mirror of
https://github.com/metabarcoding/obitools4.git
synced 2025-12-08 08:40:26 +00:00
Big change iin the data model, and a first version of obiuniq
This commit is contained in:
@@ -40,13 +40,13 @@ func main() {
|
||||
nsymbol := 0
|
||||
for fs.Next() {
|
||||
s := fs.Get()
|
||||
if s.IsNil() {
|
||||
if s==nil {
|
||||
log.Panicln("Read sequence is nil")
|
||||
}
|
||||
nread += s.Count()
|
||||
nvariant++
|
||||
nsymbol += s.Length()
|
||||
(&s).Recycle()
|
||||
s.Recycle()
|
||||
}
|
||||
|
||||
if obicount.CLIIsPrintingVariantCount() {
|
||||
|
||||
@@ -1,7 +1,9 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"log"
|
||||
"os"
|
||||
"runtime/pprof"
|
||||
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
||||
@@ -10,12 +12,12 @@ import (
|
||||
|
||||
func main() {
|
||||
|
||||
// f, err := os.Create("cpu.pprof")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// pprof.StartCPUProfile(f)
|
||||
// defer pprof.StopCPUProfile()
|
||||
f, err := os.Create("cpu.pprof")
|
||||
if err != nil {
|
||||
log.Fatal(err)
|
||||
}
|
||||
pprof.StartCPUProfile(f)
|
||||
defer pprof.StopCPUProfile()
|
||||
|
||||
// ftrace, err := os.Create("cpu.trace")
|
||||
// if err != nil {
|
||||
|
||||
@@ -6,12 +6,15 @@ import (
|
||||
"runtime/pprof"
|
||||
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiuniq"
|
||||
)
|
||||
|
||||
func main() {
|
||||
|
||||
defer obiseq.LogBioSeqStatus()
|
||||
|
||||
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
|
||||
f, err := os.Create("cpu.pprof")
|
||||
if err != nil {
|
||||
|
||||
@@ -43,7 +43,7 @@ func main() {
|
||||
|
||||
A := []byte("ccgcctccttagaacaggctcctctagaaaaccatagtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
|
||||
// B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg")
|
||||
sA := obiseq.MakeBioSequence("A", A, "")
|
||||
sA := obiseq.NewBioSequence("A", A, "")
|
||||
// sB := obiseq.MakeBioSequence("B", B, "")
|
||||
|
||||
pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)
|
||||
|
||||
Reference in New Issue
Block a user