Big change iin the data model, and a first version of obiuniq

This commit is contained in:
2022-02-21 19:00:23 +01:00
parent 9737f97084
commit 2e7c1834b0
43 changed files with 664 additions and 440 deletions
+2 -2
View File
@@ -40,13 +40,13 @@ func main() {
nsymbol := 0
for fs.Next() {
s := fs.Get()
if s.IsNil() {
if s==nil {
log.Panicln("Read sequence is nil")
}
nread += s.Count()
nvariant++
nsymbol += s.Length()
(&s).Recycle()
s.Recycle()
}
if obicount.CLIIsPrintingVariantCount() {
+8 -6
View File
@@ -1,7 +1,9 @@
package main
import (
"log"
"os"
"runtime/pprof"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
@@ -10,12 +12,12 @@ import (
func main() {
// f, err := os.Create("cpu.pprof")
// if err != nil {
// log.Fatal(err)
// }
// pprof.StartCPUProfile(f)
// defer pprof.StopCPUProfile()
f, err := os.Create("cpu.pprof")
if err != nil {
log.Fatal(err)
}
pprof.StartCPUProfile(f)
defer pprof.StopCPUProfile()
// ftrace, err := os.Create("cpu.trace")
// if err != nil {
+3
View File
@@ -6,12 +6,15 @@ import (
"runtime/pprof"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiuniq"
)
func main() {
defer obiseq.LogBioSeqStatus()
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
f, err := os.Create("cpu.pprof")
if err != nil {
+1 -1
View File
@@ -43,7 +43,7 @@ func main() {
A := []byte("ccgcctccttagaacaggctcctctagaaaaccatagtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
// B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg")
sA := obiseq.MakeBioSequence("A", A, "")
sA := obiseq.NewBioSequence("A", A, "")
// sB := obiseq.MakeBioSequence("B", B, "")
pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)