
## NAME
|
||
|
|
|
||
|
|
`obidemerge` — split merged sequence records back into individual, sample-annotated copies
|
||
|
|
|
||
|
|
## SYNOPSIS
|
||
|
|
|
||
|
|
```
|
||
|
|
obidemerge [options] [input_files...]
|
||
|
|
```
|
||
|
|
|
||
|
|
## DESCRIPTION
|
||
|
|
|
||
|
|
In a typical metabarcoding workflow, `obiuniq` or similar tools collapse identical sequences
|
||
|
|
from multiple samples into a single representative record. That record carries a statistics
|
||
|
|
attribute (for example `merged_sample`) that stores, for every original sample, how many
|
||
|
|
times the sequence was observed. This compact representation is convenient for clustering
|
||
|
|
and denoising, but some downstream analyses need the original, per-sample view.
|
||
|
|
|
||
|
|
`obidemerge` reverses that merging step. For each input sequence, it reads the statistics
|
||
|
|
stored under a chosen attribute (by default `sample`) and produces one output sequence per
|
||
|
|
entry in that statistics map. Each output sequence is a copy of the original, but:
|
||
|
|
|
||
|
|
- its `sample` attribute (or whichever slot you chose) is set to the name of the individual
|
||
|
|
sample,
|
||
|
|
- its read count is set to the abundance recorded for that sample.
|
||
|
|
|
||
|
|
The original statistics attribute is removed from all output sequences.
|
||
|
|
|
||
|
|
Sequences that carry no statistics for the chosen slot are passed through unchanged.
|
||
|
|
|
||
|
|
The command reads sequences from one or more files, or from standard input when no file is
|
||
|
|
given, and writes the results to standard output or to the file specified with `--out`.
|
||
|
|
|
||
|
|
## INPUT FORMATS
|
||
|
|
|
||
|
|
`obidemerge` accepts all sequence formats supported by OBITools4:
|
||
|
|
|
||
|
|
| Format | Description |
|
||
|
|
|--------|-------------|
|
||
|
|
| FASTA | Plain nucleotide sequences with annotation in the title line |
|
||
|
|
| FASTQ | Sequences with per-base quality scores |
|
||
|
|
| EMBL | European Nucleotide Archive flat-file format |
|
||
|
|
| GenBank | NCBI GenBank flat-file format |
|
||
|
|
| ecoPCR | Output produced by the ecoPCR tool |
|
||
|
|
| CSV | Comma-separated values with sequence and metadata columns |
|
||
|
|
|
||
|
|
The format is detected automatically from the file extension or content. You can override
|
||
|
|
detection with the format flags listed under **Input format options** below.
|
||
|
|
|
||
|
|
Annotations embedded in FASTA/FASTQ title lines can follow the OBI key=value style
|
||
|
|
(`--input-OBI-header`) or JSON style (`--input-json-header`).
|
||
|
|
|
||
|
|
## OUTPUT FORMATS
|
||
|
|
|
||
|
|
By default, the output format mirrors the input:
|
||
|
|
|
||
|
|
- If the input contains quality scores, output is FASTQ.
|
||
|
|
- Otherwise, output is FASTA with OBI-style annotations.
|
||
|
|
|
||
|
|
You can force a specific format with `--fasta-output`, `--fastq-output`, or `--json-output`.
|
||
|
|
|
||
|
|
## OPTIONS
|
||
|
|
|
||
|
|
### Demerge option
|
||
|
|
|
||
|
|
`--demerge <slot>`, `-d <slot>`
|
||
|
|
: Name of the sequence attribute that holds the per-sample statistics to expand.
|
||
|
|
Each key in that statistics map becomes a separate output sequence.
|
||
|
|
**Default:** `sample`
|
||
|
|
|
||
|
|
### Output options
|
||
|
|
|
||
|
|
`--out <FILENAME>`, `-o <FILENAME>`
|
||
|
|
: Write output to this file instead of standard output. Use `-` for standard output.
|
||
|
|
**Default:** `-` (standard output)
|
||
|
|
|
||
|
|
`--fasta-output`
|
||
|
|
: Write output in FASTA format, even when quality scores are available.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--fastq-output`
|
||
|
|
: Write output in FASTQ format (requires quality scores in the input).
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--json-output`
|
||
|
|
: Write output in JSON format, one record per line.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--output-OBI-header`, `-O`
|
||
|
|
: Write FASTA/FASTQ title lines in OBI key=value annotation style.
|
||
|
|
**Default:** false (JSON-style headers)
|
||
|
|
|
||
|
|
`--output-json-header`
|
||
|
|
: Write FASTA/FASTQ title lines in JSON annotation style.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--compress`, `-Z`
|
||
|
|
: Compress the output with gzip.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--skip-empty`
|
||
|
|
: Discard sequences of length zero from the output.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
### Input format options
|
||
|
|
|
||
|
|
`--fasta`
|
||
|
|
: Force reading in FASTA format.
|
||
|
|
|
||
|
|
`--fastq`
|
||
|
|
: Force reading in FASTQ format.
|
||
|
|
|
||
|
|
`--embl`
|
||
|
|
: Force reading in EMBL flat-file format.
|
||
|
|
|
||
|
|
`--genbank`
|
||
|
|
: Force reading in GenBank flat-file format.
|
||
|
|
|
||
|
|
`--ecopcr`
|
||
|
|
: Force reading in ecoPCR output format.
|
||
|
|
|
||
|
|
`--csv`
|
||
|
|
: Force reading in CSV format.
|
||
|
|
|
||
|
|
`--input-OBI-header`
|
||
|
|
: Parse FASTA/FASTQ title lines as OBI-style key=value annotations.
|
||
|
|
|
||
|
|
`--input-json-header`
|
||
|
|
: Parse FASTA/FASTQ title lines as JSON annotations.
|
||
|
|
|
||
|
|
`--solexa`
|
||
|
|
: Decode quality scores using the Solexa/Illumina 1.0 convention instead of the standard
|
||
|
|
Phred scale. Use this only for very old sequencing data.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--u-to-t`
|
||
|
|
: Convert uracil (U) to thymine (T) in all sequences. Useful when working with RNA-derived
|
||
|
|
data that should be treated as DNA.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--no-order`
|
||
|
|
: When reading from several input files, do not attempt to preserve the order of records
|
||
|
|
across files. May improve speed when order does not matter.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
### Taxonomy options
|
||
|
|
|
||
|
|
`--taxonomy <path>`, `-t <path>`
|
||
|
|
: Path to the OBITools4 taxonomy database. Required only if taxonomic identifiers need to
|
||
|
|
be resolved or validated during output.
|
||
|
|
**Default:** none
|
||
|
|
|
||
|
|
`--fail-on-taxonomy`
|
||
|
|
: Stop with an error if a taxonomic identifier in the data is not found in the loaded
|
||
|
|
taxonomy database.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--raw-taxid`
|
||
|
|
: Print taxonomic identifiers as plain numbers, without appending the taxon name and rank.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--update-taxid`
|
||
|
|
: Automatically replace deprecated taxonomic identifiers with their current equivalents,
|
||
|
|
as declared in the taxonomy database.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--with-leaves`
|
||
|
|
: When a taxonomy is extracted from the sequence file itself, treat each sequence as a
|
||
|
|
leaf node under its annotated taxonomic identifier.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
### Performance options
|
||
|
|
|
||
|
|
`--max-cpu <int>`
|
||
|
|
: Maximum number of parallel processing threads. Increase for faster processing on
|
||
|
|
multi-core machines.
|
||
|
|
**Default:** 16 (or the value of the `OBIMAXCPU` environment variable)
|
||
|
|
|
||
|
|
`--batch-size <int>`
|
||
|
|
: Minimum number of sequences processed together as a group.
|
||
|
|
**Default:** 1
|
||
|
|
|
||
|
|
`--batch-size-max <int>`
|
||
|
|
: Maximum number of sequences processed together as a group.
|
||
|
|
**Default:** 2000
|
||
|
|
|
||
|
|
`--batch-mem <size>`
|
||
|
|
: Maximum memory used per processing group (e.g. `64M`, `1G`). Set to `0` to disable the
|
||
|
|
memory limit and rely on `--batch-size-max` alone.
|
||
|
|
**Default:** `128M`
|
||
|
|
|
||
|
|
### Display options
|
||
|
|
|
||
|
|
`--no-progressbar`
|
||
|
|
: Hide the progress bar.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--silent-warning`
|
||
|
|
: Suppress warning messages.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--debug`
|
||
|
|
: Enable verbose debug logging.
|
||
|
|
**Default:** false
|
||
|
|
|
||
|
|
`--version`
|
||
|
|
: Print the OBITools4 version and exit.
|
||
|
|
|
||
|
|
`--help`, `-h`, `-?`
|
||
|
|
: Print this help message and exit.
|
||
|
|
|
||
|
|
## EXAMPLES
|
||
|
|
|
||
|
|
### Example 1 — basic demerge using the default slot
|
||
|
|
|
||
|
|
After running `obiuniq`, the file `unique.fasta` contains merged sequences whose
|
||
|
|
`merged_sample` attribute records abundance per sample. Demerge back to one
|
||
|
|
sequence per sample:
|
||
|
|
<!-- corrected: -d sample (not -d merged_sample) because HasStatsOn("sample") looks for the merged_sample attribute -->
|
||
|
|
|
||
|
|
```bash
|
||
|
|
obidemerge -d sample unique.fasta > per_sample_merged.fasta
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 7 sequences written to `per_sample_merged.fasta`.
|
||
|
|
|
||
|
|
### Example 2 — demerge with the default `sample` slot
|
||
|
|
|
||
|
|
If the statistics are already stored under the attribute named `sample` (the default),
|
||
|
|
no `-d` flag is needed:
|
||
|
|
|
||
|
|
```bash
|
||
|
|
obidemerge unique.fasta > per_sample_default.fasta
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 7 sequences written to `per_sample_default.fasta`.
|
||
|
|
|
||
|
|
### Example 3 — write compressed output to a file
|
||
|
|
|
||
|
|
```bash
|
||
|
|
obidemerge -d sample -o per_sample.fasta.gz --compress unique.fasta
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 7 sequences written (compressed) to `per_sample.fasta.gz`.
|
||
|
|
|
||
|
|
### Example 4 — pipeline use: cluster, then demerge
|
||
|
|
|
||
|
|
Obtain unique sequences, cluster them, then expand the clusters back to individual
|
||
|
|
sample records for ecological analysis:
|
||
|
|
|
||
|
|
```bash
|
||
|
|
obiuniq -m sample reads.fastq \
|
||
|
|
| obiclean ... \
|
||
|
|
| obidemerge -d sample -o demerged.fasta
|
||
|
|
```
|
||
|
|
|
||
|
|
### Example 5 — process multiple input files
|
||
|
|
|
||
|
|
```bash
|
||
|
|
obidemerge -d sample run1_unique.fasta run2_unique.fasta > combined_demerged.fasta
|
||
|
|
```
|
||
|
|
|
||
|
|
**Expected output:** 6 sequences written to `combined_demerged.fasta`.
|
||
|
|
|
||
|
|
## SEE ALSO
|
||
|
|
|
||
|
|
`obiuniq(1)` — collapses identical sequences and records per-sample counts (the inverse operation)
|
||
|
|
`obiclean(1)` — removes PCR/sequencing artefacts from a set of unique sequences
|
||
|
|
`obiannotate(1)` — adds or modifies sequence attributes
|
||
|
|
`obigrep(1)` — filters sequences by attributes or sequence content
|
||
|
|
`obicount(1)` — counts sequences and total reads in a file
|
||
|
|
|
||
|
|
## NOTES
|
||
|
|
|
||
|
|
**Relationship to `obiuniq`.**
|
||
|
|
`obiuniq --merge sample` stores per-sample counts under an attribute named `merged_sample`.
|
||
|
|
When you later call `obidemerge`, you must therefore pass `-d sample` to match that
|
||
|
|
attribute name. The `-d` option takes the **logical** slot name (here `sample`), not the
|
||
|
|
internal storage name (`merged_sample`).
|
||
|
|
<!-- corrected: -d sample is correct (not -d merged_sample); the tool prepends "merged_" internally when looking up the attribute -->
|
||
|
|
|
||
|
|
**Read counts after demerging.**
|
||
|
|
Each output sequence has its read count set to the value recorded in the statistics map for
|
||
|
|
that sample. If you sum the counts of all output sequences that share the same identifier,
|
||
|
|
you recover the total count of the original merged record.
|
||
|
|
|
||
|
|
**Order of output sequences.**
|
||
|
|
The order in which the per-sample copies of a single merged sequence appear in the output
|
||
|
|
is not guaranteed. If a stable order is required, pipe the output through `obisort`.
|
||
|
|
|
||
|
|
## OUTPUT
|
||
|
|
|
||
|
|
`obidemerge` writes one sequence record per sample entry found in the statistics attribute.
|
||
|
|
Each output record is a copy of the input sequence, with:
|
||
|
|
|
||
|
|
- the statistics attribute (`merged_<slot>`) removed,
|
||
|
|
- the `<slot>` attribute set to the sample name,
|
||
|
|
- the `count` attribute set to the abundance for that sample.
|
||
|
|
|
||
|
|
Sequences with no statistics for the chosen slot are passed through unchanged.
|
||
|
|
|
||
|
|
## Observed output example
|
||
|
|
|
||
|
|
```
|
||
|
|
>seq001 {"count":5,"sample":"sampleA"}
|
||
|
|
acgtacgtacgtacgtacgtacgtacgtacgtacgtacgt
|
||
|
|
>seq001 {"count":3,"sample":"sampleB"}
|
||
|
|
acgtacgtacgtacgtacgtacgtacgtacgtacgtacgt
|
||
|
|
>seq001 {"count":1,"sample":"sampleC"}
|
||
|
|
acgtacgtacgtacgtacgtacgtacgtacgtacgtacgt
|
||
|
|
>seq002 {"count":2,"sample":"sampleA"}
|
||
|
|
ttggccaattggccaattggccaattggccaattggccaa
|
||
|
|
>seq002 {"count":7,"sample":"sampleD"}
|
||
|
|
ttggccaattggccaattggccaattggccaattggccaa
|
||
|
|
>seq003 {"count":4,"sample":"sampleB"}
|
||
|
|
gctagctagctagctagctagctagctagctagctagcta
|
||
|
|
>seq004 {"count":6}
|
||
|
|
aaaaccccggggttttaaaaccccggggttttaaaacccc
|
||
|
|
```
|