mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-06-24 01:31:00 +00:00
Complement to the documentation
Former-commit-id: 89952a6f3bb261a6aaec24430906e635914ffce4
This commit is contained in:
+21
-7
@@ -2,21 +2,35 @@
|
|||||||
|
|
||||||
## Latest changes
|
## Latest changes
|
||||||
|
|
||||||
### Bug fixes
|
|
||||||
|
|
||||||
- In `obicsv` the **--keep count** was not equivalent to **--count**.
|
|
||||||
- In `obipairing` and `obipcrtag` correct a bug in the alignment procedure leading to negative scores.
|
|
||||||
- In `obimultiplex` correct a bug leading to a miss-read of the ngsfilter file when tags where written in lower case.
|
|
||||||
|
|
||||||
### New feature
|
### New feature
|
||||||
|
|
||||||
- In `obimatrix` a **--transpose** option allows to transpose the produced matrix table in CSV format.
|
- In `obimatrix` a **--transpose** option allows to transpose the produced matrix table in CSV format.
|
||||||
- In `obitpairing` and `obipcrtag` two new options **--exact-mode** and **--fast-absolute** to control the heuristic used in the alignment procedure. **--exact-mode** allows for disconnecting the heuristic and run the exact algorithm at the cost of a speed. **--fast-absolute** change the scoring schema of the heuristic.
|
- In `obitpairing` and `obipcrtag` two new options **--exact-mode** and **--fast-absolute** to control
|
||||||
|
the heuristic used in the alignment procedure. **--exact-mode** allows for disconnecting the heuristic
|
||||||
|
and run the exact algorithm at the cost of a speed. **--fast-absolute** change the scoring schema of
|
||||||
|
the heuristic.
|
||||||
|
- In `obiannotate` adds the possibility to annotate the first match of a pattern using the same algorithm
|
||||||
|
than the one used in `obipcr` and `obimultiplex`. For that four option were added :
|
||||||
|
- **--pattern** : to specify the pattern. It can use IUPAC codes and position with no error tolerated
|
||||||
|
has to be followed by a `#` character.
|
||||||
|
- **--pattern-name** : To specify the names of the slot used to report the results. Default is *pattern*
|
||||||
|
- **--pattern-error** : To specify the maximum number of error tolerated during matching process.
|
||||||
|
- **--allows-indels** : By default considered errors are mismatched, this flag allows for indels.
|
||||||
|
Only the first match is reported if several occurrences exist. If no match is found on direct strand then
|
||||||
|
pattern is looked for on the reverse complemented strand of the sequence.
|
||||||
|
|
||||||
### Enhancement
|
### Enhancement
|
||||||
|
|
||||||
- For efficiency purposes, now the `obiuniq` command run on disk by default. Consequently, the **--on-disk** option has been replaced by **--in-memory** to ask explicitly to use memory.
|
- For efficiency purposes, now the `obiuniq` command run on disk by default. Consequently, the **--on-disk** option has been replaced by **--in-memory** to ask explicitly to use memory.
|
||||||
|
|
||||||
|
### Bug fixes
|
||||||
|
|
||||||
|
- In `obicsv`, the **--keep count** was not equivalent to **--count**.
|
||||||
|
- In `obipairing` and `obipcrtag`, correct a bug in the alignment procedure leading to negative scores.
|
||||||
|
- In `obimultiplex`, correct a bug leading to a miss-read of the ngsfilter file when tags where written in lower case.
|
||||||
|
- In `obitag`, correct a bug leading to the annotation by taxid 1 (root) all the sequences having a 100% match
|
||||||
|
with one the reference sequence.
|
||||||
|
|
||||||
## November 16th, 2023. Release 4.1.0
|
## November 16th, 2023. Release 4.1.0
|
||||||
|
|
||||||
### New feature
|
### New feature
|
||||||
|
|||||||
+179
-73
@@ -213,7 +213,7 @@
|
|||||||
|
|
||||||
\begin{document}
|
\begin{document}
|
||||||
\maketitle
|
\maketitle
|
||||||
\ifdefined\Shaded\renewenvironment{Shaded}{\begin{tcolorbox}[frame hidden, borderline west={3pt}{0pt}{shadecolor}, sharp corners, boxrule=0pt, enhanced, interior hidden, breakable]}{\end{tcolorbox}}\fi
|
\ifdefined\Shaded\renewenvironment{Shaded}{\begin{tcolorbox}[breakable, interior hidden, enhanced, boxrule=0pt, borderline west={3pt}{0pt}{shadecolor}, sharp corners, frame hidden]}{\end{tcolorbox}}\fi
|
||||||
|
|
||||||
\renewcommand*\contentsname{Table of contents}
|
\renewcommand*\contentsname{Table of contents}
|
||||||
{
|
{
|
||||||
@@ -368,12 +368,12 @@ take into account the taxonomic annotations, ultimately allowing sorting
|
|||||||
and filtering of sequence records based on the taxonomy.
|
and filtering of sequence records based on the taxonomy.
|
||||||
|
|
||||||
\hypertarget{installation-of-the-obitools}{%
|
\hypertarget{installation-of-the-obitools}{%
|
||||||
\chapter{Installation of the
|
\chapter{\texorpdfstring{Installation of the
|
||||||
obitools}\label{installation-of-the-obitools}}
|
\emph{OBITools}}{Installation of the OBITools}}\label{installation-of-the-obitools}}
|
||||||
|
|
||||||
\hypertarget{availability-of-the-obitools}{%
|
\hypertarget{availability-of-the-obitools}{%
|
||||||
\section{Availability of the
|
\section{\texorpdfstring{Availability of the
|
||||||
OBITools}\label{availability-of-the-obitools}}
|
\emph{OBITools}}{Availability of the OBITools}}\label{availability-of-the-obitools}}
|
||||||
|
|
||||||
The \emph{OBITools} are open source and protected by the
|
The \emph{OBITools} are open source and protected by the
|
||||||
\href{http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html}{CeCILL
|
\href{http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html}{CeCILL
|
||||||
@@ -389,7 +389,7 @@ downloaded from the metabarcoding git server
|
|||||||
|
|
||||||
The \emph{OBITools4} are developped using the \href{https://go.dev/}{GO
|
The \emph{OBITools4} are developped using the \href{https://go.dev/}{GO
|
||||||
programming language}, we stick to the latest version of the language,
|
programming language}, we stick to the latest version of the language,
|
||||||
today the \(1.19.5\). If you want to download and compile the sources
|
today the \(1.21.4\). If you want to download and compile the sources
|
||||||
yourself, you first need to install the corresponding compiler on your
|
yourself, you first need to install the corresponding compiler on your
|
||||||
system. Some parts of the soft are also written in C, therefore a recent
|
system. Some parts of the soft are also written in C, therefore a recent
|
||||||
C compiler is also requested, GCC on Linux or Windows, the Developer
|
C compiler is also requested, GCC on Linux or Windows, the Developer
|
||||||
@@ -402,6 +402,47 @@ C compiler is available on your system.
|
|||||||
\section{Installation with the install
|
\section{Installation with the install
|
||||||
script}\label{installation-with-the-install-script}}
|
script}\label{installation-with-the-install-script}}
|
||||||
|
|
||||||
|
An installation script that compiles the new \emph{OBITools} on your
|
||||||
|
Unix-like system is available online. The easiest way to run it is to
|
||||||
|
copy and paste the following command into your terminal
|
||||||
|
|
||||||
|
\begin{Shaded}
|
||||||
|
\begin{Highlighting}[]
|
||||||
|
\ExtensionTok{curl} \AttributeTok{{-}L}\NormalTok{ https://metabarcoding.org/obitools4/install.sh }\KeywordTok{|} \FunctionTok{bash}
|
||||||
|
\end{Highlighting}
|
||||||
|
\end{Shaded}
|
||||||
|
|
||||||
|
By default, the script installs the \emph{OBITools} commands and other
|
||||||
|
associated files into the \texttt{/usr/local} directory. The names of
|
||||||
|
the commands in the new \emph{OBITools4} are mostly identical to those
|
||||||
|
in \emph{OBITools2}. Therefore, installing the new \emph{OBITools} may
|
||||||
|
hide or delete the old ones. If you want both versions to be available
|
||||||
|
on your system, the installation script offers two options:
|
||||||
|
|
||||||
|
\begin{quote}
|
||||||
|
-i, --install-dir Directory where \emph{OBITools} are installed (as
|
||||||
|
example use \texttt{/usr/local} not \texttt{/usr/local/bin}).
|
||||||
|
|
||||||
|
-p, --obitools-prefix Prefix added to the \emph{OBITools} command names
|
||||||
|
if you want to have several versions of obitools at the same time on
|
||||||
|
your system (as example \texttt{-p\ g} will produce \texttt{gobigrep}
|
||||||
|
command instead of \texttt{obigrep}).
|
||||||
|
\end{quote}
|
||||||
|
|
||||||
|
You can use these options by following the installation command:
|
||||||
|
|
||||||
|
\begin{Shaded}
|
||||||
|
\begin{Highlighting}[]
|
||||||
|
\ExtensionTok{curl} \AttributeTok{{-}L}\NormalTok{ https://metabarcoding.org/obitools4/install.sh }\KeywordTok{|} \DataTypeTok{\textbackslash{}}
|
||||||
|
\FunctionTok{bash} \AttributeTok{{-}s} \AttributeTok{{-}{-}} \AttributeTok{{-}{-}install{-}dir}\NormalTok{ test\_install }\AttributeTok{{-}{-}obitools{-}prefix}\NormalTok{ k}
|
||||||
|
\end{Highlighting}
|
||||||
|
\end{Shaded}
|
||||||
|
|
||||||
|
In this case, the binaries will be installed in the
|
||||||
|
\texttt{test\_install} directory and all command names will be prefixed
|
||||||
|
with the letter \texttt{k}. Thus \texttt{obigrep} will be named
|
||||||
|
\texttt{kobigrep}.
|
||||||
|
|
||||||
\hypertarget{compilation-from-sources}{%
|
\hypertarget{compilation-from-sources}{%
|
||||||
\section{Compilation from sources}\label{compilation-from-sources}}
|
\section{Compilation from sources}\label{compilation-from-sources}}
|
||||||
|
|
||||||
@@ -409,25 +450,27 @@ script}\label{installation-with-the-install-script}}
|
|||||||
\chapter{\texorpdfstring{File formats usable with
|
\chapter{\texorpdfstring{File formats usable with
|
||||||
\emph{OBITools}}{File formats usable with OBITools}}\label{file-formats-usable-with-obitools}}
|
\emph{OBITools}}{File formats usable with OBITools}}\label{file-formats-usable-with-obitools}}
|
||||||
|
|
||||||
OBITools manipulate have to manipulate DNA sequence data and taxonomical
|
\emph{OBITools} manipulate have to manipulate DNA sequence data and
|
||||||
data. They can use some supplentary metadata describing the experiment
|
taxonomical data. They can use some supplentary metadata describing the
|
||||||
and produce some stats about the processed DNA data. All the manipulated
|
experiment and produce some stats about the processed DNA data. All the
|
||||||
data are stored in text files, following standard data format.
|
manipulated data are stored in text files, following standard data
|
||||||
|
format.
|
||||||
|
|
||||||
\hypertarget{the-dna-sequence-data}{%
|
\hypertarget{the-dna-sequence-data}{%
|
||||||
\chapter{The DNA sequence data}\label{the-dna-sequence-data}}
|
\section{The DNA sequence data}\label{the-dna-sequence-data}}
|
||||||
|
|
||||||
Sequences can be stored following various format. OBITools knows some of
|
Sequences can be stored following various format. \emph{OBITools} knows
|
||||||
them. The central formats for sequence files manipulated by OBITools
|
some of them. The central formats for sequence files manipulated by
|
||||||
scripts are the
|
\emph{OBITools} scripts are the
|
||||||
\protect\hyperlink{the-fasta-sequence-format}{\texttt{fasta}} and
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} and
|
||||||
\protect\hyperlink{the-fastq-sequence-format}{\texttt{fastq}} format.
|
\protect\hyperlink{sec-fastq}{\emph{FASTQ}} format. \emph{OBITools}
|
||||||
OBITools extends the both these formats by specifying a syntax to
|
extends the both these formats by specifying a syntax to include in the
|
||||||
include in the definition line data qualifying the sequence. All file
|
definition line data qualifying the sequence. All file formats use the
|
||||||
formats use the \texttt{IUPAC} code for encoding nucleotides.
|
\protect\hyperlink{sec-iupac}{\texttt{IUPAC}} code for encoding
|
||||||
|
nucleotides.
|
||||||
|
|
||||||
Moreover these two formats that can be used as input and output formats,
|
Moreover these two formats that can be used as input and output formats,
|
||||||
\textbf{OBITools4} can read the following format :
|
\emph{OBITools4} can read the following format :
|
||||||
|
|
||||||
\begin{itemize}
|
\begin{itemize}
|
||||||
\tightlist
|
\tightlist
|
||||||
@@ -442,11 +485,11 @@ Moreover these two formats that can be used as input and output formats,
|
|||||||
output files}
|
output files}
|
||||||
\end{itemize}
|
\end{itemize}
|
||||||
|
|
||||||
\hypertarget{the-iupac-code}{%
|
\hypertarget{sec-iupac}{%
|
||||||
\section{The IUPAC Code}\label{the-iupac-code}}
|
\subsection{The IUPAC Code}\label{sec-iupac}}
|
||||||
|
|
||||||
The International Union of Pure and Applied Chemistry (IUPAC\_) defined
|
The International Union of Pure and Applied Chemistry (\href{}{IUPAC})
|
||||||
the standard code for representing protein or DNA sequences.
|
defined the standard code for representing protein or DNA sequences.
|
||||||
|
|
||||||
\begin{longtable}[]{@{}ll@{}}
|
\begin{longtable}[]{@{}ll@{}}
|
||||||
\toprule()
|
\toprule()
|
||||||
@@ -473,22 +516,24 @@ N & Any base (A, C, G, T, or U) \\
|
|||||||
\end{longtable}
|
\end{longtable}
|
||||||
|
|
||||||
\hypertarget{sec-fasta}{%
|
\hypertarget{sec-fasta}{%
|
||||||
\section{\texorpdfstring{The \emph{fasta} sequence
|
\subsection{\texorpdfstring{The \emph{FASTA} sequence
|
||||||
format}{The fasta sequence format}}\label{sec-fasta}}
|
format}{The FASTA sequence format}}\label{sec-fasta}}
|
||||||
|
|
||||||
The \textbf{fasta format} is certainly the most widely used sequence
|
The \protect\hyperlink{sec-fasta}{\emph{FASTA}} format is certainly the
|
||||||
file format. This is certainly due to its great simplicity. It was
|
most widely used sequence file format. This is certainly due to its
|
||||||
originally created for the Lipman and Pearson
|
great simplicity. It was originally created for the Lipman and Pearson
|
||||||
\href{http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation}{FASTA
|
\href{http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation}{\texttt{FASTA}
|
||||||
program}. OBITools use in more of the classical \texttt{fasta} format an
|
program}. \emph{OBITools} use in more of the classical
|
||||||
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} format an
|
||||||
\texttt{extended\ version} of this format where structured data are
|
\texttt{extended\ version} of this format where structured data are
|
||||||
included in the title line.
|
included in the title line.
|
||||||
|
|
||||||
In \emph{fasta} format a sequence is represented by a title line
|
In \protect\hyperlink{sec-fasta}{\emph{FASTA}} format a sequence is
|
||||||
beginning with a \textbf{\texttt{\textgreater{}}} character and the
|
represented by a title line beginning with a
|
||||||
sequences by itself following the :doc:\texttt{iupac} code. The sequence
|
\textbf{\texttt{\textgreater{}}} character and the sequences by itself
|
||||||
is usually split other severals lines of the same length (expect for the
|
following the \protect\hyperlink{sec-iupac}{\texttt{IUPAC}} code. The
|
||||||
last one)
|
sequence is usually split other severals lines of the same length
|
||||||
|
(expect for the last one)
|
||||||
|
|
||||||
\begin{verbatim}
|
\begin{verbatim}
|
||||||
>my_sequence this is my pretty sequence
|
>my_sequence this is my pretty sequence
|
||||||
@@ -520,34 +565,45 @@ GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
|||||||
AACGACGTTGCAGTACGTTGCAGT
|
AACGACGTTGCAGTACGTTGCAGT
|
||||||
\end{verbatim}
|
\end{verbatim}
|
||||||
|
|
||||||
|
\hypertarget{file-extensions}{%
|
||||||
|
\subsubsection{File extensions}\label{file-extensions}}
|
||||||
|
|
||||||
|
There is no standard file extension for a
|
||||||
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} file, but \texttt{.fa} and
|
||||||
|
\texttt{.fasta}, are commonly used.
|
||||||
|
|
||||||
\hypertarget{sec-fastq}{%
|
\hypertarget{sec-fastq}{%
|
||||||
\section[The \emph{fastq} sequence format]{\texorpdfstring{The
|
\subsection[The \emph{FASTQ} sequence format]{\texorpdfstring{The
|
||||||
\emph{fastq} sequence
|
\emph{FASTQ} sequence
|
||||||
format\footnote{This article uses material from the Wikipedia article
|
format\footnote{This article uses material from the Wikipedia article
|
||||||
\href{http://en.wikipedia.org/wiki/FASTQ_format}{\texttt{FASTQ\ format}}
|
\href{http://en.wikipedia.org/wiki/FASTQ_format}{\texttt{FASTQ\ format}}
|
||||||
which is released under the
|
which is released under the
|
||||||
\texttt{Creative\ Commons\ Attribution-Share-Alike\ License\ 3.0}}}{The fastq sequence format}}\label{sec-fastq}}
|
\texttt{Creative\ Commons\ Attribution-Share-Alike\ License\ 3.0}}}{The FASTQ sequence format}}\label{sec-fastq}}
|
||||||
|
|
||||||
The \textbf{FASTQ} format is a text file format for storing both
|
The \protect\hyperlink{sec-fastq}{\emph{FASTQ}} format is a text file
|
||||||
biological sequences (only nucleic acid sequences) and the associated
|
format for storing both biological sequences (only nucleic acid
|
||||||
quality scores. The sequence and score are each encoded by a single
|
sequences) and the associated sequence quality scores. Every nucleotide
|
||||||
ASCII character. This format was originally developed by the Wellcome
|
of the sequence and its associated quality score are each encoded by a
|
||||||
Trust Sanger Institute to link a
|
single ASCII character. This format was originally developed by the
|
||||||
\protect\hyperlink{the-fasta-sequence-format}{FASTA} sequence file to
|
Wellcome Trust Sanger Institute to link a
|
||||||
the corresponding quality data, but has recently become the de facto
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} sequence file to the
|
||||||
|
corresponding quality data, but is now became the \emph{de facto}
|
||||||
standard for storing results from high-throughput sequencers (Cock et
|
standard for storing results from high-throughput sequencers (Cock et
|
||||||
al. 2010).
|
al. 2010).
|
||||||
|
|
||||||
A fastq file normally uses four lines per sequence.
|
\emph{OBITools} considers that a
|
||||||
|
\protect\hyperlink{sec-fastq}{\emph{FASTQ}} file uses four lines to
|
||||||
|
encode a sequence record.
|
||||||
|
|
||||||
\begin{itemize}
|
\begin{itemize}
|
||||||
\tightlist
|
\tightlist
|
||||||
\item
|
\item
|
||||||
Line 1 begins with a `@' character and is followed by a sequence
|
Line 1 begins with a `@' character and is followed by a sequence
|
||||||
identifier and an \emph{optional} description (like a
|
identifier and an \emph{optional} description (like a
|
||||||
:ref:\texttt{fasta} title line).
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} title line).
|
||||||
\item
|
\item
|
||||||
Line 2 is the raw sequence letters.
|
Line 2 is the sequence letters, in upper or lower case, but
|
||||||
|
\emph{OBITools} only write sequences as lower cases.
|
||||||
\item
|
\item
|
||||||
Line 3 begins with a `+' character and is \emph{optionally} followed
|
Line 3 begins with a `+' character and is \emph{optionally} followed
|
||||||
by the same sequence identifier (and any description) again.
|
by the same sequence identifier (and any description) again.
|
||||||
@@ -556,7 +612,7 @@ A fastq file normally uses four lines per sequence.
|
|||||||
contain the same number of symbols as letters in the sequence.
|
contain the same number of symbols as letters in the sequence.
|
||||||
\end{itemize}
|
\end{itemize}
|
||||||
|
|
||||||
A fastq file containing a single sequence might look like this:
|
A \protect\hyperlink{sec-fastq}{\emph{FASTQ}} file looks like this:
|
||||||
|
|
||||||
\begin{verbatim}
|
\begin{verbatim}
|
||||||
@SEQ_ID
|
@SEQ_ID
|
||||||
@@ -575,21 +631,21 @@ characters in left-to-right increasing order of quality
|
|||||||
^_`abcdefghijklmnopqrstuvwxyz{|}~
|
^_`abcdefghijklmnopqrstuvwxyz{|}~
|
||||||
\end{verbatim}
|
\end{verbatim}
|
||||||
|
|
||||||
The original Sanger FASTQ files also allowed the sequence and quality
|
If the original Sanger \protect\hyperlink{sec-fastq}{\emph{FASTQ}} files
|
||||||
strings to be wrapped (split over multiple lines), but this is generally
|
also allowed the sequence and quality strings to be wrapped (split over
|
||||||
discouraged as it can make parsing complicated due to the unfortunate
|
multiple lines), it is not supported by \emph{OBITools} as it make
|
||||||
choice of ``@'' and ``+'' as markers (these characters can also occur in
|
parsing complicated due to the unfortunate choice of ``@'' and ``+'' as
|
||||||
the quality string).
|
markers (these characters can also occur in the quality string).
|
||||||
|
|
||||||
\hypertarget{sequence-quality-scores}{%
|
\hypertarget{sequence-quality-scores}{%
|
||||||
\subsection*{Sequence quality scores}\label{sequence-quality-scores}}
|
\subsubsection*{Sequence quality scores}\label{sequence-quality-scores}}
|
||||||
\addcontentsline{toc}{subsection}{Sequence quality scores}
|
\addcontentsline{toc}{subsubsection}{Sequence quality scores}
|
||||||
|
|
||||||
The Phred quality value \emph{Q} is an integer mapping of \emph{p}
|
The Phred quality value \emph{Q} is an integer mapping of \emph{p}
|
||||||
(i.e., the probability that the corresponding base call is incorrect).
|
(\emph{i.e.}, the probability that the corresponding base call is
|
||||||
Two different equations have been in use. The first is the standard
|
incorrect). Two different equations have been in use. The first is the
|
||||||
Sanger variant to assess reliability of a base call, otherwise known as
|
standard Sanger variant to assess reliability of a base call, otherwise
|
||||||
Phred quality score:
|
known as Phred quality score:
|
||||||
|
|
||||||
\[
|
\[
|
||||||
Q_\text{sanger} = -10 \, \log_{10} p
|
Q_\text{sanger} = -10 \, \log_{10} p
|
||||||
@@ -621,12 +677,12 @@ equivalently, \(Q = 13\).}
|
|||||||
\end{figure}
|
\end{figure}
|
||||||
|
|
||||||
\hypertarget{encoding}{%
|
\hypertarget{encoding}{%
|
||||||
\subsubsection*{Encoding}\label{encoding}}
|
\paragraph*{Encoding}\label{encoding}}
|
||||||
\addcontentsline{toc}{subsubsection}{Encoding}
|
\addcontentsline{toc}{paragraph}{Encoding}
|
||||||
|
|
||||||
The \emph{fastq} format had differente way of encoding the Phred quality
|
The \protect\hyperlink{sec-fastq}{\emph{FASTQ}} format had differente
|
||||||
score along the time. Here a breif history of these changes is
|
way of encoding the Phred quality score along the time. Here a breif
|
||||||
presented.
|
history of these changes is presented. \emph{OBITools}
|
||||||
|
|
||||||
\begin{itemize}
|
\begin{itemize}
|
||||||
\tightlist
|
\tightlist
|
||||||
@@ -684,15 +740,65 @@ given run.
|
|||||||
to the use of the Sanger format (Phred+33).
|
to the use of the Sanger format (Phred+33).
|
||||||
\end{itemize}
|
\end{itemize}
|
||||||
|
|
||||||
OBItools follows the Sanger format. Nevertheless, It is possible to read
|
\emph{OBITools} follows the Sanger format. Nevertheless, It is possible
|
||||||
files encoded following the Solexa/Illumina format by applying a shift
|
to read files encoded following the Solexa/Illumina format by applying a
|
||||||
of 62 (see the option \textbf{-\/-solexa} of the OBITools commands).
|
shift of 62 (see the option \textbf{--solexa} of the \emph{OBITools}
|
||||||
|
commands).
|
||||||
|
|
||||||
\hypertarget{file-extension}{%
|
\hypertarget{file-extensions-1}{%
|
||||||
\section{File extension}\label{file-extension}}
|
\subsubsection{File extensions}\label{file-extensions-1}}
|
||||||
|
|
||||||
There is no standard file extension for a FASTQ file, but .fq and
|
There is no standard file extension for a
|
||||||
.fastq, are commonly used.
|
\protect\hyperlink{sec-fastq}{\emph{FASTQ}} file, but \texttt{.fq} and
|
||||||
|
\texttt{.fastq}, are commonly used.
|
||||||
|
|
||||||
|
\hypertarget{the-taxonomy-files}{%
|
||||||
|
\section{The taxonomy files}\label{the-taxonomy-files}}
|
||||||
|
|
||||||
|
Many OBITools are able to take into account taxonomic data. This is done
|
||||||
|
by specifying a directory containing all
|
||||||
|
:doc:\texttt{NCBI\ taxonomy\ dump\ files\ \textless{}./taxdump\textgreater{}}.
|
||||||
|
|
||||||
|
\hypertarget{the-sample-description-file}{%
|
||||||
|
\section{The sample description
|
||||||
|
file}\label{the-sample-description-file}}
|
||||||
|
|
||||||
|
A key file for \emph{OBITools4} is the file describing all samples (PCR)
|
||||||
|
analyzed in the processed sequencing library file. This file, often
|
||||||
|
called the \texttt{ngsfilter} file, is a tab separated values (TSV)
|
||||||
|
file. The format of this file is exactly identical to that used in
|
||||||
|
\emph{OBITools2} and \emph{OBITools4}.
|
||||||
|
|
||||||
|
\texttt{\{tsv,\ .smaller\}\ wolf\_diet\ \ \ \ 13a\_F730603\ \ \ \ \ \ aattaac\ \ TTAGATACCCCACTATGC\ \ \ \ TAGAACAGGCTCCTCTAG\ \ \ \ \ F\ wolf\_diet\ \ \ \ 15a\_F730814\ \ \ \ \ \ gaagtag\ \ TTAGATACCCCACTATGC\ \ \ \ TAGAACAGGCTCCTCTAG\ \ \ \ \ F\ wolf\_diet\ \ \ \ 26a\_F040644\ \ \ \ \ \ gaatatc\ \ TTAGATACCCCACTATGC\ \ \ \ TAGAACAGGCTCCTCTAG\ \ \ \ \ F\ wolf\_diet\ \ \ \ 29a\_F260619\ \ \ \ \ \ gcctcct\ \ TTAGATACCCCACTATGC\ \ \ \ TAGAACAGGCTCCTCTAG\ \ \ \ \ F}
|
||||||
|
|
||||||
|
At least six columns must be present in every line of the file.
|
||||||
|
|
||||||
|
\begin{itemize}
|
||||||
|
\item
|
||||||
|
The first column contains the name of the experience:
|
||||||
|
|
||||||
|
An experiment name groups a set of sample together. Sequences
|
||||||
|
belonging to the experiment are tagged with an attribute
|
||||||
|
\texttt{experiment} containing the name of the experiment in their
|
||||||
|
annotation.
|
||||||
|
\item
|
||||||
|
The second column contains the sample identifier in the experiment
|
||||||
|
|
||||||
|
The sample identifier must be unique in the experiment. The
|
||||||
|
\texttt{obimultiplex} and \texttt{obitagpcr} commands add to all the
|
||||||
|
sequences bellonging to the same sample an attribute \texttt{sample}
|
||||||
|
containing the sample identifier
|
||||||
|
\item
|
||||||
|
The third column contains description of the tag used to identify
|
||||||
|
sequences corresponding to this sample
|
||||||
|
\item
|
||||||
|
The fourth column contains the forward primer sequence
|
||||||
|
\item
|
||||||
|
The fifth column contains the reverse primer sequence
|
||||||
|
\item
|
||||||
|
The sixth column must always contain the character \texttt{F} (full
|
||||||
|
length)
|
||||||
|
\end{itemize}
|
||||||
|
|
||||||
\hypertarget{obitools-v4-tutorial}{%
|
\hypertarget{obitools-v4-tutorial}{%
|
||||||
\chapter{OBITools V4 Tutorial}\label{obitools-v4-tutorial}}
|
\chapter{OBITools V4 Tutorial}\label{obitools-v4-tutorial}}
|
||||||
|
|||||||
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
@@ -0,0 +1,19 @@
|
|||||||
|
{
|
||||||
|
"hash": "0d2b5eca01fd0d516bf9dee813b291f8",
|
||||||
|
"result": {
|
||||||
|
"markdown": "```{css}\ncode.sourceCode div.cell-output-stdout {\n font-size: 0.8em;\n}\n\ndiv.cell-output-stdout {\n font-size: 0.8em;\n}\n```\n\n\n# Preface {.unnumbered}\n\nThe first version of *OBITools* started to be developed in 2005. This was at the beginning of the DNA metabarcoding story at the Laboratoire d'Ecologie Alpine (LECA) in Grenoble. At that time, with Pierre Taberlet and François Pompanon, we were thinking about the potential of this new methodology under development. PIerre and François developed more the laboratory methods, while I was thinking more about the tools for analysing the sequences produced. Two ideas were behind this development. I wanted something modular, and something easy to extend. To achieve the first goal, I decided to implement obitools as a suite of unix commands mimicking the classic unix commands but dedicated to sequence files. The basic unix commands are very useful for automatically manipulating, parsing and editing text files. They work in flow, line by line on the input text. The result is a new text file that can be used as input for the next command. Such a design makes it possible to quickly develop a text processing pipeline by chaining simple elementary operations. The *OBITools* are the exact counterpart of these basic Unix commands, but the basic information they process is a sequence (potentially spanning several lines of text), not a single line of text. Most *OBITools* consume sequence files and produce sequence files. Thus, the principles of chaining and modularity are respected. In order to be able to easily extend the *OBITools* to keep up with our evolving ideas about processing DNA metabarcoding data, it was decided to develop them using an interpreted language: Python. Python 2, the version available at the time, allowed us to develop the *OBITools* efficiently. When parts of the algorithms were computationally demanding, they were implemented in C and linked to the Python code. Even though Python is not the most efficient language available, even though computers were not as powerful as they are today, the size of the data we could produce using 454 sequencers or early solexa machines was small enough to be processed in a reasonable time.\n\nThe first public version of obitools was [*OBITools2*](https://metabarcoding.org/obitools) [@Boyer2016-gq], this was actually a cleaned up and documented version of *OBITools* that had been running at LECA for years and was not really distributed except to a few collaborators. This is where *OBITools* started its public life from then on. The DNA metabarcoding spring schools provided and still provide user training every year. But *OBITools2* soon suffered from two limitations: it was developed in Python2, which was increasingly abandoned in favour of Python3, and the data size kept increasing with the new illumina machines. Python's intrinsic slowness coupled with the increasing size of the datasets made OBITools computation times increasingly long. The abandonment of all maintenance of Python2 by its developers also imposed the need for a new version of OBITools. \n\n[*OBITools3*](https://metabarcoding.org/obitools3) was the first response to this crisis. Developed and maintained by [Céline Mercier](https://www.celine-mercier.info), *OBITools3* attempted to address several limitations of *OBITools2*. It is a complete new code, mainly developed in Python3, with most of the lower layer code written in C for efficiency. OBITools3 has also abandoned text files for binary files for the same reason of efficiency. They have been replaced by a database structure that keeps track of every operation performed on the data. \n\nHere we present *OBITools4* which can be seen as a return to the origins of OBITools. While *OBITools3* offered traceability of analyses, which is in line with the concept of open science, and faster execution, *OBITools2* was more versatile and not only usable for the analysis of DNA metabarcoding data. *OBITools4* is the third full implementation of *OBITools*. The idea behind this new version is to go back to the original design of *OBITools* which ran on text files containing sequences, like the classic Unix commands, but running at least as fast as *OBITools3* and taking advantage of the multicore architecture of all modern laptops. For this, the idea of relying on an interpreted language was abandoned. The *OBITools4* are now fully implemented in the [GO](https://go.dev) language with the exception of a few small pieces of specific code already implemented very efficiently in C. *OBITools4* also implement a new format for the annotations inserted in the header of every sequences. Rather tha relying on a format specific to *OBITools*, by default *OBITools4* use the [JSON](https://www.json.org) format. This simplifies the writing of parsers in any languages, and thus allows obitools to easiestly interact with other software.\n\n",
|
||||||
|
"supporting": [
|
||||||
|
"index_files"
|
||||||
|
],
|
||||||
|
"filters": [],
|
||||||
|
"engineDependencies": {
|
||||||
|
"jupyter": [
|
||||||
|
{
|
||||||
|
"jsWidgets": false,
|
||||||
|
"jupyterWidgets": false,
|
||||||
|
"htmlLibraries": []
|
||||||
|
}
|
||||||
|
]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,11 @@
|
|||||||
|
{
|
||||||
|
"hash": "0d2b5eca01fd0d516bf9dee813b291f8",
|
||||||
|
"result": {
|
||||||
|
"markdown": "```{css}\ncode.sourceCode div.cell-output-stdout {\n font-size: 0.8em;\n}\n\ndiv.cell-output-stdout {\n font-size: 0.8em;\n}\n```\n\n\n# Preface {.unnumbered}\n\nThe first version of *OBITools* started to be developed in 2005. This was at the beginning of the DNA metabarcoding story at the Laboratoire d'Ecologie Alpine (LECA) in Grenoble. At that time, with Pierre Taberlet and François Pompanon, we were thinking about the potential of this new methodology under development. PIerre and François developed more the laboratory methods, while I was thinking more about the tools for analysing the sequences produced. Two ideas were behind this development. I wanted something modular, and something easy to extend. To achieve the first goal, I decided to implement obitools as a suite of unix commands mimicking the classic unix commands but dedicated to sequence files. The basic unix commands are very useful for automatically manipulating, parsing and editing text files. They work in flow, line by line on the input text. The result is a new text file that can be used as input for the next command. Such a design makes it possible to quickly develop a text processing pipeline by chaining simple elementary operations. The *OBITools* are the exact counterpart of these basic Unix commands, but the basic information they process is a sequence (potentially spanning several lines of text), not a single line of text. Most *OBITools* consume sequence files and produce sequence files. Thus, the principles of chaining and modularity are respected. In order to be able to easily extend the *OBITools* to keep up with our evolving ideas about processing DNA metabarcoding data, it was decided to develop them using an interpreted language: Python. Python 2, the version available at the time, allowed us to develop the *OBITools* efficiently. When parts of the algorithms were computationally demanding, they were implemented in C and linked to the Python code. Even though Python is not the most efficient language available, even though computers were not as powerful as they are today, the size of the data we could produce using 454 sequencers or early solexa machines was small enough to be processed in a reasonable time.\n\nThe first public version of obitools was [*OBITools2*](https://metabarcoding.org/obitools) [@Boyer2016-gq], this was actually a cleaned up and documented version of *OBITools* that had been running at LECA for years and was not really distributed except to a few collaborators. This is where *OBITools* started its public life from then on. The DNA metabarcoding spring schools provided and still provide user training every year. But *OBITools2* soon suffered from two limitations: it was developed in Python2, which was increasingly abandoned in favour of Python3, and the data size kept increasing with the new illumina machines. Python's intrinsic slowness coupled with the increasing size of the datasets made OBITools computation times increasingly long. The abandonment of all maintenance of Python2 by its developers also imposed the need for a new version of OBITools. \n\n[*OBITools3*](https://metabarcoding.org/obitools3) was the first response to this crisis. Developed and maintained by [Céline Mercier](https://www.celine-mercier.info), *OBITools3* attempted to address several limitations of *OBITools2*. It is a complete new code, mainly developed in Python3, with most of the lower layer code written in C for efficiency. OBITools3 has also abandoned text files for binary files for the same reason of efficiency. They have been replaced by a database structure that keeps track of every operation performed on the data. \n\nHere we present *OBITools4* which can be seen as a return to the origins of OBITools. While *OBITools3* offered traceability of analyses, which is in line with the concept of open science, and faster execution, *OBITools2* was more versatile and not only usable for the analysis of DNA metabarcoding data. *OBITools4* is the third full implementation of *OBITools*. The idea behind this new version is to go back to the original design of *OBITools* which ran on text files containing sequences, like the classic Unix commands, but running at least as fast as *OBITools3* and taking advantage of the multicore architecture of all modern laptops. For this, the idea of relying on an interpreted language was abandoned. The *OBITools4* are now fully implemented in the [GO](https://go.dev) language with the exception of a few small pieces of specific code already implemented very efficiently in C. *OBITools4* also implement a new format for the annotations inserted in the header of every sequences. Rather tha relying on a format specific to *OBITools*, by default *OBITools4* use the [JSON](https://www.json.org) format. This simplifies the writing of parsers in any languages, and thus allows obitools to easiestly interact with other software.\n\n",
|
||||||
|
"supporting": [
|
||||||
|
"index_files/figure-html"
|
||||||
|
],
|
||||||
|
"filters": [],
|
||||||
|
"includes": {}
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,10 @@
|
|||||||
|
{
|
||||||
|
"hash": "6372b3136d3b9e38461c2fd369bcdefd",
|
||||||
|
"result": {
|
||||||
|
"markdown": "```{css eval=FALSE}\ncode.sourceCode div.cell-output-stdout {\n font-size: 0.8em;\n}\n\ndiv.cell-output-stdout {\n font-size: 0.8em;\n}\n```\n\n\n# Preface {.unnumbered}\n\nThe first version of *OBITools* started to be developed in 2005. This was at the beginning of the DNA metabarcoding story at the Laboratoire d'Ecologie Alpine (LECA) in Grenoble. At that time, with Pierre Taberlet and François Pompanon, we were thinking about the potential of this new methodology under development. PIerre and François developed more the laboratory methods, while I was thinking more about the tools for analysing the sequences produced. Two ideas were behind this development. I wanted something modular, and something easy to extend. To achieve the first goal, I decided to implement obitools as a suite of unix commands mimicking the classic unix commands but dedicated to sequence files. The basic unix commands are very useful for automatically manipulating, parsing and editing text files. They work in flow, line by line on the input text. The result is a new text file that can be used as input for the next command. Such a design makes it possible to quickly develop a text processing pipeline by chaining simple elementary operations. The *OBITools* are the exact counterpart of these basic Unix commands, but the basic information they process is a sequence (potentially spanning several lines of text), not a single line of text. Most *OBITools* consume sequence files and produce sequence files. Thus, the principles of chaining and modularity are respected. In order to be able to easily extend the *OBITools* to keep up with our evolving ideas about processing DNA metabarcoding data, it was decided to develop them using an interpreted language: Python. Python 2, the version available at the time, allowed us to develop the *OBITools* efficiently. When parts of the algorithms were computationally demanding, they were implemented in C and linked to the Python code. Even though Python is not the most efficient language available, even though computers were not as powerful as they are today, the size of the data we could produce using 454 sequencers or early solexa machines was small enough to be processed in a reasonable time.\n\nThe first public version of obitools was [*OBITools2*](https://metabarcoding.org/obitools) [@Boyer2016-gq], this was actually a cleaned up and documented version of *OBITools* that had been running at LECA for years and was not really distributed except to a few collaborators. This is where *OBITools* started its public life from then on. The DNA metabarcoding spring schools provided and still provide user training every year. But *OBITools2* soon suffered from two limitations: it was developed in Python2, which was increasingly abandoned in favour of Python3, and the data size kept increasing with the new illumina machines. Python's intrinsic slowness coupled with the increasing size of the datasets made OBITools computation times increasingly long. The abandonment of all maintenance of Python2 by its developers also imposed the need for a new version of OBITools. \n\n[*OBITools3*](https://metabarcoding.org/obitools3) was the first response to this crisis. Developed and maintained by [Céline Mercier](https://www.celine-mercier.info), *OBITools3* attempted to address several limitations of *OBITools2*. It is a complete new code, mainly developed in Python3, with most of the lower layer code written in C for efficiency. OBITools3 has also abandoned text files for binary files for the same reason of efficiency. They have been replaced by a database structure that keeps track of every operation performed on the data. \n\nHere we present *OBITools4* which can be seen as a return to the origins of OBITools. While *OBITools3* offered traceability of analyses, which is in line with the concept of open science, and faster execution, *OBITools2* was more versatile and not only usable for the analysis of DNA metabarcoding data. *OBITools4* is the third full implementation of *OBITools*. The idea behind this new version is to go back to the original design of *OBITools* which ran on text files containing sequences, like the classic Unix commands, but running at least as fast as *OBITools3* and taking advantage of the multicore architecture of all modern laptops. For this, the idea of relying on an interpreted language was abandoned. The *OBITools4* are now fully implemented in the [GO](https://go.dev) language with the exception of a few small pieces of specific code already implemented very efficiently in C. *OBITools4* also implement a new format for the annotations inserted in the header of every sequences. Rather tha relying on a format specific to *OBITools*, by default *OBITools4* use the [JSON](https://www.json.org) format. This simplifies the writing of parsers in any languages, and thus allows obitools to easiestly interact with other software.\n\n",
|
||||||
|
"supporting": [
|
||||||
|
"index_files/figure-pdf"
|
||||||
|
],
|
||||||
|
"filters": []
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,19 @@
|
|||||||
|
{
|
||||||
|
"hash": "cdc3ee1d58e10538db75a4867b10ee0e",
|
||||||
|
"result": {
|
||||||
|
"markdown": "# Installation of the *OBITools*\n\n## Availability of the *OBITools*\n\nThe *OBITools* are open source and protected by the [CeCILL 2.1 license](http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html).\n\nAll the sources of the [*OBITools4*](http://metabarcoding.org/obitools4) can be downloaded from the metabarcoding git server (https://git.metabarcoding.org).\n\n## Prerequisites\n\nThe *OBITools4* are developped using the [GO programming language](https://go.dev/), we stick to the latest version of the language, today the $1.21.4$. If you want to download and compile the sources yourself, you first need to install the corresponding compiler on your system. Some parts of the soft are also written in C, therefore a recent C compiler is also requested, GCC on Linux or Windows, the Developer Tools on Mac.\n\nWhatever the installation you decide for, you will have to ensure that a C compiler is available on your system.\n\n## Installation with the install script\n\nAn installation script that compiles the new *OBITools* on your Unix-like system is available online.\nThe easiest way to run it is to copy and paste the following command into your terminal\n\n::: {.cell execution_count=1}\n``` {.bash .cell-code}\ncurl -L https://metabarcoding.org/obitools4/install.sh | bash\n```\n:::\n\n\nBy default, the script installs the *OBITools* commands and other associated files into the `/usr/local` directory.\nThe names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.\nTherefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be \navailable on your system, the installation script offers two options:\n\n\n> -i, --install-dir Directory where *OBITools* are installed \n> (as example use `/usr/local` not `/usr/local/bin`).\n> \n> -p, --obitools-prefix Prefix added to the *OBITools* command names if you\n> want to have several versions of obitools at the\n> same time on your system (as example `-p g` will produce \n> `gobigrep` command instead of `obigrep`).\n\nYou can use these options by following the installation command:\n\n::: {.cell execution_count=2}\n``` {.bash .cell-code}\ncurl -L https://metabarcoding.org/obitools4/install.sh | \\\n bash -s -- --install-dir test_install --obitools-prefix k\n```\n:::\n\n\nIn this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus `obigrep` will be named `kobigrep`.\n\n\n## Compilation from sources\n\n",
|
||||||
|
"supporting": [
|
||||||
|
"installation_files/figure-epub"
|
||||||
|
],
|
||||||
|
"filters": [],
|
||||||
|
"engineDependencies": {
|
||||||
|
"jupyter": [
|
||||||
|
{
|
||||||
|
"jsWidgets": false,
|
||||||
|
"jupyterWidgets": false,
|
||||||
|
"htmlLibraries": []
|
||||||
|
}
|
||||||
|
]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,11 @@
|
|||||||
|
{
|
||||||
|
"hash": "cdc3ee1d58e10538db75a4867b10ee0e",
|
||||||
|
"result": {
|
||||||
|
"markdown": "# Installation of the *OBITools*\n\n## Availability of the *OBITools*\n\nThe *OBITools* are open source and protected by the [CeCILL 2.1 license](http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html).\n\nAll the sources of the [*OBITools4*](http://metabarcoding.org/obitools4) can be downloaded from the metabarcoding git server (https://git.metabarcoding.org).\n\n## Prerequisites\n\nThe *OBITools4* are developped using the [GO programming language](https://go.dev/), we stick to the latest version of the language, today the $1.21.4$. If you want to download and compile the sources yourself, you first need to install the corresponding compiler on your system. Some parts of the soft are also written in C, therefore a recent C compiler is also requested, GCC on Linux or Windows, the Developer Tools on Mac.\n\nWhatever the installation you decide for, you will have to ensure that a C compiler is available on your system.\n\n## Installation with the install script\n\nAn installation script that compiles the new *OBITools* on your Unix-like system is available online.\nThe easiest way to run it is to copy and paste the following command into your terminal\n\n::: {.cell execution_count=1}\n``` {.bash .cell-code}\ncurl -L https://metabarcoding.org/obitools4/install.sh | bash\n```\n:::\n\n\nBy default, the script installs the *OBITools* commands and other associated files into the `/usr/local` directory.\nThe names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.\nTherefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be \navailable on your system, the installation script offers two options:\n\n\n> -i, --install-dir Directory where *OBITools* are installed \n> (as example use `/usr/local` not `/usr/local/bin`).\n> \n> -p, --obitools-prefix Prefix added to the *OBITools* command names if you\n> want to have several versions of obitools at the\n> same time on your system (as example `-p g` will produce \n> `gobigrep` command instead of `obigrep`).\n\nYou can use these options by following the installation command:\n\n::: {.cell execution_count=2}\n``` {.bash .cell-code}\ncurl -L https://metabarcoding.org/obitools4/install.sh | \\\n bash -s -- --install-dir test_install --obitools-prefix k\n```\n:::\n\n\nIn this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus `obigrep` will be named `kobigrep`.\n\n\n## Compilation from sources\n\n",
|
||||||
|
"supporting": [
|
||||||
|
"installation_files/figure-html"
|
||||||
|
],
|
||||||
|
"filters": [],
|
||||||
|
"includes": {}
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,10 @@
|
|||||||
|
{
|
||||||
|
"hash": "cdc3ee1d58e10538db75a4867b10ee0e",
|
||||||
|
"result": {
|
||||||
|
"markdown": "# Installation of the *OBITools*\n\n## Availability of the *OBITools*\n\nThe *OBITools* are open source and protected by the [CeCILL 2.1 license](http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html).\n\nAll the sources of the [*OBITools4*](http://metabarcoding.org/obitools4) can be downloaded from the metabarcoding git server (https://git.metabarcoding.org).\n\n## Prerequisites\n\nThe *OBITools4* are developped using the [GO programming language](https://go.dev/), we stick to the latest version of the language, today the $1.21.4$. If you want to download and compile the sources yourself, you first need to install the corresponding compiler on your system. Some parts of the soft are also written in C, therefore a recent C compiler is also requested, GCC on Linux or Windows, the Developer Tools on Mac.\n\nWhatever the installation you decide for, you will have to ensure that a C compiler is available on your system.\n\n## Installation with the install script\n\nAn installation script that compiles the new *OBITools* on your Unix-like system is available online.\nThe easiest way to run it is to copy and paste the following command into your terminal\n\n::: {.cell execution_count=1}\n``` {.bash .cell-code}\ncurl -L https://metabarcoding.org/obitools4/install.sh | bash\n```\n:::\n\n\nBy default, the script installs the *OBITools* commands and other associated files into the `/usr/local` directory.\nThe names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.\nTherefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be \navailable on your system, the installation script offers two options:\n\n\n> -i, --install-dir Directory where *OBITools* are installed \n> (as example use `/usr/local` not `/usr/local/bin`).\n> \n> -p, --obitools-prefix Prefix added to the *OBITools* command names if you\n> want to have several versions of obitools at the\n> same time on your system (as example `-p g` will produce \n> `gobigrep` command instead of `obigrep`).\n\nYou can use these options by following the installation command:\n\n::: {.cell execution_count=2}\n``` {.bash .cell-code}\ncurl -L https://metabarcoding.org/obitools4/install.sh | \\\n bash -s -- --install-dir test_install --obitools-prefix k\n```\n:::\n\n\nIn this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus `obigrep` will be named `kobigrep`.\n\n\n## Compilation from sources\n\n",
|
||||||
|
"supporting": [
|
||||||
|
"installation_files/figure-pdf"
|
||||||
|
],
|
||||||
|
"filters": []
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -41,12 +41,14 @@ execute:
|
|||||||
format:
|
format:
|
||||||
html:
|
html:
|
||||||
theme: zephyr
|
theme: zephyr
|
||||||
|
embed-resources: true
|
||||||
pdf:
|
pdf:
|
||||||
documentclass: scrreprt
|
documentclass: scrreprt
|
||||||
keep-tex: true
|
keep-tex: true
|
||||||
epub:
|
epub:
|
||||||
html-math-method: mathml
|
html-math-method: mathml
|
||||||
|
code-overflow: scroll
|
||||||
|
css: epub.css
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|||||||
Binary file not shown.
|
Before Width: | Height: | Size: 19 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 61 KiB |
@@ -0,0 +1 @@
|
|||||||
|
c9abc6ef1d9b10058625347639c0a133059bfe90
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
9be990e7b56476a941dcdd1d074f31e666ec8dc8
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
4e6501bd48200758a94734704f075dcadd97a712
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
fcbb404e0aba238ccfab3f5e1ca388985be78115
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
3c08c12ad322472ca9f3f1137e6dcc9fc9c504b1
|
||||||
+103
-64
@@ -1,23 +1,20 @@
|
|||||||
# File formats usable with *OBITools*
|
# File formats usable with *OBITools*
|
||||||
|
|
||||||
OBITools manipulate have to manipulate DNA sequence data and taxonomical data.
|
*OBITools* manipulate have to manipulate DNA sequence data and taxonomical data. They can use some supplentary metadata describing the experiment and produce some stats about the processed DNA data. All the manipulated data are stored in text files, following standard data format.
|
||||||
They can use some supplentary metadata describing the experiment and produce
|
|
||||||
some stats about the processed DNA data. All the manipulated data are stored in
|
|
||||||
text files, following standard data format.
|
|
||||||
|
|
||||||
# The DNA sequence data
|
## The DNA sequence data
|
||||||
|
|
||||||
Sequences can be stored following various format. OBITools knows some of them. The central formats for sequence files manipulated by OBITools scripts are the [`fasta`](#the-fasta-sequence-format) and [`fastq`](#the-fastq-sequence-format) format. OBITools extends the both these formats by specifying a syntax to include in the definition line data qualifying the sequence. All file formats use the `IUPAC` code for encoding nucleotides.
|
Sequences can be stored following various format. *OBITools* knows some of them. The central formats for sequence files manipulated by *OBITools* scripts are the [*FASTA*](#sec-fasta) and [*FASTQ*](#sec-fastq) format. *OBITools* extends the both these formats by specifying a syntax to include in the definition line data qualifying the sequence. All file formats use the [`IUPAC`](#sec-iupac) code for encoding nucleotides.
|
||||||
|
|
||||||
Moreover these two formats that can be used as input and output formats, **OBITools4** can read the following format :
|
Moreover these two formats that can be used as input and output formats, *OBITools4* can read the following format :
|
||||||
|
|
||||||
- [EBML flat file](https://ena-docs.readthedocs.io/en/latest/submit/fileprep/flat-file-example.html) format (use by ENA)
|
- [EBML flat file](https://ena-docs.readthedocs.io/en/latest/submit/fileprep/flat-file-example.html) format (use by ENA)
|
||||||
- [Genbank flat file format](https://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html)
|
- [Genbank flat file format](https://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html)
|
||||||
- [ecoPCR output files](https://pythonhosted.org/OBITools/scripts/ecoPCR.html)
|
- [ecoPCR output files](https://pythonhosted.org/OBITools/scripts/ecoPCR.html)
|
||||||
|
|
||||||
## The IUPAC Code
|
### The IUPAC Code {#sec-iupac}
|
||||||
|
|
||||||
The International Union of Pure and Applied Chemistry (IUPAC\_) defined the standard code for representing protein or DNA sequences.
|
The International Union of Pure and Applied Chemistry ([IUPAC]()) defined the standard code for representing protein or DNA sequences.
|
||||||
|
|
||||||
| **Code** | **Nucleotide** |
|
| **Code** | **Nucleotide** |
|
||||||
|----------|-----------------------------|
|
|----------|-----------------------------|
|
||||||
@@ -38,48 +35,59 @@ The International Union of Pure and Applied Chemistry (IUPAC\_) defined the stan
|
|||||||
| V | A, C, or G (not T, not U) |
|
| V | A, C, or G (not T, not U) |
|
||||||
| N | Any base (A, C, G, T, or U) |
|
| N | Any base (A, C, G, T, or U) |
|
||||||
|
|
||||||
## The *fasta* sequence format {#sec-fasta}
|
### The *FASTA* sequence format {#sec-fasta}
|
||||||
|
|
||||||
The **fasta format** is certainly the most widely used sequence file format. This is certainly due to its great simplicity. It was originally created for the Lipman and Pearson [FASTA program](http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation). OBITools use in more of the classical `fasta` format an `extended version` of this format where structured data are included in the title line.
|
The [*FASTA*](#sec-fasta) format is certainly the most widely used sequence file format. This is certainly due to its great simplicity. It was originally created for the Lipman and Pearson [`FASTA` program](http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation). *OBITools* use in more of the classical [*FASTA*](#sec-fasta) format an `extended version` of this format where structured data are included in the title line.
|
||||||
|
|
||||||
In *fasta* format a sequence is represented by a title line beginning with a **`>`** character and the sequences by itself following the :doc:`iupac` code. The sequence is usually split other severals lines of the same length (expect for the last one)
|
In [*FASTA*](#sec-fasta) format a sequence is represented by a title line beginning with a **`>`** character and the sequences by itself following the [`IUPAC`](#sec-iupac) code. The sequence is usually split other severals lines of the same length (expect for the last one)
|
||||||
|
|
||||||
>my_sequence this is my pretty sequence
|
```
|
||||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
>my_sequence this is my pretty sequence
|
||||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||||
AACGACGTTGCAGTACGTTGCAGT
|
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||||
|
AACGACGTTGCAGTACGTTGCAGT
|
||||||
|
```
|
||||||
|
|
||||||
This is no special format for the title line excepting that this line should be unique. Usually the first word following the **\>** character is considered as the sequence identifier. The end of the title line corresponding to a description of the sequence. Several sequences can be concatenated in a same file. The description of the next sequence is just pasted at the end of the record of the previous one
|
This is no special format for the title line excepting that this line should be unique. Usually the first word following the **\>** character is considered as the sequence identifier. The end of the title line corresponding to a description of the sequence. Several sequences can be concatenated in a same file. The description of the next sequence is just pasted at the end of the record of the previous one
|
||||||
|
|
||||||
>sequence_A this is my first pretty sequence
|
```
|
||||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
>sequence_A this is my first pretty sequence
|
||||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||||
AACGACGTTGCAGTACGTTGCAGT
|
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||||
>sequence_B this is my second pretty sequence
|
AACGACGTTGCAGTACGTTGCAGT
|
||||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
>sequence_B this is my second pretty sequence
|
||||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||||
AACGACGTTGCAGTACGTTGCAGT
|
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||||
>sequence_C this is my third pretty sequence
|
AACGACGTTGCAGTACGTTGCAGT
|
||||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
>sequence_C this is my third pretty sequence
|
||||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||||
AACGACGTTGCAGTACGTTGCAGT
|
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||||
|
AACGACGTTGCAGTACGTTGCAGT
|
||||||
## The *fastq* sequence format[^01_obitools_doc-1]{#sec-fastq}
|
|
||||||
|
|
||||||
The **FASTQ** format is a text file format for storing both biological sequences (only nucleic acid sequences) and the associated quality scores. The sequence and score are each encoded by a single ASCII character. This format was originally developed by the Wellcome Trust Sanger Institute to link a [FASTA](#the-fasta-sequence-format) sequence file to the corresponding quality data, but has recently become the de facto standard for storing results from high-throughput sequencers [@cock2010sanger].
|
|
||||||
|
|
||||||
[^01_obitools_doc-1]: This article uses material from the Wikipedia article [`FASTQ format`](http://en.wikipedia.org/wiki/FASTQ_format) which is released under the `Creative Commons Attribution-Share-Alike License 3.0`
|
|
||||||
|
|
||||||
A fastq file normally uses four lines per sequence.
|
|
||||||
|
|
||||||
- Line 1 begins with a '\@' character and is followed by a sequence identifier and an *optional* description (like a :ref:`fasta` title line).
|
|
||||||
- Line 2 is the raw sequence letters.
|
|
||||||
- Line 3 begins with a '+' character and is *optionally* followed by the same sequence identifier (and any description) again.
|
|
||||||
- Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
|
|
||||||
|
|
||||||
A fastq file containing a single sequence might look like this:
|
|
||||||
|
|
||||||
```
|
```
|
||||||
|
|
||||||
|
#### File extensions
|
||||||
|
|
||||||
|
There is no standard file extension for a [*FASTA*](#sec-fasta) file, but `.fa` and `.fasta`, are commonly used.
|
||||||
|
|
||||||
|
### The *FASTQ* sequence format[^formats-1] {#sec-fastq}
|
||||||
|
|
||||||
|
[^formats-1]: This article uses material from the Wikipedia article [`FASTQ format`](http://en.wikipedia.org/wiki/FASTQ_format) which is released under the `Creative Commons Attribution-Share-Alike License 3.0`
|
||||||
|
|
||||||
|
The [*FASTQ*](#sec-fastq) format is a text file format for storing both biological sequences (only nucleic acid sequences) and the associated sequence quality scores. Every nucleotide of the sequence and its associated quality score are each encoded by a single ASCII character. This format was originally developed by the Wellcome Trust Sanger Institute to link a [*FASTA*](#sec-fasta) sequence file to the corresponding quality data, but is now became the *de facto* standard for storing results from high-throughput sequencers [@cock2010sanger].
|
||||||
|
|
||||||
|
*OBITools* considers that a [*FASTQ*](#sec-fastq) file uses four lines to encode a sequence record.
|
||||||
|
|
||||||
|
- Line 1 begins with a '\@' character and is followed by a sequence identifier and an *optional* description
|
||||||
|
(like a [*FASTA*](#sec-fasta) title line).
|
||||||
|
- Line 2 is the sequence letters, in upper or lower case, but *OBITools* only write sequences as lower cases.
|
||||||
|
- Line 3 begins with a '+' character and is *optionally* followed by the same sequence identifier
|
||||||
|
(and any description) again.
|
||||||
|
- Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of
|
||||||
|
symbols as letters in the sequence.
|
||||||
|
|
||||||
|
A [*FASTQ*](#sec-fastq) file looks like this:
|
||||||
|
|
||||||
|
```
|
||||||
@SEQ_ID
|
@SEQ_ID
|
||||||
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
|
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
|
||||||
+
|
+
|
||||||
@@ -88,16 +96,16 @@ GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
|
|||||||
|
|
||||||
The character '!' represents the lowest quality while '\~' is the highest. Here are the quality value characters in left-to-right increasing order of quality (`ASCII`):
|
The character '!' represents the lowest quality while '\~' is the highest. Here are the quality value characters in left-to-right increasing order of quality (`ASCII`):
|
||||||
|
|
||||||
```
|
```
|
||||||
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]
|
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]
|
||||||
^_`abcdefghijklmnopqrstuvwxyz{|}~
|
^_`abcdefghijklmnopqrstuvwxyz{|}~
|
||||||
```
|
```
|
||||||
|
|
||||||
The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "\@" and "+" as markers (these characters can also occur in the quality string).
|
If the original Sanger [*FASTQ*](#sec-fastq) files also allowed the sequence and quality strings to be wrapped (split over multiple lines), it is not supported by *OBITools* as it make parsing complicated due to the unfortunate choice of "\@" and "+" as markers (these characters can also occur in the quality string).
|
||||||
|
|
||||||
### Sequence quality scores{.unnumbered}
|
#### Sequence quality scores {.unnumbered}
|
||||||
|
|
||||||
The Phred quality value *Q* is an integer mapping of *p* (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:
|
The Phred quality value *Q* is an integer mapping of *p* (*i.e.*, the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:
|
||||||
|
|
||||||
$$
|
$$
|
||||||
Q_\text{sanger} = -10 \, \log_{10} p
|
Q_\text{sanger} = -10 \, \log_{10} p
|
||||||
@@ -113,24 +121,18 @@ Although both mappings are asymptotically identical at higher quality values, th
|
|||||||
|
|
||||||
{#fig-Probabilitymetrics}
|
{#fig-Probabilitymetrics}
|
||||||
|
|
||||||
|
##### Encoding {.unnumbered}
|
||||||
|
|
||||||
#### Encoding{.unnumbered}
|
The [*FASTQ*](#sec-fastq) format had differente way of encoding the Phred quality score along the time. Here a breif history of these changes is presented. *OBITools*
|
||||||
|
|
||||||
The *fastq* format had differente way of encoding the Phred quality score along the time. Here a breif history of these changes is presented.
|
|
||||||
|
|
||||||
- Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps).
|
- Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps).
|
||||||
- Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
|
- Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
|
||||||
- Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
|
- Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
|
||||||
- Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B".
|
- Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B".
|
||||||
|
|
||||||
> Sequencing Control Software, Version 2.6, (Catalog \# SY-960-2601, Part \# 15009921 Rev. A, November 2009, page 30)
|
> Sequencing Control Software, Version 2.6, (Catalog \# SY-960-2601, Part \# 15009921 Rev. A, November 2009, page 30) states the following: *If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses.* Also, the quality score encoded as "B" letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:
|
||||||
> states the following: *If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality
|
|
||||||
> values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of
|
|
||||||
> quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific
|
|
||||||
> final portion of the read should not be used in further analyses.* Also, the quality score encoded as "B" letter
|
|
||||||
> may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:
|
|
||||||
|
|
||||||
```
|
```
|
||||||
@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
|
@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
|
||||||
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGA
|
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGA
|
||||||
TTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
|
TTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
|
||||||
@@ -143,8 +145,45 @@ An alternative interpretation of this ASCII encoding has been proposed. Also, in
|
|||||||
|
|
||||||
- Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).
|
- Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).
|
||||||
|
|
||||||
OBItools follows the Sanger format. Nevertheless, It is possible to read files encoded following the Solexa/Illumina format by applying a shift of 62 (see the option **\--solexa** of the OBITools commands).
|
*OBITools* follows the Sanger format. Nevertheless, It is possible to read files encoded following the Solexa/Illumina format by applying a shift of 62 (see the option **--solexa** of the *OBITools* commands).
|
||||||
|
|
||||||
## File extension
|
#### File extensions
|
||||||
|
|
||||||
There is no standard file extension for a FASTQ file, but .fq and .fastq, are commonly used.
|
There is no standard file extension for a [*FASTQ*](#sec-fastq) file, but `.fq` and `.fastq`, are commonly used.
|
||||||
|
|
||||||
|
## The taxonomy files
|
||||||
|
|
||||||
|
Many OBITools are able to take into account taxonomic data. This is done by specifying
|
||||||
|
a directory containing all :doc:`NCBI taxonomy dump files <./taxdump>`.
|
||||||
|
|
||||||
|
|
||||||
|
## The sample description file
|
||||||
|
|
||||||
|
A key file for *OBITools4* is the file describing all samples (PCR) analyzed in the processed sequencing library file.
|
||||||
|
This file, often called the `ngsfilter` file, is a tab separated values (TSV) file. The format of this file is exactly
|
||||||
|
identical to that used in *OBITools2* and *OBITools4*.
|
||||||
|
|
||||||
|
```{tsv, .smaller}
|
||||||
|
wolf_diet 13a_F730603 aattaac TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F
|
||||||
|
wolf_diet 15a_F730814 gaagtag TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F
|
||||||
|
wolf_diet 26a_F040644 gaatatc TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F
|
||||||
|
wolf_diet 29a_F260619 gcctcct TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F
|
||||||
|
```
|
||||||
|
|
||||||
|
At least six columns must be present in every line of the file.
|
||||||
|
|
||||||
|
- The first column contains the name of the experience:
|
||||||
|
|
||||||
|
An experiment name groups a set of sample together. Sequences belonging to the experiment are
|
||||||
|
tagged with an attribute `experiment` containing the name of the experiment in their annotation.
|
||||||
|
|
||||||
|
- The second column contains the sample identifier in the experiment
|
||||||
|
|
||||||
|
The sample identifier must be unique in the experiment. The `obimultiplex` and `obitagpcr` commands add
|
||||||
|
to all the sequences bellonging to the same sample an attribute `sample` containing the sample identifier
|
||||||
|
|
||||||
|
- The third column contains description of the tag used to identify sequences corresponding to this sample
|
||||||
|
|
||||||
|
- The fourth column contains the forward primer sequence
|
||||||
|
- The fifth column contains the reverse primer sequence
|
||||||
|
- The sixth column must always contain the character `F` (full length)
|
||||||
+4304
File diff suppressed because one or more lines are too long
@@ -0,0 +1 @@
|
|||||||
|
66c05db68b31d840135dabdb2bfa4ddee8fd3957
|
||||||
@@ -1,6 +1,6 @@
|
|||||||
# Installation of the obitools
|
# Installation of the *OBITools*
|
||||||
|
|
||||||
## Availability of the OBITools
|
## Availability of the *OBITools*
|
||||||
|
|
||||||
The *OBITools* are open source and protected by the [CeCILL 2.1 license](http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html).
|
The *OBITools* are open source and protected by the [CeCILL 2.1 license](http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html).
|
||||||
|
|
||||||
@@ -8,11 +8,44 @@ All the sources of the [*OBITools4*](http://metabarcoding.org/obitools4) can be
|
|||||||
|
|
||||||
## Prerequisites
|
## Prerequisites
|
||||||
|
|
||||||
The *OBITools4* are developped using the [GO programming language](https://go.dev/), we stick to the latest version of the language, today the $1.19.5$. If you want to download and compile the sources yourself, you first need to install the corresponding compiler on your system. Some parts of the soft are also written in C, therefore a recent C compiler is also requested, GCC on Linux or Windows, the Developer Tools on Mac.
|
The *OBITools4* are developped using the [GO programming language](https://go.dev/), we stick to the latest version of the language, today the $1.21.4$. If you want to download and compile the sources yourself, you first need to install the corresponding compiler on your system. Some parts of the soft are also written in C, therefore a recent C compiler is also requested, GCC on Linux or Windows, the Developer Tools on Mac.
|
||||||
|
|
||||||
Whatever the installation you decide for, you will have to ensure that a C compiler is available on your system.
|
Whatever the installation you decide for, you will have to ensure that a C compiler is available on your system.
|
||||||
|
|
||||||
## Installation with the install script
|
## Installation with the install script
|
||||||
|
|
||||||
|
An installation script that compiles the new *OBITools* on your Unix-like system is available online.
|
||||||
|
The easiest way to run it is to copy and paste the following command into your terminal
|
||||||
|
|
||||||
|
```{bash}
|
||||||
|
#| eval: false
|
||||||
|
curl -L https://metabarcoding.org/obitools4/install.sh | bash
|
||||||
|
```
|
||||||
|
|
||||||
|
By default, the script installs the *OBITools* commands and other associated files into the `/usr/local` directory.
|
||||||
|
The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
|
||||||
|
Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be
|
||||||
|
available on your system, the installation script offers two options:
|
||||||
|
|
||||||
|
|
||||||
|
> -i, --install-dir Directory where *OBITools* are installed
|
||||||
|
> (as example use `/usr/local` not `/usr/local/bin`).
|
||||||
|
>
|
||||||
|
> -p, --obitools-prefix Prefix added to the *OBITools* command names if you
|
||||||
|
> want to have several versions of obitools at the
|
||||||
|
> same time on your system (as example `-p g` will produce
|
||||||
|
> `gobigrep` command instead of `obigrep`).
|
||||||
|
|
||||||
|
You can use these options by following the installation command:
|
||||||
|
|
||||||
|
```{bash}
|
||||||
|
#| eval: false
|
||||||
|
curl -L https://metabarcoding.org/obitools4/install.sh | \
|
||||||
|
bash -s -- --install-dir test_install --obitools-prefix k
|
||||||
|
```
|
||||||
|
|
||||||
|
In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus `obigrep` will be named `kobigrep`.
|
||||||
|
|
||||||
|
|
||||||
## Compilation from sources
|
## Compilation from sources
|
||||||
|
|
||||||
|
|||||||
@@ -0,0 +1 @@
|
|||||||
|
396888557eb60df9c0c43140545cb945f94dba19
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
6190e7e7d926a7ed289145ae9808076d3a5e5e18
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
aaa1261fd473ee852e6462abb4cefae7eb36a486
|
||||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1 @@
|
|||||||
|
568390348c10625dee9c6f3d6d1a3ba54a08aee3
|
||||||
Binary file not shown.
|
After Width: | Height: | Size: 46 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 45 KiB |
Binary file not shown.
Binary file not shown.
Vendored
BIN
Binary file not shown.
Vendored
BIN
Binary file not shown.
Vendored
-533
@@ -1,533 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - Appendix A — Annexes</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
pre > code.sourceCode { white-space: pre; position: relative; }
|
|
||||||
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
|
|
||||||
pre > code.sourceCode > span:empty { height: 1.2em; }
|
|
||||||
.sourceCode { overflow: visible; }
|
|
||||||
code.sourceCode > span { color: inherit; text-decoration: inherit; }
|
|
||||||
div.sourceCode { margin: 1em 0; }
|
|
||||||
pre.sourceCode { margin: 0; }
|
|
||||||
@media screen {
|
|
||||||
div.sourceCode { overflow: auto; }
|
|
||||||
}
|
|
||||||
@media print {
|
|
||||||
pre > code.sourceCode { white-space: pre-wrap; }
|
|
||||||
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
|
|
||||||
}
|
|
||||||
pre.numberSource code
|
|
||||||
{ counter-reset: source-line 0; }
|
|
||||||
pre.numberSource code > span
|
|
||||||
{ position: relative; left: -4em; counter-increment: source-line; }
|
|
||||||
pre.numberSource code > span > a:first-child::before
|
|
||||||
{ content: counter(source-line);
|
|
||||||
position: relative; left: -1em; text-align: right; vertical-align: baseline;
|
|
||||||
border: none; display: inline-block;
|
|
||||||
-webkit-touch-callout: none; -webkit-user-select: none;
|
|
||||||
-khtml-user-select: none; -moz-user-select: none;
|
|
||||||
-ms-user-select: none; user-select: none;
|
|
||||||
padding: 0 4px; width: 4em;
|
|
||||||
color: #aaaaaa;
|
|
||||||
}
|
|
||||||
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
|
|
||||||
div.sourceCode
|
|
||||||
{ }
|
|
||||||
@media screen {
|
|
||||||
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
|
|
||||||
}
|
|
||||||
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
|
|
||||||
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
|
|
||||||
code span.at { color: #7d9029; } /* Attribute */
|
|
||||||
code span.bn { color: #40a070; } /* BaseN */
|
|
||||||
code span.bu { color: #008000; } /* BuiltIn */
|
|
||||||
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
|
|
||||||
code span.ch { color: #4070a0; } /* Char */
|
|
||||||
code span.cn { color: #880000; } /* Constant */
|
|
||||||
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
|
|
||||||
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
|
|
||||||
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
|
|
||||||
code span.dt { color: #902000; } /* DataType */
|
|
||||||
code span.dv { color: #40a070; } /* DecVal */
|
|
||||||
code span.er { color: #ff0000; font-weight: bold; } /* Error */
|
|
||||||
code span.ex { } /* Extension */
|
|
||||||
code span.fl { color: #40a070; } /* Float */
|
|
||||||
code span.fu { color: #06287e; } /* Function */
|
|
||||||
code span.im { color: #008000; font-weight: bold; } /* Import */
|
|
||||||
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
|
|
||||||
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
|
|
||||||
code span.op { color: #666666; } /* Operator */
|
|
||||||
code span.ot { color: #007020; } /* Other */
|
|
||||||
code span.pp { color: #bc7a00; } /* Preprocessor */
|
|
||||||
code span.sc { color: #4070a0; } /* SpecialChar */
|
|
||||||
code span.ss { color: #bb6688; } /* SpecialString */
|
|
||||||
code span.st { color: #4070a0; } /* String */
|
|
||||||
code span.va { color: #19177c; } /* Variable */
|
|
||||||
code span.vs { color: #4070a0; } /* VerbatimString */
|
|
||||||
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./references.html" rel="next">
|
|
||||||
<link href="./library.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title">Appendix A — Annexes</h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#sequence-attributes" id="toc-sequence-attributes" class="nav-link active" data-scroll-target="#sequence-attributes"><span class="toc-section-number">A.1</span> Sequence attributes</a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block">Appendix A — Annexes</h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="sequence-attributes" class="level2" data-number="A.1">
|
|
||||||
<h2 data-number="A.1" class="anchored" data-anchor-id="sequence-attributes"><span class="header-section-number">A.1</span> Sequence attributes</h2>
|
|
||||||
<p><strong>ali_dir (<code>string</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
<li>The attribute can contain 2 string values <code>left</code> or <code>right</code>.</li>
|
|
||||||
</ul>
|
|
||||||
<p>The alignment generated by <em>obipairing</em> is a 3’-end gap free algorithm. Two cases can occur when aligning the forward and reverse reads. If the barcode is long enough, both the reads overlap only on their 3’ ends. In such case, the alignment direction <code>ali_dir</code> is set to <em>left</em>. If the barcode is shorter than the read length, the paired reads overlap by their 5’ ends, and the complete barcode is sequenced by both the reads. In that later case, <code>ali_dir</code> is set to <em>right</em>.</p>
|
|
||||||
<p><strong>ali_length (<code>int</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
</ul>
|
|
||||||
<p>Length of the aligned parts when merging forward and reverse reads</p>
|
|
||||||
<p><strong>count (<code>int</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obiuniq</em> tool</li>
|
|
||||||
<li>Getter : method <code>Count()</code></li>
|
|
||||||
<li>Setter : method <code>SetCount(int)</code></li>
|
|
||||||
</ul>
|
|
||||||
<p>The <code>count</code> attribute indicates how-many strictly identical reads have been merged in a single record. It contains an integer value. If it is absent this means that the sequence record represents a single occurrence of the sequence.</p>
|
|
||||||
<p>The <code>Count()</code> method allows to access to the count attribute as an integer value. If the <code>count</code> attribute is not defined for the given sequence, the value <em>1</em> is returned</p>
|
|
||||||
<p><strong>merged_* (<code>map[string]int</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obiuniq</em> tool</li>
|
|
||||||
</ul>
|
|
||||||
<p>The <code>-m</code> option of the <em>obiuniq</em> tools allows for keeping track of the distribution of the values stored in given attribute of interest. Often this option is used to summarise distribution of a sequence variant accross samples when <em>obiuniq</em> is run after running <em>obimultiplex</em>. The actual name of the attribute depends on the name of the monitored attribute. If <code>-m</code> option is used with the attribute <em>sample</em>, then this attribute names <em>merged_sample</em>.</p>
|
|
||||||
<p><strong>mode (<code>string</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
<li>The attribute can contain 2 string values <code>join</code> or <code>alignment</code>.</li>
|
|
||||||
</ul>
|
|
||||||
<p><strong>obitag_ref_index (<code>map[string]string</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obirefidx</em> tool.</li>
|
|
||||||
</ul>
|
|
||||||
<p>It resumes to which taxonomic annotation a match to that sequence must lead according to the number of differences existing between the query sequence and the reference sequence having that tag.</p>
|
|
||||||
<div class="sourceCode" id="cb1"><pre class="sourceCode json code-with-copy"><code class="sourceCode json"><span id="cb1-1"><a href="#cb1-1" aria-hidden="true" tabindex="-1"></a> <span class="fu">{</span><span class="dt">"0"</span><span class="fu">:</span><span class="st">"9606@Homo sapiens@species"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-2"><a href="#cb1-2" aria-hidden="true" tabindex="-1"></a> <span class="dt">"2"</span><span class="fu">:</span><span class="st">"207598@Homininae@subfamily"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-3"><a href="#cb1-3" aria-hidden="true" tabindex="-1"></a> <span class="dt">"3"</span><span class="fu">:</span><span class="st">"9604@Hominidae@family"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-4"><a href="#cb1-4" aria-hidden="true" tabindex="-1"></a> <span class="dt">"8"</span><span class="fu">:</span><span class="st">"314295@Hominoidea@superfamily"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-5"><a href="#cb1-5" aria-hidden="true" tabindex="-1"></a> <span class="dt">"10"</span><span class="fu">:</span><span class="st">"9526@Catarrhini@parvorder"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-6"><a href="#cb1-6" aria-hidden="true" tabindex="-1"></a> <span class="dt">"12"</span><span class="fu">:</span><span class="st">"1437010@Boreoeutheria@clade"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-7"><a href="#cb1-7" aria-hidden="true" tabindex="-1"></a> <span class="dt">"16"</span><span class="fu">:</span><span class="st">"9347@Eutheria@clade"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-8"><a href="#cb1-8" aria-hidden="true" tabindex="-1"></a> <span class="dt">"17"</span><span class="fu">:</span><span class="st">"40674@Mammalia@class"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-9"><a href="#cb1-9" aria-hidden="true" tabindex="-1"></a> <span class="dt">"22"</span><span class="fu">:</span><span class="st">"117571@Euteleostomi@clade"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-10"><a href="#cb1-10" aria-hidden="true" tabindex="-1"></a> <span class="dt">"25"</span><span class="fu">:</span><span class="st">"7776@Gnathostomata@clade"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-11"><a href="#cb1-11" aria-hidden="true" tabindex="-1"></a> <span class="dt">"29"</span><span class="fu">:</span><span class="st">"33213@Bilateria@clade"</span><span class="fu">,</span></span>
|
|
||||||
<span id="cb1-12"><a href="#cb1-12" aria-hidden="true" tabindex="-1"></a> <span class="dt">"30"</span><span class="fu">:</span><span class="st">"6072@Eumetazoa@clade"</span><span class="fu">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p><strong>pairing_mismatches (<code>map[string]string</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
</ul>
|
|
||||||
<p><strong>seq_a_single (<code>int</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
</ul>
|
|
||||||
<p><strong>seq_ab_match (<code>int</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
</ul>
|
|
||||||
<p><strong>seq_b_single (<code>int</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
</ul>
|
|
||||||
<p><strong>score (<code>int</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
</ul>
|
|
||||||
<p><strong>score_norm (<code>float</code>)</strong></p>
|
|
||||||
<ul>
|
|
||||||
<li>Set by the <em>obipairing</em> tool</li>
|
|
||||||
<li>The value ranges between 0 and 1.</li>
|
|
||||||
</ul>
|
|
||||||
<p>Score of the alignment between forward and reverse reads expressed as a fraction of identity.</p>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./library.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text">The GO <em>OBITools</em> library</span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./references.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text">References</span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
+1
@@ -0,0 +1 @@
|
|||||||
|
f80b0a57d2179e19a09b0030ce7c8da85a462c6b
|
||||||
Vendored
-406
@@ -1,406 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 10 Sequence annotations</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./comm_computation.html" rel="next">
|
|
||||||
<link href="./comm_reformat.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#obiannotate" id="toc-obiannotate" class="nav-link active" data-scroll-target="#obiannotate"><span class="toc-section-number">10.1</span> <code>obiannotate</code></a></li>
|
|
||||||
<li><a href="#obitag" id="toc-obitag" class="nav-link" data-scroll-target="#obitag"><span class="toc-section-number">10.2</span> <code>obitag</code></a></li>
|
|
||||||
<li><a href="#obitagpcr" id="toc-obitagpcr" class="nav-link" data-scroll-target="#obitagpcr"><span class="toc-section-number">10.3</span> <code>obitagpcr</code></a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="obiannotate" class="level2" data-number="10.1">
|
|
||||||
<h2 data-number="10.1" class="anchored" data-anchor-id="obiannotate"><span class="header-section-number">10.1</span> <code>obiannotate</code></h2>
|
|
||||||
</section>
|
|
||||||
<section id="obitag" class="level2" data-number="10.2">
|
|
||||||
<h2 data-number="10.2" class="anchored" data-anchor-id="obitag"><span class="header-section-number">10.2</span> <code>obitag</code></h2>
|
|
||||||
</section>
|
|
||||||
<section id="obitagpcr" class="level2" data-number="10.3">
|
|
||||||
<h2 data-number="10.3" class="anchored" data-anchor-id="obitagpcr"><span class="header-section-number">10.3</span> <code>obitagpcr</code></h2>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./comm_reformat.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./comm_computation.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
e19d90920100208c9bd9fb8951bfb088ea941516
|
||||||
-528
@@ -1,528 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 11 Computations on sequences</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
div.csl-bib-body { }
|
|
||||||
div.csl-entry {
|
|
||||||
clear: both;
|
|
||||||
}
|
|
||||||
.hanging div.csl-entry {
|
|
||||||
margin-left:2em;
|
|
||||||
text-indent:-2em;
|
|
||||||
}
|
|
||||||
div.csl-left-margin {
|
|
||||||
min-width:2em;
|
|
||||||
float:left;
|
|
||||||
}
|
|
||||||
div.csl-right-inline {
|
|
||||||
margin-left:2em;
|
|
||||||
padding-left:1em;
|
|
||||||
}
|
|
||||||
div.csl-indent {
|
|
||||||
margin-left: 2em;
|
|
||||||
}
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./comm_sampling.html" rel="next">
|
|
||||||
<link href="./comm_annotation.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
<script src="https://cdn.jsdelivr.net/npm/mathjax@3/es5/tex-chtml-full.js" type="text/javascript"></script>
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#obipairing" id="toc-obipairing" class="nav-link active" data-scroll-target="#obipairing"><span class="toc-section-number">11.1</span> <code>obipairing</code></a>
|
|
||||||
<ul class="collapse">
|
|
||||||
<li><a href="#alignment-procedure" id="toc-alignment-procedure" class="nav-link" data-scroll-target="#alignment-procedure">Alignment procedure</a></li>
|
|
||||||
<li><a href="#the-scoring-system" id="toc-the-scoring-system" class="nav-link" data-scroll-target="#the-scoring-system">The scoring system</a></li>
|
|
||||||
</ul></li>
|
|
||||||
<li><a href="#obimultiplex" id="toc-obimultiplex" class="nav-link" data-scroll-target="#obimultiplex"><span class="toc-section-number">11.2</span> <code>obimultiplex</code></a></li>
|
|
||||||
<li><a href="#obicomplement" id="toc-obicomplement" class="nav-link" data-scroll-target="#obicomplement"><span class="toc-section-number">11.3</span> <code>obicomplement</code></a></li>
|
|
||||||
<li><a href="#obiclean" id="toc-obiclean" class="nav-link" data-scroll-target="#obiclean"><span class="toc-section-number">11.4</span> <code>obiclean</code></a></li>
|
|
||||||
<li><a href="#obiuniq" id="toc-obiuniq" class="nav-link" data-scroll-target="#obiuniq"><span class="toc-section-number">11.5</span> <code>obiuniq</code></a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="obipairing" class="level2" data-number="11.1">
|
|
||||||
<h2 data-number="11.1" class="anchored" data-anchor-id="obipairing"><span class="header-section-number">11.1</span> <code>obipairing</code></h2>
|
|
||||||
<blockquote class="blockquote">
|
|
||||||
<p>Replace the <code>illuminapairedends</code> original <em>OBITools</em></p>
|
|
||||||
</blockquote>
|
|
||||||
<section id="alignment-procedure" class="level3 unnumbered">
|
|
||||||
<h3 class="unnumbered anchored" data-anchor-id="alignment-procedure">Alignment procedure</h3>
|
|
||||||
<p><code>obipairing</code> is introducing a new alignment algorithm compared to the <code>illuminapairedend</code> command of the <code>OBITools V2</code>. Nethertheless this new algorithm has been design to produce the same results than the previous, except in very few cases.</p>
|
|
||||||
<p>The new algorithm is a two-step procedure. First, a FASTN-type algorithm <span class="citation" data-cites="Lipman1985-hw">(<a href="references.html#ref-Lipman1985-hw" role="doc-biblioref">Lipman and Pearson 1985</a>)</span> identifies the best offset between the two matched readings. This identifies the region of overlap.</p>
|
|
||||||
<p>In the second step, the matching regions of the two reads are extracted along with a flanking sequence of <span class="math inline">\(\Delta\)</span> base pairs. The two subsequences are then aligned using a “one side free end-gap” dynamic programming algorithm. This latter step is only called if at least one mismatch is detected by the FASTP step.</p>
|
|
||||||
<p>Unless the similarity between the two reads at their overlap region is very low, the addition of the flanking regions in the second step of the alignment ensures the same alignment as if the dynamic programming alignment was performed on the full reads.</p>
|
|
||||||
</section>
|
|
||||||
<section id="the-scoring-system" class="level3 unnumbered">
|
|
||||||
<h3 class="unnumbered anchored" data-anchor-id="the-scoring-system">The scoring system</h3>
|
|
||||||
<p>In the dynamic programming step, the match and mismatch scores take into account the quality scores of the two aligned nucleotides. By taking these into account, the probability of a true match can be calculated for each aligned base pair.</p>
|
|
||||||
<p>If we consider a nucleotide read with a quality score <span class="math inline">\(Q\)</span>, the probability of misreading this base (<span class="math inline">\(P_E\)</span>) is : <span class="math display">\[
|
|
||||||
P_E = 10^{-\frac{Q}{10}}
|
|
||||||
\]</span></p>
|
|
||||||
<p>Thus, when a given nucleotide <span class="math inline">\(X\)</span> is observed with the quality score <span class="math inline">\(Q\)</span>. The probability that <span class="math inline">\(X\)</span> is really an <span class="math inline">\(X\)</span> is :</p>
|
|
||||||
<p><span class="math display">\[
|
|
||||||
P(X=X) = 1 - P_E
|
|
||||||
\]</span></p>
|
|
||||||
<p>Otherwise, <span class="math inline">\(X\)</span> is actually one of the three other possible nucleotides (<span class="math inline">\(X_{E1}\)</span>, <span class="math inline">\(X_{E2}\)</span> or <span class="math inline">\(X_{E3}\)</span>). If we suppose that the three reading error have the same probability :</p>
|
|
||||||
<p><span class="math display">\[
|
|
||||||
P(X=X_{E1}) = P(X=X_{E3}) = P(X=X_{E3}) = \frac{P_E}{3}
|
|
||||||
\]</span></p>
|
|
||||||
<p>At each position in an alignment where the two nucleotides <span class="math inline">\(X_1\)</span> and <span class="math inline">\(X_2\)</span> face each other (not a gapped position), the probability of a true match varies depending on whether <span class="math inline">\(X_1=X_2\)</span>, an observed match, or <span class="math inline">\(X_1 \neq X_2\)</span>, an observed mismatch.</p>
|
|
||||||
<p><strong>Probability of a true match when <span class="math inline">\(X_1=X_2\)</span></strong></p>
|
|
||||||
<p>That probability can be divided in two parts. First <span class="math inline">\(X_1\)</span> and <span class="math inline">\(X_2\)</span> have been correctly read. The corresponding probability is :</p>
|
|
||||||
<p><span class="math display">\[
|
|
||||||
\begin{aligned}
|
|
||||||
P_{TM} &= (1- PE_1)(1-PE_2)\\
|
|
||||||
&=(1 - 10^{-\frac{Q_1}{10} } )(1 - 10^{-\frac{Q_2}{10}} )
|
|
||||||
\end{aligned}
|
|
||||||
\]</span></p>
|
|
||||||
<p>Secondly, a match can occure if the true nucleotides read as <span class="math inline">\(X_1\)</span> and <span class="math inline">\(X_2\)</span> are not <span class="math inline">\(X_1\)</span> and <span class="math inline">\(X_2\)</span> but identical.</p>
|
|
||||||
<p><span class="math display">\[
|
|
||||||
\begin{aligned}
|
|
||||||
P(X_1==X_{E1}) \cap P(X_2==X_{E1}) &= \frac{P_{E1} P_{E2}}{9} \\
|
|
||||||
P(X_1==X_{Ex}) \cap P(X_2==X_{Ex}) & = \frac{P_{E1} P_{E2}}{3}
|
|
||||||
\end{aligned}
|
|
||||||
\]</span></p>
|
|
||||||
<p>The probability of a true match between <span class="math inline">\(X_1\)</span> and <span class="math inline">\(X_2\)</span> when <span class="math inline">\(X_1 = X_2\)</span> an observed match :</p>
|
|
||||||
<p><span class="math display">\[
|
|
||||||
\begin{aligned}
|
|
||||||
P(MATCH | X_1 = X_2) = (1- PE_1)(1-PE_2) + \frac{P_{E1} P_{E2}}{3}
|
|
||||||
\end{aligned}
|
|
||||||
\]</span></p>
|
|
||||||
<p><strong>Probability of a true match when <span class="math inline">\(X_1 \neq X_2\)</span></strong></p>
|
|
||||||
<p>That probability can be divided in three parts.</p>
|
|
||||||
<ol type="a">
|
|
||||||
<li><span class="math inline">\(X_1\)</span> has been correctly read and <span class="math inline">\(X_2\)</span> is a sequencing error and is actually equal to <span class="math inline">\(X_1\)</span>. <span class="math display">\[
|
|
||||||
P_a = (1-P_{E1})\frac{P_{E2}}{3}
|
|
||||||
\]</span></li>
|
|
||||||
<li><span class="math inline">\(X_2\)</span> has been correctly read and <span class="math inline">\(X_1\)</span> is a sequencing error and is actually equal to <span class="math inline">\(X_2\)</span>. <span class="math display">\[
|
|
||||||
P_b = (1-P_{E2})\frac{P_{E1}}{3}
|
|
||||||
\]</span></li>
|
|
||||||
<li><span class="math inline">\(X_1\)</span> and <span class="math inline">\(X_2\)</span> corresponds to sequencing error but are actually the same base <span class="math inline">\(X_{Ex}\)</span> <span class="math display">\[
|
|
||||||
P_c = 2\frac{P_{E1} P_{E2}}{9}
|
|
||||||
\]</span></li>
|
|
||||||
</ol>
|
|
||||||
<p>Consequently : <span class="math display">\[
|
|
||||||
\begin{aligned}
|
|
||||||
P(MATCH | X_1 \neq X_2) = (1-P_{E1})\frac{P_{E2}}{3} + (1-P_{E2})\frac{P_{E1}}{3} + 2\frac{P_{E1} P_{E2}}{9}
|
|
||||||
\end{aligned}
|
|
||||||
\]</span></p>
|
|
||||||
<p><strong>Probability of a match under the random model</strong></p>
|
|
||||||
<p>The second considered model is a pure random model where every base is equiprobable, hence having a probability of occurrence of a nucleotide equals <span class="math inline">\(0.25\)</span>. Under that hypothesis</p>
|
|
||||||
<p><span class="math display">\[
|
|
||||||
P(MATCH | \text{Random model}) = 0.25
|
|
||||||
\]</span></p>
|
|
||||||
<p><strong>The score is a log ration of likelyhood</strong></p>
|
|
||||||
<p>Score is define as the logarithm of the ratio between the likelyhood of the observations considering the sequencer error model over tha likelyhood u</p>
|
|
||||||
<div class="cell">
|
|
||||||
<div class="cell-output-display">
|
|
||||||
<div class="quarto-figure quarto-figure-center">
|
|
||||||
<figure class="figure">
|
|
||||||
<p><img src="comm_computation_files/figure-html/unnamed-chunk-1-1.png" class="img-fluid figure-img" width="672"></p>
|
|
||||||
<p></p><figcaption class="figure-caption">Evolution of the match and mismatch scores when the quality of base is 20 while the second range from 10 to 40.</figcaption><p></p>
|
|
||||||
</figure>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
</section>
|
|
||||||
</section>
|
|
||||||
<section id="obimultiplex" class="level2" data-number="11.2">
|
|
||||||
<h2 data-number="11.2" class="anchored" data-anchor-id="obimultiplex"><span class="header-section-number">11.2</span> <code>obimultiplex</code></h2>
|
|
||||||
<blockquote class="blockquote">
|
|
||||||
<p>Replace the <code>ngsfilter</code> original <em>OBITools</em></p>
|
|
||||||
</blockquote>
|
|
||||||
</section>
|
|
||||||
<section id="obicomplement" class="level2" data-number="11.3">
|
|
||||||
<h2 data-number="11.3" class="anchored" data-anchor-id="obicomplement"><span class="header-section-number">11.3</span> <code>obicomplement</code></h2>
|
|
||||||
</section>
|
|
||||||
<section id="obiclean" class="level2" data-number="11.4">
|
|
||||||
<h2 data-number="11.4" class="anchored" data-anchor-id="obiclean"><span class="header-section-number">11.4</span> <code>obiclean</code></h2>
|
|
||||||
</section>
|
|
||||||
<section id="obiuniq" class="level2" data-number="11.5">
|
|
||||||
<h2 data-number="11.5" class="anchored" data-anchor-id="obiuniq"><span class="header-section-number">11.5</span> <code>obiuniq</code></h2>
|
|
||||||
|
|
||||||
|
|
||||||
<div id="refs" class="references csl-bib-body hanging-indent" role="doc-bibliography" style="display: none">
|
|
||||||
<div id="ref-Lipman1985-hw" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Lipman, D J, and W R Pearson. 1985. <span>“<span class="nocase">Rapid and sensitive protein similarity searches</span>.”</span> <em>Science</em> 227 (4693): 1435–41. <a href="http://www.ncbi.nlm.nih.gov/pubmed/2983426">http://www.ncbi.nlm.nih.gov/pubmed/2983426</a>.
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./comm_annotation.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./comm_sampling.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
67ad5e762743fa43802a59dffd91edfba9a6b132
|
||||||
-401
@@ -1,401 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 8 Metabarcode design and quality assessment</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./comm_reformat.html" rel="next">
|
|
||||||
<link href="./expressions.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#obipcr" id="toc-obipcr" class="nav-link active" data-scroll-target="#obipcr"><span class="toc-section-number">8.1</span> <code>obipcr</code></a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="obipcr" class="level2" data-number="8.1">
|
|
||||||
<h2 data-number="8.1" class="anchored" data-anchor-id="obipcr"><span class="header-section-number">8.1</span> <code>obipcr</code></h2>
|
|
||||||
<blockquote class="blockquote">
|
|
||||||
<p>Replace the <code>ecoPCR</code> original <em>OBITools</em></p>
|
|
||||||
</blockquote>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./expressions.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./comm_reformat.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
5498aac95b1795da9edb65224b69c7d821c4e2b8
|
||||||
Vendored
-398
@@ -1,398 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 9 File format conversions</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./comm_annotation.html" rel="next">
|
|
||||||
<link href="./comm_metabarcode_design.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#obiconvert" id="toc-obiconvert" class="nav-link active" data-scroll-target="#obiconvert"><span class="toc-section-number">9.1</span> <code>obiconvert</code></a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="obiconvert" class="level2" data-number="9.1">
|
|
||||||
<h2 data-number="9.1" class="anchored" data-anchor-id="obiconvert"><span class="header-section-number">9.1</span> <code>obiconvert</code></h2>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./comm_annotation.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
974a84e3029e148c9ed12d4b49b5dd311cc16386
|
||||||
Vendored
-505
@@ -1,505 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 12 Sequence sampling and filtering</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
pre > code.sourceCode { white-space: pre; position: relative; }
|
|
||||||
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
|
|
||||||
pre > code.sourceCode > span:empty { height: 1.2em; }
|
|
||||||
.sourceCode { overflow: visible; }
|
|
||||||
code.sourceCode > span { color: inherit; text-decoration: inherit; }
|
|
||||||
div.sourceCode { margin: 1em 0; }
|
|
||||||
pre.sourceCode { margin: 0; }
|
|
||||||
@media screen {
|
|
||||||
div.sourceCode { overflow: auto; }
|
|
||||||
}
|
|
||||||
@media print {
|
|
||||||
pre > code.sourceCode { white-space: pre-wrap; }
|
|
||||||
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
|
|
||||||
}
|
|
||||||
pre.numberSource code
|
|
||||||
{ counter-reset: source-line 0; }
|
|
||||||
pre.numberSource code > span
|
|
||||||
{ position: relative; left: -4em; counter-increment: source-line; }
|
|
||||||
pre.numberSource code > span > a:first-child::before
|
|
||||||
{ content: counter(source-line);
|
|
||||||
position: relative; left: -1em; text-align: right; vertical-align: baseline;
|
|
||||||
border: none; display: inline-block;
|
|
||||||
-webkit-touch-callout: none; -webkit-user-select: none;
|
|
||||||
-khtml-user-select: none; -moz-user-select: none;
|
|
||||||
-ms-user-select: none; user-select: none;
|
|
||||||
padding: 0 4px; width: 4em;
|
|
||||||
color: #aaaaaa;
|
|
||||||
}
|
|
||||||
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
|
|
||||||
div.sourceCode
|
|
||||||
{ }
|
|
||||||
@media screen {
|
|
||||||
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
|
|
||||||
}
|
|
||||||
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
|
|
||||||
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
|
|
||||||
code span.at { color: #7d9029; } /* Attribute */
|
|
||||||
code span.bn { color: #40a070; } /* BaseN */
|
|
||||||
code span.bu { color: #008000; } /* BuiltIn */
|
|
||||||
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
|
|
||||||
code span.ch { color: #4070a0; } /* Char */
|
|
||||||
code span.cn { color: #880000; } /* Constant */
|
|
||||||
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
|
|
||||||
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
|
|
||||||
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
|
|
||||||
code span.dt { color: #902000; } /* DataType */
|
|
||||||
code span.dv { color: #40a070; } /* DecVal */
|
|
||||||
code span.er { color: #ff0000; font-weight: bold; } /* Error */
|
|
||||||
code span.ex { } /* Extension */
|
|
||||||
code span.fl { color: #40a070; } /* Float */
|
|
||||||
code span.fu { color: #06287e; } /* Function */
|
|
||||||
code span.im { color: #008000; font-weight: bold; } /* Import */
|
|
||||||
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
|
|
||||||
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
|
|
||||||
code span.op { color: #666666; } /* Operator */
|
|
||||||
code span.ot { color: #007020; } /* Other */
|
|
||||||
code span.pp { color: #bc7a00; } /* Preprocessor */
|
|
||||||
code span.sc { color: #4070a0; } /* SpecialChar */
|
|
||||||
code span.ss { color: #bb6688; } /* SpecialString */
|
|
||||||
code span.st { color: #4070a0; } /* String */
|
|
||||||
code span.va { color: #19177c; } /* Variable */
|
|
||||||
code span.vs { color: #4070a0; } /* VerbatimString */
|
|
||||||
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./comm_utilities.html" rel="next">
|
|
||||||
<link href="./comm_computation.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
<script src="https://cdn.jsdelivr.net/npm/mathjax@3/es5/tex-chtml-full.js" type="text/javascript"></script>
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#obigrep-filters-sequence-files-according-to-numerous-conditions" id="toc-obigrep-filters-sequence-files-according-to-numerous-conditions" class="nav-link active" data-scroll-target="#obigrep-filters-sequence-files-according-to-numerous-conditions"><span class="toc-section-number">12.1</span> <code>obigrep</code> – filters sequence files according to numerous conditions</a>
|
|
||||||
<ul class="collapse">
|
|
||||||
<li><a href="#the-options-usable-with-obigrep" id="toc-the-options-usable-with-obigrep" class="nav-link" data-scroll-target="#the-options-usable-with-obigrep"><span class="toc-section-number">12.1.1</span> The options usable with <code>obigrep</code></a></li>
|
|
||||||
</ul></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="obigrep-filters-sequence-files-according-to-numerous-conditions" class="level2" data-number="12.1">
|
|
||||||
<h2 data-number="12.1" class="anchored" data-anchor-id="obigrep-filters-sequence-files-according-to-numerous-conditions"><span class="header-section-number">12.1</span> <code>obigrep</code> – filters sequence files according to numerous conditions</h2>
|
|
||||||
<p>The <code>obigrep</code> command is somewhat analogous to the standard Unix <code>grep</code> command. It selects a subset of sequence records from a sequence file. A sequence record is a complex object consisting of an identifier, a set of attributes (a key, defined by its name, associated with a value), a definition, and the sequence itself. Instead of working text line by text line like the standard Unix tool, <code>obigrep</code> selection is done sequence record by sequence record. A large number of options allow you to refine the selection on any element of the sequence. <code>obigrep</code> allows you to specify multiple conditions simultaneously (which take on the value <code>TRUE</code> or <code>FALSE</code>) and only those sequence records which meet all conditions (all conditions are <code>TRUE</code>) are selected. <code>obigrep</code> is able to work on two paired read files. The selection criteria apply to one or the other of the readings in each pair depending on the mode chosen (<strong>--paired-mode</strong> option). In all cases the selection is applied in the same way to both files, thus maintaining their consistency.</p>
|
|
||||||
<section id="the-options-usable-with-obigrep" class="level3" data-number="12.1.1">
|
|
||||||
<h3 data-number="12.1.1" class="anchored" data-anchor-id="the-options-usable-with-obigrep"><span class="header-section-number">12.1.1</span> The options usable with <code>obigrep</code></h3>
|
|
||||||
<section id="selecting-sequences-based-on-their-caracteristics" class="level4" data-number="12.1.1.1">
|
|
||||||
<h4 data-number="12.1.1.1" class="anchored" data-anchor-id="selecting-sequences-based-on-their-caracteristics"><span class="header-section-number">12.1.1.1</span> Selecting sequences based on their caracteristics</h4>
|
|
||||||
<p>Sequences can be selected on several of their caracteristics, their length, their id, their sequence. Options allow for specifying the condition if selection.</p>
|
|
||||||
<p><strong>Selection based on the sequence</strong></p>
|
|
||||||
<p>Sequence records can be selected according if they match or not with a pattern. The simplest pattern is as short sequence (<em>e.g</em> <code>AACCTT</code>). But the usage of regular patterns allows for looking for more complex pattern. As example, <code>A[TG]C+G</code> matches a <code>A</code>, followed by a <code>T</code> or a <code>G</code>, then one or several <code>C</code> and endly a <code>G</code>.</p>
|
|
||||||
<dl>
|
|
||||||
<dt><strong>--sequence</strong>|<strong>-s</strong> <em>PATTERN</em></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Regular expression pattern to be tested against the sequence itself. The pattern is case insensitive. A complete description of the regular pattern grammar is available <a href="https://yourbasic.org/golang/regexp-cheat-sheet/#cheat-sheet">here</a>.</p>
|
|
||||||
</dd>
|
|
||||||
<dt><em>Examples:</em></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Selects only the sequence records that contain an <em>EcoRI</em> restriction site.</p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
<div class="sourceCode" id="cb1"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb1-1"><a href="#cb1-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-s</span> <span class="st">'GAATTC'</span> seq1.fasta <span class="op">></span> seq2.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>: Selects only the sequence records that contain a stretch of at least 10 <code>A</code>.</p>
|
|
||||||
<div class="sourceCode" id="cb2"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb2-1"><a href="#cb2-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-s</span> <span class="st">'A{10,}'</span> seq1.fasta <span class="op">></span> seq2.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>: Selects only the sequence records that do not contain ambiguous nucleotides.</p>
|
|
||||||
<div class="sourceCode" id="cb3"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb3-1"><a href="#cb3-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-s</span> <span class="st">'^[ACGT]+$'</span> seq1.fasta <span class="op">></span> seq2.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<dl>
|
|
||||||
<dt><strong>--min-count</strong> | <strong>-c</strong> <em>COUNT</em></dt>
|
|
||||||
<dd>
|
|
||||||
<p>only sequences reprensenting at least <em>COUNT</em> reads will be selected. That option rely on the <code>count</code> attribute. If the <code>count</code> attribute is not defined for a sequence record, it is assumed equal to <span class="math inline">\(1\)</span>.</p>
|
|
||||||
</dd>
|
|
||||||
<dt><strong>--max-count</strong> | <strong>-C</strong> <em>COUNT</em></dt>
|
|
||||||
<dd>
|
|
||||||
<p>only sequences reprensenting no more than <em>COUNT</em> reads will be selected. That option rely on the <code>count</code> attribute. If the <code>count</code> attribute is not defined for a sequence record, it is assumed equal to <span class="math inline">\(1\)</span>.</p>
|
|
||||||
</dd>
|
|
||||||
<dt><em>Examples</em></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Selecting sequence records representing at least five reads in the dataset.</p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
<div class="sourceCode" id="cb4"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb4-1"><a href="#cb4-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-c</span> 5 data_SPER01.fasta <span class="op">></span> data_norare_SPER01.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
</section>
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./comm_computation.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./comm_utilities.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
9f1301a018d9dcb23ae18235a9ee4d7b3e4f4afe
|
||||||
Vendored
-482
@@ -1,482 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 13 Utilities</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
pre > code.sourceCode { white-space: pre; position: relative; }
|
|
||||||
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
|
|
||||||
pre > code.sourceCode > span:empty { height: 1.2em; }
|
|
||||||
.sourceCode { overflow: visible; }
|
|
||||||
code.sourceCode > span { color: inherit; text-decoration: inherit; }
|
|
||||||
div.sourceCode { margin: 1em 0; }
|
|
||||||
pre.sourceCode { margin: 0; }
|
|
||||||
@media screen {
|
|
||||||
div.sourceCode { overflow: auto; }
|
|
||||||
}
|
|
||||||
@media print {
|
|
||||||
pre > code.sourceCode { white-space: pre-wrap; }
|
|
||||||
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
|
|
||||||
}
|
|
||||||
pre.numberSource code
|
|
||||||
{ counter-reset: source-line 0; }
|
|
||||||
pre.numberSource code > span
|
|
||||||
{ position: relative; left: -4em; counter-increment: source-line; }
|
|
||||||
pre.numberSource code > span > a:first-child::before
|
|
||||||
{ content: counter(source-line);
|
|
||||||
position: relative; left: -1em; text-align: right; vertical-align: baseline;
|
|
||||||
border: none; display: inline-block;
|
|
||||||
-webkit-touch-callout: none; -webkit-user-select: none;
|
|
||||||
-khtml-user-select: none; -moz-user-select: none;
|
|
||||||
-ms-user-select: none; user-select: none;
|
|
||||||
padding: 0 4px; width: 4em;
|
|
||||||
color: #aaaaaa;
|
|
||||||
}
|
|
||||||
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
|
|
||||||
div.sourceCode
|
|
||||||
{ }
|
|
||||||
@media screen {
|
|
||||||
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
|
|
||||||
}
|
|
||||||
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
|
|
||||||
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
|
|
||||||
code span.at { color: #7d9029; } /* Attribute */
|
|
||||||
code span.bn { color: #40a070; } /* BaseN */
|
|
||||||
code span.bu { color: #008000; } /* BuiltIn */
|
|
||||||
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
|
|
||||||
code span.ch { color: #4070a0; } /* Char */
|
|
||||||
code span.cn { color: #880000; } /* Constant */
|
|
||||||
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
|
|
||||||
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
|
|
||||||
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
|
|
||||||
code span.dt { color: #902000; } /* DataType */
|
|
||||||
code span.dv { color: #40a070; } /* DecVal */
|
|
||||||
code span.er { color: #ff0000; font-weight: bold; } /* Error */
|
|
||||||
code span.ex { } /* Extension */
|
|
||||||
code span.fl { color: #40a070; } /* Float */
|
|
||||||
code span.fu { color: #06287e; } /* Function */
|
|
||||||
code span.im { color: #008000; font-weight: bold; } /* Import */
|
|
||||||
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
|
|
||||||
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
|
|
||||||
code span.op { color: #666666; } /* Operator */
|
|
||||||
code span.ot { color: #007020; } /* Other */
|
|
||||||
code span.pp { color: #bc7a00; } /* Preprocessor */
|
|
||||||
code span.sc { color: #4070a0; } /* SpecialChar */
|
|
||||||
code span.ss { color: #bb6688; } /* SpecialString */
|
|
||||||
code span.st { color: #4070a0; } /* String */
|
|
||||||
code span.va { color: #19177c; } /* Variable */
|
|
||||||
code span.vs { color: #4070a0; } /* VerbatimString */
|
|
||||||
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./library.html" rel="next">
|
|
||||||
<link href="./comm_sampling.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#obicount" id="toc-obicount" class="nav-link active" data-scroll-target="#obicount"><span class="toc-section-number">13.1</span> <code>obicount</code></a></li>
|
|
||||||
<li><a href="#obidistribute" id="toc-obidistribute" class="nav-link" data-scroll-target="#obidistribute"><span class="toc-section-number">13.2</span> <code>obidistribute</code></a></li>
|
|
||||||
<li><a href="#obifind" id="toc-obifind" class="nav-link" data-scroll-target="#obifind"><span class="toc-section-number">13.3</span> <code>obifind</code></a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="obicount" class="level2" data-number="13.1">
|
|
||||||
<h2 data-number="13.1" class="anchored" data-anchor-id="obicount"><span class="header-section-number">13.1</span> <code>obicount</code></h2>
|
|
||||||
<p><code>obicount</code> counts the number of sequence records, the sum of the <code>count</code> attributes, and the sum of the length of all the sequences.</p>
|
|
||||||
<p><em>Example:</em></p>
|
|
||||||
<div class="sourceCode" id="cb1"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb1-1"><a href="#cb1-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> seq.fasta </span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>Prints the number of sequence records contained in the <code>seq.fasta</code> file and the sum of their <code>count</code> attributes.</p>
|
|
||||||
<p><em>Options specific to the command</em></p>
|
|
||||||
<ul>
|
|
||||||
<li><code>--reads|-r</code> Prints read counts.</li>
|
|
||||||
<li><code>--symbols|-s</code> Prints symbol counts.</li>
|
|
||||||
<li><code>--variants|-v</code> Prints variant counts.</li>
|
|
||||||
</ul>
|
|
||||||
</section>
|
|
||||||
<section id="obidistribute" class="level2" data-number="13.2">
|
|
||||||
<h2 data-number="13.2" class="anchored" data-anchor-id="obidistribute"><span class="header-section-number">13.2</span> <code>obidistribute</code></h2>
|
|
||||||
</section>
|
|
||||||
<section id="obifind" class="level2" data-number="13.3">
|
|
||||||
<h2 data-number="13.3" class="anchored" data-anchor-id="obifind"><span class="header-section-number">13.3</span> <code>obifind</code></h2>
|
|
||||||
<blockquote class="blockquote">
|
|
||||||
<p>Replace the <code>ecofind</code> original <em>OBITools.</em></p>
|
|
||||||
</blockquote>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./comm_sampling.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./library.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text">The GO <em>OBITools</em> library</span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
4886929d10bb81f68840e2e7e5829ff97571c293
|
||||||
Vendored
+3897
-36
File diff suppressed because one or more lines are too long
Vendored
-494
@@ -1,494 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 6 Options common to most of the OBITools commands</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
pre > code.sourceCode { white-space: pre; position: relative; }
|
|
||||||
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
|
|
||||||
pre > code.sourceCode > span:empty { height: 1.2em; }
|
|
||||||
.sourceCode { overflow: visible; }
|
|
||||||
code.sourceCode > span { color: inherit; text-decoration: inherit; }
|
|
||||||
div.sourceCode { margin: 1em 0; }
|
|
||||||
pre.sourceCode { margin: 0; }
|
|
||||||
@media screen {
|
|
||||||
div.sourceCode { overflow: auto; }
|
|
||||||
}
|
|
||||||
@media print {
|
|
||||||
pre > code.sourceCode { white-space: pre-wrap; }
|
|
||||||
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
|
|
||||||
}
|
|
||||||
pre.numberSource code
|
|
||||||
{ counter-reset: source-line 0; }
|
|
||||||
pre.numberSource code > span
|
|
||||||
{ position: relative; left: -4em; counter-increment: source-line; }
|
|
||||||
pre.numberSource code > span > a:first-child::before
|
|
||||||
{ content: counter(source-line);
|
|
||||||
position: relative; left: -1em; text-align: right; vertical-align: baseline;
|
|
||||||
border: none; display: inline-block;
|
|
||||||
-webkit-touch-callout: none; -webkit-user-select: none;
|
|
||||||
-khtml-user-select: none; -moz-user-select: none;
|
|
||||||
-ms-user-select: none; user-select: none;
|
|
||||||
padding: 0 4px; width: 4em;
|
|
||||||
color: #aaaaaa;
|
|
||||||
}
|
|
||||||
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
|
|
||||||
div.sourceCode
|
|
||||||
{ }
|
|
||||||
@media screen {
|
|
||||||
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
|
|
||||||
}
|
|
||||||
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
|
|
||||||
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
|
|
||||||
code span.at { color: #7d9029; } /* Attribute */
|
|
||||||
code span.bn { color: #40a070; } /* BaseN */
|
|
||||||
code span.bu { color: #008000; } /* BuiltIn */
|
|
||||||
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
|
|
||||||
code span.ch { color: #4070a0; } /* Char */
|
|
||||||
code span.cn { color: #880000; } /* Constant */
|
|
||||||
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
|
|
||||||
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
|
|
||||||
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
|
|
||||||
code span.dt { color: #902000; } /* DataType */
|
|
||||||
code span.dv { color: #40a070; } /* DecVal */
|
|
||||||
code span.er { color: #ff0000; font-weight: bold; } /* Error */
|
|
||||||
code span.ex { } /* Extension */
|
|
||||||
code span.fl { color: #40a070; } /* Float */
|
|
||||||
code span.fu { color: #06287e; } /* Function */
|
|
||||||
code span.im { color: #008000; font-weight: bold; } /* Import */
|
|
||||||
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
|
|
||||||
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
|
|
||||||
code span.op { color: #666666; } /* Operator */
|
|
||||||
code span.ot { color: #007020; } /* Other */
|
|
||||||
code span.pp { color: #bc7a00; } /* Preprocessor */
|
|
||||||
code span.sc { color: #4070a0; } /* SpecialChar */
|
|
||||||
code span.ss { color: #bb6688; } /* SpecialString */
|
|
||||||
code span.st { color: #4070a0; } /* String */
|
|
||||||
code span.va { color: #19177c; } /* Variable */
|
|
||||||
code span.vs { color: #4070a0; } /* VerbatimString */
|
|
||||||
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./expressions.html" rel="next">
|
|
||||||
<link href="./output.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#helpful-options" id="toc-helpful-options" class="nav-link active" data-scroll-target="#helpful-options"><span class="toc-section-number">6.1</span> Helpful options</a></li>
|
|
||||||
<li><a href="#system-related-options" id="toc-system-related-options" class="nav-link" data-scroll-target="#system-related-options"><span class="toc-section-number">6.2</span> System related options</a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="helpful-options" class="level2" data-number="6.1">
|
|
||||||
<h2 data-number="6.1" class="anchored" data-anchor-id="helpful-options"><span class="header-section-number">6.1</span> Helpful options</h2>
|
|
||||||
<dl>
|
|
||||||
<dt><strong>--help</strong>, <strong>-h</strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Display a friendly help message.</p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
<p><strong>--no-progressbar</strong></p>
|
|
||||||
</section>
|
|
||||||
<section id="system-related-options" class="level2" data-number="6.2">
|
|
||||||
<h2 data-number="6.2" class="anchored" data-anchor-id="system-related-options"><span class="header-section-number">6.2</span> System related options</h2>
|
|
||||||
<p><strong>Managing parallel execution of tasks</strong></p>
|
|
||||||
<p>A new feature of <em>OBITools</em> V4 is the ability to run multiple tasks in parallel, reading files, calculating on the data, formatting and writing the results. Each of these tasks can itself be parallelized by dividing the data into batches and running the calculation on several batches in parallel. This allows the overall calculation time of an <em>OBITools</em> command to be reduced considerably. The parameters organizing the parallel calculation are determined automatically to use the maximum capacity of your computer. But in some circumstances, it is necessary to override these default settings either to try to optimize the computation on a given machine, or to limit the OBITools to using only a part of the computational capacity. There are two options for doing this.</p>
|
|
||||||
<dl>
|
|
||||||
<dt><strong>--max-cpu</strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>OBITools V4 are able to run in parallel on all the CPU cores available on the computer. It is sometime required to limit the computation to a smaller number of cores. That option specify the maximum number of cores that the OBITools command can use. This behaviour can also be set up using the <code>OBIMAXCPU</code> environment variable.</p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
<p><strong>--workers</strong>, <strong>-w</strong></p>
|
|
||||||
<p>If your computer has 8 cores, but you want to limit <em>OBITools</em> to use only two of them you have several solution:</p>
|
|
||||||
<ul>
|
|
||||||
<li><p>If you want to set the limit for a single execution you can use the <strong>–max-cpu</strong> option</p>
|
|
||||||
<div class="sourceCode" id="cb1"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb1-1"><a href="#cb1-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obiconvert</span> <span class="at">--max-cpu</span> 2 <span class="at">--fasta-output</span> data.fastq <span class="op">></span> data.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>or you can precede the command by setting the environment variable <code>OBIMAXCPU</code></p>
|
|
||||||
<div class="sourceCode" id="cb2"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb2-1"><a href="#cb2-1" aria-hidden="true" tabindex="-1"></a><span class="va">OBIMAXCPU</span><span class="op">=</span>2 <span class="ex">obiconvert</span> <span class="at">--fasta-output</span> data.fastq <span class="op">></span> data.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div></li>
|
|
||||||
<li><p>If you want to set the limit to your complete session, you have to export <code>OBIMAXCPU</code></p>
|
|
||||||
<div class="sourceCode" id="cb3"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb3-1"><a href="#cb3-1" aria-hidden="true" tabindex="-1"></a><span class="bu">export</span> <span class="va">OBIMAXCPU</span><span class="op">=</span>2 </span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>all the following OBITools commands will be limited to use at max 2 CPU cores.</p></li>
|
|
||||||
<li><p>If all the time you want to impose this limit, you must include the above <code>export</code> command in your <code>.bashrc</code> file.</p></li>
|
|
||||||
</ul>
|
|
||||||
<p><strong>OBITools debuging related options</strong></p>
|
|
||||||
<p><strong>--debug</strong></p>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./output.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./expressions.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
1259d5a9b6a31ee52558b1f1ba7e951dade0be20
|
||||||
Vendored
-560
@@ -1,560 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 7 OBITools expression language</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
pre > code.sourceCode { white-space: pre; position: relative; }
|
|
||||||
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
|
|
||||||
pre > code.sourceCode > span:empty { height: 1.2em; }
|
|
||||||
.sourceCode { overflow: visible; }
|
|
||||||
code.sourceCode > span { color: inherit; text-decoration: inherit; }
|
|
||||||
div.sourceCode { margin: 1em 0; }
|
|
||||||
pre.sourceCode { margin: 0; }
|
|
||||||
@media screen {
|
|
||||||
div.sourceCode { overflow: auto; }
|
|
||||||
}
|
|
||||||
@media print {
|
|
||||||
pre > code.sourceCode { white-space: pre-wrap; }
|
|
||||||
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
|
|
||||||
}
|
|
||||||
pre.numberSource code
|
|
||||||
{ counter-reset: source-line 0; }
|
|
||||||
pre.numberSource code > span
|
|
||||||
{ position: relative; left: -4em; counter-increment: source-line; }
|
|
||||||
pre.numberSource code > span > a:first-child::before
|
|
||||||
{ content: counter(source-line);
|
|
||||||
position: relative; left: -1em; text-align: right; vertical-align: baseline;
|
|
||||||
border: none; display: inline-block;
|
|
||||||
-webkit-touch-callout: none; -webkit-user-select: none;
|
|
||||||
-khtml-user-select: none; -moz-user-select: none;
|
|
||||||
-ms-user-select: none; user-select: none;
|
|
||||||
padding: 0 4px; width: 4em;
|
|
||||||
color: #aaaaaa;
|
|
||||||
}
|
|
||||||
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
|
|
||||||
div.sourceCode
|
|
||||||
{ }
|
|
||||||
@media screen {
|
|
||||||
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
|
|
||||||
}
|
|
||||||
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
|
|
||||||
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
|
|
||||||
code span.at { color: #7d9029; } /* Attribute */
|
|
||||||
code span.bn { color: #40a070; } /* BaseN */
|
|
||||||
code span.bu { color: #008000; } /* BuiltIn */
|
|
||||||
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
|
|
||||||
code span.ch { color: #4070a0; } /* Char */
|
|
||||||
code span.cn { color: #880000; } /* Constant */
|
|
||||||
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
|
|
||||||
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
|
|
||||||
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
|
|
||||||
code span.dt { color: #902000; } /* DataType */
|
|
||||||
code span.dv { color: #40a070; } /* DecVal */
|
|
||||||
code span.er { color: #ff0000; font-weight: bold; } /* Error */
|
|
||||||
code span.ex { } /* Extension */
|
|
||||||
code span.fl { color: #40a070; } /* Float */
|
|
||||||
code span.fu { color: #06287e; } /* Function */
|
|
||||||
code span.im { color: #008000; font-weight: bold; } /* Import */
|
|
||||||
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
|
|
||||||
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
|
|
||||||
code span.op { color: #666666; } /* Operator */
|
|
||||||
code span.ot { color: #007020; } /* Other */
|
|
||||||
code span.pp { color: #bc7a00; } /* Preprocessor */
|
|
||||||
code span.sc { color: #4070a0; } /* SpecialChar */
|
|
||||||
code span.ss { color: #bb6688; } /* SpecialString */
|
|
||||||
code span.st { color: #4070a0; } /* String */
|
|
||||||
code span.va { color: #19177c; } /* Variable */
|
|
||||||
code span.vs { color: #4070a0; } /* VerbatimString */
|
|
||||||
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./comm_metabarcode_design.html" rel="next">
|
|
||||||
<link href="./common_options.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
<script src="https://cdn.jsdelivr.net/npm/mathjax@3/es5/tex-chtml-full.js" type="text/javascript"></script>
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#variables-usable-in-the-expression" id="toc-variables-usable-in-the-expression" class="nav-link active" data-scroll-target="#variables-usable-in-the-expression"><span class="toc-section-number">7.1</span> Variables usable in the expression</a></li>
|
|
||||||
<li><a href="#function-defined-in-the-language" id="toc-function-defined-in-the-language" class="nav-link" data-scroll-target="#function-defined-in-the-language"><span class="toc-section-number">7.2</span> Function defined in the language</a>
|
|
||||||
<ul class="collapse">
|
|
||||||
<li><a href="#instrospection-functions" id="toc-instrospection-functions" class="nav-link" data-scroll-target="#instrospection-functions">Instrospection functions</a></li>
|
|
||||||
<li><a href="#cast-functions" id="toc-cast-functions" class="nav-link" data-scroll-target="#cast-functions">Cast functions</a></li>
|
|
||||||
<li><a href="#string-related-functions" id="toc-string-related-functions" class="nav-link" data-scroll-target="#string-related-functions">String related functions</a></li>
|
|
||||||
<li><a href="#condition-function" id="toc-condition-function" class="nav-link" data-scroll-target="#condition-function">Condition function</a></li>
|
|
||||||
<li><a href="#sequence-analysis-related-function" id="toc-sequence-analysis-related-function" class="nav-link" data-scroll-target="#sequence-analysis-related-function"><span class="toc-section-number">7.2.1</span> Sequence analysis related function</a></li>
|
|
||||||
</ul></li>
|
|
||||||
<li><a href="#accessing-to-the-sequence-annotations" id="toc-accessing-to-the-sequence-annotations" class="nav-link" data-scroll-target="#accessing-to-the-sequence-annotations"><span class="toc-section-number">7.3</span> Accessing to the sequence annotations</a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<p>Several OBITools (<em>e.g.</em> obigrep, obiannotate) allow the user to specify some simple expressions to compute values or define predicates. This expressions are parsed and evaluated using the <a href="https://pkg.go.dev/github.com/PaesslerAG/gval" title="Gval (Go eVALuate) for evaluating arbitrary expressions Go-like expressions.">gval</a> go package, which allows for evaluating go-Like expression.</p>
|
|
||||||
<section id="variables-usable-in-the-expression" class="level2" data-number="7.1">
|
|
||||||
<h2 data-number="7.1" class="anchored" data-anchor-id="variables-usable-in-the-expression"><span class="header-section-number">7.1</span> Variables usable in the expression</h2>
|
|
||||||
<ul>
|
|
||||||
<li><code>sequence</code> is the sequence object on which the expression is evaluated.</li>
|
|
||||||
<li><code>annotations</code>is a map object containing every annotations associated to the currently processed sequence.</li>
|
|
||||||
</ul>
|
|
||||||
</section>
|
|
||||||
<section id="function-defined-in-the-language" class="level2" data-number="7.2">
|
|
||||||
<h2 data-number="7.2" class="anchored" data-anchor-id="function-defined-in-the-language"><span class="header-section-number">7.2</span> Function defined in the language</h2>
|
|
||||||
<section id="instrospection-functions" class="level3 unnumbered">
|
|
||||||
<h3 class="unnumbered anchored" data-anchor-id="instrospection-functions">Instrospection functions</h3>
|
|
||||||
<dl>
|
|
||||||
<dt><strong><code>len(x)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>It is a generic function allowing to retreive the size of a object. It returns the length of a sequences, the number of element in a map like <code>annotations</code>, the number of elements in an array. The reurned value is an <code>int</code>.</p>
|
|
||||||
</dd>
|
|
||||||
<dt><strong><code>contains(map,key)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Tests if the <code>map</code> contains a value assciated to <code>key</code></p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
</section>
|
|
||||||
<section id="cast-functions" class="level3 unnumbered">
|
|
||||||
<h3 class="unnumbered anchored" data-anchor-id="cast-functions">Cast functions</h3>
|
|
||||||
<dl>
|
|
||||||
<dt><strong><code>int(x)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Converts if possible the <code>x</code> value to an integer value. The function returns an <code>int</code>.</p>
|
|
||||||
</dd>
|
|
||||||
<dt><strong><code>numeric(x)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Converts if possible the <code>x</code> value to a float value. The function returns a <code>float</code>.</p>
|
|
||||||
</dd>
|
|
||||||
<dt><strong><code>bool(x)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Converts if possible the <code>x</code> value to a boolean value. The function returns a <code>bool</code>.</p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
</section>
|
|
||||||
<section id="string-related-functions" class="level3 unnumbered">
|
|
||||||
<h3 class="unnumbered anchored" data-anchor-id="string-related-functions">String related functions</h3>
|
|
||||||
<dl>
|
|
||||||
<dt><strong><code>printf(format,...)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Allows to combine several values to build a string. <code>format</code> follows the classical C <code>printf</code> syntax. The function returns a <code>string</code>.</p>
|
|
||||||
</dd>
|
|
||||||
<dt><strong><code>subspc(x)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>substitutes every space in the <code>x</code> string by the underscore (<code>_</code>) character. The function returns a <code>string</code>.</p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
</section>
|
|
||||||
<section id="condition-function" class="level3 unnumbered">
|
|
||||||
<h3 class="unnumbered anchored" data-anchor-id="condition-function">Condition function</h3>
|
|
||||||
<dl>
|
|
||||||
<dt><strong><code>ifelse(condition,val1,val2)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>The <code>condition</code> value has to be a <code>bool</code> value. If it is <code>true</code> the function returns <code>val1</code>, otherwise, it is returning <code>val2</code>.</p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
</section>
|
|
||||||
<section id="sequence-analysis-related-function" class="level3" data-number="7.2.1">
|
|
||||||
<h3 data-number="7.2.1" class="anchored" data-anchor-id="sequence-analysis-related-function"><span class="header-section-number">7.2.1</span> Sequence analysis related function</h3>
|
|
||||||
<dl>
|
|
||||||
<dt><strong><code>composition(sequence)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>The nucleotide composition of the sequence is returned as as map indexed by <code>a</code>, <code>c</code>, <code>g</code>, or <code>t</code> and each value is the number of occurrences of that nucleotide. A fifth key <code>others</code> accounts for all others symboles.</p>
|
|
||||||
</dd>
|
|
||||||
<dt><strong><code>gcskew(sequence)</code></strong></dt>
|
|
||||||
<dd>
|
|
||||||
<p>Computes the excess of g compare to c of the sequence, known as the GC skew.</p>
|
|
||||||
<p><span class="math display">\[
|
|
||||||
Skew_{GC}=\frac{G-C}{G+C}
|
|
||||||
\]</span></p>
|
|
||||||
</dd>
|
|
||||||
</dl>
|
|
||||||
</section>
|
|
||||||
</section>
|
|
||||||
<section id="accessing-to-the-sequence-annotations" class="level2" data-number="7.3">
|
|
||||||
<h2 data-number="7.3" class="anchored" data-anchor-id="accessing-to-the-sequence-annotations"><span class="header-section-number">7.3</span> Accessing to the sequence annotations</h2>
|
|
||||||
<p>The <code>annotations</code> variable is a map object containing all the annotations associated to the currently processed sequence. Index of the map are the attribute names. It exists to possibillities to retreive an annotation. It is possible to use the classical <code>[]</code> indexing operator, putting the attribute name quoted by double quotes between them.</p>
|
|
||||||
<div class="sourceCode" id="cb1"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb1-1"><a href="#cb1-1" aria-hidden="true" tabindex="-1"></a>annotations<span class="op">[</span><span class="st">"direction"</span><span class="op">]</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>The above code retreives the <code>direction</code> annotation. A second notation using the dot (<code>.</code>) is often more convenient.</p>
|
|
||||||
<div class="sourceCode" id="cb2"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb2-1"><a href="#cb2-1" aria-hidden="true" tabindex="-1"></a>annotations<span class="op">.</span>direction</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>Special attributes of the sequence are accessible only by dedicated methods of the <code>sequence</code> object.</p>
|
|
||||||
<ul>
|
|
||||||
<li>The sequence identifier : <code>Id()</code></li>
|
|
||||||
<li>THe sequence definition : <code>Definition()</code></li>
|
|
||||||
</ul>
|
|
||||||
<div class="sourceCode" id="cb3"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb3-1"><a href="#cb3-1" aria-hidden="true" tabindex="-1"></a>sequence<span class="op">.</span>Id<span class="op">()</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./common_options.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
9ae6db2f2861fe7b5469391ca8439bed33f988ce
|
||||||
Vendored
+3977
-93
File diff suppressed because one or more lines are too long
Vendored
+3905
-44
File diff suppressed because one or more lines are too long
Vendored
+3990
-42
File diff suppressed because one or more lines are too long
Vendored
+3909
-48
File diff suppressed because one or more lines are too long
Vendored
+3901
-40
File diff suppressed because one or more lines are too long
Vendored
-638
@@ -1,638 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - The GO OBITools library</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
pre > code.sourceCode { white-space: pre; position: relative; }
|
|
||||||
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
|
|
||||||
pre > code.sourceCode > span:empty { height: 1.2em; }
|
|
||||||
.sourceCode { overflow: visible; }
|
|
||||||
code.sourceCode > span { color: inherit; text-decoration: inherit; }
|
|
||||||
div.sourceCode { margin: 1em 0; }
|
|
||||||
pre.sourceCode { margin: 0; }
|
|
||||||
@media screen {
|
|
||||||
div.sourceCode { overflow: auto; }
|
|
||||||
}
|
|
||||||
@media print {
|
|
||||||
pre > code.sourceCode { white-space: pre-wrap; }
|
|
||||||
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
|
|
||||||
}
|
|
||||||
pre.numberSource code
|
|
||||||
{ counter-reset: source-line 0; }
|
|
||||||
pre.numberSource code > span
|
|
||||||
{ position: relative; left: -4em; counter-increment: source-line; }
|
|
||||||
pre.numberSource code > span > a:first-child::before
|
|
||||||
{ content: counter(source-line);
|
|
||||||
position: relative; left: -1em; text-align: right; vertical-align: baseline;
|
|
||||||
border: none; display: inline-block;
|
|
||||||
-webkit-touch-callout: none; -webkit-user-select: none;
|
|
||||||
-khtml-user-select: none; -moz-user-select: none;
|
|
||||||
-ms-user-select: none; user-select: none;
|
|
||||||
padding: 0 4px; width: 4em;
|
|
||||||
color: #aaaaaa;
|
|
||||||
}
|
|
||||||
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
|
|
||||||
div.sourceCode
|
|
||||||
{ }
|
|
||||||
@media screen {
|
|
||||||
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
|
|
||||||
}
|
|
||||||
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
|
|
||||||
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
|
|
||||||
code span.at { color: #7d9029; } /* Attribute */
|
|
||||||
code span.bn { color: #40a070; } /* BaseN */
|
|
||||||
code span.bu { color: #008000; } /* BuiltIn */
|
|
||||||
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
|
|
||||||
code span.ch { color: #4070a0; } /* Char */
|
|
||||||
code span.cn { color: #880000; } /* Constant */
|
|
||||||
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
|
|
||||||
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
|
|
||||||
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
|
|
||||||
code span.dt { color: #902000; } /* DataType */
|
|
||||||
code span.dv { color: #40a070; } /* DecVal */
|
|
||||||
code span.er { color: #ff0000; font-weight: bold; } /* Error */
|
|
||||||
code span.ex { } /* Extension */
|
|
||||||
code span.fl { color: #40a070; } /* Float */
|
|
||||||
code span.fu { color: #06287e; } /* Function */
|
|
||||||
code span.im { color: #008000; font-weight: bold; } /* Import */
|
|
||||||
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
|
|
||||||
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
|
|
||||||
code span.op { color: #666666; } /* Operator */
|
|
||||||
code span.ot { color: #007020; } /* Other */
|
|
||||||
code span.pp { color: #bc7a00; } /* Preprocessor */
|
|
||||||
code span.sc { color: #4070a0; } /* SpecialChar */
|
|
||||||
code span.ss { color: #bb6688; } /* SpecialString */
|
|
||||||
code span.st { color: #4070a0; } /* String */
|
|
||||||
code span.va { color: #19177c; } /* Variable */
|
|
||||||
code span.vs { color: #4070a0; } /* VerbatimString */
|
|
||||||
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./annexes.html" rel="next">
|
|
||||||
<link href="./comm_utilities.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title">The GO <em>OBITools</em> library</h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#biosequence" id="toc-biosequence" class="nav-link active" data-scroll-target="#biosequence">BioSequence</a>
|
|
||||||
<ul class="collapse">
|
|
||||||
<li><a href="#creating-new-instances" id="toc-creating-new-instances" class="nav-link" data-scroll-target="#creating-new-instances">Creating new instances</a></li>
|
|
||||||
<li><a href="#end-of-life-of-a-biosequence-instance" id="toc-end-of-life-of-a-biosequence-instance" class="nav-link" data-scroll-target="#end-of-life-of-a-biosequence-instance">End of life of a <code>BioSequence</code> instance</a></li>
|
|
||||||
<li><a href="#accessing-to-the-elements-of-a-sequence" id="toc-accessing-to-the-elements-of-a-sequence" class="nav-link" data-scroll-target="#accessing-to-the-elements-of-a-sequence">Accessing to the elements of a sequence</a></li>
|
|
||||||
<li><a href="#the-annotations-of-a-sequence" id="toc-the-annotations-of-a-sequence" class="nav-link" data-scroll-target="#the-annotations-of-a-sequence">The annotations of a sequence</a></li>
|
|
||||||
</ul></li>
|
|
||||||
<li><a href="#the-sequence-iterator" id="toc-the-sequence-iterator" class="nav-link" data-scroll-target="#the-sequence-iterator">The sequence iterator</a>
|
|
||||||
<ul class="collapse">
|
|
||||||
<li><a href="#basic-usage-of-a-sequence-iterator" id="toc-basic-usage-of-a-sequence-iterator" class="nav-link" data-scroll-target="#basic-usage-of-a-sequence-iterator">Basic usage of a sequence iterator</a></li>
|
|
||||||
<li><a href="#the-pipable-functions" id="toc-the-pipable-functions" class="nav-link" data-scroll-target="#the-pipable-functions">The <code>Pipable</code> functions</a></li>
|
|
||||||
<li><a href="#the-teeable-functions" id="toc-the-teeable-functions" class="nav-link" data-scroll-target="#the-teeable-functions">The <code>Teeable</code> functions</a></li>
|
|
||||||
</ul></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block">The GO <em>OBITools</em> library</h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="biosequence" class="level2">
|
|
||||||
<h2 class="anchored" data-anchor-id="biosequence">BioSequence</h2>
|
|
||||||
<p>The <code>BioSequence</code> class is used to represent biological sequences. It allows for storing : - the sequence itself as a <code>[]byte</code> - the sequencing quality score as a <code>[]byte</code> if needed - an identifier as a <code>string</code> - a definition as a <code>string</code> - a set of <em>(key, value)</em> pairs in a <code>map[sting]interface{}</code></p>
|
|
||||||
<p>BioSequence is defined in the obiseq module and is included using the code</p>
|
|
||||||
<div class="sourceCode" id="cb1"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb1-1"><a href="#cb1-1" aria-hidden="true" tabindex="-1"></a><span class="kw">import</span> <span class="op">(</span></span>
|
|
||||||
<span id="cb1-2"><a href="#cb1-2" aria-hidden="true" tabindex="-1"></a> <span class="st">"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"</span></span>
|
|
||||||
<span id="cb1-3"><a href="#cb1-3" aria-hidden="true" tabindex="-1"></a><span class="op">)</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<section id="creating-new-instances" class="level3">
|
|
||||||
<h3 class="anchored" data-anchor-id="creating-new-instances">Creating new instances</h3>
|
|
||||||
<p>To create new instance, use</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>MakeBioSequence(id string, sequence []byte, definition string) obiseq.BioSequence</code></li>
|
|
||||||
<li><code>NewBioSequence(id string, sequence []byte, definition string) *obiseq.BioSequence</code></li>
|
|
||||||
</ul>
|
|
||||||
<p>Both create a <code>BioSequence</code> instance, but when the first one returns the instance, the second returns a pointer on the new instance. Two other functions <code>MakeEmptyBioSequence</code>, and <code>NewEmptyBioSequence</code> do the same job but provide an uninitialized objects.</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>id</code> parameters corresponds to the unique identifier of the sequence. It mist be a string constituted of a single word (not containing any space).</li>
|
|
||||||
<li><code>sequence</code> is the DNA sequence itself, provided as a <code>byte</code> array (<code>[]byte</code>).</li>
|
|
||||||
<li><code>definition</code> is a <code>string</code>, potentially empty, but usualy containing a sentence explaining what is that sequence.</li>
|
|
||||||
</ul>
|
|
||||||
<div class="sourceCode" id="cb2"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb2-1"><a href="#cb2-1" aria-hidden="true" tabindex="-1"></a><span class="kw">import</span> <span class="op">(</span></span>
|
|
||||||
<span id="cb2-2"><a href="#cb2-2" aria-hidden="true" tabindex="-1"></a> <span class="st">"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"</span></span>
|
|
||||||
<span id="cb2-3"><a href="#cb2-3" aria-hidden="true" tabindex="-1"></a><span class="op">)</span></span>
|
|
||||||
<span id="cb2-4"><a href="#cb2-4" aria-hidden="true" tabindex="-1"></a></span>
|
|
||||||
<span id="cb2-5"><a href="#cb2-5" aria-hidden="true" tabindex="-1"></a><span class="kw">func</span> main<span class="op">()</span> <span class="op">{</span></span>
|
|
||||||
<span id="cb2-6"><a href="#cb2-6" aria-hidden="true" tabindex="-1"></a> myseq <span class="op">:=</span> obiseq<span class="op">.</span>NewBiosequence<span class="op">(</span></span>
|
|
||||||
<span id="cb2-7"><a href="#cb2-7" aria-hidden="true" tabindex="-1"></a> <span class="st">"seq_GH0001"</span><span class="op">,</span></span>
|
|
||||||
<span id="cb2-8"><a href="#cb2-8" aria-hidden="true" tabindex="-1"></a> bytes<span class="op">.</span>FromString<span class="op">(</span><span class="st">"ACGTGTCAGTCG"</span><span class="op">),</span></span>
|
|
||||||
<span id="cb2-9"><a href="#cb2-9" aria-hidden="true" tabindex="-1"></a> <span class="st">"A short test sequence"</span><span class="op">,</span></span>
|
|
||||||
<span id="cb2-10"><a href="#cb2-10" aria-hidden="true" tabindex="-1"></a> <span class="op">)</span></span>
|
|
||||||
<span id="cb2-11"><a href="#cb2-11" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>When formated as fasta the parameters correspond to the following schema</p>
|
|
||||||
<pre><code>>id definition containing potentially several words
|
|
||||||
sequence</code></pre>
|
|
||||||
</section>
|
|
||||||
<section id="end-of-life-of-a-biosequence-instance" class="level3">
|
|
||||||
<h3 class="anchored" data-anchor-id="end-of-life-of-a-biosequence-instance">End of life of a <code>BioSequence</code> instance</h3>
|
|
||||||
<p>When an instance of <code>BioSequence</code> is no longer in use, it is normally taken over by the GO garbage collector. If you know that an instance will never be used again, you can, if you wish, call the <code>Recycle</code> method on it to store the allocated memory elements in a <code>pool</code> to limit the allocation effort when many sequences are being handled. Once the recycle method has been called on an instance, you must ensure that no other method is called on it.</p>
|
|
||||||
</section>
|
|
||||||
<section id="accessing-to-the-elements-of-a-sequence" class="level3">
|
|
||||||
<h3 class="anchored" data-anchor-id="accessing-to-the-elements-of-a-sequence">Accessing to the elements of a sequence</h3>
|
|
||||||
<p>The different elements of an <code>obiseq.BioSequence</code> must be accessed using a set of methods. For the three main elements provided during the creation of a new instance methodes are :</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>Id() string</code></li>
|
|
||||||
<li><code>Sequence() []byte</code></li>
|
|
||||||
<li><code>Definition() string</code></li>
|
|
||||||
</ul>
|
|
||||||
<p>It exists pending method to change the value of these elements</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>SetId(id string)</code></li>
|
|
||||||
<li><code>SetSequence(sequence []byte)</code></li>
|
|
||||||
<li><code>SetDefinition(definition string)</code></li>
|
|
||||||
</ul>
|
|
||||||
<div class="sourceCode" id="cb4"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb4-1"><a href="#cb4-1" aria-hidden="true" tabindex="-1"></a><span class="kw">import</span> <span class="op">(</span></span>
|
|
||||||
<span id="cb4-2"><a href="#cb4-2" aria-hidden="true" tabindex="-1"></a> <span class="st">"fmt"</span></span>
|
|
||||||
<span id="cb4-3"><a href="#cb4-3" aria-hidden="true" tabindex="-1"></a> <span class="st">"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"</span></span>
|
|
||||||
<span id="cb4-4"><a href="#cb4-4" aria-hidden="true" tabindex="-1"></a><span class="op">)</span></span>
|
|
||||||
<span id="cb4-5"><a href="#cb4-5" aria-hidden="true" tabindex="-1"></a></span>
|
|
||||||
<span id="cb4-6"><a href="#cb4-6" aria-hidden="true" tabindex="-1"></a><span class="kw">func</span> main<span class="op">()</span> <span class="op">{</span></span>
|
|
||||||
<span id="cb4-7"><a href="#cb4-7" aria-hidden="true" tabindex="-1"></a> myseq <span class="op">:=</span> obiseq<span class="op">.</span>NewBiosequence<span class="op">(</span></span>
|
|
||||||
<span id="cb4-8"><a href="#cb4-8" aria-hidden="true" tabindex="-1"></a> <span class="st">"seq_GH0001"</span><span class="op">,</span></span>
|
|
||||||
<span id="cb4-9"><a href="#cb4-9" aria-hidden="true" tabindex="-1"></a> bytes<span class="op">.</span>FromString<span class="op">(</span><span class="st">"ACGTGTCAGTCG"</span><span class="op">),</span></span>
|
|
||||||
<span id="cb4-10"><a href="#cb4-10" aria-hidden="true" tabindex="-1"></a> <span class="st">"A short test sequence"</span><span class="op">,</span></span>
|
|
||||||
<span id="cb4-11"><a href="#cb4-11" aria-hidden="true" tabindex="-1"></a> <span class="op">)</span></span>
|
|
||||||
<span id="cb4-12"><a href="#cb4-12" aria-hidden="true" tabindex="-1"></a></span>
|
|
||||||
<span id="cb4-13"><a href="#cb4-13" aria-hidden="true" tabindex="-1"></a> fmt<span class="op">.</span>Println<span class="op">(</span>myseq<span class="op">.</span>Id<span class="op">())</span></span>
|
|
||||||
<span id="cb4-14"><a href="#cb4-14" aria-hidden="true" tabindex="-1"></a> myseq<span class="op">.</span>SetId<span class="op">(</span><span class="st">"SPE01_0001"</span><span class="op">)</span></span>
|
|
||||||
<span id="cb4-15"><a href="#cb4-15" aria-hidden="true" tabindex="-1"></a> fmt<span class="op">.</span>Println<span class="op">(</span>myseq<span class="op">.</span>Id<span class="op">())</span></span>
|
|
||||||
<span id="cb4-16"><a href="#cb4-16" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<section id="different-ways-for-accessing-an-editing-the-sequence" class="level4">
|
|
||||||
<h4 class="anchored" data-anchor-id="different-ways-for-accessing-an-editing-the-sequence">Different ways for accessing an editing the sequence</h4>
|
|
||||||
<p>If <code>Sequence()</code>and <code>SetSequence(sequence []byte)</code> methods are the basic ones, several other methods exist.</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>String() string</code> return the sequence directly converted to a <code>string</code> instance.</li>
|
|
||||||
<li>The <code>Write</code> method family allows for extending an existing sequence following the buffer protocol.
|
|
||||||
<ul>
|
|
||||||
<li><code>Write(data []byte) (int, error)</code> allows for appending a byte array on 3’ end of the sequence.</li>
|
|
||||||
<li><code>WriteString(data string) (int, error)</code> allows for appending a <code>string</code>.</li>
|
|
||||||
<li><code>WriteByte(data byte) error</code> allows for appending a single <code>byte</code>.</li>
|
|
||||||
</ul></li>
|
|
||||||
</ul>
|
|
||||||
<p>The <code>Clear</code> method empties the sequence buffer.</p>
|
|
||||||
<div class="sourceCode" id="cb5"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb5-1"><a href="#cb5-1" aria-hidden="true" tabindex="-1"></a><span class="kw">import</span> <span class="op">(</span></span>
|
|
||||||
<span id="cb5-2"><a href="#cb5-2" aria-hidden="true" tabindex="-1"></a> <span class="st">"fmt"</span></span>
|
|
||||||
<span id="cb5-3"><a href="#cb5-3" aria-hidden="true" tabindex="-1"></a> <span class="st">"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"</span></span>
|
|
||||||
<span id="cb5-4"><a href="#cb5-4" aria-hidden="true" tabindex="-1"></a><span class="op">)</span></span>
|
|
||||||
<span id="cb5-5"><a href="#cb5-5" aria-hidden="true" tabindex="-1"></a></span>
|
|
||||||
<span id="cb5-6"><a href="#cb5-6" aria-hidden="true" tabindex="-1"></a><span class="kw">func</span> main<span class="op">()</span> <span class="op">{</span></span>
|
|
||||||
<span id="cb5-7"><a href="#cb5-7" aria-hidden="true" tabindex="-1"></a> myseq <span class="op">:=</span> obiseq<span class="op">.</span>NewEmptyBiosequence<span class="op">()</span></span>
|
|
||||||
<span id="cb5-8"><a href="#cb5-8" aria-hidden="true" tabindex="-1"></a></span>
|
|
||||||
<span id="cb5-9"><a href="#cb5-9" aria-hidden="true" tabindex="-1"></a> myseq<span class="op">.</span>WriteString<span class="op">(</span><span class="st">"accc"</span><span class="op">)</span></span>
|
|
||||||
<span id="cb5-10"><a href="#cb5-10" aria-hidden="true" tabindex="-1"></a> myseq<span class="op">.</span>WriteByte<span class="op">(</span><span class="dt">byte</span><span class="op">(</span><span class="ch">'c'</span><span class="op">))</span></span>
|
|
||||||
<span id="cb5-11"><a href="#cb5-11" aria-hidden="true" tabindex="-1"></a> fmt<span class="op">.</span>Println<span class="op">(</span>myseq<span class="op">.</span>String<span class="op">())</span></span>
|
|
||||||
<span id="cb5-12"><a href="#cb5-12" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
</section>
|
|
||||||
<section id="sequence-quality-scores" class="level4">
|
|
||||||
<h4 class="anchored" data-anchor-id="sequence-quality-scores">Sequence quality scores</h4>
|
|
||||||
<p>Sequence quality scores cannot be initialized at the time of instance creation. You must use dedicated methods to add quality scores to a sequence.</p>
|
|
||||||
<p>To be coherent the length of both the DNA sequence and que quality score sequence must be equal. But assessment of this constraint is realized. It is of the programmer responsability to check that invariant.</p>
|
|
||||||
<p>While accessing to the quality scores relies on the method <code>Quality() []byte</code>, setting the quality need to call one of the following method. They run similarly to their sequence dedicated conterpart.</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>SetQualities(qualities Quality)</code></li>
|
|
||||||
<li><code>WriteQualities(data []byte) (int, error)</code></li>
|
|
||||||
<li><code>WriteByteQualities(data byte) error</code></li>
|
|
||||||
</ul>
|
|
||||||
<p>In a way analogous to the <code>Clear</code> method, <code>ClearQualities()</code> empties the sequence of quality scores.</p>
|
|
||||||
</section>
|
|
||||||
</section>
|
|
||||||
<section id="the-annotations-of-a-sequence" class="level3">
|
|
||||||
<h3 class="anchored" data-anchor-id="the-annotations-of-a-sequence">The annotations of a sequence</h3>
|
|
||||||
<p>A sequence can be annotated with attributes. Each attribute is associated with a value. An attribute is identified by its name. The name of an attribute consists of a character string containing no spaces or blank characters. Values can be of several types.</p>
|
|
||||||
<ul>
|
|
||||||
<li>Scalar types:
|
|
||||||
<ul>
|
|
||||||
<li>integer</li>
|
|
||||||
<li>numeric</li>
|
|
||||||
<li>character</li>
|
|
||||||
<li>boolean</li>
|
|
||||||
</ul></li>
|
|
||||||
<li>Container types:
|
|
||||||
<ul>
|
|
||||||
<li>vector</li>
|
|
||||||
<li>map</li>
|
|
||||||
</ul></li>
|
|
||||||
</ul>
|
|
||||||
<p>Vectors can contain any type of scalar. Maps are compulsorily indexed by strings and can contain any scalar type. It is not possible to have nested container type.</p>
|
|
||||||
<p>Annotations are stored in an object of type <code>bioseq.Annotation</code> which is an alias of <code>map[string]interface{}</code>. This map can be retrieved using the <code>Annotations() Annotation</code> method. If no annotation has been defined for this sequence, the method returns an empty map. It is possible to test an instance of <code>BioSequence</code> using its <code>HasAnnotation() bool</code> method to see if it has any annotations associated with it.</p>
|
|
||||||
<ul>
|
|
||||||
<li>GetAttribute(key string) (interface{}, bool)</li>
|
|
||||||
</ul>
|
|
||||||
</section>
|
|
||||||
</section>
|
|
||||||
<section id="the-sequence-iterator" class="level2">
|
|
||||||
<h2 class="anchored" data-anchor-id="the-sequence-iterator">The sequence iterator</h2>
|
|
||||||
<p>The pakage <em>obiter</em> provides an iterator mecanism for manipulating sequences. The main class provided by this package is <code>obiiter.IBioSequence</code>. An <code>IBioSequence</code> iterator provides batch of sequences.</p>
|
|
||||||
<section id="basic-usage-of-a-sequence-iterator" class="level3">
|
|
||||||
<h3 class="anchored" data-anchor-id="basic-usage-of-a-sequence-iterator">Basic usage of a sequence iterator</h3>
|
|
||||||
<p>Many functions, among them functions reading sequences from a text file, return a <code>IBioSequence</code> iterator. The iterator class provides two main methods:</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>Next() bool</code></li>
|
|
||||||
<li><code>Get() obiiter.BioSequenceBatch</code></li>
|
|
||||||
</ul>
|
|
||||||
<p>The <code>Next</code> method moves the iterator to the next value, while the <code>Get</code> method returns the currently pointed value. Using them, it is possible to loop over the data as in the following code chunk.</p>
|
|
||||||
<div class="sourceCode" id="cb6"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb6-1"><a href="#cb6-1" aria-hidden="true" tabindex="-1"></a><span class="kw">import</span> <span class="op">(</span></span>
|
|
||||||
<span id="cb6-2"><a href="#cb6-2" aria-hidden="true" tabindex="-1"></a> <span class="st">"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"</span></span>
|
|
||||||
<span id="cb6-3"><a href="#cb6-3" aria-hidden="true" tabindex="-1"></a><span class="op">)</span></span>
|
|
||||||
<span id="cb6-4"><a href="#cb6-4" aria-hidden="true" tabindex="-1"></a></span>
|
|
||||||
<span id="cb6-5"><a href="#cb6-5" aria-hidden="true" tabindex="-1"></a><span class="kw">func</span> main<span class="op">()</span> <span class="op">{</span></span>
|
|
||||||
<span id="cb6-6"><a href="#cb6-6" aria-hidden="true" tabindex="-1"></a> mydata <span class="op">:=</span> obiformats<span class="op">.</span>ReadFastSeqFromFile<span class="op">(</span><span class="st">"myfile.fasta"</span><span class="op">)</span></span>
|
|
||||||
<span id="cb6-7"><a href="#cb6-7" aria-hidden="true" tabindex="-1"></a> </span>
|
|
||||||
<span id="cb6-8"><a href="#cb6-8" aria-hidden="true" tabindex="-1"></a> <span class="cf">for</span> mydata<span class="op">.</span>Next<span class="op">()</span> <span class="op">{</span></span>
|
|
||||||
<span id="cb6-9"><a href="#cb6-9" aria-hidden="true" tabindex="-1"></a> data <span class="op">:=</span> mydata<span class="op">.</span>Get<span class="op">()</span></span>
|
|
||||||
<span id="cb6-10"><a href="#cb6-10" aria-hidden="true" tabindex="-1"></a> <span class="co">//</span></span>
|
|
||||||
<span id="cb6-11"><a href="#cb6-11" aria-hidden="true" tabindex="-1"></a> <span class="co">// Whatever you want to do with the data chunk</span></span>
|
|
||||||
<span id="cb6-12"><a href="#cb6-12" aria-hidden="true" tabindex="-1"></a> <span class="co">//</span></span>
|
|
||||||
<span id="cb6-13"><a href="#cb6-13" aria-hidden="true" tabindex="-1"></a> <span class="op">}</span></span>
|
|
||||||
<span id="cb6-14"><a href="#cb6-14" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
<p>An <code>obiseq.BioSequenceBatch</code> instance is a set of sequences stored in an <code>obiseq.BioSequenceSlice</code> and a sequence number. The number of sequences in a batch is not defined. A batch can even contain zero sequences, if for example all sequences initially included in the batch have been filtered out at some stage of their processing.</p>
|
|
||||||
</section>
|
|
||||||
<section id="the-pipable-functions" class="level3">
|
|
||||||
<h3 class="anchored" data-anchor-id="the-pipable-functions">The <code>Pipable</code> functions</h3>
|
|
||||||
<p>A function consuming a <code>obiiter.IBioSequence</code> and returning a <code>obiiter.IBioSequence</code> is of class <code>obiiter.Pipable</code>.</p>
|
|
||||||
</section>
|
|
||||||
<section id="the-teeable-functions" class="level3">
|
|
||||||
<h3 class="anchored" data-anchor-id="the-teeable-functions">The <code>Teeable</code> functions</h3>
|
|
||||||
<p>A function consuming a <code>obiiter.IBioSequence</code> and returning two <code>obiiter.IBioSequence</code> instance is of class <code>obiiter.Teeable</code>.</p>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./comm_utilities.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./annexes.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
+1
@@ -0,0 +1 @@
|
|||||||
|
6adc7728ea35727f4455183f8ba3f99d446edbb6
|
||||||
Vendored
-422
@@ -1,422 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - 5 Controling OBITools outputs</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./common_options.html" rel="next">
|
|
||||||
<link href="./inupt.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
<nav id="TOC" role="doc-toc" class="toc-active">
|
|
||||||
<h2 id="toc-title">Table of contents</h2>
|
|
||||||
|
|
||||||
<ul>
|
|
||||||
<li><a href="#specifying-output-format" id="toc-specifying-output-format" class="nav-link active" data-scroll-target="#specifying-output-format"><span class="toc-section-number">5.1</span> Specifying output format</a></li>
|
|
||||||
<li><a href="#the-fasta-and-fastq-annotations-format" id="toc-the-fasta-and-fastq-annotations-format" class="nav-link" data-scroll-target="#the-fasta-and-fastq-annotations-format"><span class="toc-section-number">5.2</span> The Fasta and Fastq annotations format</a></li>
|
|
||||||
</ul>
|
|
||||||
</nav>
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<section id="specifying-output-format" class="level2" data-number="5.1">
|
|
||||||
<h2 data-number="5.1" class="anchored" data-anchor-id="specifying-output-format"><span class="header-section-number">5.1</span> Specifying output format</h2>
|
|
||||||
<p>Only two output sequence formats are supported by OBITools, Fasta and Fastq. Fastq is used when output sequences are associated with quality information. Otherwise, Fasta is the default format. However, it is possible to force the output format by using one of the following two options. Forcing the use of Fasta results in the loss of quality information. Conversely, when the Fastq format is forced with sequences that have no quality data, dummy qualities set to 40 for each nucleotide are added.</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>--fasta-output</code> Read data following the ecoPCR output format.</li>
|
|
||||||
<li><code>--fastq-output</code> Read data following the EMBL flatfile format.</li>
|
|
||||||
</ul>
|
|
||||||
<p>OBITools allows multiple input files to be specified for a single command.</p>
|
|
||||||
<ul>
|
|
||||||
<li><code>--no-order</code> When several input files are provided, indicates that there is no order among them. (default: false). Using such option can increase a lot the processing of the data.</li>
|
|
||||||
</ul>
|
|
||||||
</section>
|
|
||||||
<section id="the-fasta-and-fastq-annotations-format" class="level2" data-number="5.2">
|
|
||||||
<h2 data-number="5.2" class="anchored" data-anchor-id="the-fasta-and-fastq-annotations-format"><span class="header-section-number">5.2</span> The Fasta and Fastq annotations format</h2>
|
|
||||||
<p>OBITools extend the <a href="#the-fasta-sequence-format">Fasta</a> and <a href="#the-fastq-sequence-format">Fastq</a> formats by introducing a format for the title lines of these formats allowing to annotate every sequence. While the previous version of OBITools used an <em>ad-hoc</em> format for these annotation, this new version introduce the usage of the standard JSON format to store them.</p>
|
|
||||||
<p>On input, OBITools automatically recognize the format of the annotations, but two options allows to force the parsing following one of them. You should normally not need to use these options.</p>
|
|
||||||
<ul>
|
|
||||||
<li><p><code>--input-OBI-header</code> FASTA/FASTQ title line annotations follow OBI format. (default: false)</p></li>
|
|
||||||
<li><p><code>--input-json-header</code> FASTA/FASTQ title line annotations follow json format. (default: false)</p></li>
|
|
||||||
</ul>
|
|
||||||
<p>On output, by default annotation are formatted using the new JSON format. For compatibility with previous version of OBITools and with external scripts and software, it is possible to force the usage of the previous OBITools format.</p>
|
|
||||||
<ul>
|
|
||||||
<li><p><code>--output-OBI-header|-O</code> output FASTA/FASTQ title line annotations follow OBI format. (default: false)</p></li>
|
|
||||||
<li><p><code>--output-json-header</code> output FASTA/FASTQ title line annotations follow json format. (default: false)</p></li>
|
|
||||||
</ul>
|
|
||||||
|
|
||||||
|
|
||||||
</section>
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./inupt.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
<a href="./common_options.html" class="pagination-link">
|
|
||||||
<span class="nav-page-text"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></span> <i class="bi bi-arrow-right-short"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
+1
@@ -0,0 +1 @@
|
|||||||
|
314e5584b10e3435609ce827c79f46ea15f98545
|
||||||
Vendored
-533
@@ -1,533 +0,0 @@
|
|||||||
<!DOCTYPE html>
|
|
||||||
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
|
|
||||||
|
|
||||||
<meta charset="utf-8">
|
|
||||||
<meta name="generator" content="quarto-1.2.256">
|
|
||||||
|
|
||||||
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
|
|
||||||
|
|
||||||
|
|
||||||
<title>OBITools V4 - References</title>
|
|
||||||
<style>
|
|
||||||
code{white-space: pre-wrap;}
|
|
||||||
span.smallcaps{font-variant: small-caps;}
|
|
||||||
div.columns{display: flex; gap: min(4vw, 1.5em);}
|
|
||||||
div.column{flex: auto; overflow-x: auto;}
|
|
||||||
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
|
|
||||||
ul.task-list{list-style: none;}
|
|
||||||
ul.task-list li input[type="checkbox"] {
|
|
||||||
width: 0.8em;
|
|
||||||
margin: 0 0.8em 0.2em -1.6em;
|
|
||||||
vertical-align: middle;
|
|
||||||
}
|
|
||||||
div.csl-bib-body { }
|
|
||||||
div.csl-entry {
|
|
||||||
clear: both;
|
|
||||||
}
|
|
||||||
.hanging div.csl-entry {
|
|
||||||
margin-left:2em;
|
|
||||||
text-indent:-2em;
|
|
||||||
}
|
|
||||||
div.csl-left-margin {
|
|
||||||
min-width:2em;
|
|
||||||
float:left;
|
|
||||||
}
|
|
||||||
div.csl-right-inline {
|
|
||||||
margin-left:2em;
|
|
||||||
padding-left:1em;
|
|
||||||
}
|
|
||||||
div.csl-indent {
|
|
||||||
margin-left: 2em;
|
|
||||||
}
|
|
||||||
</style>
|
|
||||||
|
|
||||||
|
|
||||||
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
|
|
||||||
<script src="site_libs/quarto-nav/headroom.min.js"></script>
|
|
||||||
<script src="site_libs/clipboard/clipboard.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/fuse.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-search/quarto-search.js"></script>
|
|
||||||
<meta name="quarto:offset" content="./">
|
|
||||||
<link href="./annexes.html" rel="prev">
|
|
||||||
<script src="site_libs/quarto-html/quarto.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/popper.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
|
|
||||||
<script src="site_libs/quarto-html/anchor.min.js"></script>
|
|
||||||
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
|
|
||||||
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
|
|
||||||
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
|
|
||||||
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
|
|
||||||
<script id="quarto-search-options" type="application/json">{
|
|
||||||
"location": "sidebar",
|
|
||||||
"copy-button": false,
|
|
||||||
"collapse-after": 3,
|
|
||||||
"panel-placement": "start",
|
|
||||||
"type": "textbox",
|
|
||||||
"limit": 20,
|
|
||||||
"language": {
|
|
||||||
"search-no-results-text": "No results",
|
|
||||||
"search-matching-documents-text": "matching documents",
|
|
||||||
"search-copy-link-title": "Copy link to search",
|
|
||||||
"search-hide-matches-text": "Hide additional matches",
|
|
||||||
"search-more-match-text": "more match in this document",
|
|
||||||
"search-more-matches-text": "more matches in this document",
|
|
||||||
"search-clear-button-title": "Clear",
|
|
||||||
"search-detached-cancel-button-title": "Cancel",
|
|
||||||
"search-submit-button-title": "Submit"
|
|
||||||
}
|
|
||||||
}</script>
|
|
||||||
|
|
||||||
|
|
||||||
</head>
|
|
||||||
|
|
||||||
<body class="nav-sidebar floating">
|
|
||||||
|
|
||||||
<div id="quarto-search-results"></div>
|
|
||||||
<header id="quarto-header" class="headroom fixed-top">
|
|
||||||
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
|
|
||||||
<div class="container-fluid d-flex justify-content-between">
|
|
||||||
<h1 class="quarto-secondary-nav-title">References</h1>
|
|
||||||
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
|
|
||||||
<i class="bi bi-chevron-right"></i>
|
|
||||||
</button>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</header>
|
|
||||||
<!-- content -->
|
|
||||||
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
|
|
||||||
<!-- sidebar -->
|
|
||||||
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
|
|
||||||
<div class="pt-lg-2 mt-2 text-left sidebar-header">
|
|
||||||
<div class="sidebar-title mb-0 py-0">
|
|
||||||
<a href="./">OBITools V4</a>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="mt-2 flex-shrink-0 align-items-center">
|
|
||||||
<div class="sidebar-search">
|
|
||||||
<div id="quarto-search" class="" title="Search"></div>
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
<div class="sidebar-menu-container">
|
|
||||||
<ul class="list-unstyled mt-1">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./intro.html" class="sidebar-item-text sidebar-link">The OBITools</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-1" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-1" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./installation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span> <span class="chapter-title">Installation of the obitools</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span> <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span> <span class="chapter-title">OBITools V4 Tutorial</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./commands.html" class="sidebar-item-text sidebar-link">The *OBITools V4* commands</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-2" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-2" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./inupt.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span> <span class="chapter-title">Specifying the data input to <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./output.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span> <span class="chapter-title">Controling OBITools outputs</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./common_options.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span> <span class="chapter-title">Options common to most of the <em>OBITools</em> commands</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./expressions.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">7</span> <span class="chapter-title">OBITools expression language</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_metabarcode_design.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">8</span> <span class="chapter-title">Metabarcode design and quality assessment</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_reformat.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">9</span> <span class="chapter-title">File format conversions</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_annotation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">10</span> <span class="chapter-title">Sequence annotations</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_computation.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">11</span> <span class="chapter-title">Computations on sequences</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_sampling.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">12</span> <span class="chapter-title">Sequence sampling and filtering</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./comm_utilities.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">13</span> <span class="chapter-title">Utilities</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<span class="sidebar-item-text sidebar-link text-start">The GO *OBITools* library</span>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item sidebar-item-section">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a class="sidebar-item-text sidebar-link text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">Appendices</a>
|
|
||||||
<a class="sidebar-item-toggle text-start" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar-section-4" aria-expanded="true">
|
|
||||||
<i class="bi bi-chevron-right ms-2"></i>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<ul id="quarto-sidebar-section-4" class="collapse list-unstyled sidebar-section depth1 show">
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
<li class="sidebar-item">
|
|
||||||
<div class="sidebar-item-container">
|
|
||||||
<a href="./references.html" class="sidebar-item-text sidebar-link active">References</a>
|
|
||||||
</div>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</li>
|
|
||||||
</ul>
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
<!-- margin-sidebar -->
|
|
||||||
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
|
|
||||||
|
|
||||||
</div>
|
|
||||||
<!-- main -->
|
|
||||||
<main class="content" id="quarto-document-content">
|
|
||||||
|
|
||||||
<header id="title-block-header" class="quarto-title-block default">
|
|
||||||
<div class="quarto-title">
|
|
||||||
<h1 class="title d-none d-lg-block">References</h1>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
<div class="quarto-title-meta">
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
</header>
|
|
||||||
|
|
||||||
<div id="refs" class="references csl-bib-body hanging-indent" role="doc-bibliography">
|
|
||||||
<div id="ref-Andersen2012-gj" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Andersen, Kenneth, Karen Lise Bird, Morten Rasmussen, James Haile,
|
|
||||||
Henrik Breuning-Madsen, Kurt H Kjaer, Ludovic Orlando, M Thomas P
|
|
||||||
Gilbert, and Eske Willerslev. 2012. <span>“<span class="nocase">Meta-barcoding of <span class="nocase">ë</span>dirt<span class="nocase">ı́</span>DNA from soil reflects vertebrate
|
|
||||||
biodiversity</span>.”</span> <em>Molecular Ecology</em> 21 (8): 1966–79.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Baldwin2013-yc" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Baldwin, Darren S, Matthew J Colloff, Gavin N Rees, Anthony A Chariton,
|
|
||||||
Garth O Watson, Leon N Court, Diana M Hartley, et al. 2013. <span>“<span class="nocase">Impacts of inundation and drought on eukaryote
|
|
||||||
biodiversity in semi-arid floodplain soils</span>.”</span> <em>Molecular
|
|
||||||
Ecology</em> 22 (6): 1746–58. <a href="https://doi.org/10.1111/mec.12190">https://doi.org/10.1111/mec.12190</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Boyer2016-gq" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Boyer, Frédéric, Céline Mercier, Aurélie Bonin, Yvan Le Bras, Pierre
|
|
||||||
Taberlet, and Eric Coissac. 2016. <span>“<span class="nocase">obitools:
|
|
||||||
a unix-inspired software package for DNA metabarcoding</span>.”</span>
|
|
||||||
<em>Molecular Ecology Resources</em> 16 (1): 176–82. <a href="https://doi.org/10.1111/1755-0998.12428">https://doi.org/10.1111/1755-0998.12428</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Caporaso2010-ii" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Caporaso, J Gregory, Justin Kuczynski, Jesse Stombaugh, Kyle Bittinger,
|
|
||||||
Frederic D Bushman, Elizabeth K Costello, Noah Fierer, et al. 2010.
|
|
||||||
<span>“<span class="nocase">QIIME allows analysis of high-throughput
|
|
||||||
community sequencing data</span>.”</span> <em>Nature Methods</em> 7 (5):
|
|
||||||
335–36. <a href="https://doi.org/10.1038/nmeth.f.303">https://doi.org/10.1038/nmeth.f.303</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Chariton2010-cz" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Chariton, Anthony A, Anthony C Roach, Stuart L Simpson, and Graeme E
|
|
||||||
Batley. 2010. <span>“<span class="nocase">Influence of the choice of
|
|
||||||
physical and chemistry variables on interpreting patterns of sediment
|
|
||||||
contaminants and their relationships with estuarine macrobenthic
|
|
||||||
communities</span>.”</span> <em>Marine and Freshwater Research</em>. <a href="https://doi.org/10.1071/mf09263">https://doi.org/10.1071/mf09263</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-cock2010sanger" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Cock, Peter JA, Christopher J Fields, Naohisa Goto, Michael L Heuer, and
|
|
||||||
Peter M Rice. 2010. <span>“The Sanger FASTQ File Format for Sequences
|
|
||||||
with Quality Scores, and the Solexa/Illumina FASTQ Variants.”</span>
|
|
||||||
<em>Nucleic Acids Research</em> 38 (6): 1767–71.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Deagle2009-yh" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Deagle, Bruce E, Roger Kirkwood, and Simon N Jarman. 2009. <span>“<span class="nocase">Analysis of Australian fur seal diet by pyrosequencing
|
|
||||||
prey DNA in faeces</span>.”</span> <em>Molecular Ecology</em> 18 (9):
|
|
||||||
2022–38. <a href="https://doi.org/10.1111/j.1365-294X.2009.04158.x">https://doi.org/10.1111/j.1365-294X.2009.04158.x</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Kowalczyk2011-kg" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Kowalczyk, Rafał, Pierre Taberlet, Eric Coissac, Alice Valentini,
|
|
||||||
Christian Miquel, Tomasz Kamiński, and Jan M Wójcik. 2011. <span>“<span class="nocase">Influence of management practices on large herbivore
|
|
||||||
diet—Case of European bison in Bia<span class="nocase">ł</span>owie<span class="nocase">ż</span>a Primeval Forest (Poland)</span>.”</span>
|
|
||||||
<em>Forest Ecology and Management</em> 261 (4): 821–28. <a href="https://doi.org/10.1016/j.foreco.2010.11.026">https://doi.org/10.1016/j.foreco.2010.11.026</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Lipman1985-hw" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Lipman, D J, and W R Pearson. 1985. <span>“<span class="nocase">Rapid
|
|
||||||
and sensitive protein similarity searches</span>.”</span>
|
|
||||||
<em>Science</em> 227 (4693): 1435–41. <a href="http://www.ncbi.nlm.nih.gov/pubmed/2983426">http://www.ncbi.nlm.nih.gov/pubmed/2983426</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Parducci2012-rn" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Parducci, Laura, Tina Jørgensen, Mari Mette Tollefsrud, Ellen Elverland,
|
|
||||||
Torbjørn Alm, Sonia L Fontana, K D Bennett, et al. 2012. <span>“<span class="nocase">Glacial survival of boreal trees in northern
|
|
||||||
Scandinavia</span>.”</span> <em>Science</em> 335 (6072): 1083–86. <a href="https://doi.org/10.1126/science.1216043">https://doi.org/10.1126/science.1216043</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Riaz2011-gn" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Riaz, Tiayyba, Wasim Shehzad, Alain Viari, François Pompanon, Pierre
|
|
||||||
Taberlet, and Eric Coissac. 2011. <span>“<span class="nocase">ecoPrimers: inference of new DNA barcode markers from
|
|
||||||
whole genome sequence analysis</span>.”</span> <em>Nucleic Acids
|
|
||||||
Research</em> 39 (21): e145. <a href="https://doi.org/10.1093/nar/gkr732">https://doi.org/10.1093/nar/gkr732</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Schloss2009-qy" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Schloss, Patrick D, Sarah L Westcott, Thomas Ryabin, Justine R Hall,
|
|
||||||
Martin Hartmann, Emily B Hollister, Ryan A Lesniewski, et al. 2009.
|
|
||||||
<span>“<span class="nocase">Introducing mothur: open-source,
|
|
||||||
platform-independent, community-supported software for describing and
|
|
||||||
comparing microbial communities</span>.”</span> <em>Applied and
|
|
||||||
Environmental Microbiology</em> 75 (23): 7537–41. <a href="https://doi.org/10.1128/AEM.01541-09">https://doi.org/10.1128/AEM.01541-09</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Seguritan2001-tg" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Seguritan, V, and F Rohwer. 2001. <span>“<span class="nocase">FastGroup:
|
|
||||||
a program to dereplicate libraries of 16S rDNA sequences</span>.”</span>
|
|
||||||
<em>BMC Bioinformatics</em> 2 (October): 9. <a href="https://doi.org/10.1186/1471-2105-2-9">https://doi.org/10.1186/1471-2105-2-9</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Shehzad2012-pn" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Shehzad, Wasim, Tiayyba Riaz, Muhammad A Nawaz, Christian Miquel, Carole
|
|
||||||
Poillot, Safdar A Shah, Francois Pompanon, Eric Coissac, and Pierre
|
|
||||||
Taberlet. 2012. <span>“<span class="nocase">Carnivore diet analysis
|
|
||||||
based on next-generation sequencing: Application to the leopard cat
|
|
||||||
(Prionailurus bengalensis) in Pakistan</span>.”</span> <em>Molecular
|
|
||||||
Ecology</em> 21 (8): 1951–65. <a href="https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x">https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Sogin2006-ab" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Sogin, Mitchell L, Hilary G Morrison, Julie A Huber, David Mark Welch,
|
|
||||||
Susan M Huse, Phillip R Neal, Jesus M Arrieta, and Gerhard J Herndl.
|
|
||||||
2006. <span>“<span class="nocase">Microbial diversity in the deep sea
|
|
||||||
and the underexplored "rare biosphere"</span>.”</span> <em>Proceedings
|
|
||||||
of the National Academy of Sciences of the United States of America</em>
|
|
||||||
103 (32): 12115–20. <a href="https://doi.org/10.1073/pnas.0605127103">https://doi.org/10.1073/pnas.0605127103</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Sonstebo2010-vv" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Sønstebø, J H, L Gielly, A K Brysting, R Elven, M Edwards, J Haile, E
|
|
||||||
Willerslev, et al. 2010. <span>“<span class="nocase">Using
|
|
||||||
next-generation sequencing for molecular reconstruction of past Arctic
|
|
||||||
vegetation and climate</span>.”</span> <em>Molecular Ecology
|
|
||||||
Resources</em> 10 (6): 1009–18. <a href="https://doi.org/10.1111/j.1755-0998.2010.02855.x">https://doi.org/10.1111/j.1755-0998.2010.02855.x</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Taberlet2012-pf" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Taberlet, Pierre, Eric Coissac, Mehrdad Hajibabaei, and Loren H
|
|
||||||
Rieseberg. 2012. <span>“<span>Environmental DNA</span>.”</span>
|
|
||||||
<em>Molecular Ecology</em> 21 (8): 1789–93. <a href="https://doi.org/10.1111/j.1365-294X.2012.05542.x">https://doi.org/10.1111/j.1365-294X.2012.05542.x</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Thomsen2012-au" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Thomsen, Philip Francis, Jos Kielgast, Lars L Iversen, Carsten Wiuf,
|
|
||||||
Morten Rasmussen, M Thomas P Gilbert, Ludovic Orlando, and Eske
|
|
||||||
Willerslev. 2012. <span>“<span class="nocase">Monitoring endangered
|
|
||||||
freshwater biodiversity using environmental DNA</span>.”</span>
|
|
||||||
<em>Molecular Ecology</em> 21 (11): 2565–73. <a href="https://doi.org/10.1111/j.1365-294X.2011.05418.x">https://doi.org/10.1111/j.1365-294X.2011.05418.x</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Valentini2009-ay" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Valentini, Alice, Christian Miquel, Muhammad Ali Nawaz, Eva Bellemain,
|
|
||||||
Eric Coissac, François Pompanon, Ludovic Gielly, et al. 2009.
|
|
||||||
<span>“<span class="nocase">New perspectives in diet analysis based on
|
|
||||||
DNA barcoding and parallel pyrosequencing: the trnL
|
|
||||||
approach</span>.”</span> <em>Molecular Ecology Resources</em> 9 (1):
|
|
||||||
51–60. <a href="https://doi.org/10.1111/j.1755-0998.2008.02352.x">https://doi.org/10.1111/j.1755-0998.2008.02352.x</a>.
|
|
||||||
</div>
|
|
||||||
<div id="ref-Yoccoz2012-ix" class="csl-entry" role="doc-biblioentry">
|
|
||||||
Yoccoz, N G, K A Bråthen, L Gielly, J Haile, M E Edwards, T Goslar, H
|
|
||||||
Von Stedingk, et al. 2012. <span>“<span class="nocase">DNA from soil
|
|
||||||
mirrors plant taxonomic and growth form diversity</span>.”</span>
|
|
||||||
<em>Molecular Ecology</em> 21 (15): 3647–55. <a href="https://doi.org/10.1111/j.1365-294X.2012.05545.x">https://doi.org/10.1111/j.1365-294X.2012.05545.x</a>.
|
|
||||||
</div>
|
|
||||||
</div>
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</main> <!-- /main -->
|
|
||||||
<script id="quarto-html-after-body" type="application/javascript">
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (event) {
|
|
||||||
const toggleBodyColorMode = (bsSheetEl) => {
|
|
||||||
const mode = bsSheetEl.getAttribute("data-mode");
|
|
||||||
const bodyEl = window.document.querySelector("body");
|
|
||||||
if (mode === "dark") {
|
|
||||||
bodyEl.classList.add("quarto-dark");
|
|
||||||
bodyEl.classList.remove("quarto-light");
|
|
||||||
} else {
|
|
||||||
bodyEl.classList.add("quarto-light");
|
|
||||||
bodyEl.classList.remove("quarto-dark");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
const toggleBodyColorPrimary = () => {
|
|
||||||
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
|
|
||||||
if (bsSheetEl) {
|
|
||||||
toggleBodyColorMode(bsSheetEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
toggleBodyColorPrimary();
|
|
||||||
const icon = "";
|
|
||||||
const anchorJS = new window.AnchorJS();
|
|
||||||
anchorJS.options = {
|
|
||||||
placement: 'right',
|
|
||||||
icon: icon
|
|
||||||
};
|
|
||||||
anchorJS.add('.anchored');
|
|
||||||
const clipboard = new window.ClipboardJS('.code-copy-button', {
|
|
||||||
target: function(trigger) {
|
|
||||||
return trigger.previousElementSibling;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
clipboard.on('success', function(e) {
|
|
||||||
// button target
|
|
||||||
const button = e.trigger;
|
|
||||||
// don't keep focus
|
|
||||||
button.blur();
|
|
||||||
// flash "checked"
|
|
||||||
button.classList.add('code-copy-button-checked');
|
|
||||||
var currentTitle = button.getAttribute("title");
|
|
||||||
button.setAttribute("title", "Copied!");
|
|
||||||
let tooltip;
|
|
||||||
if (window.bootstrap) {
|
|
||||||
button.setAttribute("data-bs-toggle", "tooltip");
|
|
||||||
button.setAttribute("data-bs-placement", "left");
|
|
||||||
button.setAttribute("data-bs-title", "Copied!");
|
|
||||||
tooltip = new bootstrap.Tooltip(button,
|
|
||||||
{ trigger: "manual",
|
|
||||||
customClass: "code-copy-button-tooltip",
|
|
||||||
offset: [0, -8]});
|
|
||||||
tooltip.show();
|
|
||||||
}
|
|
||||||
setTimeout(function() {
|
|
||||||
if (tooltip) {
|
|
||||||
tooltip.hide();
|
|
||||||
button.removeAttribute("data-bs-title");
|
|
||||||
button.removeAttribute("data-bs-toggle");
|
|
||||||
button.removeAttribute("data-bs-placement");
|
|
||||||
}
|
|
||||||
button.setAttribute("title", currentTitle);
|
|
||||||
button.classList.remove('code-copy-button-checked');
|
|
||||||
}, 1000);
|
|
||||||
// clear code selection
|
|
||||||
e.clearSelection();
|
|
||||||
});
|
|
||||||
function tippyHover(el, contentFn) {
|
|
||||||
const config = {
|
|
||||||
allowHTML: true,
|
|
||||||
content: contentFn,
|
|
||||||
maxWidth: 500,
|
|
||||||
delay: 100,
|
|
||||||
arrow: false,
|
|
||||||
appendTo: function(el) {
|
|
||||||
return el.parentElement;
|
|
||||||
},
|
|
||||||
interactive: true,
|
|
||||||
interactiveBorder: 10,
|
|
||||||
theme: 'quarto',
|
|
||||||
placement: 'bottom-start'
|
|
||||||
};
|
|
||||||
window.tippy(el, config);
|
|
||||||
}
|
|
||||||
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
|
|
||||||
for (var i=0; i<noterefs.length; i++) {
|
|
||||||
const ref = noterefs[i];
|
|
||||||
tippyHover(ref, function() {
|
|
||||||
// use id or data attribute instead here
|
|
||||||
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
|
|
||||||
try { href = new URL(href).hash; } catch {}
|
|
||||||
const id = href.replace(/^#\/?/, "");
|
|
||||||
const note = window.document.getElementById(id);
|
|
||||||
return note.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
const findCites = (el) => {
|
|
||||||
const parentEl = el.parentElement;
|
|
||||||
if (parentEl) {
|
|
||||||
const cites = parentEl.dataset.cites;
|
|
||||||
if (cites) {
|
|
||||||
return {
|
|
||||||
el,
|
|
||||||
cites: cites.split(' ')
|
|
||||||
};
|
|
||||||
} else {
|
|
||||||
return findCites(el.parentElement)
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
|
|
||||||
for (var i=0; i<bibliorefs.length; i++) {
|
|
||||||
const ref = bibliorefs[i];
|
|
||||||
const citeInfo = findCites(ref);
|
|
||||||
if (citeInfo) {
|
|
||||||
tippyHover(citeInfo.el, function() {
|
|
||||||
var popup = window.document.createElement('div');
|
|
||||||
citeInfo.cites.forEach(function(cite) {
|
|
||||||
var citeDiv = window.document.createElement('div');
|
|
||||||
citeDiv.classList.add('hanging-indent');
|
|
||||||
citeDiv.classList.add('csl-entry');
|
|
||||||
var biblioDiv = window.document.getElementById('ref-' + cite);
|
|
||||||
if (biblioDiv) {
|
|
||||||
citeDiv.innerHTML = biblioDiv.innerHTML;
|
|
||||||
}
|
|
||||||
popup.appendChild(citeDiv);
|
|
||||||
});
|
|
||||||
return popup.innerHTML;
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
</script>
|
|
||||||
<nav class="page-navigation">
|
|
||||||
<div class="nav-page nav-page-previous">
|
|
||||||
<a href="./annexes.html" class="pagination-link">
|
|
||||||
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">A</span> <span class="chapter-title">Annexes</span></span>
|
|
||||||
</a>
|
|
||||||
</div>
|
|
||||||
<div class="nav-page nav-page-next">
|
|
||||||
</div>
|
|
||||||
</nav>
|
|
||||||
</div> <!-- /content -->
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
</body></html>
|
|
||||||
@@ -0,0 +1 @@
|
|||||||
|
d1ab8a47978e8cbde063ec16bae609a9371d97ea
|
||||||
Vendored
+14
-21
File diff suppressed because one or more lines are too long
-1704
File diff suppressed because it is too large
Load Diff
Binary file not shown.
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
@@ -1,171 +0,0 @@
|
|||||||
/* quarto syntax highlight colors */
|
|
||||||
:root {
|
|
||||||
--quarto-hl-ot-color: #003B4F;
|
|
||||||
--quarto-hl-at-color: #657422;
|
|
||||||
--quarto-hl-ss-color: #20794D;
|
|
||||||
--quarto-hl-an-color: #5E5E5E;
|
|
||||||
--quarto-hl-fu-color: #4758AB;
|
|
||||||
--quarto-hl-st-color: #20794D;
|
|
||||||
--quarto-hl-cf-color: #003B4F;
|
|
||||||
--quarto-hl-op-color: #5E5E5E;
|
|
||||||
--quarto-hl-er-color: #AD0000;
|
|
||||||
--quarto-hl-bn-color: #AD0000;
|
|
||||||
--quarto-hl-al-color: #AD0000;
|
|
||||||
--quarto-hl-va-color: #111111;
|
|
||||||
--quarto-hl-bu-color: inherit;
|
|
||||||
--quarto-hl-ex-color: inherit;
|
|
||||||
--quarto-hl-pp-color: #AD0000;
|
|
||||||
--quarto-hl-in-color: #5E5E5E;
|
|
||||||
--quarto-hl-vs-color: #20794D;
|
|
||||||
--quarto-hl-wa-color: #5E5E5E;
|
|
||||||
--quarto-hl-do-color: #5E5E5E;
|
|
||||||
--quarto-hl-im-color: #00769E;
|
|
||||||
--quarto-hl-ch-color: #20794D;
|
|
||||||
--quarto-hl-dt-color: #AD0000;
|
|
||||||
--quarto-hl-fl-color: #AD0000;
|
|
||||||
--quarto-hl-co-color: #5E5E5E;
|
|
||||||
--quarto-hl-cv-color: #5E5E5E;
|
|
||||||
--quarto-hl-cn-color: #8f5902;
|
|
||||||
--quarto-hl-sc-color: #5E5E5E;
|
|
||||||
--quarto-hl-dv-color: #AD0000;
|
|
||||||
--quarto-hl-kw-color: #003B4F;
|
|
||||||
}
|
|
||||||
|
|
||||||
/* other quarto variables */
|
|
||||||
:root {
|
|
||||||
--quarto-font-monospace: SFMono-Regular, Menlo, Monaco, Consolas, "Liberation Mono", "Courier New", monospace;
|
|
||||||
}
|
|
||||||
|
|
||||||
pre > code.sourceCode > span {
|
|
||||||
color: #003B4F;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span {
|
|
||||||
color: #003B4F;
|
|
||||||
}
|
|
||||||
|
|
||||||
code.sourceCode > span {
|
|
||||||
color: #003B4F;
|
|
||||||
}
|
|
||||||
|
|
||||||
div.sourceCode,
|
|
||||||
div.sourceCode pre.sourceCode {
|
|
||||||
color: #003B4F;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.ot {
|
|
||||||
color: #003B4F;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.at {
|
|
||||||
color: #657422;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.ss {
|
|
||||||
color: #20794D;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.an {
|
|
||||||
color: #5E5E5E;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.fu {
|
|
||||||
color: #4758AB;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.st {
|
|
||||||
color: #20794D;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.cf {
|
|
||||||
color: #003B4F;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.op {
|
|
||||||
color: #5E5E5E;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.er {
|
|
||||||
color: #AD0000;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.bn {
|
|
||||||
color: #AD0000;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.al {
|
|
||||||
color: #AD0000;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.va {
|
|
||||||
color: #111111;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.pp {
|
|
||||||
color: #AD0000;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.in {
|
|
||||||
color: #5E5E5E;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.vs {
|
|
||||||
color: #20794D;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.wa {
|
|
||||||
color: #5E5E5E;
|
|
||||||
font-style: italic;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.do {
|
|
||||||
color: #5E5E5E;
|
|
||||||
font-style: italic;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.im {
|
|
||||||
color: #00769E;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.ch {
|
|
||||||
color: #20794D;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.dt {
|
|
||||||
color: #AD0000;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.fl {
|
|
||||||
color: #AD0000;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.co {
|
|
||||||
color: #5E5E5E;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.cv {
|
|
||||||
color: #5E5E5E;
|
|
||||||
font-style: italic;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.cn {
|
|
||||||
color: #8f5902;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.sc {
|
|
||||||
color: #5E5E5E;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.dv {
|
|
||||||
color: #AD0000;
|
|
||||||
}
|
|
||||||
|
|
||||||
code span.kw {
|
|
||||||
color: #003B4F;
|
|
||||||
}
|
|
||||||
|
|
||||||
.prevent-inlining {
|
|
||||||
content: "</";
|
|
||||||
}
|
|
||||||
|
|
||||||
/*# sourceMappingURL=debc5d5d77c3f9108843748ff7464032.css.map */
|
|
||||||
-770
@@ -1,770 +0,0 @@
|
|||||||
const sectionChanged = new CustomEvent("quarto-sectionChanged", {
|
|
||||||
detail: {},
|
|
||||||
bubbles: true,
|
|
||||||
cancelable: false,
|
|
||||||
composed: false,
|
|
||||||
});
|
|
||||||
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function (_event) {
|
|
||||||
const tocEl = window.document.querySelector('nav.toc-active[role="doc-toc"]');
|
|
||||||
const sidebarEl = window.document.getElementById("quarto-sidebar");
|
|
||||||
const leftTocEl = window.document.getElementById("quarto-sidebar-toc-left");
|
|
||||||
const marginSidebarEl = window.document.getElementById(
|
|
||||||
"quarto-margin-sidebar"
|
|
||||||
);
|
|
||||||
// function to determine whether the element has a previous sibling that is active
|
|
||||||
const prevSiblingIsActiveLink = (el) => {
|
|
||||||
const sibling = el.previousElementSibling;
|
|
||||||
if (sibling && sibling.tagName === "A") {
|
|
||||||
return sibling.classList.contains("active");
|
|
||||||
} else {
|
|
||||||
return false;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
// fire slideEnter for bootstrap tab activations (for htmlwidget resize behavior)
|
|
||||||
function fireSlideEnter(e) {
|
|
||||||
const event = window.document.createEvent("Event");
|
|
||||||
event.initEvent("slideenter", true, true);
|
|
||||||
window.document.dispatchEvent(event);
|
|
||||||
}
|
|
||||||
const tabs = window.document.querySelectorAll('a[data-bs-toggle="tab"]');
|
|
||||||
tabs.forEach((tab) => {
|
|
||||||
tab.addEventListener("shown.bs.tab", fireSlideEnter);
|
|
||||||
});
|
|
||||||
|
|
||||||
// fire slideEnter for tabby tab activations (for htmlwidget resize behavior)
|
|
||||||
document.addEventListener("tabby", fireSlideEnter, false);
|
|
||||||
|
|
||||||
// Track scrolling and mark TOC links as active
|
|
||||||
// get table of contents and sidebar (bail if we don't have at least one)
|
|
||||||
const tocLinks = tocEl
|
|
||||||
? [...tocEl.querySelectorAll("a[data-scroll-target]")]
|
|
||||||
: [];
|
|
||||||
const makeActive = (link) => tocLinks[link].classList.add("active");
|
|
||||||
const removeActive = (link) => tocLinks[link].classList.remove("active");
|
|
||||||
const removeAllActive = () =>
|
|
||||||
[...Array(tocLinks.length).keys()].forEach((link) => removeActive(link));
|
|
||||||
|
|
||||||
// activate the anchor for a section associated with this TOC entry
|
|
||||||
tocLinks.forEach((link) => {
|
|
||||||
link.addEventListener("click", () => {
|
|
||||||
if (link.href.indexOf("#") !== -1) {
|
|
||||||
const anchor = link.href.split("#")[1];
|
|
||||||
const heading = window.document.querySelector(
|
|
||||||
`[data-anchor-id=${anchor}]`
|
|
||||||
);
|
|
||||||
if (heading) {
|
|
||||||
// Add the class
|
|
||||||
heading.classList.add("reveal-anchorjs-link");
|
|
||||||
|
|
||||||
// function to show the anchor
|
|
||||||
const handleMouseout = () => {
|
|
||||||
heading.classList.remove("reveal-anchorjs-link");
|
|
||||||
heading.removeEventListener("mouseout", handleMouseout);
|
|
||||||
};
|
|
||||||
|
|
||||||
// add a function to clear the anchor when the user mouses out of it
|
|
||||||
heading.addEventListener("mouseout", handleMouseout);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
});
|
|
||||||
|
|
||||||
const sections = tocLinks.map((link) => {
|
|
||||||
const target = link.getAttribute("data-scroll-target");
|
|
||||||
if (target.startsWith("#")) {
|
|
||||||
return window.document.getElementById(decodeURI(`${target.slice(1)}`));
|
|
||||||
} else {
|
|
||||||
return window.document.querySelector(decodeURI(`${target}`));
|
|
||||||
}
|
|
||||||
});
|
|
||||||
|
|
||||||
const sectionMargin = 200;
|
|
||||||
let currentActive = 0;
|
|
||||||
// track whether we've initialized state the first time
|
|
||||||
let init = false;
|
|
||||||
|
|
||||||
const updateActiveLink = () => {
|
|
||||||
// The index from bottom to top (e.g. reversed list)
|
|
||||||
let sectionIndex = -1;
|
|
||||||
if (
|
|
||||||
window.innerHeight + window.pageYOffset >=
|
|
||||||
window.document.body.offsetHeight
|
|
||||||
) {
|
|
||||||
sectionIndex = 0;
|
|
||||||
} else {
|
|
||||||
sectionIndex = [...sections].reverse().findIndex((section) => {
|
|
||||||
if (section) {
|
|
||||||
return window.pageYOffset >= section.offsetTop - sectionMargin;
|
|
||||||
} else {
|
|
||||||
return false;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
}
|
|
||||||
if (sectionIndex > -1) {
|
|
||||||
const current = sections.length - sectionIndex - 1;
|
|
||||||
if (current !== currentActive) {
|
|
||||||
removeAllActive();
|
|
||||||
currentActive = current;
|
|
||||||
makeActive(current);
|
|
||||||
if (init) {
|
|
||||||
window.dispatchEvent(sectionChanged);
|
|
||||||
}
|
|
||||||
init = true;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
const inHiddenRegion = (top, bottom, hiddenRegions) => {
|
|
||||||
for (const region of hiddenRegions) {
|
|
||||||
if (top <= region.bottom && bottom >= region.top) {
|
|
||||||
return true;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return false;
|
|
||||||
};
|
|
||||||
|
|
||||||
const categorySelector = "header.quarto-title-block .quarto-category";
|
|
||||||
const activateCategories = (href) => {
|
|
||||||
// Find any categories
|
|
||||||
// Surround them with a link pointing back to:
|
|
||||||
// #category=Authoring
|
|
||||||
try {
|
|
||||||
const categoryEls = window.document.querySelectorAll(categorySelector);
|
|
||||||
for (const categoryEl of categoryEls) {
|
|
||||||
const categoryText = categoryEl.textContent;
|
|
||||||
if (categoryText) {
|
|
||||||
const link = `${href}#category=${encodeURIComponent(categoryText)}`;
|
|
||||||
const linkEl = window.document.createElement("a");
|
|
||||||
linkEl.setAttribute("href", link);
|
|
||||||
for (const child of categoryEl.childNodes) {
|
|
||||||
linkEl.append(child);
|
|
||||||
}
|
|
||||||
categoryEl.appendChild(linkEl);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
} catch {
|
|
||||||
// Ignore errors
|
|
||||||
}
|
|
||||||
};
|
|
||||||
function hasTitleCategories() {
|
|
||||||
return window.document.querySelector(categorySelector) !== null;
|
|
||||||
}
|
|
||||||
|
|
||||||
function offsetRelativeUrl(url) {
|
|
||||||
const offset = getMeta("quarto:offset");
|
|
||||||
return offset ? offset + url : url;
|
|
||||||
}
|
|
||||||
|
|
||||||
function offsetAbsoluteUrl(url) {
|
|
||||||
const offset = getMeta("quarto:offset");
|
|
||||||
const baseUrl = new URL(offset, window.location);
|
|
||||||
|
|
||||||
const projRelativeUrl = url.replace(baseUrl, "");
|
|
||||||
if (projRelativeUrl.startsWith("/")) {
|
|
||||||
return projRelativeUrl;
|
|
||||||
} else {
|
|
||||||
return "/" + projRelativeUrl;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// read a meta tag value
|
|
||||||
function getMeta(metaName) {
|
|
||||||
const metas = window.document.getElementsByTagName("meta");
|
|
||||||
for (let i = 0; i < metas.length; i++) {
|
|
||||||
if (metas[i].getAttribute("name") === metaName) {
|
|
||||||
return metas[i].getAttribute("content");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return "";
|
|
||||||
}
|
|
||||||
|
|
||||||
async function findAndActivateCategories() {
|
|
||||||
const currentPagePath = offsetAbsoluteUrl(window.location.href);
|
|
||||||
const response = await fetch(offsetRelativeUrl("listings.json"));
|
|
||||||
if (response.status == 200) {
|
|
||||||
return response.json().then(function (listingPaths) {
|
|
||||||
const listingHrefs = [];
|
|
||||||
for (const listingPath of listingPaths) {
|
|
||||||
const pathWithoutLeadingSlash = listingPath.listing.substring(1);
|
|
||||||
for (const item of listingPath.items) {
|
|
||||||
if (
|
|
||||||
item === currentPagePath ||
|
|
||||||
item === currentPagePath + "index.html"
|
|
||||||
) {
|
|
||||||
// Resolve this path against the offset to be sure
|
|
||||||
// we already are using the correct path to the listing
|
|
||||||
// (this adjusts the listing urls to be rooted against
|
|
||||||
// whatever root the page is actually running against)
|
|
||||||
const relative = offsetRelativeUrl(pathWithoutLeadingSlash);
|
|
||||||
const baseUrl = window.location;
|
|
||||||
const resolvedPath = new URL(relative, baseUrl);
|
|
||||||
listingHrefs.push(resolvedPath.pathname);
|
|
||||||
break;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Look up the tree for a nearby linting and use that if we find one
|
|
||||||
const nearestListing = findNearestParentListing(
|
|
||||||
offsetAbsoluteUrl(window.location.pathname),
|
|
||||||
listingHrefs
|
|
||||||
);
|
|
||||||
if (nearestListing) {
|
|
||||||
activateCategories(nearestListing);
|
|
||||||
} else {
|
|
||||||
// See if the referrer is a listing page for this item
|
|
||||||
const referredRelativePath = offsetAbsoluteUrl(document.referrer);
|
|
||||||
const referrerListing = listingHrefs.find((listingHref) => {
|
|
||||||
const isListingReferrer =
|
|
||||||
listingHref === referredRelativePath ||
|
|
||||||
listingHref === referredRelativePath + "index.html";
|
|
||||||
return isListingReferrer;
|
|
||||||
});
|
|
||||||
|
|
||||||
if (referrerListing) {
|
|
||||||
// Try to use the referrer if possible
|
|
||||||
activateCategories(referrerListing);
|
|
||||||
} else if (listingHrefs.length > 0) {
|
|
||||||
// Otherwise, just fall back to the first listing
|
|
||||||
activateCategories(listingHrefs[0]);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
}
|
|
||||||
}
|
|
||||||
if (hasTitleCategories()) {
|
|
||||||
findAndActivateCategories();
|
|
||||||
}
|
|
||||||
|
|
||||||
const findNearestParentListing = (href, listingHrefs) => {
|
|
||||||
if (!href || !listingHrefs) {
|
|
||||||
return undefined;
|
|
||||||
}
|
|
||||||
// Look up the tree for a nearby linting and use that if we find one
|
|
||||||
const relativeParts = href.substring(1).split("/");
|
|
||||||
while (relativeParts.length > 0) {
|
|
||||||
const path = relativeParts.join("/");
|
|
||||||
for (const listingHref of listingHrefs) {
|
|
||||||
if (listingHref.startsWith(path)) {
|
|
||||||
return listingHref;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
relativeParts.pop();
|
|
||||||
}
|
|
||||||
|
|
||||||
return undefined;
|
|
||||||
};
|
|
||||||
|
|
||||||
const manageSidebarVisiblity = (el, placeholderDescriptor) => {
|
|
||||||
let isVisible = true;
|
|
||||||
|
|
||||||
return (hiddenRegions) => {
|
|
||||||
if (el === null) {
|
|
||||||
return;
|
|
||||||
}
|
|
||||||
|
|
||||||
// Find the last element of the TOC
|
|
||||||
const lastChildEl = el.lastElementChild;
|
|
||||||
|
|
||||||
if (lastChildEl) {
|
|
||||||
// Find the top and bottom o the element that is being managed
|
|
||||||
const elTop = el.offsetTop;
|
|
||||||
const elBottom =
|
|
||||||
elTop + lastChildEl.offsetTop + lastChildEl.offsetHeight;
|
|
||||||
|
|
||||||
// Converts the sidebar to a menu
|
|
||||||
const convertToMenu = () => {
|
|
||||||
for (const child of el.children) {
|
|
||||||
child.style.opacity = 0;
|
|
||||||
child.style.overflow = "hidden";
|
|
||||||
}
|
|
||||||
|
|
||||||
const toggleContainer = window.document.createElement("div");
|
|
||||||
toggleContainer.style.width = "100%";
|
|
||||||
toggleContainer.classList.add("zindex-over-content");
|
|
||||||
toggleContainer.classList.add("quarto-sidebar-toggle");
|
|
||||||
toggleContainer.classList.add("headroom-target"); // Marks this to be managed by headeroom
|
|
||||||
toggleContainer.id = placeholderDescriptor.id;
|
|
||||||
toggleContainer.style.position = "fixed";
|
|
||||||
|
|
||||||
const toggleIcon = window.document.createElement("i");
|
|
||||||
toggleIcon.classList.add("quarto-sidebar-toggle-icon");
|
|
||||||
toggleIcon.classList.add("bi");
|
|
||||||
toggleIcon.classList.add("bi-caret-down-fill");
|
|
||||||
|
|
||||||
const toggleTitle = window.document.createElement("div");
|
|
||||||
const titleEl = window.document.body.querySelector(
|
|
||||||
placeholderDescriptor.titleSelector
|
|
||||||
);
|
|
||||||
if (titleEl) {
|
|
||||||
toggleTitle.append(titleEl.innerText, toggleIcon);
|
|
||||||
}
|
|
||||||
toggleTitle.classList.add("zindex-over-content");
|
|
||||||
toggleTitle.classList.add("quarto-sidebar-toggle-title");
|
|
||||||
toggleContainer.append(toggleTitle);
|
|
||||||
|
|
||||||
const toggleContents = window.document.createElement("div");
|
|
||||||
toggleContents.classList = el.classList;
|
|
||||||
toggleContents.classList.add("zindex-over-content");
|
|
||||||
toggleContents.classList.add("quarto-sidebar-toggle-contents");
|
|
||||||
for (const child of el.children) {
|
|
||||||
if (child.id === "toc-title") {
|
|
||||||
continue;
|
|
||||||
}
|
|
||||||
|
|
||||||
const clone = child.cloneNode(true);
|
|
||||||
clone.style.opacity = 1;
|
|
||||||
clone.style.display = null;
|
|
||||||
toggleContents.append(clone);
|
|
||||||
}
|
|
||||||
toggleContents.style.height = "0px";
|
|
||||||
toggleContainer.append(toggleContents);
|
|
||||||
el.parentElement.prepend(toggleContainer);
|
|
||||||
|
|
||||||
// Process clicks
|
|
||||||
let tocShowing = false;
|
|
||||||
// Allow the caller to control whether this is dismissed
|
|
||||||
// when it is clicked (e.g. sidebar navigation supports
|
|
||||||
// opening and closing the nav tree, so don't dismiss on click)
|
|
||||||
const clickEl = placeholderDescriptor.dismissOnClick
|
|
||||||
? toggleContainer
|
|
||||||
: toggleTitle;
|
|
||||||
|
|
||||||
const closeToggle = () => {
|
|
||||||
if (tocShowing) {
|
|
||||||
toggleContainer.classList.remove("expanded");
|
|
||||||
toggleContents.style.height = "0px";
|
|
||||||
tocShowing = false;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
const positionToggle = () => {
|
|
||||||
// position the element (top left of parent, same width as parent)
|
|
||||||
const elRect = el.getBoundingClientRect();
|
|
||||||
toggleContainer.style.left = `${elRect.left}px`;
|
|
||||||
toggleContainer.style.top = `${elRect.top}px`;
|
|
||||||
toggleContainer.style.width = `${elRect.width}px`;
|
|
||||||
};
|
|
||||||
|
|
||||||
// Get rid of any expanded toggle if the user scrolls
|
|
||||||
window.document.addEventListener(
|
|
||||||
"scroll",
|
|
||||||
throttle(() => {
|
|
||||||
closeToggle();
|
|
||||||
}, 50)
|
|
||||||
);
|
|
||||||
|
|
||||||
// Handle positioning of the toggle
|
|
||||||
window.addEventListener(
|
|
||||||
"resize",
|
|
||||||
throttle(() => {
|
|
||||||
positionToggle();
|
|
||||||
}, 50)
|
|
||||||
);
|
|
||||||
positionToggle();
|
|
||||||
|
|
||||||
// Process the click
|
|
||||||
clickEl.onclick = () => {
|
|
||||||
if (!tocShowing) {
|
|
||||||
toggleContainer.classList.add("expanded");
|
|
||||||
toggleContents.style.height = null;
|
|
||||||
tocShowing = true;
|
|
||||||
} else {
|
|
||||||
closeToggle();
|
|
||||||
}
|
|
||||||
};
|
|
||||||
};
|
|
||||||
|
|
||||||
// Converts a sidebar from a menu back to a sidebar
|
|
||||||
const convertToSidebar = () => {
|
|
||||||
for (const child of el.children) {
|
|
||||||
child.style.opacity = 1;
|
|
||||||
child.style.overflow = null;
|
|
||||||
}
|
|
||||||
|
|
||||||
const placeholderEl = window.document.getElementById(
|
|
||||||
placeholderDescriptor.id
|
|
||||||
);
|
|
||||||
if (placeholderEl) {
|
|
||||||
placeholderEl.remove();
|
|
||||||
}
|
|
||||||
|
|
||||||
el.classList.remove("rollup");
|
|
||||||
};
|
|
||||||
|
|
||||||
if (isReaderMode()) {
|
|
||||||
convertToMenu();
|
|
||||||
isVisible = false;
|
|
||||||
} else {
|
|
||||||
if (!isVisible) {
|
|
||||||
// If the element is current not visible reveal if there are
|
|
||||||
// no conflicts with overlay regions
|
|
||||||
if (!inHiddenRegion(elTop, elBottom, hiddenRegions)) {
|
|
||||||
convertToSidebar();
|
|
||||||
isVisible = true;
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
// If the element is visible, hide it if it conflicts with overlay regions
|
|
||||||
// and insert a placeholder toggle (or if we're in reader mode)
|
|
||||||
if (inHiddenRegion(elTop, elBottom, hiddenRegions)) {
|
|
||||||
convertToMenu();
|
|
||||||
isVisible = false;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
};
|
|
||||||
};
|
|
||||||
|
|
||||||
// Find any conflicting margin elements and add margins to the
|
|
||||||
// top to prevent overlap
|
|
||||||
const marginChildren = window.document.querySelectorAll(
|
|
||||||
".column-margin.column-container > * "
|
|
||||||
);
|
|
||||||
|
|
||||||
nexttick(() => {
|
|
||||||
let lastBottom = 0;
|
|
||||||
for (const marginChild of marginChildren) {
|
|
||||||
const top = marginChild.getBoundingClientRect().top + window.scrollY;
|
|
||||||
if (top < lastBottom) {
|
|
||||||
const margin = lastBottom - top;
|
|
||||||
marginChild.style.marginTop = `${margin}px`;
|
|
||||||
}
|
|
||||||
const styles = window.getComputedStyle(marginChild);
|
|
||||||
const marginTop = parseFloat(styles["marginTop"]);
|
|
||||||
|
|
||||||
lastBottom = top + marginChild.getBoundingClientRect().height + marginTop;
|
|
||||||
}
|
|
||||||
});
|
|
||||||
|
|
||||||
// Manage the visibility of the toc and the sidebar
|
|
||||||
const marginScrollVisibility = manageSidebarVisiblity(marginSidebarEl, {
|
|
||||||
id: "quarto-toc-toggle",
|
|
||||||
titleSelector: "#toc-title",
|
|
||||||
dismissOnClick: true,
|
|
||||||
});
|
|
||||||
const sidebarScrollVisiblity = manageSidebarVisiblity(sidebarEl, {
|
|
||||||
id: "quarto-sidebarnav-toggle",
|
|
||||||
titleSelector: ".title",
|
|
||||||
dismissOnClick: false,
|
|
||||||
});
|
|
||||||
let tocLeftScrollVisibility;
|
|
||||||
if (leftTocEl) {
|
|
||||||
tocLeftScrollVisibility = manageSidebarVisiblity(leftTocEl, {
|
|
||||||
id: "quarto-lefttoc-toggle",
|
|
||||||
titleSelector: "#toc-title",
|
|
||||||
dismissOnClick: true,
|
|
||||||
});
|
|
||||||
}
|
|
||||||
|
|
||||||
// Find the first element that uses formatting in special columns
|
|
||||||
const conflictingEls = window.document.body.querySelectorAll(
|
|
||||||
'[class^="column-"], [class*=" column-"], aside, [class*="margin-caption"], [class*=" margin-caption"], [class*="margin-ref"], [class*=" margin-ref"]'
|
|
||||||
);
|
|
||||||
|
|
||||||
// Filter all the possibly conflicting elements into ones
|
|
||||||
// the do conflict on the left or ride side
|
|
||||||
const arrConflictingEls = Array.from(conflictingEls);
|
|
||||||
const leftSideConflictEls = arrConflictingEls.filter((el) => {
|
|
||||||
if (el.tagName === "ASIDE") {
|
|
||||||
return false;
|
|
||||||
}
|
|
||||||
return Array.from(el.classList).find((className) => {
|
|
||||||
return (
|
|
||||||
className !== "column-body" &&
|
|
||||||
className.startsWith("column-") &&
|
|
||||||
!className.endsWith("right") &&
|
|
||||||
!className.endsWith("container") &&
|
|
||||||
className !== "column-margin"
|
|
||||||
);
|
|
||||||
});
|
|
||||||
});
|
|
||||||
const rightSideConflictEls = arrConflictingEls.filter((el) => {
|
|
||||||
if (el.tagName === "ASIDE") {
|
|
||||||
return true;
|
|
||||||
}
|
|
||||||
|
|
||||||
const hasMarginCaption = Array.from(el.classList).find((className) => {
|
|
||||||
return className == "margin-caption";
|
|
||||||
});
|
|
||||||
if (hasMarginCaption) {
|
|
||||||
return true;
|
|
||||||
}
|
|
||||||
|
|
||||||
return Array.from(el.classList).find((className) => {
|
|
||||||
return (
|
|
||||||
className !== "column-body" &&
|
|
||||||
!className.endsWith("container") &&
|
|
||||||
className.startsWith("column-") &&
|
|
||||||
!className.endsWith("left")
|
|
||||||
);
|
|
||||||
});
|
|
||||||
});
|
|
||||||
|
|
||||||
const kOverlapPaddingSize = 10;
|
|
||||||
function toRegions(els) {
|
|
||||||
return els.map((el) => {
|
|
||||||
const top =
|
|
||||||
el.getBoundingClientRect().top +
|
|
||||||
document.documentElement.scrollTop -
|
|
||||||
kOverlapPaddingSize;
|
|
||||||
return {
|
|
||||||
top,
|
|
||||||
bottom: top + el.scrollHeight + 2 * kOverlapPaddingSize,
|
|
||||||
};
|
|
||||||
});
|
|
||||||
}
|
|
||||||
|
|
||||||
const hideOverlappedSidebars = () => {
|
|
||||||
marginScrollVisibility(toRegions(rightSideConflictEls));
|
|
||||||
sidebarScrollVisiblity(toRegions(leftSideConflictEls));
|
|
||||||
if (tocLeftScrollVisibility) {
|
|
||||||
tocLeftScrollVisibility(toRegions(leftSideConflictEls));
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
window.quartoToggleReader = () => {
|
|
||||||
// Applies a slow class (or removes it)
|
|
||||||
// to update the transition speed
|
|
||||||
const slowTransition = (slow) => {
|
|
||||||
const manageTransition = (id, slow) => {
|
|
||||||
const el = document.getElementById(id);
|
|
||||||
if (el) {
|
|
||||||
if (slow) {
|
|
||||||
el.classList.add("slow");
|
|
||||||
} else {
|
|
||||||
el.classList.remove("slow");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
manageTransition("TOC", slow);
|
|
||||||
manageTransition("quarto-sidebar", slow);
|
|
||||||
};
|
|
||||||
|
|
||||||
const readerMode = !isReaderMode();
|
|
||||||
setReaderModeValue(readerMode);
|
|
||||||
|
|
||||||
// If we're entering reader mode, slow the transition
|
|
||||||
if (readerMode) {
|
|
||||||
slowTransition(readerMode);
|
|
||||||
}
|
|
||||||
highlightReaderToggle(readerMode);
|
|
||||||
hideOverlappedSidebars();
|
|
||||||
|
|
||||||
// If we're exiting reader mode, restore the non-slow transition
|
|
||||||
if (!readerMode) {
|
|
||||||
slowTransition(!readerMode);
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
const highlightReaderToggle = (readerMode) => {
|
|
||||||
const els = document.querySelectorAll(".quarto-reader-toggle");
|
|
||||||
if (els) {
|
|
||||||
els.forEach((el) => {
|
|
||||||
if (readerMode) {
|
|
||||||
el.classList.add("reader");
|
|
||||||
} else {
|
|
||||||
el.classList.remove("reader");
|
|
||||||
}
|
|
||||||
});
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
const setReaderModeValue = (val) => {
|
|
||||||
if (window.location.protocol !== "file:") {
|
|
||||||
window.localStorage.setItem("quarto-reader-mode", val);
|
|
||||||
} else {
|
|
||||||
localReaderMode = val;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
|
|
||||||
const isReaderMode = () => {
|
|
||||||
if (window.location.protocol !== "file:") {
|
|
||||||
return window.localStorage.getItem("quarto-reader-mode") === "true";
|
|
||||||
} else {
|
|
||||||
return localReaderMode;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
let localReaderMode = null;
|
|
||||||
|
|
||||||
// Walk the TOC and collapse/expand nodes
|
|
||||||
// Nodes are expanded if:
|
|
||||||
// - they are top level
|
|
||||||
// - they have children that are 'active' links
|
|
||||||
// - they are directly below an link that is 'active'
|
|
||||||
const walk = (el, depth) => {
|
|
||||||
// Tick depth when we enter a UL
|
|
||||||
if (el.tagName === "UL") {
|
|
||||||
depth = depth + 1;
|
|
||||||
}
|
|
||||||
|
|
||||||
// It this is active link
|
|
||||||
let isActiveNode = false;
|
|
||||||
if (el.tagName === "A" && el.classList.contains("active")) {
|
|
||||||
isActiveNode = true;
|
|
||||||
}
|
|
||||||
|
|
||||||
// See if there is an active child to this element
|
|
||||||
let hasActiveChild = false;
|
|
||||||
for (child of el.children) {
|
|
||||||
hasActiveChild = walk(child, depth) || hasActiveChild;
|
|
||||||
}
|
|
||||||
|
|
||||||
// Process the collapse state if this is an UL
|
|
||||||
if (el.tagName === "UL") {
|
|
||||||
if (depth === 1 || hasActiveChild || prevSiblingIsActiveLink(el)) {
|
|
||||||
el.classList.remove("collapse");
|
|
||||||
} else {
|
|
||||||
el.classList.add("collapse");
|
|
||||||
}
|
|
||||||
|
|
||||||
// untick depth when we leave a UL
|
|
||||||
depth = depth - 1;
|
|
||||||
}
|
|
||||||
return hasActiveChild || isActiveNode;
|
|
||||||
};
|
|
||||||
|
|
||||||
// walk the TOC and expand / collapse any items that should be shown
|
|
||||||
|
|
||||||
if (tocEl) {
|
|
||||||
walk(tocEl, 0);
|
|
||||||
updateActiveLink();
|
|
||||||
}
|
|
||||||
|
|
||||||
// Throttle the scroll event and walk peridiocally
|
|
||||||
window.document.addEventListener(
|
|
||||||
"scroll",
|
|
||||||
throttle(() => {
|
|
||||||
if (tocEl) {
|
|
||||||
updateActiveLink();
|
|
||||||
walk(tocEl, 0);
|
|
||||||
}
|
|
||||||
if (!isReaderMode()) {
|
|
||||||
hideOverlappedSidebars();
|
|
||||||
}
|
|
||||||
}, 5)
|
|
||||||
);
|
|
||||||
window.addEventListener(
|
|
||||||
"resize",
|
|
||||||
throttle(() => {
|
|
||||||
if (!isReaderMode()) {
|
|
||||||
hideOverlappedSidebars();
|
|
||||||
}
|
|
||||||
}, 10)
|
|
||||||
);
|
|
||||||
hideOverlappedSidebars();
|
|
||||||
highlightReaderToggle(isReaderMode());
|
|
||||||
});
|
|
||||||
|
|
||||||
// grouped tabsets
|
|
||||||
window.addEventListener("pageshow", (_event) => {
|
|
||||||
function getTabSettings() {
|
|
||||||
const data = localStorage.getItem("quarto-persistent-tabsets-data");
|
|
||||||
if (!data) {
|
|
||||||
localStorage.setItem("quarto-persistent-tabsets-data", "{}");
|
|
||||||
return {};
|
|
||||||
}
|
|
||||||
if (data) {
|
|
||||||
return JSON.parse(data);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
function setTabSettings(data) {
|
|
||||||
localStorage.setItem(
|
|
||||||
"quarto-persistent-tabsets-data",
|
|
||||||
JSON.stringify(data)
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
function setTabState(groupName, groupValue) {
|
|
||||||
const data = getTabSettings();
|
|
||||||
data[groupName] = groupValue;
|
|
||||||
setTabSettings(data);
|
|
||||||
}
|
|
||||||
|
|
||||||
function toggleTab(tab, active) {
|
|
||||||
const tabPanelId = tab.getAttribute("aria-controls");
|
|
||||||
const tabPanel = document.getElementById(tabPanelId);
|
|
||||||
if (active) {
|
|
||||||
tab.classList.add("active");
|
|
||||||
tabPanel.classList.add("active");
|
|
||||||
} else {
|
|
||||||
tab.classList.remove("active");
|
|
||||||
tabPanel.classList.remove("active");
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
function toggleAll(selectedGroup, selectorsToSync) {
|
|
||||||
for (const [thisGroup, tabs] of Object.entries(selectorsToSync)) {
|
|
||||||
const active = selectedGroup === thisGroup;
|
|
||||||
for (const tab of tabs) {
|
|
||||||
toggleTab(tab, active);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
function findSelectorsToSyncByLanguage() {
|
|
||||||
const result = {};
|
|
||||||
const tabs = Array.from(
|
|
||||||
document.querySelectorAll(`div[data-group] a[id^='tabset-']`)
|
|
||||||
);
|
|
||||||
for (const item of tabs) {
|
|
||||||
const div = item.parentElement.parentElement.parentElement;
|
|
||||||
const group = div.getAttribute("data-group");
|
|
||||||
if (!result[group]) {
|
|
||||||
result[group] = {};
|
|
||||||
}
|
|
||||||
const selectorsToSync = result[group];
|
|
||||||
const value = item.innerHTML;
|
|
||||||
if (!selectorsToSync[value]) {
|
|
||||||
selectorsToSync[value] = [];
|
|
||||||
}
|
|
||||||
selectorsToSync[value].push(item);
|
|
||||||
}
|
|
||||||
return result;
|
|
||||||
}
|
|
||||||
|
|
||||||
function setupSelectorSync() {
|
|
||||||
const selectorsToSync = findSelectorsToSyncByLanguage();
|
|
||||||
Object.entries(selectorsToSync).forEach(([group, tabSetsByValue]) => {
|
|
||||||
Object.entries(tabSetsByValue).forEach(([value, items]) => {
|
|
||||||
items.forEach((item) => {
|
|
||||||
item.addEventListener("click", (_event) => {
|
|
||||||
setTabState(group, value);
|
|
||||||
toggleAll(value, selectorsToSync[group]);
|
|
||||||
});
|
|
||||||
});
|
|
||||||
});
|
|
||||||
});
|
|
||||||
return selectorsToSync;
|
|
||||||
}
|
|
||||||
|
|
||||||
const selectorsToSync = setupSelectorSync();
|
|
||||||
for (const [group, selectedName] of Object.entries(getTabSettings())) {
|
|
||||||
const selectors = selectorsToSync[group];
|
|
||||||
// it's possible that stale state gives us empty selections, so we explicitly check here.
|
|
||||||
if (selectors) {
|
|
||||||
toggleAll(selectedName, selectors);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
|
|
||||||
function throttle(func, wait) {
|
|
||||||
let waiting = false;
|
|
||||||
return function () {
|
|
||||||
if (!waiting) {
|
|
||||||
func.apply(this, arguments);
|
|
||||||
waiting = true;
|
|
||||||
setTimeout(function () {
|
|
||||||
waiting = false;
|
|
||||||
}, wait);
|
|
||||||
}
|
|
||||||
};
|
|
||||||
}
|
|
||||||
|
|
||||||
function nexttick(func) {
|
|
||||||
return setTimeout(func, 0);
|
|
||||||
}
|
|
||||||
@@ -1 +0,0 @@
|
|||||||
.tippy-box[data-animation=fade][data-state=hidden]{opacity:0}[data-tippy-root]{max-width:calc(100vw - 10px)}.tippy-box{position:relative;background-color:#333;color:#fff;border-radius:4px;font-size:14px;line-height:1.4;white-space:normal;outline:0;transition-property:transform,visibility,opacity}.tippy-box[data-placement^=top]>.tippy-arrow{bottom:0}.tippy-box[data-placement^=top]>.tippy-arrow:before{bottom:-7px;left:0;border-width:8px 8px 0;border-top-color:initial;transform-origin:center top}.tippy-box[data-placement^=bottom]>.tippy-arrow{top:0}.tippy-box[data-placement^=bottom]>.tippy-arrow:before{top:-7px;left:0;border-width:0 8px 8px;border-bottom-color:initial;transform-origin:center bottom}.tippy-box[data-placement^=left]>.tippy-arrow{right:0}.tippy-box[data-placement^=left]>.tippy-arrow:before{border-width:8px 0 8px 8px;border-left-color:initial;right:-7px;transform-origin:center left}.tippy-box[data-placement^=right]>.tippy-arrow{left:0}.tippy-box[data-placement^=right]>.tippy-arrow:before{left:-7px;border-width:8px 8px 8px 0;border-right-color:initial;transform-origin:center right}.tippy-box[data-inertia][data-state=visible]{transition-timing-function:cubic-bezier(.54,1.5,.38,1.11)}.tippy-arrow{width:16px;height:16px;color:#333}.tippy-arrow:before{content:"";position:absolute;border-color:transparent;border-style:solid}.tippy-content{position:relative;padding:5px 9px;z-index:1}
|
|
||||||
File diff suppressed because one or more lines are too long
@@ -1,7 +0,0 @@
|
|||||||
/*!
|
|
||||||
* headroom.js v0.12.0 - Give your page some headroom. Hide your header until you need it
|
|
||||||
* Copyright (c) 2020 Nick Williams - http://wicky.nillia.ms/headroom.js
|
|
||||||
* License: MIT
|
|
||||||
*/
|
|
||||||
|
|
||||||
!function(t,n){"object"==typeof exports&&"undefined"!=typeof module?module.exports=n():"function"==typeof define&&define.amd?define(n):(t=t||self).Headroom=n()}(this,function(){"use strict";function t(){return"undefined"!=typeof window}function d(t){return function(t){return t&&t.document&&function(t){return 9===t.nodeType}(t.document)}(t)?function(t){var n=t.document,o=n.body,s=n.documentElement;return{scrollHeight:function(){return Math.max(o.scrollHeight,s.scrollHeight,o.offsetHeight,s.offsetHeight,o.clientHeight,s.clientHeight)},height:function(){return t.innerHeight||s.clientHeight||o.clientHeight},scrollY:function(){return void 0!==t.pageYOffset?t.pageYOffset:(s||o.parentNode||o).scrollTop}}}(t):function(t){return{scrollHeight:function(){return Math.max(t.scrollHeight,t.offsetHeight,t.clientHeight)},height:function(){return Math.max(t.offsetHeight,t.clientHeight)},scrollY:function(){return t.scrollTop}}}(t)}function n(t,s,e){var n,o=function(){var n=!1;try{var t={get passive(){n=!0}};window.addEventListener("test",t,t),window.removeEventListener("test",t,t)}catch(t){n=!1}return n}(),i=!1,r=d(t),l=r.scrollY(),a={};function c(){var t=Math.round(r.scrollY()),n=r.height(),o=r.scrollHeight();a.scrollY=t,a.lastScrollY=l,a.direction=l<t?"down":"up",a.distance=Math.abs(t-l),a.isOutOfBounds=t<0||o<t+n,a.top=t<=s.offset[a.direction],a.bottom=o<=t+n,a.toleranceExceeded=a.distance>s.tolerance[a.direction],e(a),l=t,i=!1}function h(){i||(i=!0,n=requestAnimationFrame(c))}var u=!!o&&{passive:!0,capture:!1};return t.addEventListener("scroll",h,u),c(),{destroy:function(){cancelAnimationFrame(n),t.removeEventListener("scroll",h,u)}}}function o(t){return t===Object(t)?t:{down:t,up:t}}function s(t,n){n=n||{},Object.assign(this,s.options,n),this.classes=Object.assign({},s.options.classes,n.classes),this.elem=t,this.tolerance=o(this.tolerance),this.offset=o(this.offset),this.initialised=!1,this.frozen=!1}return s.prototype={constructor:s,init:function(){return s.cutsTheMustard&&!this.initialised&&(this.addClass("initial"),this.initialised=!0,setTimeout(function(t){t.scrollTracker=n(t.scroller,{offset:t.offset,tolerance:t.tolerance},t.update.bind(t))},100,this)),this},destroy:function(){this.initialised=!1,Object.keys(this.classes).forEach(this.removeClass,this),this.scrollTracker.destroy()},unpin:function(){!this.hasClass("pinned")&&this.hasClass("unpinned")||(this.addClass("unpinned"),this.removeClass("pinned"),this.onUnpin&&this.onUnpin.call(this))},pin:function(){this.hasClass("unpinned")&&(this.addClass("pinned"),this.removeClass("unpinned"),this.onPin&&this.onPin.call(this))},freeze:function(){this.frozen=!0,this.addClass("frozen")},unfreeze:function(){this.frozen=!1,this.removeClass("frozen")},top:function(){this.hasClass("top")||(this.addClass("top"),this.removeClass("notTop"),this.onTop&&this.onTop.call(this))},notTop:function(){this.hasClass("notTop")||(this.addClass("notTop"),this.removeClass("top"),this.onNotTop&&this.onNotTop.call(this))},bottom:function(){this.hasClass("bottom")||(this.addClass("bottom"),this.removeClass("notBottom"),this.onBottom&&this.onBottom.call(this))},notBottom:function(){this.hasClass("notBottom")||(this.addClass("notBottom"),this.removeClass("bottom"),this.onNotBottom&&this.onNotBottom.call(this))},shouldUnpin:function(t){return"down"===t.direction&&!t.top&&t.toleranceExceeded},shouldPin:function(t){return"up"===t.direction&&t.toleranceExceeded||t.top},addClass:function(t){this.elem.classList.add.apply(this.elem.classList,this.classes[t].split(" "))},removeClass:function(t){this.elem.classList.remove.apply(this.elem.classList,this.classes[t].split(" "))},hasClass:function(t){return this.classes[t].split(" ").every(function(t){return this.classList.contains(t)},this.elem)},update:function(t){t.isOutOfBounds||!0!==this.frozen&&(t.top?this.top():this.notTop(),t.bottom?this.bottom():this.notBottom(),this.shouldUnpin(t)?this.unpin():this.shouldPin(t)&&this.pin())}},s.options={tolerance:{up:0,down:0},offset:0,scroller:t()?window:null,classes:{frozen:"headroom--frozen",pinned:"headroom--pinned",unpinned:"headroom--unpinned",top:"headroom--top",notTop:"headroom--not-top",bottom:"headroom--bottom",notBottom:"headroom--not-bottom",initial:"headroom"}},s.cutsTheMustard=!!(t()&&function(){}.bind&&"classList"in document.documentElement&&Object.assign&&Object.keys&&requestAnimationFrame),s});
|
|
||||||
-221
@@ -1,221 +0,0 @@
|
|||||||
const headroomChanged = new CustomEvent("quarto-hrChanged", {
|
|
||||||
detail: {},
|
|
||||||
bubbles: true,
|
|
||||||
cancelable: false,
|
|
||||||
composed: false,
|
|
||||||
});
|
|
||||||
|
|
||||||
window.document.addEventListener("DOMContentLoaded", function () {
|
|
||||||
let init = false;
|
|
||||||
|
|
||||||
function throttle(func, wait) {
|
|
||||||
var timeout;
|
|
||||||
return function () {
|
|
||||||
const context = this;
|
|
||||||
const args = arguments;
|
|
||||||
const later = function () {
|
|
||||||
clearTimeout(timeout);
|
|
||||||
timeout = null;
|
|
||||||
func.apply(context, args);
|
|
||||||
};
|
|
||||||
|
|
||||||
if (!timeout) {
|
|
||||||
timeout = setTimeout(later, wait);
|
|
||||||
}
|
|
||||||
};
|
|
||||||
}
|
|
||||||
|
|
||||||
function headerOffset() {
|
|
||||||
// Set an offset if there is are fixed top navbar
|
|
||||||
const headerEl = window.document.querySelector("header.fixed-top");
|
|
||||||
if (headerEl) {
|
|
||||||
return headerEl.clientHeight;
|
|
||||||
} else {
|
|
||||||
return 0;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
function footerOffset() {
|
|
||||||
const footerEl = window.document.querySelector("footer.footer");
|
|
||||||
if (footerEl) {
|
|
||||||
return footerEl.clientHeight;
|
|
||||||
} else {
|
|
||||||
return 0;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
function updateDocumentOffsetWithoutAnimation() {
|
|
||||||
updateDocumentOffset(false);
|
|
||||||
}
|
|
||||||
|
|
||||||
function updateDocumentOffset(animated) {
|
|
||||||
// set body offset
|
|
||||||
const topOffset = headerOffset();
|
|
||||||
const bodyOffset = topOffset + footerOffset();
|
|
||||||
const bodyEl = window.document.body;
|
|
||||||
bodyEl.setAttribute("data-bs-offset", topOffset);
|
|
||||||
bodyEl.style.paddingTop = topOffset + "px";
|
|
||||||
|
|
||||||
// deal with sidebar offsets
|
|
||||||
const sidebars = window.document.querySelectorAll(
|
|
||||||
".sidebar, .headroom-target"
|
|
||||||
);
|
|
||||||
sidebars.forEach((sidebar) => {
|
|
||||||
if (!animated) {
|
|
||||||
sidebar.classList.add("notransition");
|
|
||||||
// Remove the no transition class after the animation has time to complete
|
|
||||||
setTimeout(function () {
|
|
||||||
sidebar.classList.remove("notransition");
|
|
||||||
}, 201);
|
|
||||||
}
|
|
||||||
|
|
||||||
if (window.Headroom && sidebar.classList.contains("sidebar-unpinned")) {
|
|
||||||
sidebar.style.top = "0";
|
|
||||||
sidebar.style.maxHeight = "100vh";
|
|
||||||
} else {
|
|
||||||
sidebar.style.top = topOffset + "px";
|
|
||||||
sidebar.style.maxHeight = "calc(100vh - " + topOffset + "px)";
|
|
||||||
}
|
|
||||||
});
|
|
||||||
|
|
||||||
// allow space for footer
|
|
||||||
const mainContainer = window.document.querySelector(".quarto-container");
|
|
||||||
if (mainContainer) {
|
|
||||||
mainContainer.style.minHeight = "calc(100vh - " + bodyOffset + "px)";
|
|
||||||
}
|
|
||||||
|
|
||||||
// link offset
|
|
||||||
let linkStyle = window.document.querySelector("#quarto-target-style");
|
|
||||||
if (!linkStyle) {
|
|
||||||
linkStyle = window.document.createElement("style");
|
|
||||||
window.document.head.appendChild(linkStyle);
|
|
||||||
}
|
|
||||||
while (linkStyle.firstChild) {
|
|
||||||
linkStyle.removeChild(linkStyle.firstChild);
|
|
||||||
}
|
|
||||||
if (topOffset > 0) {
|
|
||||||
linkStyle.appendChild(
|
|
||||||
window.document.createTextNode(`
|
|
||||||
section:target::before {
|
|
||||||
content: "";
|
|
||||||
display: block;
|
|
||||||
height: ${topOffset}px;
|
|
||||||
margin: -${topOffset}px 0 0;
|
|
||||||
}`)
|
|
||||||
);
|
|
||||||
}
|
|
||||||
if (init) {
|
|
||||||
window.dispatchEvent(headroomChanged);
|
|
||||||
}
|
|
||||||
init = true;
|
|
||||||
}
|
|
||||||
|
|
||||||
// initialize headroom
|
|
||||||
var header = window.document.querySelector("#quarto-header");
|
|
||||||
if (header && window.Headroom) {
|
|
||||||
const headroom = new window.Headroom(header, {
|
|
||||||
tolerance: 5,
|
|
||||||
onPin: function () {
|
|
||||||
const sidebars = window.document.querySelectorAll(
|
|
||||||
".sidebar, .headroom-target"
|
|
||||||
);
|
|
||||||
sidebars.forEach((sidebar) => {
|
|
||||||
sidebar.classList.remove("sidebar-unpinned");
|
|
||||||
});
|
|
||||||
updateDocumentOffset();
|
|
||||||
},
|
|
||||||
onUnpin: function () {
|
|
||||||
const sidebars = window.document.querySelectorAll(
|
|
||||||
".sidebar, .headroom-target"
|
|
||||||
);
|
|
||||||
sidebars.forEach((sidebar) => {
|
|
||||||
sidebar.classList.add("sidebar-unpinned");
|
|
||||||
});
|
|
||||||
updateDocumentOffset();
|
|
||||||
},
|
|
||||||
});
|
|
||||||
headroom.init();
|
|
||||||
|
|
||||||
let frozen = false;
|
|
||||||
window.quartoToggleHeadroom = function () {
|
|
||||||
if (frozen) {
|
|
||||||
headroom.unfreeze();
|
|
||||||
frozen = false;
|
|
||||||
} else {
|
|
||||||
headroom.freeze();
|
|
||||||
frozen = true;
|
|
||||||
}
|
|
||||||
};
|
|
||||||
}
|
|
||||||
|
|
||||||
// Observe size changed for the header
|
|
||||||
const headerEl = window.document.querySelector("header.fixed-top");
|
|
||||||
if (headerEl && window.ResizeObserver) {
|
|
||||||
const observer = new window.ResizeObserver(
|
|
||||||
updateDocumentOffsetWithoutAnimation
|
|
||||||
);
|
|
||||||
observer.observe(headerEl, {
|
|
||||||
attributes: true,
|
|
||||||
childList: true,
|
|
||||||
characterData: true,
|
|
||||||
});
|
|
||||||
} else {
|
|
||||||
window.addEventListener(
|
|
||||||
"resize",
|
|
||||||
throttle(updateDocumentOffsetWithoutAnimation, 50)
|
|
||||||
);
|
|
||||||
}
|
|
||||||
setTimeout(updateDocumentOffsetWithoutAnimation, 250);
|
|
||||||
|
|
||||||
// fixup index.html links if we aren't on the filesystem
|
|
||||||
if (window.location.protocol !== "file:") {
|
|
||||||
const links = window.document.querySelectorAll("a");
|
|
||||||
for (let i = 0; i < links.length; i++) {
|
|
||||||
links[i].href = links[i].href.replace(/\/index\.html/, "/");
|
|
||||||
}
|
|
||||||
|
|
||||||
// Fixup any sharing links that require urls
|
|
||||||
// Append url to any sharing urls
|
|
||||||
const sharingLinks = window.document.querySelectorAll(
|
|
||||||
"a.sidebar-tools-main-item"
|
|
||||||
);
|
|
||||||
for (let i = 0; i < sharingLinks.length; i++) {
|
|
||||||
const sharingLink = sharingLinks[i];
|
|
||||||
const href = sharingLink.getAttribute("href");
|
|
||||||
if (href) {
|
|
||||||
sharingLink.setAttribute(
|
|
||||||
"href",
|
|
||||||
href.replace("|url|", window.location.href)
|
|
||||||
);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Scroll the active navigation item into view, if necessary
|
|
||||||
const navSidebar = window.document.querySelector("nav#quarto-sidebar");
|
|
||||||
if (navSidebar) {
|
|
||||||
// Find the active item
|
|
||||||
const activeItem = navSidebar.querySelector("li.sidebar-item a.active");
|
|
||||||
if (activeItem) {
|
|
||||||
// Wait for the scroll height and height to resolve by observing size changes on the
|
|
||||||
// nav element that is scrollable
|
|
||||||
const resizeObserver = new ResizeObserver((_entries) => {
|
|
||||||
// The bottom of the element
|
|
||||||
const elBottom = activeItem.offsetTop;
|
|
||||||
const viewBottom = navSidebar.scrollTop + navSidebar.clientHeight;
|
|
||||||
|
|
||||||
// The element height and scroll height are the same, then we are still loading
|
|
||||||
if (viewBottom !== navSidebar.scrollHeight) {
|
|
||||||
// Determine if the item isn't visible and scroll to it
|
|
||||||
if (elBottom >= viewBottom) {
|
|
||||||
navSidebar.scrollTop = elBottom;
|
|
||||||
}
|
|
||||||
|
|
||||||
// stop observing now since we've completed the scroll
|
|
||||||
resizeObserver.unobserve(navSidebar);
|
|
||||||
}
|
|
||||||
});
|
|
||||||
resizeObserver.observe(navSidebar);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
});
|
|
||||||
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because it is too large
Load Diff
Vendored
+4002
-132
File diff suppressed because one or more lines are too long
Reference in New Issue
Block a user