Big change iin the data model, and a first version of obiuniq

This commit is contained in:
2022-02-21 19:00:23 +01:00
parent 9737f97084
commit 2e7c1834b0
43 changed files with 664 additions and 440 deletions

View File

@@ -40,13 +40,13 @@ func main() {
nsymbol := 0 nsymbol := 0
for fs.Next() { for fs.Next() {
s := fs.Get() s := fs.Get()
if s.IsNil() { if s==nil {
log.Panicln("Read sequence is nil") log.Panicln("Read sequence is nil")
} }
nread += s.Count() nread += s.Count()
nvariant++ nvariant++
nsymbol += s.Length() nsymbol += s.Length()
(&s).Recycle() s.Recycle()
} }
if obicount.CLIIsPrintingVariantCount() { if obicount.CLIIsPrintingVariantCount() {

View File

@@ -1,7 +1,9 @@
package main package main
import ( import (
"log"
"os" "os"
"runtime/pprof"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
@@ -10,12 +12,12 @@ import (
func main() { func main() {
// f, err := os.Create("cpu.pprof") f, err := os.Create("cpu.pprof")
// if err != nil { if err != nil {
// log.Fatal(err) log.Fatal(err)
// } }
// pprof.StartCPUProfile(f) pprof.StartCPUProfile(f)
// defer pprof.StopCPUProfile() defer pprof.StopCPUProfile()
// ftrace, err := os.Create("cpu.trace") // ftrace, err := os.Create("cpu.trace")
// if err != nil { // if err != nil {

View File

@@ -6,12 +6,15 @@ import (
"runtime/pprof" "runtime/pprof"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiuniq" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiuniq"
) )
func main() { func main() {
defer obiseq.LogBioSeqStatus()
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof // go tool pprof -http=":8000" ./obipairing ./cpu.pprof
f, err := os.Create("cpu.pprof") f, err := os.Create("cpu.pprof")
if err != nil { if err != nil {

View File

@@ -43,7 +43,7 @@ func main() {
A := []byte("ccgcctccttagaacaggctcctctagaaaaccatagtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg") A := []byte("ccgcctccttagaacaggctcctctagaaaaccatagtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
// B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg") // B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg")
sA := obiseq.MakeBioSequence("A", A, "") sA := obiseq.NewBioSequence("A", A, "")
// sB := obiseq.MakeBioSequence("B", B, "") // sB := obiseq.MakeBioSequence("B", B, "")
pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3) pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)

View File

@@ -65,24 +65,24 @@ func _BuildAlignment(seqA, seqB []byte, path []int, gap byte, bufferA, bufferB *
// In that case an arena will be allocated by the function but, it will not // In that case an arena will be allocated by the function but, it will not
// be reusable for other alignments and desallocated at the BuildAlignment // be reusable for other alignments and desallocated at the BuildAlignment
// return. // return.
func BuildAlignment(seqA, seqB obiseq.BioSequence, func BuildAlignment(seqA, seqB *obiseq.BioSequence,
path []int, gap byte) (obiseq.BioSequence, obiseq.BioSequence) { path []int, gap byte) (*obiseq.BioSequence, *obiseq.BioSequence) {
bufferSA := obiseq.GetSlice() bufferSA := obiseq.GetSlice()
defer obiseq.RecycleSlice(bufferSA) defer obiseq.RecycleSlice(&bufferSA)
bufferSB := obiseq.GetSlice() bufferSB := obiseq.GetSlice()
defer obiseq.RecycleSlice(bufferSB) defer obiseq.RecycleSlice(&bufferSB)
_BuildAlignment(seqA.Sequence(), seqB.Sequence(), path, gap, _BuildAlignment(seqA.Sequence(), seqB.Sequence(), path, gap,
&bufferSA, &bufferSA,
&bufferSB) &bufferSB)
seqA = obiseq.MakeBioSequence(seqA.Id(), seqA = obiseq.NewBioSequence(seqA.Id(),
bufferSA, bufferSA,
seqA.Definition()) seqA.Definition())
seqB = obiseq.MakeBioSequence(seqB.Id(), seqB = obiseq.NewBioSequence(seqB.Id(),
bufferSB, bufferSB,
seqB.Definition()) seqB.Definition())
@@ -110,15 +110,15 @@ func BuildAlignment(seqA, seqB obiseq.BioSequence,
// In that case arenas will be allocated by the function but, they will not // In that case arenas will be allocated by the function but, they will not
// be reusable for other alignments and desallocated at the BuildQualityConsensus // be reusable for other alignments and desallocated at the BuildQualityConsensus
// return. // return.
func BuildQualityConsensus(seqA, seqB obiseq.BioSequence, path []int) (obiseq.BioSequence, int) { func BuildQualityConsensus(seqA, seqB *obiseq.BioSequence, path []int) (*obiseq.BioSequence, int) {
bufferSA := obiseq.GetSlice() bufferSA := obiseq.GetSlice()
bufferSB := obiseq.GetSlice() bufferSB := obiseq.GetSlice()
defer obiseq.RecycleSlice(bufferSB) defer obiseq.RecycleSlice(&bufferSB)
bufferQA := obiseq.GetSlice() bufferQA := obiseq.GetSlice()
bufferQB := obiseq.GetSlice() bufferQB := obiseq.GetSlice()
defer obiseq.RecycleSlice(bufferQB) defer obiseq.RecycleSlice(&bufferQB)
_BuildAlignment(seqA.Sequence(), seqB.Sequence(), path, ' ', _BuildAlignment(seqA.Sequence(), seqB.Sequence(), path, ' ',
&bufferSA, &bufferSB) &bufferSA, &bufferSB)
@@ -178,7 +178,7 @@ func BuildQualityConsensus(seqA, seqB obiseq.BioSequence, path []int) (obiseq.Bi
bufferQA[i] = q bufferQA[i] = q
} }
consSeq := obiseq.MakeBioSequence( consSeq := obiseq.NewBioSequence(
seqA.Id(), seqA.Id(),
bufferSA, bufferSA,
seqA.Definition(), seqA.Definition(),

View File

@@ -57,7 +57,7 @@ var _FourBitsBaseDecode = []byte{
// by the ambiguity set to 1. // by the ambiguity set to 1.
// A byte slice can be provided (buffer) to preveent allocation of a new // A byte slice can be provided (buffer) to preveent allocation of a new
// memory chunk by th function. // memory chunk by th function.
func Encode4bits(seq obiseq.BioSequence, buffer []byte) []byte { func Encode4bits(seq *obiseq.BioSequence, buffer []byte) []byte {
length := seq.Length() length := seq.Length()
rawseq := seq.Sequence() rawseq := seq.Sequence()

View File

@@ -220,7 +220,7 @@ func _FillMatrixPeRightAlign(seqA, qualA, seqB, qualB []byte, gap float64,
return _GetMatrix(scoreMatrix, la, la-1, lb1) return _GetMatrix(scoreMatrix, la, la-1, lb1)
} }
func PELeftAlign(seqA, seqB obiseq.BioSequence, gap float64, func PELeftAlign(seqA, seqB *obiseq.BioSequence, gap float64,
arena PEAlignArena) (int, []int) { arena PEAlignArena) (int, []int) {
if !_InitializedDnaScore { if !_InitializedDnaScore {
@@ -244,7 +244,7 @@ func PELeftAlign(seqA, seqB obiseq.BioSequence, gap float64,
return score, arena.pointer.path return score, arena.pointer.path
} }
func PERightAlign(seqA, seqB obiseq.BioSequence, gap float64, func PERightAlign(seqA, seqB *obiseq.BioSequence, gap float64,
arena PEAlignArena) (int, []int) { arena PEAlignArena) (int, []int) {
if !_InitializedDnaScore { if !_InitializedDnaScore {
@@ -268,7 +268,7 @@ func PERightAlign(seqA, seqB obiseq.BioSequence, gap float64,
return score, arena.pointer.path return score, arena.pointer.path
} }
func PEAlign(seqA, seqB obiseq.BioSequence, func PEAlign(seqA, seqB *obiseq.BioSequence,
gap float64, delta int, gap float64, delta int,
arena PEAlignArena) (int, []int) { arena PEAlignArena) (int, []int) {
var score, shift int var score, shift int

View File

@@ -151,7 +151,7 @@ func (pattern ApatPattern) Print() {
// at the junction. To limit memory allocation, it is possible to provide // at the junction. To limit memory allocation, it is possible to provide
// an already allocated ApatSequence to recycle its allocated memory. // an already allocated ApatSequence to recycle its allocated memory.
// The provided sequence is no more usable after the call. // The provided sequence is no more usable after the call.
func MakeApatSequence(sequence obiseq.BioSequence, circular bool, recycle ...ApatSequence) (ApatSequence, error) { func MakeApatSequence(sequence *obiseq.BioSequence, circular bool, recycle ...ApatSequence) (ApatSequence, error) {
var errno C.int32_t var errno C.int32_t
var errmsg *C.char var errmsg *C.char
seqlen := sequence.Length() seqlen := sequence.Length()

View File

@@ -218,7 +218,7 @@ func OptionBatchSize(size int) WithOption {
} }
func _Pcr(seq ApatSequence, func _Pcr(seq ApatSequence,
sequence obiseq.BioSequence, sequence *obiseq.BioSequence,
opt Options) obiseq.BioSequenceSlice { opt Options) obiseq.BioSequenceSlice {
results := make(obiseq.BioSequenceSlice, 0, 10) results := make(obiseq.BioSequenceSlice, 0, 10)
@@ -278,7 +278,7 @@ func _Pcr(seq ApatSequence,
match, _ := sequence.Subsequence(fm[0], fm[1], opt.pointer.circular) match, _ := sequence.Subsequence(fm[0], fm[1], opt.pointer.circular)
annot["forward_match"] = match.String() annot["forward_match"] = match.String()
(&match).Recycle() match.Recycle()
annot["forward_error"] = erri annot["forward_error"] = erri
@@ -286,7 +286,7 @@ func _Pcr(seq ApatSequence,
match, _ = sequence.Subsequence(rm[0], rm[1], opt.pointer.circular) match, _ = sequence.Subsequence(rm[0], rm[1], opt.pointer.circular)
match = match.ReverseComplement(true) match = match.ReverseComplement(true)
annot["reverse_match"] = match.String() annot["reverse_match"] = match.String()
(&match).Recycle() match.Recycle()
annot["reverse_error"] = errj annot["reverse_error"] = errj
results = append(results, amplicon) results = append(results, amplicon)
@@ -351,14 +351,14 @@ func _Pcr(seq ApatSequence,
match, _ := sequence.Subsequence(rm[0], rm[1], opt.pointer.circular) match, _ := sequence.Subsequence(rm[0], rm[1], opt.pointer.circular)
match.ReverseComplement(true) match.ReverseComplement(true)
annot["forward_match"] = match.String() annot["forward_match"] = match.String()
(&match).Recycle() match.Recycle()
annot["forward_error"] = errj annot["forward_error"] = errj
annot["reverse_primer"] = reverse.String() annot["reverse_primer"] = reverse.String()
match, _ = sequence.Subsequence(fm[0], fm[1], opt.pointer.circular) match, _ = sequence.Subsequence(fm[0], fm[1], opt.pointer.circular)
annot["reverse_match"] = match.String() annot["reverse_match"] = match.String()
(&match).Recycle() match.Recycle()
annot["reverse_error"] = erri annot["reverse_error"] = erri
results = append(results, amplicon) results = append(results, amplicon)
@@ -376,7 +376,7 @@ func _Pcr(seq ApatSequence,
// obiseq.BioSequence instance. PCR parameters are // obiseq.BioSequence instance. PCR parameters are
// specified using the corresponding Option functions // specified using the corresponding Option functions
// defined for the PCR algorithm. // defined for the PCR algorithm.
func PCRSim(sequence obiseq.BioSequence, options ...WithOption) obiseq.BioSequenceSlice { func PCRSim(sequence *obiseq.BioSequence, options ...WithOption) obiseq.BioSequenceSlice {
opt := MakeOptions(options) opt := MakeOptions(options)

View File

@@ -58,7 +58,7 @@ func ISequenceChunkOnDisk(iterator obiseq.IBioSequenceBatch,
}() }()
newIter.Wait() newIter.Wait()
close(newIter.Channel()) newIter.Close()
}() }()
obiformats.WriterDispatcher(dir+"/chunk_%s.fastx", obiformats.WriterDispatcher(dir+"/chunk_%s.fastx",
@@ -78,14 +78,15 @@ func ISequenceChunkOnDisk(iterator obiseq.IBioSequenceBatch,
panic(err) panic(err)
} }
chunck := make(obiseq.BioSequenceSlice, 0, 10000) //chunck := make(obiseq.BioSequenceSlice, 0, 10000)
chunck := obiseq.MakeBioSequenceSlice()
for iseq.Next() { for iseq.Next() {
b := iseq.Get() b := iseq.Get()
chunck = append(chunck, b.Slice()...) chunck = append(chunck, b.Slice()...)
b.Recycle()
} }
newIter.Channel() <- obiseq.MakeBioSequenceBatch(order, chunck...) newIter.Push(obiseq.MakeBioSequenceBatch(order, chunck))
} }

View File

@@ -23,7 +23,7 @@ func ISequenceChunk(iterator obiseq.IBioSequenceBatch,
go func() { go func() {
newIter.Wait() newIter.Wait()
close(newIter.Channel()) newIter.Close()
}() }()
go func() { go func() {
@@ -43,7 +43,7 @@ func ISequenceChunk(iterator obiseq.IBioSequenceBatch,
log.Fatalf("Cannot retreive the new chanel : %v", err) log.Fatalf("Cannot retreive the new chanel : %v", err)
} }
chunk := obiseq.GetBioSequenceSlicePtr() chunk := obiseq.NewBioSequenceSlice()
lock.Lock() lock.Lock()
chunks[newflux] = chunk chunks[newflux] = chunk
lock.Unlock() lock.Unlock()
@@ -64,7 +64,7 @@ func ISequenceChunk(iterator obiseq.IBioSequenceBatch,
for _, chunck := range chunks { for _, chunck := range chunks {
if len(*chunck) > 0 { if len(*chunck) > 0 {
newIter.Channel() <- obiseq.MakeBioSequenceBatch(order, *chunck...) newIter.Push(obiseq.MakeBioSequenceBatch(order, *chunck))
order++ order++
} }

View File

@@ -1,11 +1,59 @@
package obichunk package obichunk
import ( import (
"sync" "log"
"sort"
"sync/atomic"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
) )
//
// Interface for sorting a list of sequences accoording to
// their classes
//
type sSS struct {
code int
seq *obiseq.BioSequence
}
// By is the type of a "less" function that defines the ordering of its Planet arguments.
type _By func(p1, p2 *sSS) bool
type sSSSorter struct {
seqs []sSS
by _By // Closure used in the Less method.
}
// Len is part of sort.Interface.
func (s *sSSSorter) Len() int {
return len(s.seqs)
}
// Swap is part of sort.Interface.
func (s *sSSSorter) Swap(i, j int) {
s.seqs[i], s.seqs[j] = s.seqs[j], s.seqs[i]
}
// Less is part of sort.Interface. It is implemented by calling the "by" closure in the sorter.
func (s *sSSSorter) Less(i, j int) bool {
return s.by(&s.seqs[i], &s.seqs[j])
}
// Sort is a method on the function type, By, that sorts the argument slice according to the function.
func (by _By) Sort(seqs []sSS) {
ps := &sSSSorter{
seqs: seqs,
by: by, // The Sort method's receiver is the function (closure) that defines the sort order.
}
sort.Sort(ps)
}
//
// End of the sort interface
//
func ISequenceSubChunk(iterator obiseq.IBioSequenceBatch, func ISequenceSubChunk(iterator obiseq.IBioSequenceBatch,
classifier *obiseq.BioSequenceClassifier, classifier *obiseq.BioSequenceClassifier,
sizes ...int) (obiseq.IBioSequenceBatch, error) { sizes ...int) (obiseq.IBioSequenceBatch, error) {
@@ -27,55 +75,76 @@ func ISequenceSubChunk(iterator obiseq.IBioSequenceBatch,
go func() { go func() {
newIter.Wait() newIter.Wait()
close(newIter.Channel()) newIter.Close()
}() }()
omutex := sync.Mutex{} //omutex := sync.Mutex{}
order := 0 order := int32(0)
nextOrder := func() int { nextOrder := func() int {
omutex.Lock() neworder := int(atomic.AddInt32(&order, 1))
neworder := order
order++
omutex.Unlock()
return neworder return neworder
} }
ff := func(iterator obiseq.IBioSequenceBatch) { ff := func(iterator obiseq.IBioSequenceBatch,
chunks := make(map[int]*obiseq.BioSequenceSlice, 100) classifier *obiseq.BioSequenceClassifier) {
ordered := make([]sSS, 100)
for iterator.Next() { for iterator.Next() {
batch := iterator.Get() batch := iterator.Get()
for _, s := range batch.Slice() { if batch.Length() > 1 {
key := classifier.Code(s) classifier.Reset()
slice, ok := chunks[key] if cap(ordered) < batch.Length() {
log.Println("Allocate a new ordered sequences : ", batch.Length())
if !ok { ordered = make([]sSS, batch.Length())
slice = obiseq.GetBioSequenceSlicePtr() } else {
chunks[key] = slice ordered = ordered[:batch.Length()]
} }
*slice = append(*slice, s) for i, s := range batch.Slice() {
} ordered[i].code = classifier.Code(s)
ordered[i].seq = s
for k, chunck := range chunks { batch.Slice()[i] = nil
newIter.Channel() <- obiseq.MakeBioSequenceBatch(nextOrder(), *chunck...)
delete(chunks, k)
} }
batch.Recycle() batch.Recycle()
_By(func(p1, p2 *sSS) bool {
return p1.code < p2.code
}).Sort(ordered)
last := ordered[0].code
ss := obiseq.MakeBioSequenceSlice()
for i, v := range ordered {
if v.code != last {
newIter.Push(obiseq.MakeBioSequenceBatch(nextOrder(), ss))
ss = obiseq.MakeBioSequenceSlice()
last = v.code
}
ss = append(ss, v.seq)
ordered[i].seq = nil
}
if len(ss) > 0 {
newIter.Push(obiseq.MakeBioSequenceBatch(nextOrder(), ss))
}
} else {
newIter.Push(batch.Reorder(nextOrder()))
}
} }
newIter.Done() newIter.Done()
} }
for i := 0; i < nworkers-1; i++ { for i := 0; i < nworkers-1; i++ {
go ff(iterator.Split()) go ff(iterator.Split(), classifier.Clone())
} }
go ff(iterator) go ff(iterator, classifier)
return newIter, nil return newIter, nil
} }

View File

@@ -11,10 +11,12 @@ func IUniqueSequence(iterator obiseq.IBioSequenceBatch,
var err error var err error
opts := MakeOptions(options) opts := MakeOptions(options)
nworkers := opts.ParallelWorkers()
iUnique := obiseq.MakeIBioSequenceBatch(opts.BufferSize()) iUnique := obiseq.MakeIBioSequenceBatch(opts.BufferSize())
if opts.SortOnDisk() { if opts.SortOnDisk() {
nworkers = 1
iterator, err = ISequenceChunkOnDisk(iterator, iterator, err = ISequenceChunkOnDisk(iterator,
obiseq.HashClassifier(opts.BatchCount()), obiseq.HashClassifier(opts.BatchCount()),
opts.BufferSize()) opts.BufferSize())
@@ -33,13 +35,11 @@ func IUniqueSequence(iterator obiseq.IBioSequenceBatch,
} }
} }
nworkers := opts.ParallelWorkers()
iUnique.Add(nworkers) iUnique.Add(nworkers)
go func() { go func() {
iUnique.Wait() iUnique.Wait()
close(iUnique.Channel()) iUnique.Close()
}() }()
omutex := sync.Mutex{} omutex := sync.Mutex{}
@@ -58,14 +58,6 @@ func IUniqueSequence(iterator obiseq.IBioSequenceBatch,
cat := opts.Categories() cat := opts.Categories()
na := opts.NAValue() na := opts.NAValue()
// ff = func(input obiseq.IBioSequenceBatch,
// classifier obiseq.BioSequenceClassifier,
// icat int) {
// log.Println(na, nextOrder)
// input.Recycle()
// iUnique.Done()
// }
ff = func(input obiseq.IBioSequenceBatch, ff = func(input obiseq.IBioSequenceBatch,
classifier *obiseq.BioSequenceClassifier, classifier *obiseq.BioSequenceClassifier,
icat int) { icat int) {
@@ -88,16 +80,17 @@ func IUniqueSequence(iterator obiseq.IBioSequenceBatch,
o := 0 o := 0
for input.Next() { for input.Next() {
batch := input.Get() batch := input.Get()
if icat < 0 || len(batch.Slice()) == 1 { if icat < 0 || len(batch.Slice()) == 1 {
iUnique.Channel() <- batch.Reorder(nextOrder()) iUnique.Push(batch.Reorder(nextOrder()))
} else { } else {
next.Channel() <- batch.Reorder(o) next.Push(batch.Reorder(o))
o++ o++
} }
} }
if icat >= 0 { if icat >= 0 {
close(next.Channel()) next.Close()
} }
iUnique.Done() iUnique.Done()
@@ -112,12 +105,10 @@ func IUniqueSequence(iterator obiseq.IBioSequenceBatch,
obiseq.SequenceClassifier(), obiseq.SequenceClassifier(),
len(cat)) len(cat))
iMerged := iUnique.MakeISliceWorker( iMerged := iUnique.IMergeSequenceBatch(opts.NAValue(),
obiseq.MergeSliceWorker( opts.StatsOn(),
opts.NAValue(),
opts.StatsOn()...),
opts.BufferSize(), opts.BufferSize(),
) )
return iMerged.Rebatch(opts.BatchSize()), nil return iMerged.Speed(), nil
} }

View File

@@ -31,11 +31,12 @@ func WriterDispatcher(prototypename string,
} }
out, err := formater(data, out, err := formater(data,
fmt.Sprintf(prototypename, newflux), fmt.Sprintf(prototypename, dispatcher.Classifier().Value(newflux)),
options...) options...)
if err != nil { if err != nil {
log.Fatalf("cannot open the output file for key %d", newflux) log.Fatalf("cannot open the output file for key %s",
dispatcher.Classifier().Value(newflux))
} }
out.Recycle() out.Recycle()

View File

@@ -35,12 +35,12 @@ func __readline__(stream io.Reader) string {
return string(line[0:i]) return string(line[0:i])
} }
func __read_ecopcr_bioseq__(file *__ecopcr_file__) (obiseq.BioSequence, error) { func __read_ecopcr_bioseq__(file *__ecopcr_file__) (*obiseq.BioSequence, error) {
record, err := file.csv.Read() record, err := file.csv.Read()
if err != nil { if err != nil {
return obiseq.NilBioSequence, err return nil, err
} }
name := strings.TrimSpace(record[0]) name := strings.TrimSpace(record[0])
@@ -65,7 +65,7 @@ func __read_ecopcr_bioseq__(file *__ecopcr_file__) (obiseq.BioSequence, error) {
comment = strings.TrimSpace(record[19]) comment = strings.TrimSpace(record[19])
} }
bseq := obiseq.MakeBioSequence(name, sequence, comment) bseq := obiseq.NewBioSequence(name, sequence, comment)
annotation := bseq.Annotations() annotation := bseq.Annotations()
annotation["ac"] = name annotation["ac"] = name
@@ -168,7 +168,7 @@ func ReadEcoPCRBatch(reader io.Reader, options ...WithOption) obiseq.IBioSequenc
go func() { go func() {
newIter.Wait() newIter.Wait()
close(newIter.Channel()) newIter.Close()
}() }()
go func() { go func() {
@@ -181,9 +181,8 @@ func ReadEcoPCRBatch(reader io.Reader, options ...WithOption) obiseq.IBioSequenc
slice = append(slice, seq) slice = append(slice, seq)
ii++ ii++
if ii >= opt.BatchSize() { if ii >= opt.BatchSize() {
newIter.Channel() <- obiseq.MakeBioSequenceBatch(i, slice...) newIter.Push(obiseq.MakeBioSequenceBatch(i, slice))
slice = make(obiseq.BioSequenceSlice, 0, opt.BatchSize()) slice = obiseq.MakeBioSequenceSlice()
i++ i++
ii = 0 ii = 0
} }
@@ -192,7 +191,7 @@ func ReadEcoPCRBatch(reader io.Reader, options ...WithOption) obiseq.IBioSequenc
} }
if len(slice) > 0 { if len(slice) > 0 {
newIter.Channel() <- obiseq.MakeBioSequenceBatch(i, slice...) newIter.Push(obiseq.MakeBioSequenceBatch(i, slice))
} }
newIter.Done() newIter.Done()

View File

@@ -9,7 +9,6 @@ import (
"os" "os"
"strconv" "strconv"
"strings" "strings"
"time"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
) )
@@ -124,7 +123,7 @@ func _ParseEmblFile(input <-chan _FileChunk, out obiseq.IBioSequenceBatch) {
seqBytes.WriteString(parts[i]) seqBytes.WriteString(parts[i])
} }
case line == "//": case line == "//":
sequence := obiseq.MakeBioSequence(id, sequence := obiseq.NewBioSequence(id,
seqBytes.Bytes(), seqBytes.Bytes(),
defBytes.String()) defBytes.String())
@@ -140,8 +139,7 @@ func _ParseEmblFile(input <-chan _FileChunk, out obiseq.IBioSequenceBatch) {
seqBytes = new(bytes.Buffer) seqBytes = new(bytes.Buffer)
} }
} }
out.Channel() <- obiseq.MakeBioSequenceBatch(order, sequences...) out.Push(obiseq.MakeBioSequenceBatch(order, sequences))
} }
out.Done() out.Done()
@@ -188,11 +186,7 @@ func ReadEMBLBatch(reader io.Reader, options ...WithOption) obiseq.IBioSequenceB
newIter.Add(nworkers) newIter.Add(nworkers)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
for len(newIter.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
close(newIter.Channel())
}() }()
// for j := 0; j < opt.ParallelWorkers(); j++ { // for j := 0; j < opt.ParallelWorkers(); j++ {

View File

@@ -6,7 +6,7 @@ import (
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
) )
func ParseGuessedFastSeqHeader(sequence obiseq.BioSequence) { func ParseGuessedFastSeqHeader(sequence *obiseq.BioSequence) {
if strings.HasPrefix(sequence.Definition(), "{") { if strings.HasPrefix(sequence.Definition(), "{") {
ParseFastSeqJsonHeader(sequence) ParseFastSeqJsonHeader(sequence)
} else { } else {

View File

@@ -2,4 +2,4 @@ package obiformats
import "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" import "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
type FormatHeader func(sequence obiseq.BioSequence) string type FormatHeader func(sequence *obiseq.BioSequence) string

View File

@@ -49,12 +49,12 @@ func _parse_json_header_(header string, annotations obiseq.Annotation) string {
return strings.TrimSpace(header[stop:]) return strings.TrimSpace(header[stop:])
} }
func ParseFastSeqJsonHeader(sequence obiseq.BioSequence) { func ParseFastSeqJsonHeader(sequence *obiseq.BioSequence) {
sequence.SetDefinition(_parse_json_header_(sequence.Definition(), sequence.SetDefinition(_parse_json_header_(sequence.Definition(),
sequence.Annotations())) sequence.Annotations()))
} }
func FormatFastSeqJsonHeader(sequence obiseq.BioSequence) string { func FormatFastSeqJsonHeader(sequence *obiseq.BioSequence) string {
annotations := sequence.Annotations() annotations := sequence.Annotations()
if annotations != nil { if annotations != nil {

View File

@@ -261,7 +261,7 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
return string(bytes.TrimSpace(d)) return string(bytes.TrimSpace(d))
} }
func ParseFastSeqOBIHeader(sequence obiseq.BioSequence) { func ParseFastSeqOBIHeader(sequence *obiseq.BioSequence) {
annotations := sequence.Annotations() annotations := sequence.Annotations()
definition := ParseOBIFeatures(sequence.Definition(), definition := ParseOBIFeatures(sequence.Definition(),
@@ -270,7 +270,7 @@ func ParseFastSeqOBIHeader(sequence obiseq.BioSequence) {
sequence.SetDefinition(definition) sequence.SetDefinition(definition)
} }
func FormatFastSeqOBIHeader(sequence obiseq.BioSequence) string { func FormatFastSeqOBIHeader(sequence *obiseq.BioSequence) string {
annotations := sequence.Annotations() annotations := sequence.Annotations()
if annotations != nil { if annotations != nil {

View File

@@ -10,7 +10,6 @@ import (
"fmt" "fmt"
"log" "log"
"os" "os"
"time"
"unsafe" "unsafe"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/cutils" "git.metabarcoding.org/lecasofts/go/obitools/pkg/cutils"
@@ -24,7 +23,7 @@ func _FastseqReader(seqfile C.fast_kseq_p,
i := 0 i := 0
ii := 0 ii := 0
slice := obiseq.GetBioSequenceSlice() slice := obiseq.MakeBioSequenceSlice()
for l := int64(C.next_fast_sek(seqfile)); l > 0; l = int64(C.next_fast_sek(seqfile)) { for l := int64(C.next_fast_sek(seqfile)); l > 0; l = int64(C.next_fast_sek(seqfile)) {
@@ -45,7 +44,7 @@ func _FastseqReader(seqfile C.fast_kseq_p,
comment = "" comment = ""
} }
rep := obiseq.MakeBioSequence(name, sequence, comment) rep := obiseq.NewBioSequence(name, sequence, comment)
if s.qual.l > C.ulong(0) { if s.qual.l > C.ulong(0) {
cquality := cutils.ByteSlice(unsafe.Pointer(s.qual.s), int(s.qual.l)) cquality := cutils.ByteSlice(unsafe.Pointer(s.qual.s), int(s.qual.l))
@@ -64,17 +63,17 @@ func _FastseqReader(seqfile C.fast_kseq_p,
// log.Printf("\n==> Pushing sequence batch\n") // log.Printf("\n==> Pushing sequence batch\n")
// start := time.Now() // start := time.Now()
iterator.Channel() <- obiseq.MakeBioSequenceBatch(i, slice...) iterator.Push(obiseq.MakeBioSequenceBatch(i, slice))
// elapsed := time.Since(start) // elapsed := time.Since(start)
// log.Printf("\n==>sequences pushed after %s\n", elapsed) // log.Printf("\n==>sequences pushed after %s\n", elapsed)
slice = make(obiseq.BioSequenceSlice, 0, batch_size) slice = obiseq.MakeBioSequenceSlice()
i++ i++
ii = 0 ii = 0
} }
} }
if len(slice) > 0 { if len(slice) > 0 {
iterator.Channel() <- obiseq.MakeBioSequenceBatch(i, slice...) iterator.Push(obiseq.MakeBioSequenceBatch(i, slice))
} }
iterator.Done() iterator.Done()
@@ -109,12 +108,7 @@ func ReadFastSeqBatchFromFile(filename string, options ...WithOption) (obiseq.IB
newIter.Add(1) newIter.Add(1)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
for len(newIter.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
close(newIter.Channel())
log.Println("End of the fastq file reading") log.Println("End of the fastq file reading")
}() }()
@@ -142,8 +136,7 @@ func ReadFastSeqBatchFromStdin(options ...WithOption) obiseq.IBioSequenceBatch {
newIter.Add(1) newIter.Add(1)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
close(newIter.Channel())
}() }()
go _FastseqReader(C.open_fast_sek_stdin(C.int32_t(opt.QualityShift())), newIter, opt.BatchSize()) go _FastseqReader(C.open_fast_sek_stdin(C.int32_t(opt.QualityShift())), newIter, opt.BatchSize())

View File

@@ -7,7 +7,6 @@ import (
"log" "log"
"os" "os"
"strings" "strings"
"time"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
) )
@@ -19,9 +18,13 @@ func min(x, y int) int {
return y return y
} }
func FormatFasta(seq obiseq.BioSequence, formater FormatHeader) string { func FormatFasta(seq *obiseq.BioSequence, formater FormatHeader) string {
var fragments strings.Builder var fragments strings.Builder
if seq==nil {
log.Panicln("try to format a nil BioSequence")
}
s := seq.Sequence() s := seq.Sequence()
l := len(s) l := len(s)
@@ -106,16 +109,8 @@ func WriteFastaBatch(iterator obiseq.IBioSequenceBatch, file io.Writer, options
newIter.Add(nwriters) newIter.Add(nwriters)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
for len(chunkchan) > 0 {
time.Sleep(time.Millisecond)
}
close(chunkchan) close(chunkchan)
for len(newIter.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
close(newIter.Channel())
}() }()
ff := func(iterator obiseq.IBioSequenceBatch) { ff := func(iterator obiseq.IBioSequenceBatch) {
@@ -125,7 +120,7 @@ func WriteFastaBatch(iterator obiseq.IBioSequenceBatch, file io.Writer, options
FormatFastaBatch(batch, header_format), FormatFastaBatch(batch, header_format),
batch.Order(), batch.Order(),
} }
newIter.Channel() <- batch newIter.Push(batch)
} }
newIter.Done() newIter.Done()
} }

View File

@@ -11,7 +11,7 @@ import (
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
) )
func FormatFastq(seq obiseq.BioSequence, quality_shift int, formater FormatHeader) string { func FormatFastq(seq *obiseq.BioSequence, quality_shift int, formater FormatHeader) string {
l := seq.Length() l := seq.Length()
q := seq.Qualities() q := seq.Qualities()
@@ -106,15 +106,11 @@ func WriteFastqBatch(iterator obiseq.IBioSequenceBatch, file io.Writer, options
newIter.Add(nwriters) newIter.Add(nwriters)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
for len(chunkchan) > 0 { for len(chunkchan) > 0 {
time.Sleep(time.Millisecond) time.Sleep(time.Millisecond)
} }
close(chunkchan) close(chunkchan)
for len(newIter.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
close(newIter.Channel())
}() }()
ff := func(iterator obiseq.IBioSequenceBatch) { ff := func(iterator obiseq.IBioSequenceBatch) {
@@ -125,7 +121,7 @@ func WriteFastqBatch(iterator obiseq.IBioSequenceBatch, file io.Writer, options
batch.Order(), batch.Order(),
} }
chunkchan <- chunk chunkchan <- chunk
newIter.Channel() <- batch newIter.Push(batch)
} }
newIter.Done() newIter.Done()
} }

View File

@@ -6,7 +6,7 @@ import (
type __options__ struct { type __options__ struct {
fastseq_header_parser obiseq.SeqAnnotator fastseq_header_parser obiseq.SeqAnnotator
fastseq_header_writer func(obiseq.BioSequence) string fastseq_header_writer func(*obiseq.BioSequence) string
with_progress_bar bool with_progress_bar bool
buffer_size int buffer_size int
batch_size int batch_size int
@@ -62,7 +62,7 @@ func (opt Options) ParseFastSeqHeader() obiseq.SeqAnnotator {
return opt.pointer.fastseq_header_parser return opt.pointer.fastseq_header_parser
} }
func (opt Options) FormatFastSeqHeader() func(obiseq.BioSequence) string { func (opt Options) FormatFastSeqHeader() func(*obiseq.BioSequence) string {
return opt.pointer.fastseq_header_writer return opt.pointer.fastseq_header_writer
} }
@@ -141,7 +141,7 @@ func OptionsFastSeqDefaultHeaderParser() WithOption {
// OptionsFastSeqHeaderFormat allows foor specifying the format // OptionsFastSeqHeaderFormat allows foor specifying the format
// used to write FASTA and FASTQ sequence. // used to write FASTA and FASTQ sequence.
func OptionsFastSeqHeaderFormat(format func(obiseq.BioSequence) string) WithOption { func OptionsFastSeqHeaderFormat(format func(*obiseq.BioSequence) string) WithOption {
f := WithOption(func(opt Options) { f := WithOption(func(opt Options) {
opt.pointer.fastseq_header_writer = format opt.pointer.fastseq_header_writer = format
}) })

View File

@@ -66,7 +66,7 @@ func ReadSequencesBatchFromFile(filename string, options ...WithOption) (obiseq.
if len(tag) < 30 { if len(tag) < 30 {
newIter := obiseq.MakeIBioSequenceBatch() newIter := obiseq.MakeIBioSequenceBatch()
close(newIter.Channel()) newIter.Close()
return newIter, nil return newIter, nil
} }

View File

@@ -30,7 +30,7 @@ var __single_base_code__ = []byte{0,
// in hexadecimal and 27 in decimal. If the buffer parameter is not nil // in hexadecimal and 27 in decimal. If the buffer parameter is not nil
// the slice is used to store the result, overwise a new slice is // the slice is used to store the result, overwise a new slice is
// created. // created.
func Encode4mer(seq obiseq.BioSequence, buffer *[]byte) []byte { func Encode4mer(seq *obiseq.BioSequence, buffer *[]byte) []byte {
slength := seq.Length() slength := seq.Length()
length := slength - 3 length := slength - 3
rawseq := seq.Sequence() rawseq := seq.Sequence()
@@ -65,7 +65,7 @@ func Encode4mer(seq obiseq.BioSequence, buffer *[]byte) []byte {
return *buffer return *buffer
} }
func Index4mer(seq obiseq.BioSequence, index *[][]int, buffer *[]byte) [][]int { func Index4mer(seq *obiseq.BioSequence, index *[][]int, buffer *[]byte) [][]int {
iternal_buffer := Encode4mer(seq, buffer) iternal_buffer := Encode4mer(seq, buffer)
@@ -85,7 +85,7 @@ func Index4mer(seq obiseq.BioSequence, index *[][]int, buffer *[]byte) [][]int {
return *index return *index
} }
func FastShiftFourMer(index [][]int, seq obiseq.BioSequence, buffer *[]byte) (int, int) { func FastShiftFourMer(index [][]int, seq *obiseq.BioSequence, buffer *[]byte) (int, int) {
iternal_buffer := Encode4mer(seq, buffer) iternal_buffer := Encode4mer(seq, buffer)

View File

@@ -38,7 +38,7 @@ func (library *NGSLibrary) Compile(maxError int) error {
return nil return nil
} }
func (library *NGSLibrary) Match(sequence obiseq.BioSequence) *DemultiplexMatch { func (library *NGSLibrary) Match(sequence *obiseq.BioSequence) *DemultiplexMatch {
for primers, marker := range *library { for primers, marker := range *library {
m := marker.Match(sequence) m := marker.Match(sequence)
if m != nil { if m != nil {
@@ -50,7 +50,7 @@ func (library *NGSLibrary) Match(sequence obiseq.BioSequence) *DemultiplexMatch
return nil return nil
} }
func (library *NGSLibrary) ExtractBarcode(sequence obiseq.BioSequence, inplace bool) (obiseq.BioSequence, error) { func (library *NGSLibrary) ExtractBarcode(sequence *obiseq.BioSequence, inplace bool) (*obiseq.BioSequence, error) {
match := library.Match(sequence) match := library.Match(sequence)
return match.ExtractBarcode(sequence, inplace) return match.ExtractBarcode(sequence, inplace)
} }
@@ -103,7 +103,7 @@ func (marker *Marker) Compile(forward, reverse string, maxError int) error {
return nil return nil
} }
func (marker *Marker) Match(sequence obiseq.BioSequence) *DemultiplexMatch { func (marker *Marker) Match(sequence *obiseq.BioSequence) *DemultiplexMatch {
aseq, _ := obiapat.MakeApatSequence(sequence, false) aseq, _ := obiapat.MakeApatSequence(sequence, false)
match := marker.forward.FindAllIndex(aseq, marker.taglength) match := marker.forward.FindAllIndex(aseq, marker.taglength)
@@ -134,7 +134,7 @@ func (marker *Marker) Match(sequence obiseq.BioSequence) *DemultiplexMatch {
srtag := "" srtag := ""
if err != nil { if err != nil {
rtag = obiseq.NilBioSequence rtag = nil
} else { } else {
rtag.ReverseComplement(true) rtag.ReverseComplement(true)
srtag = strings.ToLower(rtag.String()) srtag = strings.ToLower(rtag.String())
@@ -189,7 +189,7 @@ func (marker *Marker) Match(sequence obiseq.BioSequence) *DemultiplexMatch {
defer ftag.Recycle() defer ftag.Recycle()
sftag := "" sftag := ""
if err != nil { if err != nil {
ftag = obiseq.NilBioSequence ftag = nil
} else { } else {
ftag = ftag.ReverseComplement(true) ftag = ftag.ReverseComplement(true)
@@ -218,7 +218,7 @@ func (marker *Marker) Match(sequence obiseq.BioSequence) *DemultiplexMatch {
return nil return nil
} }
func (match *DemultiplexMatch) ExtractBarcode(sequence obiseq.BioSequence, inplace bool) (obiseq.BioSequence, error) { func (match *DemultiplexMatch) ExtractBarcode(sequence *obiseq.BioSequence, inplace bool) (*obiseq.BioSequence, error) {
if !inplace { if !inplace {
sequence = sequence.Copy() sequence = sequence.Copy()
} }

View File

@@ -5,6 +5,7 @@ import (
"log" "log"
"sync" "sync"
"sync/atomic" "sync/atomic"
"time"
"github.com/tevino/abool/v2" "github.com/tevino/abool/v2"
) )
@@ -16,7 +17,7 @@ type BioSequenceBatch struct {
var NilBioSequenceBatch = BioSequenceBatch{nil, -1} var NilBioSequenceBatch = BioSequenceBatch{nil, -1}
func MakeBioSequenceBatch(order int, sequences ...BioSequence) BioSequenceBatch { func MakeBioSequenceBatch(order int, sequences BioSequenceSlice) BioSequenceBatch {
return BioSequenceBatch{ return BioSequenceBatch{
slice: sequences, slice: sequences,
order: order, order: order,
@@ -39,6 +40,15 @@ func (batch BioSequenceBatch) Slice() BioSequenceSlice {
func (batch BioSequenceBatch) Length() int { func (batch BioSequenceBatch) Length() int {
return len(batch.slice) return len(batch.slice)
} }
func (batch BioSequenceBatch) NotEmpty() bool {
return batch.slice.NotEmpty()
}
func (batch BioSequenceBatch) Pop0() *BioSequence {
return batch.slice.Pop0()
}
func (batch BioSequenceBatch) IsNil() bool { func (batch BioSequenceBatch) IsNil() bool {
return batch.slice == nil return batch.slice == nil
} }
@@ -201,6 +211,30 @@ func (iterator IBioSequenceBatch) Get() BioSequenceBatch {
return iterator.pointer.current return iterator.pointer.current
} }
func (iterator IBioSequenceBatch) Push(batch BioSequenceBatch) {
if batch.IsNil() {
log.Panicln("An Nil batch is pushed on the channel")
}
if batch.Length() == 0 {
log.Panicln("An empty batch is pushed on the channel")
}
iterator.pointer.channel <- batch
}
func (iterator IBioSequenceBatch) Close() {
close(iterator.pointer.channel)
}
func (iterator IBioSequenceBatch) WaitAndClose() {
iterator.Wait()
for len(iterator.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
iterator.Close()
}
// Finished returns 'true' value if no more data is available // Finished returns 'true' value if no more data is available
// from the iterator. // from the iterator.
func (iterator IBioSequenceBatch) Finished() bool { func (iterator IBioSequenceBatch) Finished() bool {
@@ -227,9 +261,10 @@ func (iterator IBioSequenceBatch) IBioSequence(sizes ...int) IBioSequence {
for iterator.Next() { for iterator.Next() {
batch := iterator.Get() batch := iterator.Get()
for _, s := range batch.slice { for batch.NotEmpty() {
newIter.pointer.channel <- s newIter.pointer.channel <- batch.Pop0()
} }
batch.Recycle()
} }
newIter.Done() newIter.Done()
}() }()
@@ -304,7 +339,7 @@ func (iterator IBioSequenceBatch) Concat(iterators ...IBioSequenceBatch) IBioSeq
if s.order > max_order { if s.order > max_order {
max_order = s.order max_order = s.order
} }
newIter.Channel() <- s.Reorder(s.order + previous_max) newIter.Push(s.Reorder(s.order + previous_max))
} }
previous_max = max_order + 1 previous_max = max_order + 1
@@ -315,7 +350,7 @@ func (iterator IBioSequenceBatch) Concat(iterators ...IBioSequenceBatch) IBioSeq
max_order = s.order + previous_max max_order = s.order + previous_max
} }
newIter.Channel() <- s.Reorder(s.order + previous_max) newIter.Push(s.Reorder(s.order + previous_max))
} }
previous_max = max_order + 1 previous_max = max_order + 1
} }
@@ -348,23 +383,23 @@ func (iterator IBioSequenceBatch) Rebatch(size int, sizes ...int) IBioSequenceBa
go func() { go func() {
order := 0 order := 0
iterator = iterator.SortBatches() iterator = iterator.SortBatches()
buffer := GetBioSequenceSlice() buffer := MakeBioSequenceSlice()
for iterator.Next() { for iterator.Next() {
seqs := iterator.Get() seqs := iterator.Get()
for _, s := range seqs.slice { for _, s := range seqs.slice {
buffer = append(buffer, s) buffer = append(buffer, s)
if len(buffer) == size { if len(buffer) == size {
newIter.Channel() <- MakeBioSequenceBatch(order, buffer...) newIter.Push(MakeBioSequenceBatch(order, buffer))
order++ order++
buffer = GetBioSequenceSlice() buffer = MakeBioSequenceSlice()
} }
} }
seqs.Recycle() seqs.Recycle()
} }
if len(buffer) > 0 { if len(buffer) > 0 {
newIter.Channel() <- MakeBioSequenceBatch(order, buffer...) newIter.Push(MakeBioSequenceBatch(order, buffer))
} }
newIter.Done() newIter.Done()
@@ -377,15 +412,17 @@ func (iterator IBioSequenceBatch) Rebatch(size int, sizes ...int) IBioSequenceBa
func (iterator IBioSequenceBatch) Recycle() { func (iterator IBioSequenceBatch) Recycle() {
log.Println("Start recycling of Bioseq objects") log.Println("Start recycling of Bioseq objects")
recycled := 0
for iterator.Next() { for iterator.Next() {
// iterator.Get() // iterator.Get()
batch := iterator.Get() batch := iterator.Get()
for _, seq := range batch.Slice() { for _, seq := range batch.Slice() {
(&seq).Recycle() seq.Recycle()
recycled++
} }
batch.Recycle()
} }
log.Println("End of the recycling of Bioseq objects") log.Printf("End of the recycling of %d Bioseq objects", recycled)
} }
func (iterator IBioSequenceBatch) PairWith(reverse IBioSequenceBatch, sizes ...int) IPairedBioSequenceBatch { func (iterator IBioSequenceBatch) PairWith(reverse IBioSequenceBatch, sizes ...int) IPairedBioSequenceBatch {
@@ -444,10 +481,8 @@ func (iterator IBioSequenceBatch) DivideOn(predicate SequencePredicate,
falseIter.Add(1) falseIter.Add(1)
go func() { go func() {
trueIter.Wait() trueIter.WaitAndClose()
falseIter.Wait() falseIter.WaitAndClose()
close(trueIter.Channel())
close(falseIter.Channel())
}() }()
go func() { go func() {
@@ -455,8 +490,8 @@ func (iterator IBioSequenceBatch) DivideOn(predicate SequencePredicate,
falseOrder := 0 falseOrder := 0
iterator = iterator.SortBatches() iterator = iterator.SortBatches()
trueSlice := GetBioSequenceSlice() trueSlice := MakeBioSequenceSlice()
falseSlice := GetBioSequenceSlice() falseSlice := MakeBioSequenceSlice()
for iterator.Next() { for iterator.Next() {
seqs := iterator.Get() seqs := iterator.Get()
@@ -468,26 +503,26 @@ func (iterator IBioSequenceBatch) DivideOn(predicate SequencePredicate,
} }
if len(trueSlice) == size { if len(trueSlice) == size {
trueIter.Channel() <- MakeBioSequenceBatch(trueOrder, trueSlice...) trueIter.Push(MakeBioSequenceBatch(trueOrder, trueSlice))
trueOrder++ trueOrder++
trueSlice = GetBioSequenceSlice() trueSlice = MakeBioSequenceSlice()
} }
if len(falseSlice) == size { if len(falseSlice) == size {
falseIter.Channel() <- MakeBioSequenceBatch(falseOrder, falseSlice...) falseIter.Push(MakeBioSequenceBatch(falseOrder, falseSlice))
falseOrder++ falseOrder++
falseSlice = GetBioSequenceSlice() falseSlice = MakeBioSequenceSlice()
} }
} }
seqs.Recycle() seqs.Recycle()
} }
if len(trueSlice) > 0 { if len(trueSlice) > 0 {
trueIter.Channel() <- MakeBioSequenceBatch(trueOrder, trueSlice...) trueIter.Push(MakeBioSequenceBatch(trueOrder, trueSlice))
} }
if len(falseSlice) > 0 { if len(falseSlice) > 0 {
falseIter.Channel() <- MakeBioSequenceBatch(falseOrder, falseSlice...) falseIter.Push(MakeBioSequenceBatch(falseOrder, falseSlice))
} }
trueIter.Done() trueIter.Done()

View File

@@ -2,10 +2,22 @@ package obiseq
import ( import (
"crypto/md5" "crypto/md5"
"log"
"sync/atomic"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/goutils" "git.metabarcoding.org/lecasofts/go/obitools/pkg/goutils"
) )
var _NewSeq = int32(0)
var _RecycleSeq = int32(0)
var _InMemSeq = int32(0)
var _MaxInMemSeq = int32(0)
var _BioLogRate = int(100000)
func LogBioSeqStatus() {
log.Printf("@@@@>>>> Created seq : %d Destroyed : %d In Memory : %d", _NewSeq, _RecycleSeq, _InMemSeq)
}
type Quality []uint8 type Quality []uint8
var __default_qualities__ = make(Quality, 0, 500) var __default_qualities__ = make(Quality, 0, 500)
@@ -22,7 +34,7 @@ func __make_default_qualities__(length int) Quality {
type Annotation map[string]interface{} type Annotation map[string]interface{}
type _BioSequence struct { type BioSequence struct {
id string id string
definition string definition string
sequence []byte sequence []byte
@@ -31,12 +43,17 @@ type _BioSequence struct {
annotations Annotation annotations Annotation
} }
type BioSequence struct {
sequence *_BioSequence
}
func MakeEmptyBioSequence() BioSequence { func MakeEmptyBioSequence() BioSequence {
bs := _BioSequence{ atomic.AddInt32(&_NewSeq, 1)
atomic.AddInt32(&_InMemSeq, 1)
//if atomic.CompareAndSwapInt32()()
// if int(_NewSeq)%int(_BioLogRate) == 0 {
// LogBioSeqStatus()
// }
return BioSequence{
id: "", id: "",
definition: "", definition: "",
sequence: nil, sequence: nil,
@@ -44,7 +61,11 @@ func MakeEmptyBioSequence() BioSequence {
feature: nil, feature: nil,
annotations: nil, annotations: nil,
} }
return BioSequence{&bs} }
func NewEmptyBioSequence() *BioSequence {
s := MakeEmptyBioSequence()
return &s
} }
func MakeBioSequence(id string, func MakeBioSequence(id string,
@@ -57,104 +78,109 @@ func MakeBioSequence(id string,
return bs return bs
} }
func NewBioSequence(id string,
sequence []byte,
definition string) *BioSequence {
s := MakeBioSequence(id, sequence, definition)
return &s
}
func (sequence *BioSequence) Recycle() { func (sequence *BioSequence) Recycle() {
pseq := sequence.sequence atomic.AddInt32(&_RecycleSeq, 1)
atomic.AddInt32(&_InMemSeq, -1)
if pseq != nil { // if int(_RecycleSeq)%int(_BioLogRate) == 0 {
RecycleSlice(&pseq.sequence) // LogBioSeqStatus()
RecycleSlice(&pseq.feature) // }
RecycleSlice(&pseq.qualities)
RecycleAnnotation(&pseq.annotations)
}
if sequence != nil {
RecycleSlice(&sequence.sequence)
sequence.sequence = nil sequence.sequence = nil
RecycleSlice(&sequence.feature)
sequence.feature = nil
RecycleSlice(&sequence.qualities)
sequence.qualities = nil
RecycleAnnotation(&sequence.annotations)
sequence.annotations = nil
}
} }
var NilBioSequence = BioSequence{sequence: nil} func (s *BioSequence) Copy() *BioSequence {
func (s BioSequence) IsNil() bool {
return s.sequence == nil
}
func (s BioSequence) Copy() BioSequence {
newSeq := MakeEmptyBioSequence() newSeq := MakeEmptyBioSequence()
newSeq.sequence.id = s.sequence.id newSeq.id = s.id
newSeq.sequence.definition = s.sequence.definition newSeq.definition = s.definition
newSeq.sequence.sequence = GetSlice(s.sequence.sequence...) newSeq.sequence = GetSlice(s.sequence...)
newSeq.sequence.qualities = GetSlice(s.sequence.qualities...) newSeq.qualities = GetSlice(s.qualities...)
newSeq.sequence.feature = GetSlice(s.sequence.feature...) newSeq.feature = GetSlice(s.feature...)
if len(s.sequence.annotations) > 0 { if len(s.annotations) > 0 {
newSeq.sequence.annotations = GetAnnotation(s.sequence.annotations) newSeq.annotations = GetAnnotation(s.annotations)
} }
return newSeq return &newSeq
} }
func (s BioSequence) Id() string { func (s *BioSequence) Id() string {
return s.sequence.id return s.id
} }
func (s BioSequence) Definition() string { func (s *BioSequence) Definition() string {
return s.sequence.definition return s.definition
} }
func (s BioSequence) Sequence() []byte { func (s *BioSequence) Sequence() []byte {
return s.sequence.sequence return s.sequence
} }
func (s BioSequence) String() string { func (s *BioSequence) String() string {
return string(s.sequence.sequence) return string(s.sequence)
} }
func (s BioSequence) Length() int { func (s *BioSequence) Length() int {
return len(s.sequence.sequence) return len(s.sequence)
} }
func (s BioSequence) HasQualities() bool { func (s *BioSequence) HasQualities() bool {
return len(s.sequence.qualities) > 0 return len(s.qualities) > 0
} }
func (s BioSequence) Qualities() Quality { func (s *BioSequence) Qualities() Quality {
if s.HasQualities() { if s.HasQualities() {
return s.sequence.qualities return s.qualities
} else { } else {
return __make_default_qualities__(len(s.sequence.sequence)) return __make_default_qualities__(len(s.sequence))
} }
} }
func (s BioSequence) Features() string { func (s *BioSequence) Features() string {
return string(s.sequence.feature) return string(s.feature)
} }
func (s BioSequence) HasAnnotation() bool { func (s *BioSequence) HasAnnotation() bool {
return len(s.sequence.annotations) > 0 return len(s.annotations) > 0
} }
func (s BioSequence) Annotations() Annotation { func (s *BioSequence) Annotations() Annotation {
if s.sequence == nil {
return nil if s.annotations == nil {
s.annotations = GetAnnotation()
} }
if s.sequence.annotations == nil { return s.annotations
s.sequence.annotations = GetAnnotation()
} }
return s.sequence.annotations func (s *BioSequence) MD5() [16]byte {
return md5.Sum(s.sequence)
} }
func (s BioSequence) MD5() [16]byte { func (s *BioSequence) Count() int {
return md5.Sum(s.sequence.sequence) if s.annotations == nil {
}
func (s BioSequence) Count() int {
if s.sequence.annotations == nil {
return 1 return 1
} }
if val, ok := (s.sequence.annotations)["count"]; ok { if val, ok := (s.annotations)["count"]; ok {
val, err := goutils.InterfaceToInt(val) val, err := goutils.InterfaceToInt(val)
if err == nil { if err == nil {
return val return val
@@ -163,12 +189,12 @@ func (s BioSequence) Count() int {
return 1 return 1
} }
func (s BioSequence) Taxid() int { func (s *BioSequence) Taxid() int {
if s.sequence.annotations == nil { if s.annotations == nil {
return 1 return 1
} }
if val, ok := (s.sequence.annotations)["taxid"]; ok { if val, ok := (s.annotations)["taxid"]; ok {
val, err := goutils.InterfaceToInt(val) val, err := goutils.InterfaceToInt(val)
if err == nil { if err == nil {
return val return val
@@ -177,56 +203,56 @@ func (s BioSequence) Taxid() int {
return 1 return 1
} }
func (s BioSequence) SetId(id string) { func (s *BioSequence) SetId(id string) {
s.sequence.id = id s.id = id
} }
func (s BioSequence) SetDefinition(definition string) { func (s *BioSequence) SetDefinition(definition string) {
s.sequence.definition = definition s.definition = definition
} }
func (s BioSequence) SetFeatures(feature []byte) { func (s *BioSequence) SetFeatures(feature []byte) {
if cap(s.sequence.feature) >= 300 { if cap(s.feature) >= 300 {
RecycleSlice(&s.sequence.feature) RecycleSlice(&s.feature)
} }
s.sequence.feature = feature s.feature = feature
} }
func (s BioSequence) SetSequence(sequence []byte) { func (s *BioSequence) SetSequence(sequence []byte) {
if s.sequence.sequence != nil { if s.sequence != nil {
RecycleSlice(&s.sequence.sequence) RecycleSlice(&s.sequence)
} }
s.sequence.sequence = sequence s.sequence = sequence
} }
func (s BioSequence) SetQualities(qualities Quality) { func (s *BioSequence) SetQualities(qualities Quality) {
if s.sequence.qualities != nil { if s.qualities != nil {
RecycleSlice(&s.sequence.qualities) RecycleSlice(&s.qualities)
} }
s.sequence.qualities = qualities s.qualities = qualities
} }
func (s BioSequence) WriteQualities(data []byte) (int, error) { func (s *BioSequence) WriteQualities(data []byte) (int, error) {
s.sequence.qualities = append(s.sequence.qualities, data...) s.qualities = append(s.qualities, data...)
return len(data), nil return len(data), nil
} }
func (s BioSequence) WriteByteQualities(data byte) error { func (s *BioSequence) WriteByteQualities(data byte) error {
s.sequence.qualities = append(s.sequence.qualities, data) s.qualities = append(s.qualities, data)
return nil return nil
} }
func (s BioSequence) Write(data []byte) (int, error) { func (s *BioSequence) Write(data []byte) (int, error) {
s.sequence.sequence = append(s.sequence.sequence, data...) s.sequence = append(s.sequence, data...)
return len(data), nil return len(data), nil
} }
func (s BioSequence) WriteString(data string) (int, error) { func (s *BioSequence) WriteString(data string) (int, error) {
bdata := []byte(data) bdata := []byte(data)
return s.Write(bdata) return s.Write(bdata)
} }
func (s BioSequence) WriteByte(data byte) error { func (s *BioSequence) WriteByte(data byte) error {
s.sequence.sequence = append(s.sequence.sequence, data) s.sequence = append(s.sequence, data)
return nil return nil
} }

View File

@@ -1,3 +1,58 @@
package obiseq package obiseq
type BioSequenceSlice []BioSequence import (
"sync"
)
type BioSequenceSlice []*BioSequence
var _BioSequenceSlicePool = sync.Pool{
New: func() interface{} {
bs := make(BioSequenceSlice, 0, 10)
return &bs
},
}
func NewBioSequenceSlice() *BioSequenceSlice {
return _BioSequenceSlicePool.Get().(*BioSequenceSlice)
}
func MakeBioSequenceSlice() BioSequenceSlice {
return *NewBioSequenceSlice()
}
func (s *BioSequenceSlice) Recycle() {
// if s == nil {
// log.Panicln("Trying too recycle a nil pointer")
// }
// // Code added to potentially limit memory leaks
// for i := range *s {
// (*s)[i] = nil
// }
// *s = (*s)[:0]
// _BioSequenceSlicePool.Put(s)
}
func (s *BioSequenceSlice) Push(sequence *BioSequence) {
*s = append(*s, sequence)
}
func (s *BioSequenceSlice) Pop() *BioSequence {
_s := (*s)[len(*s)-1]
(*s)[len(*s)-1] = nil
*s = (*s)[:len(*s)-1]
return _s
}
func (s *BioSequenceSlice) Pop0() *BioSequence {
_s := (*s)[0]
(*s)[0] = nil
*s = (*s)[1:]
return _s
}
func (s BioSequenceSlice) NotEmpty() bool {
return len(s) > 0
}

View File

@@ -9,19 +9,19 @@ import (
) )
type BioSequenceClassifier struct { type BioSequenceClassifier struct {
Code func(BioSequence) int Code func(*BioSequence) int
Value func(int) string Value func(int) string
Reset func()
Clone func() *BioSequenceClassifier
} }
//type BioSequenceClassifier func(sequence BioSequence) string
func AnnotationClassifier(key string, na string) *BioSequenceClassifier { func AnnotationClassifier(key string, na string) *BioSequenceClassifier {
encode := make(map[string]int, 1000) encode := make(map[string]int, 1000)
decode := make([]string, 0, 1000) decode := make([]string, 0, 1000)
locke := sync.RWMutex{} locke := sync.RWMutex{}
maxcode := 0 maxcode := 0
code := func(sequence BioSequence) int { code := func(sequence *BioSequence) int {
var val string var val string
if sequence.HasAnnotation() { if sequence.HasAnnotation() {
value, ok := sequence.Annotations()[key] value, ok := sequence.Annotations()[key]
@@ -62,12 +62,26 @@ func AnnotationClassifier(key string, na string) *BioSequenceClassifier {
return decode[k] return decode[k]
} }
c := BioSequenceClassifier{code, value} reset := func() {
locke.Lock()
defer locke.Unlock()
for k := range encode {
delete(encode, k)
}
decode = decode[:0]
}
clone := func() *BioSequenceClassifier {
return AnnotationClassifier(key, na)
}
c := BioSequenceClassifier{code, value, reset, clone}
return &c return &c
} }
func PredicateClassifier(predicate SequencePredicate) *BioSequenceClassifier { func PredicateClassifier(predicate SequencePredicate) *BioSequenceClassifier {
code := func(sequence BioSequence) int { code := func(sequence *BioSequence) int {
if predicate(sequence) { if predicate(sequence) {
return 1 return 1
} else { } else {
@@ -85,14 +99,22 @@ func PredicateClassifier(predicate SequencePredicate) *BioSequenceClassifier {
} }
c := BioSequenceClassifier{code, value} reset := func() {
}
clone := func() *BioSequenceClassifier {
return PredicateClassifier(predicate)
}
c := BioSequenceClassifier{code, value, reset, clone}
return &c return &c
} }
// Builds a classifier function based on CRC32 of the sequence // Builds a classifier function based on CRC32 of the sequence
// //
func HashClassifier(size int) *BioSequenceClassifier { func HashClassifier(size int) *BioSequenceClassifier {
code := func(sequence BioSequence) int { code := func(sequence *BioSequence) int {
return int(crc32.ChecksumIEEE(sequence.Sequence()) % uint32(size)) return int(crc32.ChecksumIEEE(sequence.Sequence()) % uint32(size))
} }
@@ -100,7 +122,15 @@ func HashClassifier(size int) *BioSequenceClassifier {
return strconv.Itoa(k) return strconv.Itoa(k)
} }
c := BioSequenceClassifier{code, value} reset := func() {
}
clone := func() *BioSequenceClassifier {
return HashClassifier(size)
}
c := BioSequenceClassifier{code, value, reset, clone}
return &c return &c
} }
@@ -112,7 +142,7 @@ func SequenceClassifier() *BioSequenceClassifier {
locke := sync.RWMutex{} locke := sync.RWMutex{}
maxcode := 0 maxcode := 0
code := func(sequence BioSequence) int { code := func(sequence *BioSequence) int {
val := sequence.String() val := sequence.String()
locke.Lock() locke.Lock()
@@ -140,7 +170,23 @@ func SequenceClassifier() *BioSequenceClassifier {
return decode[k] return decode[k]
} }
c := BioSequenceClassifier{code, value} reset := func() {
locke.Lock()
defer locke.Unlock()
// for k := range encode {
// delete(encode, k)
// }
encode = make(map[string]int)
decode = decode[:0]
maxcode = 0
}
clone := func() *BioSequenceClassifier {
return SequenceClassifier()
}
c := BioSequenceClassifier{code, value, reset, clone}
return &c return &c
} }
@@ -148,7 +194,7 @@ func RotateClassifier(size int) *BioSequenceClassifier {
n := 0 n := 0
lock := sync.Mutex{} lock := sync.Mutex{}
code := func(sequence BioSequence) int { code := func(sequence *BioSequence) int {
lock.Lock() lock.Lock()
defer lock.Unlock() defer lock.Unlock()
n = n % size n = n % size
@@ -160,6 +206,14 @@ func RotateClassifier(size int) *BioSequenceClassifier {
return strconv.Itoa(k) return strconv.Itoa(k)
} }
c := BioSequenceClassifier{code, value} reset := func() {
}
clone := func() *BioSequenceClassifier {
return RotateClassifier(size)
}
c := BioSequenceClassifier{code, value, reset, clone}
return &c return &c
} }

View File

@@ -8,6 +8,7 @@ import (
type IDistribute struct { type IDistribute struct {
outputs map[int]IBioSequenceBatch outputs map[int]IBioSequenceBatch
news chan int news chan int
classifier *BioSequenceClassifier
lock *sync.Mutex lock *sync.Mutex
} }
@@ -27,6 +28,10 @@ func (dist *IDistribute) News() chan int {
return dist.news return dist.news
} }
func (dist *IDistribute) Classifier() *BioSequenceClassifier {
return dist.classifier
}
func (iterator IBioSequenceBatch) Distribute(class *BioSequenceClassifier, sizes ...int) IDistribute { func (iterator IBioSequenceBatch) Distribute(class *BioSequenceClassifier, sizes ...int) IDistribute {
batchsize := 5000 batchsize := 5000
buffsize := 2 buffsize := 2
@@ -53,7 +58,7 @@ func (iterator IBioSequenceBatch) Distribute(class *BioSequenceClassifier, sizes
jobDone.Wait() jobDone.Wait()
close(news) close(news)
for _, i := range outputs { for _, i := range outputs {
close(i.Channel()) i.Close()
} }
}() }()
@@ -67,7 +72,7 @@ func (iterator IBioSequenceBatch) Distribute(class *BioSequenceClassifier, sizes
slice, ok := slices[key] slice, ok := slices[key]
if !ok { if !ok {
s := GetBioSequenceSlice() s := MakeBioSequenceSlice()
slice = &s slice = &s
slices[key] = slice slices[key] = slice
orders[key] = 0 orders[key] = 0
@@ -82,9 +87,9 @@ func (iterator IBioSequenceBatch) Distribute(class *BioSequenceClassifier, sizes
*slice = append(*slice, s) *slice = append(*slice, s)
if len(*slice) == batchsize { if len(*slice) == batchsize {
outputs[key].Channel() <- MakeBioSequenceBatch(orders[key], *slice...) outputs[key].Push(MakeBioSequenceBatch(orders[key], *slice))
orders[key]++ orders[key]++
s := GetBioSequenceSlice() s := MakeBioSequenceSlice()
slices[key] = &s slices[key] = &s
} }
} }
@@ -93,7 +98,7 @@ func (iterator IBioSequenceBatch) Distribute(class *BioSequenceClassifier, sizes
for key, slice := range slices { for key, slice := range slices {
if len(*slice) > 0 { if len(*slice) > 0 {
outputs[key].Channel() <- MakeBioSequenceBatch(orders[key], *slice...) outputs[key].Push(MakeBioSequenceBatch(orders[key], *slice))
} }
} }
@@ -104,6 +109,7 @@ func (iterator IBioSequenceBatch) Distribute(class *BioSequenceClassifier, sizes
return IDistribute{ return IDistribute{
outputs, outputs,
news, news,
class,
&lock} &lock}
} }

View File

@@ -2,14 +2,13 @@ package obiseq
import ( import (
"sync" "sync"
"time"
) )
// Private structure implementing an iterator over // Private structure implementing an iterator over
// bioseq.BioSequence based on a channel. // bioseq.BioSequence based on a channel.
type __ibiosequence__ struct { type __ibiosequence__ struct {
channel chan BioSequence channel chan *BioSequence
current BioSequence current *BioSequence
pushBack bool pushBack bool
all_done *sync.WaitGroup all_done *sync.WaitGroup
buffer_size int buffer_size int
@@ -39,10 +38,10 @@ func (iterator IBioSequence) Wait() {
iterator.pointer.all_done.Wait() iterator.pointer.all_done.Wait()
} }
func (iterator IBioSequence) Channel() chan BioSequence { func (iterator IBioSequence) Channel() chan *BioSequence {
return iterator.pointer.channel return iterator.pointer.channel
} }
func (iterator IBioSequence) PChannel() *chan BioSequence { func (iterator IBioSequence) PChannel() *chan *BioSequence {
return &(iterator.pointer.channel) return &(iterator.pointer.channel)
} }
@@ -54,8 +53,8 @@ func MakeIBioSequence(sizes ...int) IBioSequence {
} }
i := __ibiosequence__{ i := __ibiosequence__{
channel: make(chan BioSequence, buffsize), channel: make(chan *BioSequence, buffsize),
current: NilBioSequence, current: nil,
pushBack: false, pushBack: false,
buffer_size: buffsize, buffer_size: buffsize,
finished: false, finished: false,
@@ -73,7 +72,7 @@ func (iterator IBioSequence) Split() IBioSequence {
i := __ibiosequence__{ i := __ibiosequence__{
channel: iterator.pointer.channel, channel: iterator.pointer.channel,
current: NilBioSequence, current: nil,
pushBack: false, pushBack: false,
finished: false, finished: false,
all_done: iterator.pointer.all_done, all_done: iterator.pointer.all_done,
@@ -87,7 +86,7 @@ func (iterator IBioSequence) Split() IBioSequence {
func (iterator IBioSequence) Next() bool { func (iterator IBioSequence) Next() bool {
if iterator.IsNil() || *(iterator.pointer.pFinished) { if iterator.IsNil() || *(iterator.pointer.pFinished) {
iterator.pointer.current = NilBioSequence iterator.pointer.current = nil
return false return false
} }
@@ -103,13 +102,13 @@ func (iterator IBioSequence) Next() bool {
return true return true
} }
iterator.pointer.current = NilBioSequence iterator.pointer.current = nil
*iterator.pointer.pFinished = true *iterator.pointer.pFinished = true
return false return false
} }
func (iterator IBioSequence) PushBack() { func (iterator IBioSequence) PushBack() {
if !iterator.pointer.current.IsNil() { if !(iterator.pointer.current == nil) {
iterator.pointer.pushBack = true iterator.pointer.pushBack = true
} }
} }
@@ -118,7 +117,7 @@ func (iterator IBioSequence) PushBack() {
// currently pointed by the iterator. You have to use the // currently pointed by the iterator. You have to use the
// 'Next' method to move to the next entry before calling // 'Next' method to move to the next entry before calling
// 'Get' to retreive the following instance. // 'Get' to retreive the following instance.
func (iterator IBioSequence) Get() BioSequence { func (iterator IBioSequence) Get() *BioSequence {
return iterator.pointer.current return iterator.pointer.current
} }
@@ -156,17 +155,13 @@ func (iterator IBioSequence) IBioSequenceBatch(sizes ...int) IBioSequenceBatch {
newIter.Add(1) newIter.Add(1)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
for len(newIter.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
close(newIter.pointer.channel)
}() }()
go func() { go func() {
for j := 0; !iterator.Finished(); j++ { for j := 0; !iterator.Finished(); j++ {
batch := BioSequenceBatch{ batch := BioSequenceBatch{
slice: GetBioSequenceSlice(), slice: MakeBioSequenceSlice(),
order: j} order: j}
for i := 0; i < batchsize && iterator.Next(); i++ { for i := 0; i < batchsize && iterator.Next(); i++ {
seq := iterator.Get() seq := iterator.Get()
@@ -280,7 +275,7 @@ func (iterator IBioSequence) Tail(n int, sizes ...int) IBioSequence {
} }
newIter := MakeIBioSequence(buffsize) newIter := MakeIBioSequence(buffsize)
buffseq := GetBioSequenceSlice() buffseq := MakeBioSequenceSlice()
newIter.Add(1) newIter.Add(1)

View File

@@ -1,6 +1,6 @@
package obiseq package obiseq
func (sequence BioSequence) Join(seq2 BioSequence, inplace bool) BioSequence { func (sequence *BioSequence) Join(seq2 *BioSequence, inplace bool) *BioSequence {
if !inplace { if !inplace {
sequence = sequence.Copy() sequence = sequence.Copy()

View File

@@ -8,7 +8,7 @@ import (
type StatsOnValues map[string]int type StatsOnValues map[string]int
func (sequence BioSequence) HasStatsOn(key string) bool { func (sequence *BioSequence) HasStatsOn(key string) bool {
if !sequence.HasAnnotation() { if !sequence.HasAnnotation() {
return false return false
} }
@@ -20,7 +20,7 @@ func (sequence BioSequence) HasStatsOn(key string) bool {
return ok return ok
} }
func (sequence BioSequence) StatsOn(key string, na string) StatsOnValues { func (sequence *BioSequence) StatsOn(key string, na string) StatsOnValues {
mkey := "merged_" + key mkey := "merged_" + key
annotations := sequence.Annotations() annotations := sequence.Annotations()
istat, ok := annotations[mkey] istat, ok := annotations[mkey]
@@ -51,7 +51,7 @@ func (sequence BioSequence) StatsOn(key string, na string) StatsOnValues {
return stats return stats
} }
func (sequence BioSequence) StatsPlusOne(key string, toAdd BioSequence, na string) bool { func (sequence *BioSequence) StatsPlusOne(key string, toAdd *BioSequence, na string) bool {
sval := na sval := na
stats := sequence.StatsOn(key, na) stats := sequence.StatsOn(key, na)
retval := false retval := false
@@ -97,7 +97,7 @@ func (stats StatsOnValues) Merge(toMerged StatsOnValues) StatsOnValues {
return stats return stats
} }
func (sequence BioSequence) Merge(tomerge BioSequence, na string, inplace bool, statsOn ...string) BioSequence { func (sequence *BioSequence) Merge(tomerge *BioSequence, na string, inplace bool, statsOn ...string) *BioSequence {
if !inplace { if !inplace {
sequence = sequence.Copy() sequence = sequence.Copy()
} }
@@ -143,24 +143,63 @@ func (sequence BioSequence) Merge(tomerge BioSequence, na string, inplace bool,
return sequence return sequence
} }
func (sequences BioSequenceSlice) Merge(na string, statsOn ...string) BioSequenceSlice { func (sequences BioSequenceSlice) Merge(na string, statsOn []string) *BioSequence {
seq := sequences[0] seq := sequences[0]
//sequences[0] = nil
seq.SetQualities(nil) seq.SetQualities(nil)
seq.Annotations()["count"] = 1
for _, toMerge := range sequences[1:] { if len(sequences) == 1 {
seq.Annotations()["count"] = 1
for _, v := range statsOn {
seq.StatsOn(v, na)
}
} else {
for k, toMerge := range sequences[1:] {
seq.Merge(toMerge, na, true, statsOn...) seq.Merge(toMerge, na, true, statsOn...)
toMerge.Recycle() toMerge.Recycle()
sequences[1+k] = nil
}
} }
return sequences[0:1] sequences.Recycle()
return seq
} }
func MergeSliceWorker(na string, statsOn ...string) SeqSliceWorker { func (iterator IBioSequenceBatch) IMergeSequenceBatch(na string, statsOn []string, sizes ...int) IBioSequenceBatch {
batchsize := 100
buffsize := iterator.BufferSize()
worker := func(sequences BioSequenceSlice) BioSequenceSlice { if len(sizes) > 0 {
return sequences.Merge(na, statsOn...) batchsize = sizes[0]
}
if len(sizes) > 1 {
buffsize = sizes[1]
} }
return worker newIter := MakeIBioSequenceBatch(buffsize)
newIter.Add(1)
go func() {
newIter.WaitAndClose()
}()
go func() {
for j := 0; !iterator.Finished(); j++ {
batch := BioSequenceBatch{
slice: MakeBioSequenceSlice(),
order: j}
for i := 0; i < batchsize && iterator.Next(); i++ {
seqs := iterator.Get()
batch.slice = append(batch.slice, seqs.slice.Merge(na, statsOn))
}
if batch.Length() > 0 {
newIter.Push(batch)
}
}
newIter.Done()
}()
return newIter
} }

View File

@@ -14,9 +14,11 @@ var _BioSequenceByteSlicePool = sync.Pool{
} }
func RecycleSlice(s *[]byte) { func RecycleSlice(s *[]byte) {
if s != nil && *s != nil {
*s = (*s)[:0] *s = (*s)[:0]
_BioSequenceByteSlicePool.Put(s) _BioSequenceByteSlicePool.Put(s)
} }
}
func GetSlice(values ...byte) []byte { func GetSlice(values ...byte) []byte {
s := *(_BioSequenceByteSlicePool.Get().(*[]byte)) s := *(_BioSequenceByteSlicePool.Get().(*[]byte))
@@ -30,7 +32,7 @@ func GetSlice(values ...byte) []byte {
var BioSequenceAnnotationPool = sync.Pool{ var BioSequenceAnnotationPool = sync.Pool{
New: func() interface{} { New: func() interface{} {
bs := make(Annotation, 100) bs := make(Annotation, 5)
return &bs return &bs
}, },
} }
@@ -40,12 +42,16 @@ func RecycleAnnotation(a *Annotation) {
for k := range *a { for k := range *a {
delete(*a, k) delete(*a, k)
} }
BioSequenceAnnotationPool.Put(&(a)) BioSequenceAnnotationPool.Put(a)
} }
} }
func GetAnnotation(values ...Annotation) Annotation { func GetAnnotation(values ...Annotation) Annotation {
a := *(BioSequenceAnnotationPool.Get().(*Annotation)) a := Annotation(nil)
for a == nil {
a = *(BioSequenceAnnotationPool.Get().(*Annotation))
}
if len(values) > 0 { if len(values) > 0 {
goutils.CopyMap(a, values[0]) goutils.CopyMap(a, values[0])
@@ -53,58 +59,3 @@ func GetAnnotation(values ...Annotation) Annotation {
return a return a
} }
var _BioSequenceSlicePool = sync.Pool{
New: func() interface{} {
bs := make(BioSequenceSlice, 0, 5000)
return &bs
},
}
func (s *BioSequenceSlice) Recycle() {
*s = (*s)[:0]
_BioSequenceSlicePool.Put(s)
}
func GetBioSequenceSlicePtr(values ...BioSequence) *BioSequenceSlice {
s := _BioSequenceSlicePool.Get().(*BioSequenceSlice)
if len(values) > 0 {
*s = append(*s, values...)
}
return s
}
func GetBioSequenceSlice(values ...BioSequence) BioSequenceSlice {
return *GetBioSequenceSlicePtr(values...)
}
// var __bioseq__pool__ = sync.Pool{
// New: func() interface{} {
// var bs _BioSequence
// bs.annotations = make(Annotation, 50)
// return &bs
// },
// }
// func MakeEmptyBioSequence() BioSequence {
// bs := BioSequence{__bioseq__pool__.Get().(*_BioSequence)}
// return bs
// }
// func MakeBioSequence(id string,
// sequence []byte,
// definition string) BioSequence {
// bs := MakeEmptyBioSequence()
// bs.SetId(id)
// bs.Write(sequence)
// bs.SetDefinition(definition)
// return bs
// }
// func (sequence *BioSequence) Recycle() {
// sequence.Reset()
// __bioseq__pool__.Put(sequence.sequence)
// sequence.sequence = nil
// }

View File

@@ -1,9 +1,9 @@
package obiseq package obiseq
type SequencePredicate func(BioSequence) bool type SequencePredicate func(*BioSequence) bool
func (predicate1 SequencePredicate) And(predicate2 SequencePredicate) SequencePredicate { func (predicate1 SequencePredicate) And(predicate2 SequencePredicate) SequencePredicate {
f := func(sequence BioSequence) bool { f := func(sequence *BioSequence) bool {
return predicate1(sequence) && predicate2(sequence) return predicate1(sequence) && predicate2(sequence)
} }
@@ -11,7 +11,7 @@ func (predicate1 SequencePredicate) And(predicate2 SequencePredicate) SequencePr
} }
func (predicate1 SequencePredicate) Or(predicate2 SequencePredicate) SequencePredicate { func (predicate1 SequencePredicate) Or(predicate2 SequencePredicate) SequencePredicate {
f := func(sequence BioSequence) bool { f := func(sequence *BioSequence) bool {
return predicate1(sequence) || predicate2(sequence) return predicate1(sequence) || predicate2(sequence)
} }
@@ -19,7 +19,7 @@ func (predicate1 SequencePredicate) Or(predicate2 SequencePredicate) SequencePre
} }
func (predicate1 SequencePredicate) Xor(predicate2 SequencePredicate) SequencePredicate { func (predicate1 SequencePredicate) Xor(predicate2 SequencePredicate) SequencePredicate {
f := func(sequence BioSequence) bool { f := func(sequence *BioSequence) bool {
p1 := predicate1(sequence) p1 := predicate1(sequence)
p2 := predicate2(sequence) p2 := predicate2(sequence)
return (p1 && !p2) || (p2 && !p1) return (p1 && !p2) || (p2 && !p1)
@@ -29,7 +29,7 @@ func (predicate1 SequencePredicate) Xor(predicate2 SequencePredicate) SequencePr
} }
func (predicate1 SequencePredicate) Not() SequencePredicate { func (predicate1 SequencePredicate) Not() SequencePredicate {
f := func(sequence BioSequence) bool { f := func(sequence *BioSequence) bool {
return !predicate1(sequence) return !predicate1(sequence)
} }
@@ -38,7 +38,7 @@ func (predicate1 SequencePredicate) Not() SequencePredicate {
func HasAttribute(name string) SequencePredicate { func HasAttribute(name string) SequencePredicate {
f := func(sequence BioSequence) bool { f := func(sequence *BioSequence) bool {
if sequence.HasAnnotation() { if sequence.HasAnnotation() {
_, ok := (sequence.Annotations())[name] _, ok := (sequence.Annotations())[name]
return ok return ok
@@ -51,7 +51,7 @@ func HasAttribute(name string) SequencePredicate {
} }
func MoreAbundantThan(count int) SequencePredicate { func MoreAbundantThan(count int) SequencePredicate {
f := func(sequence BioSequence) bool { f := func(sequence *BioSequence) bool {
return sequence.Count() > count return sequence.Count() > count
} }
@@ -59,7 +59,7 @@ func MoreAbundantThan(count int) SequencePredicate {
} }
func IsLongerOrEqualTo(length int) SequencePredicate { func IsLongerOrEqualTo(length int) SequencePredicate {
f := func(sequence BioSequence) bool { f := func(sequence *BioSequence) bool {
return sequence.Length() >= length return sequence.Length() >= length
} }
@@ -67,7 +67,7 @@ func IsLongerOrEqualTo(length int) SequencePredicate {
} }
func IsShorterOrEqualTo(length int) SequencePredicate { func IsShorterOrEqualTo(length int) SequencePredicate {
f := func(sequence BioSequence) bool { f := func(sequence *BioSequence) bool {
return sequence.Length() <= length return sequence.Length() <= length
} }

View File

@@ -5,13 +5,13 @@ var __revcmp_dna__ = []byte(".TVGHEFCDIJMLKNOPQYSAABWXRZ#!][")
// Reverse complements a DNA sequence. // Reverse complements a DNA sequence.
// If the inplace parametter is true, that operation is done in place. // If the inplace parametter is true, that operation is done in place.
func (sequence BioSequence) ReverseComplement(inplace bool) BioSequence { func (sequence *BioSequence) ReverseComplement(inplace bool) *BioSequence {
if !inplace { if !inplace {
sequence = sequence.Copy() sequence = sequence.Copy()
} }
s := sequence.sequence.sequence s := sequence.sequence
for i, j := sequence.Length()-1, 0; i >= j; i-- { for i, j := sequence.Length()-1, 0; i >= j; i-- {

View File

@@ -1,6 +1,39 @@
package obiseq package obiseq
func (iterator IBioSequenceBatch) speed() IBioSequenceBatch { import (
"os"
"github.com/schollz/progressbar/v3"
)
func (iterator IBioSequenceBatch) Speed() IBioSequenceBatch {
newIter := MakeIBioSequenceBatch() newIter := MakeIBioSequenceBatch()
newIter.Add(1)
go func() {
newIter.WaitAndClose()
}()
bar := progressbar.NewOptions(
-1,
progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionSetWidth(15),
progressbar.OptionShowCount(),
progressbar.OptionShowIts(),
progressbar.OptionSetDescription("[Sequence Processing]"))
go func() {
for iterator.Next() {
batch := iterator.Get()
l := batch.Length()
newIter.Push(batch)
bar.Add(l)
}
newIter.Done()
}()
return newIter return newIter
} }

View File

@@ -7,32 +7,32 @@ import (
// Returns a sub sequence start from position 'from' included, // Returns a sub sequence start from position 'from' included,
// to position 'to' excluded. Coordinates start at position 0. // to position 'to' excluded. Coordinates start at position 0.
func (sequence BioSequence) Subsequence(from, to int, circular bool) (BioSequence, error) { func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSequence, error) {
if from >= to && !circular { if from >= to && !circular {
return NilBioSequence, errors.New("from greater than to") return nil, errors.New("from greater than to")
} }
if from < 0 || from >= sequence.Length() { if from < 0 || from >= sequence.Length() {
return NilBioSequence, errors.New("from out of bounds") return nil, errors.New("from out of bounds")
} }
if to <= 0 || to > sequence.Length() { if to <= 0 || to > sequence.Length() {
return NilBioSequence, errors.New("to out of bounds") return nil, errors.New("to out of bounds")
} }
var newSeq BioSequence var newSeq *BioSequence
if from < to { if from < to {
newSeq = MakeEmptyBioSequence() newSeq = NewEmptyBioSequence()
newSeq.Write(sequence.Sequence()[from:to]) newSeq.Write(sequence.Sequence()[from:to])
if sequence.HasQualities() { if sequence.HasQualities() {
newSeq.WriteQualities(sequence.Qualities()[from:to]) newSeq.WriteQualities(sequence.Qualities()[from:to])
} }
newSeq.sequence.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to) newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
newSeq.sequence.definition = sequence.sequence.definition newSeq.definition = sequence.definition
} else { } else {
newSeq, _ = sequence.Subsequence(from, sequence.Length(), false) newSeq, _ = sequence.Subsequence(from, sequence.Length(), false)
newSeq.Write(sequence.Sequence()[0:to]) newSeq.Write(sequence.Sequence()[0:to])
@@ -44,7 +44,7 @@ func (sequence BioSequence) Subsequence(from, to int, circular bool) (BioSequenc
} }
if len(sequence.Annotations()) > 0 { if len(sequence.Annotations()) > 0 {
newSeq.sequence.annotations = GetAnnotation(sequence.Annotations()) newSeq.annotations = GetAnnotation(sequence.Annotations())
} }
return newSeq, nil return newSeq, nil

View File

@@ -2,16 +2,15 @@ package obiseq
import ( import (
"log" "log"
"time"
) )
type SeqAnnotator func(BioSequence) type SeqAnnotator func(*BioSequence)
type SeqWorker func(BioSequence) BioSequence type SeqWorker func(*BioSequence) *BioSequence
type SeqSliceWorker func(BioSequenceSlice) BioSequenceSlice type SeqSliceWorker func(BioSequenceSlice) BioSequenceSlice
func AnnotatorToSeqWorker(function SeqAnnotator) SeqWorker { func AnnotatorToSeqWorker(function SeqAnnotator) SeqWorker {
f := func(seq BioSequence) BioSequence { f := func(seq *BioSequence) *BioSequence {
function(seq) function(seq)
return seq return seq
} }
@@ -63,11 +62,7 @@ func (iterator IBioSequenceBatch) MakeIWorker(worker SeqWorker, sizes ...int) IB
newIter.Add(nworkers) newIter.Add(nworkers)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
for len(newIter.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
close(newIter.pointer.channel)
log.Println("End of the batch workers") log.Println("End of the batch workers")
}() }()
@@ -78,7 +73,7 @@ func (iterator IBioSequenceBatch) MakeIWorker(worker SeqWorker, sizes ...int) IB
for i, seq := range batch.slice { for i, seq := range batch.slice {
batch.slice[i] = worker(seq) batch.slice[i] = worker(seq)
} }
newIter.pointer.channel <- batch newIter.Push(batch)
} }
newIter.Done() newIter.Done()
} }
@@ -109,11 +104,7 @@ func (iterator IBioSequenceBatch) MakeISliceWorker(worker SeqSliceWorker, sizes
newIter.Add(nworkers) newIter.Add(nworkers)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
for len(newIter.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
close(newIter.pointer.channel)
log.Println("End of the batch slice workers") log.Println("End of the batch slice workers")
}() }()

View File

@@ -33,7 +33,7 @@ func IsSubCladeOf(taxonomy Taxonomy, taxid int) obiseq.SequencePredicate {
log.Fatalf("Cannot find taxon : %d (%v)", taxid, err) log.Fatalf("Cannot find taxon : %d (%v)", taxid, err)
} }
f := func(sequence obiseq.BioSequence) bool { f := func(sequence *obiseq.BioSequence) bool {
taxon, err := taxonomy.Taxon(sequence.Taxid()) taxon, err := taxonomy.Taxon(sequence.Taxid())
return err == nil && taxon.IsSubCladeOf(parent) return err == nil && taxon.IsSubCladeOf(parent)
} }

View File

@@ -5,7 +5,6 @@ import (
"math" "math"
"os" "os"
"runtime" "runtime"
"time"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq" "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
@@ -49,7 +48,7 @@ func _Abs(x int) int {
// Outputs: // Outputs:
// cgatgcta..........aatcgtacga // cgatgcta..........aatcgtacga
// //
func JoinPairedSequence(seqA, seqB obiseq.BioSequence, inplace bool) obiseq.BioSequence { func JoinPairedSequence(seqA, seqB *obiseq.BioSequence, inplace bool) *obiseq.BioSequence {
if !inplace { if !inplace {
seqA = seqA.Copy() seqA = seqA.Copy()
@@ -64,7 +63,7 @@ func JoinPairedSequence(seqA, seqB obiseq.BioSequence, inplace bool) obiseq.BioS
} }
if inplace { if inplace {
(&seqB).Recycle() seqB.Recycle()
} }
return seqA return seqA
@@ -104,10 +103,10 @@ func JoinPairedSequence(seqA, seqB obiseq.BioSequence, inplace bool) obiseq.BioS
// An obiseq.BioSequence corresponding to the assembling of the both // An obiseq.BioSequence corresponding to the assembling of the both
// input sequence. // input sequence.
// //
func AssemblePESequences(seqA, seqB obiseq.BioSequence, func AssemblePESequences(seqA, seqB *obiseq.BioSequence,
gap float64, delta, minOverlap int, minIdentity float64, withStats bool, gap float64, delta, minOverlap int, minIdentity float64, withStats bool,
inplace bool, inplace bool,
arenaAlign obialign.PEAlignArena) obiseq.BioSequence { arenaAlign obialign.PEAlignArena) *obiseq.BioSequence {
score, path := obialign.PEAlign(seqA, seqB, gap, delta, arenaAlign) score, path := obialign.PEAlign(seqA, seqB, gap, delta, arenaAlign)
cons, match := obialign.BuildQualityConsensus(seqA, seqB, path) cons, match := obialign.BuildQualityConsensus(seqA, seqB, path)
@@ -152,8 +151,8 @@ func AssemblePESequences(seqA, seqB obiseq.BioSequence,
annot["score_norm"] = scoreNorm annot["score_norm"] = scoreNorm
if inplace { if inplace {
(&seqA).Recycle() seqA.Recycle()
(&seqB).Recycle() seqB.Recycle()
} }
} }
} else { } else {
@@ -222,11 +221,7 @@ func IAssemblePESequencesBatch(iterator obiseq.IPairedBioSequenceBatch,
newIter.Add(nworkers) newIter.Add(nworkers)
go func() { go func() {
newIter.Wait() newIter.WaitAndClose()
for len(newIter.Channel()) > 0 {
time.Sleep(time.Millisecond)
}
close(newIter.Channel())
log.Printf("End of the sequence Pairing") log.Printf("End of the sequence Pairing")
}() }()
@@ -254,10 +249,10 @@ func IAssemblePESequencesBatch(iterator obiseq.IPairedBioSequenceBatch,
} }
} }
bar.Add(batch.Length() - processed) bar.Add(batch.Length() - processed)
newIter.Channel() <- obiseq.MakeBioSequenceBatch( newIter.Push(obiseq.MakeBioSequenceBatch(
batch.Order(), batch.Order(),
cons..., cons,
) ))
} }
newIter.Done() newIter.Done()
} }