mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-03-25 21:40:52 +00:00
Add SuperKmer extraction functionality
This commit introduces the ExtractSuperKmers function which identifies maximal subsequences where all consecutive k-mers share the same minimizer. It includes: - SuperKmer struct to represent the maximal subsequences - dequeItem struct for tracking minimizers in a sliding window - Efficient algorithm using monotone deque for O(1) amortized minimizer tracking - Comprehensive parameter validation - Support for buffer reuse for performance optimization - Extensive test cases covering basic functionality, edge cases, and performance benchmarks The implementation uses simultaneous forward/reverse m-mer encoding for O(1) canonical m-mer computation and maintains a monotone deque to track minimizers efficiently.
This commit is contained in:
@@ -54,6 +54,162 @@ func EncodeKmers(seq []byte, k int, buffer *[]uint64) []uint64 {
|
|||||||
return result
|
return result
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// SuperKmer represents a maximal subsequence where all consecutive k-mers
|
||||||
|
// share the same minimizer. A minimizer is the smallest canonical m-mer
|
||||||
|
// among the (k-m+1) m-mers contained in a k-mer.
|
||||||
|
type SuperKmer struct {
|
||||||
|
Minimizer uint64 // The canonical minimizer value (normalized m-mer)
|
||||||
|
Start int // Starting position in the original sequence (0-indexed)
|
||||||
|
End int // Ending position (exclusive, like Go slice notation)
|
||||||
|
Sequence []byte // The actual DNA subsequence [Start:End]
|
||||||
|
}
|
||||||
|
|
||||||
|
// dequeItem represents an element in the monotone deque used for
|
||||||
|
// tracking minimizers in a sliding window.
|
||||||
|
type dequeItem struct {
|
||||||
|
position int // Position of the m-mer in the sequence
|
||||||
|
canonical uint64 // Canonical (normalized) m-mer value
|
||||||
|
}
|
||||||
|
|
||||||
|
// ExtractSuperKmers extracts super k-mers from a DNA sequence.
|
||||||
|
// A super k-mer is a maximal subsequence where all consecutive k-mers
|
||||||
|
// share the same minimizer. The minimizer of a k-mer is the smallest
|
||||||
|
// canonical m-mer among its (k-m+1) constituent m-mers.
|
||||||
|
//
|
||||||
|
// The algorithm uses:
|
||||||
|
// - Simultaneous forward/reverse m-mer encoding for O(1) canonical m-mer computation
|
||||||
|
// - Monotone deque for O(1) amortized minimizer tracking per position
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
||||||
|
// - k: k-mer size (must be between m+1 and 32)
|
||||||
|
// - m: minimizer size (must be between 1 and k-1)
|
||||||
|
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
|
||||||
|
//
|
||||||
|
// Returns:
|
||||||
|
// - slice of SuperKmer structs representing maximal subsequences
|
||||||
|
// - nil if parameters are invalid or sequence is too short
|
||||||
|
//
|
||||||
|
// Time complexity: O(n) where n is the sequence length
|
||||||
|
// Space complexity: O(k-m+1) for the deque + O(number of super k-mers) for results
|
||||||
|
func ExtractSuperKmers(seq []byte, k int, m int, buffer *[]SuperKmer) []SuperKmer {
|
||||||
|
// Validate parameters
|
||||||
|
if m < 1 || m >= k || k < 2 || k > 32 || len(seq) < k {
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Initialize result buffer
|
||||||
|
var result []SuperKmer
|
||||||
|
if buffer == nil {
|
||||||
|
// Estimate: worst case is one super k-mer per k nucleotides
|
||||||
|
estimatedSize := len(seq) / k
|
||||||
|
if estimatedSize < 1 {
|
||||||
|
estimatedSize = 1
|
||||||
|
}
|
||||||
|
result = make([]SuperKmer, 0, estimatedSize)
|
||||||
|
} else {
|
||||||
|
result = (*buffer)[:0]
|
||||||
|
}
|
||||||
|
|
||||||
|
// Initialize monotone deque for tracking minimizers
|
||||||
|
deque := make([]dequeItem, 0, k-m+1)
|
||||||
|
|
||||||
|
// Masks for m-mer encoding
|
||||||
|
mMask := uint64(1)<<(m*2) - 1
|
||||||
|
rcShift := uint((m - 1) * 2)
|
||||||
|
|
||||||
|
// Build first m-1 nucleotides (can't form complete m-mer yet)
|
||||||
|
var fwdMmer, rvcMmer uint64
|
||||||
|
for i := 0; i < m-1 && i < len(seq); i++ {
|
||||||
|
code := uint64(__single_base_code__[seq[i]&31])
|
||||||
|
fwdMmer = (fwdMmer << 2) | code
|
||||||
|
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Track super k-mer boundaries
|
||||||
|
superKmerStart := 0
|
||||||
|
var currentMinimizer uint64
|
||||||
|
firstKmer := true
|
||||||
|
|
||||||
|
// Slide through sequence, processing each position that completes an m-mer
|
||||||
|
for pos := m - 1; pos < len(seq); pos++ {
|
||||||
|
// Add new nucleotide to m-mer
|
||||||
|
code := uint64(__single_base_code__[seq[pos]&31])
|
||||||
|
fwdMmer = ((fwdMmer << 2) | code) & mMask
|
||||||
|
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||||
|
|
||||||
|
// Get canonical m-mer (minimum of forward and reverse complement)
|
||||||
|
canonical := fwdMmer
|
||||||
|
if rvcMmer < fwdMmer {
|
||||||
|
canonical = rvcMmer
|
||||||
|
}
|
||||||
|
|
||||||
|
mmerPos := pos - m + 1
|
||||||
|
|
||||||
|
// Remove m-mers outside the current k-mer window from front of deque
|
||||||
|
// The k-mer at position pos spans from (pos-k+1) to pos
|
||||||
|
// It contains m-mers from position (pos-k+1) to (pos-m+1)
|
||||||
|
if pos >= k-1 {
|
||||||
|
windowStart := pos - k + 1
|
||||||
|
for len(deque) > 0 && deque[0].position < windowStart {
|
||||||
|
deque = deque[1:]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Maintain monotone property: remove larger values from back
|
||||||
|
for len(deque) > 0 && deque[len(deque)-1].canonical >= canonical {
|
||||||
|
deque = deque[:len(deque)-1]
|
||||||
|
}
|
||||||
|
|
||||||
|
// Add new m-mer to deque
|
||||||
|
deque = append(deque, dequeItem{position: mmerPos, canonical: canonical})
|
||||||
|
|
||||||
|
// Once we have processed the first k nucleotides, we have our first k-mer
|
||||||
|
if pos >= k-1 {
|
||||||
|
// The minimizer is at the front of the deque
|
||||||
|
newMinimizer := deque[0].canonical
|
||||||
|
kmerStart := pos - k + 1 // Start position of current k-mer (ending at pos)
|
||||||
|
|
||||||
|
if firstKmer {
|
||||||
|
// Initialize first super k-mer
|
||||||
|
currentMinimizer = newMinimizer
|
||||||
|
firstKmer = false
|
||||||
|
} else if newMinimizer != currentMinimizer {
|
||||||
|
// Minimizer changed at this k-mer position
|
||||||
|
// Previous k-mer started at position kmerStart-1
|
||||||
|
// That k-mer is seq[kmerStart-1 : kmerStart-1+k] (Go slice notation)
|
||||||
|
// The last base of that k-mer is at kmerStart-1+k-1 = kmerStart+k-2
|
||||||
|
// In Go slice notation (exclusive end): kmerStart+k-1
|
||||||
|
endPos := kmerStart + k - 1
|
||||||
|
superKmer := SuperKmer{
|
||||||
|
Minimizer: currentMinimizer,
|
||||||
|
Start: superKmerStart,
|
||||||
|
End: endPos,
|
||||||
|
Sequence: seq[superKmerStart:endPos],
|
||||||
|
}
|
||||||
|
result = append(result, superKmer)
|
||||||
|
|
||||||
|
// New super k-mer starts at current k-mer position
|
||||||
|
superKmerStart = kmerStart
|
||||||
|
currentMinimizer = newMinimizer
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Emit final super k-mer
|
||||||
|
if !firstKmer {
|
||||||
|
superKmer := SuperKmer{
|
||||||
|
Minimizer: currentMinimizer,
|
||||||
|
Start: superKmerStart,
|
||||||
|
End: len(seq),
|
||||||
|
Sequence: seq[superKmerStart:],
|
||||||
|
}
|
||||||
|
result = append(result, superKmer)
|
||||||
|
}
|
||||||
|
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
// ReverseComplement computes the reverse complement of an encoded k-mer.
|
// ReverseComplement computes the reverse complement of an encoded k-mer.
|
||||||
// The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11).
|
// The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11).
|
||||||
// The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11.
|
// The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11.
|
||||||
|
|||||||
@@ -516,3 +516,316 @@ func BenchmarkNormalizeKmer(b *testing.B) {
|
|||||||
NormalizeKmer(kmer, k)
|
NormalizeKmer(kmer, k)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// TestExtractSuperKmersBasic tests basic super k-mer extraction
|
||||||
|
func TestExtractSuperKmersBasic(t *testing.T) {
|
||||||
|
tests := []struct {
|
||||||
|
name string
|
||||||
|
seq string
|
||||||
|
k int
|
||||||
|
m int
|
||||||
|
validate func(*testing.T, []SuperKmer)
|
||||||
|
}{
|
||||||
|
{
|
||||||
|
name: "simple sequence",
|
||||||
|
seq: "ACGTACGTACGT",
|
||||||
|
k: 5,
|
||||||
|
m: 3,
|
||||||
|
validate: func(t *testing.T, sks []SuperKmer) {
|
||||||
|
if len(sks) == 0 {
|
||||||
|
t.Error("expected at least one super k-mer")
|
||||||
|
}
|
||||||
|
// Verify all super k-mers cover the sequence
|
||||||
|
totalLen := 0
|
||||||
|
for _, sk := range sks {
|
||||||
|
totalLen += sk.End - sk.Start
|
||||||
|
if string(sk.Sequence) != string([]byte(t.Name())[len(t.Name())-len(sk.Sequence):]) {
|
||||||
|
// Just verify Start/End matches Sequence
|
||||||
|
if string(sk.Sequence) != string([]byte("ACGTACGTACGT")[sk.Start:sk.End]) {
|
||||||
|
t.Errorf("Sequence mismatch: seq[%d:%d] != %s", sk.Start, sk.End, sk.Sequence)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
},
|
||||||
|
},
|
||||||
|
{
|
||||||
|
name: "single k-mer sequence",
|
||||||
|
seq: "ACGTACGT",
|
||||||
|
k: 8,
|
||||||
|
m: 4,
|
||||||
|
validate: func(t *testing.T, sks []SuperKmer) {
|
||||||
|
if len(sks) != 1 {
|
||||||
|
t.Errorf("expected exactly 1 super k-mer for len(seq)==k, got %d", len(sks))
|
||||||
|
}
|
||||||
|
if len(sks) > 0 {
|
||||||
|
if sks[0].Start != 0 || sks[0].End != 8 {
|
||||||
|
t.Errorf("expected [0:8], got [%d:%d]", sks[0].Start, sks[0].End)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
},
|
||||||
|
},
|
||||||
|
{
|
||||||
|
name: "repeating sequence",
|
||||||
|
seq: "AAAAAAAAAA",
|
||||||
|
k: 5,
|
||||||
|
m: 3,
|
||||||
|
validate: func(t *testing.T, sks []SuperKmer) {
|
||||||
|
// Repeating A should have same minimizer (AAA) everywhere
|
||||||
|
if len(sks) != 1 {
|
||||||
|
t.Errorf("expected 1 super k-mer for repeating sequence, got %d", len(sks))
|
||||||
|
}
|
||||||
|
if len(sks) > 0 {
|
||||||
|
if sks[0].Start != 0 || sks[0].End != 10 {
|
||||||
|
t.Errorf("expected super k-mer to cover entire sequence [0:10], got [%d:%d]",
|
||||||
|
sks[0].Start, sks[0].End)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
},
|
||||||
|
},
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, tt := range tests {
|
||||||
|
t.Run(tt.name, func(t *testing.T) {
|
||||||
|
result := ExtractSuperKmers([]byte(tt.seq), tt.k, tt.m, nil)
|
||||||
|
tt.validate(t, result)
|
||||||
|
})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestExtractSuperKmersEdgeCases tests edge cases and error handling
|
||||||
|
func TestExtractSuperKmersEdgeCases(t *testing.T) {
|
||||||
|
tests := []struct {
|
||||||
|
name string
|
||||||
|
seq string
|
||||||
|
k int
|
||||||
|
m int
|
||||||
|
expectNil bool
|
||||||
|
}{
|
||||||
|
{"empty sequence", "", 5, 3, true},
|
||||||
|
{"seq shorter than k", "ACG", 5, 3, true},
|
||||||
|
{"m < 1", "ACGTACGT", 5, 0, true},
|
||||||
|
{"m >= k", "ACGTACGT", 5, 5, true},
|
||||||
|
{"m == k-1 (valid)", "ACGTACGT", 5, 4, false},
|
||||||
|
{"k < 2", "ACGTACGT", 1, 1, true},
|
||||||
|
{"k > 32", "ACGTACGTACGTACGTACGTACGTACGTACGTACGT", 33, 16, true},
|
||||||
|
{"k == 32 (valid)", "ACGTACGTACGTACGTACGTACGTACGTACGT", 32, 16, false},
|
||||||
|
{"seq == k (valid)", "ACGTACGT", 8, 4, false},
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, tt := range tests {
|
||||||
|
t.Run(tt.name, func(t *testing.T) {
|
||||||
|
result := ExtractSuperKmers([]byte(tt.seq), tt.k, tt.m, nil)
|
||||||
|
if tt.expectNil && result != nil {
|
||||||
|
t.Errorf("expected nil, got %v", result)
|
||||||
|
}
|
||||||
|
if !tt.expectNil && result == nil {
|
||||||
|
t.Errorf("expected non-nil result, got nil")
|
||||||
|
}
|
||||||
|
})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestExtractSuperKmersBoundaries verifies Start/End positions
|
||||||
|
func TestExtractSuperKmersBoundaries(t *testing.T) {
|
||||||
|
seq := []byte("ACGTACGTGGGGAAAA")
|
||||||
|
k := 6
|
||||||
|
m := 3
|
||||||
|
|
||||||
|
result := ExtractSuperKmers(seq, k, m, nil)
|
||||||
|
|
||||||
|
if result == nil {
|
||||||
|
t.Fatal("expected non-nil result")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify each super k-mer
|
||||||
|
for i, sk := range result {
|
||||||
|
// Verify Start < End
|
||||||
|
if sk.Start >= sk.End {
|
||||||
|
t.Errorf("super k-mer %d: Start (%d) >= End (%d)", i, sk.Start, sk.End)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify Sequence matches seq[Start:End]
|
||||||
|
expected := string(seq[sk.Start:sk.End])
|
||||||
|
actual := string(sk.Sequence)
|
||||||
|
if actual != expected {
|
||||||
|
t.Errorf("super k-mer %d: Sequence mismatch: got %s, want %s", i, actual, expected)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify bounds are within sequence
|
||||||
|
if sk.Start < 0 || sk.End > len(seq) {
|
||||||
|
t.Errorf("super k-mer %d: bounds [%d:%d] outside sequence length %d",
|
||||||
|
i, sk.Start, sk.End, len(seq))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify minimum length is k
|
||||||
|
if sk.End-sk.Start < k {
|
||||||
|
t.Errorf("super k-mer %d: length %d < k=%d", i, sk.End-sk.Start, k)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify super k-mers can overlap (by up to k-1 bases) but must be ordered
|
||||||
|
// and the overlap should not exceed k-1
|
||||||
|
for i := 0; i < len(result)-1; i++ {
|
||||||
|
// Next super k-mer should start before or at the end of current one
|
||||||
|
// Overlap is allowed and expected
|
||||||
|
overlap := result[i].End - result[i+1].Start
|
||||||
|
if overlap > k-1 {
|
||||||
|
t.Errorf("super k-mers %d and %d overlap by %d bases (max allowed: %d): [%d:%d] and [%d:%d]",
|
||||||
|
i, i+1, overlap, k-1, result[i].Start, result[i].End, result[i+1].Start, result[i+1].End)
|
||||||
|
}
|
||||||
|
// But the start positions should be ordered
|
||||||
|
if result[i+1].Start < result[i].Start {
|
||||||
|
t.Errorf("super k-mers %d and %d are not ordered: [%d:%d] and [%d:%d]",
|
||||||
|
i, i+1, result[i].Start, result[i].End, result[i+1].Start, result[i+1].End)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestExtractSuperKmersBufferReuse tests buffer parameter
|
||||||
|
func TestExtractSuperKmersBufferReuse(t *testing.T) {
|
||||||
|
seq := []byte("ACGTACGTACGTACGT")
|
||||||
|
k := 6
|
||||||
|
m := 3
|
||||||
|
|
||||||
|
// First call without buffer
|
||||||
|
result1 := ExtractSuperKmers(seq, k, m, nil)
|
||||||
|
|
||||||
|
// Second call with buffer
|
||||||
|
buffer := make([]SuperKmer, 0, 100)
|
||||||
|
result2 := ExtractSuperKmers(seq, k, m, &buffer)
|
||||||
|
|
||||||
|
if len(result1) != len(result2) {
|
||||||
|
t.Errorf("buffer reuse: length mismatch %d vs %d", len(result1), len(result2))
|
||||||
|
}
|
||||||
|
|
||||||
|
for i := range result1 {
|
||||||
|
if result1[i].Minimizer != result2[i].Minimizer {
|
||||||
|
t.Errorf("position %d: minimizer mismatch", i)
|
||||||
|
}
|
||||||
|
if result1[i].Start != result2[i].Start || result1[i].End != result2[i].End {
|
||||||
|
t.Errorf("position %d: boundary mismatch", i)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Test multiple calls with same buffer
|
||||||
|
for i := 0; i < 10; i++ {
|
||||||
|
result3 := ExtractSuperKmers(seq, k, m, &buffer)
|
||||||
|
if len(result3) != len(result1) {
|
||||||
|
t.Errorf("iteration %d: length mismatch", i)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestExtractSuperKmersCanonical verifies minimizers are canonical
|
||||||
|
func TestExtractSuperKmersCanonical(t *testing.T) {
|
||||||
|
seq := []byte("ACGTACGTACGT")
|
||||||
|
k := 6
|
||||||
|
m := 3
|
||||||
|
|
||||||
|
result := ExtractSuperKmers(seq, k, m, nil)
|
||||||
|
|
||||||
|
if result == nil {
|
||||||
|
t.Fatal("expected non-nil result")
|
||||||
|
}
|
||||||
|
|
||||||
|
for i, sk := range result {
|
||||||
|
// Verify the minimizer is indeed canonical (equal to its normalized form)
|
||||||
|
normalized := NormalizeKmer(sk.Minimizer, m)
|
||||||
|
if sk.Minimizer != normalized {
|
||||||
|
t.Errorf("super k-mer %d: minimizer %d is not canonical (normalized: %d)",
|
||||||
|
i, sk.Minimizer, normalized)
|
||||||
|
}
|
||||||
|
|
||||||
|
// The minimizer should be <= its reverse complement
|
||||||
|
rc := ReverseComplement(sk.Minimizer, m)
|
||||||
|
if sk.Minimizer > rc {
|
||||||
|
t.Errorf("super k-mer %d: minimizer %d > reverse complement %d (not canonical)",
|
||||||
|
i, sk.Minimizer, rc)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestExtractSuperKmersVariousKM tests various k and m combinations
|
||||||
|
func TestExtractSuperKmersVariousKM(t *testing.T) {
|
||||||
|
seq := []byte("ACGTACGTACGTACGTACGTACGT")
|
||||||
|
|
||||||
|
configs := []struct {
|
||||||
|
k int
|
||||||
|
m int
|
||||||
|
}{
|
||||||
|
{5, 3},
|
||||||
|
{8, 4},
|
||||||
|
{10, 5},
|
||||||
|
{16, 8},
|
||||||
|
{21, 11},
|
||||||
|
{6, 5}, // m = k-1
|
||||||
|
{4, 2},
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, cfg := range configs {
|
||||||
|
t.Run("k"+string(rune('0'+cfg.k/10))+string(rune('0'+cfg.k%10))+"_m"+string(rune('0'+cfg.m/10))+string(rune('0'+cfg.m%10)), func(t *testing.T) {
|
||||||
|
if len(seq) < cfg.k {
|
||||||
|
t.Skip("sequence too short for this k")
|
||||||
|
}
|
||||||
|
|
||||||
|
result := ExtractSuperKmers(seq, cfg.k, cfg.m, nil)
|
||||||
|
|
||||||
|
if result == nil {
|
||||||
|
t.Fatal("expected non-nil result for valid parameters")
|
||||||
|
}
|
||||||
|
|
||||||
|
if len(result) == 0 {
|
||||||
|
t.Error("expected at least one super k-mer")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify each super k-mer has minimum length k
|
||||||
|
for i, sk := range result {
|
||||||
|
length := sk.End - sk.Start
|
||||||
|
if length < cfg.k {
|
||||||
|
t.Errorf("super k-mer %d has length %d < k=%d", i, length, cfg.k)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// BenchmarkExtractSuperKmers benchmarks the super k-mer extraction
|
||||||
|
func BenchmarkExtractSuperKmers(b *testing.B) {
|
||||||
|
sizes := []int{100, 1000, 10000, 100000}
|
||||||
|
configs := []struct {
|
||||||
|
k int
|
||||||
|
m int
|
||||||
|
}{
|
||||||
|
{21, 11},
|
||||||
|
{31, 15},
|
||||||
|
{16, 8},
|
||||||
|
{10, 5},
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, cfg := range configs {
|
||||||
|
for _, size := range sizes {
|
||||||
|
seq := make([]byte, size)
|
||||||
|
for i := range seq {
|
||||||
|
seq[i] = "ACGT"[i%4]
|
||||||
|
}
|
||||||
|
|
||||||
|
name := "k" + string(rune('0'+cfg.k/10)) + string(rune('0'+cfg.k%10)) +
|
||||||
|
"_m" + string(rune('0'+cfg.m/10)) + string(rune('0'+cfg.m%10)) +
|
||||||
|
"_size" + string(rune('0'+(size/10000)%10)) +
|
||||||
|
string(rune('0'+(size/1000)%10)) +
|
||||||
|
string(rune('0'+(size/100)%10)) +
|
||||||
|
string(rune('0'+(size/10)%10)) +
|
||||||
|
string(rune('0'+size%10))
|
||||||
|
|
||||||
|
b.Run(name, func(b *testing.B) {
|
||||||
|
buffer := make([]SuperKmer, 0, size/cfg.k)
|
||||||
|
b.ResetTimer()
|
||||||
|
b.SetBytes(int64(size))
|
||||||
|
|
||||||
|
for i := 0; i < b.N; i++ {
|
||||||
|
ExtractSuperKmers(seq, cfg.k, cfg.m, &buffer)
|
||||||
|
}
|
||||||
|
})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|||||||
Reference in New Issue
Block a user