mirror of
https://github.com/metabarcoding/obitools4.git
synced 2025-12-08 08:40:26 +00:00
obimultiplex2 in now obimultiplex
Former-commit-id: ee6f5e15a3f1729dfc2806d039c842c9c3bdd343
This commit is contained in:
107
doc/book/wolf_data/wolf_diet_ngsfilter.csv
Executable file
107
doc/book/wolf_data/wolf_diet_ngsfilter.csv
Executable file
@@ -0,0 +1,107 @@
|
||||
###
|
||||
### Example of NGSFilter CSV configuration file
|
||||
###
|
||||
#
|
||||
# The CSV file can contain comments starting with the # character
|
||||
# and empty lines.
|
||||
# At the top of the file a set of lines of three or four columns and having
|
||||
# the first column containing @param can be used to define parameters
|
||||
# for the obimultiplex tool. The structure of these lines is :
|
||||
#
|
||||
# @param,parameter_name,parameter_value
|
||||
# @param,parameter_name,parameter_value1,parameter_value2
|
||||
#
|
||||
# The following lines describes the PCR multiplexed in the sequencing library.
|
||||
# The first line describes the columns of the CSV file and the following lines
|
||||
# describe the PCR multiplexed.
|
||||
#
|
||||
# Five columns are expected :
|
||||
#
|
||||
# - experiment: the experiment name
|
||||
# - sample: the sample (pcr) name
|
||||
# - sample_tag: the tag identifying the sample
|
||||
# - forward_primer: the forward primer sequence
|
||||
# - reverse_primer: the reverse primer sequence
|
||||
#
|
||||
# Supplementary columns are allowed. Their names and content will be used to
|
||||
# annotate the sequence corresponding to the sample, as the key=value; located
|
||||
# after the @ sign did in the original ngsfilter file format.
|
||||
#
|
||||
###
|
||||
### Description of the parameters
|
||||
###
|
||||
#
|
||||
# The forward_spacer and the reverse_spacer allow to specify the number of
|
||||
# nucleotide separating the 5' end of the forward or reverse primer respectively
|
||||
# to the 3' end of the tag. The default value is 0.
|
||||
#
|
||||
# The param spacer allows for specify this value for both forward and reverse
|
||||
# simultaneously. The spacer parameter can also, when used wirh two arguments,
|
||||
# allow to specify the # the spacer value for a specific primer:
|
||||
#
|
||||
# @param,spacer,CAGCTGCTATGTCGATGCTGACT,2
|
||||
#
|
||||
@param,forward_spacer,0
|
||||
@param,reverse_spacer,0
|
||||
#
|
||||
# A new method for designing indel proof tag is to not use one of the four
|
||||
# nucleotides in their sequence and to flank the tag with this fourth nucleotide.
|
||||
# That nucleotide is the tag delimiter. Similarly, to the spacer value,
|
||||
# three ways to specify the tag delimiter exist:
|
||||
# - the forward_tag_delimiter and reverse_tag_delimiter
|
||||
# - the tag_delimiter in its two forms with one and two arguments
|
||||
#
|
||||
@param,forward_tag_delimiter,0
|
||||
@param,reverse_tag_delimiter,0
|
||||
#
|
||||
# Three algorithms are available to math a pair of tags with a sample.
|
||||
# It is specified using the @matching parameter. The three possible
|
||||
# values are strict, hamming, and indel. The default value is strict.
|
||||
# As for previous parameters, forward_matching and reverse_matching can
|
||||
# be used to specify the matching value for each primer. And spacer
|
||||
# can be used with two arguments to specify the matching value for
|
||||
# a specific primer.
|
||||
#
|
||||
@param,matching,strict
|
||||
#
|
||||
# The primer_mismatches parameter allows to specify the number of errors allowed
|
||||
# when matching the primer. The default value is 2. The same declination of
|
||||
# the parameters forward_primer_mismatches and reverse_primer_mismatches exist.
|
||||
#
|
||||
@param,primer_mismatches,2
|
||||
#
|
||||
# The @indel parameter allows to specify if indel are allowed during the matching
|
||||
# of the primers to the sequence. The default value is false. forward_indel and
|
||||
# reverse_indel can be used to specify the value for each primer.
|
||||
#
|
||||
@param,indels,false
|
||||
#
|
||||
###
|
||||
### Description of the PCR multiplexed
|
||||
###
|
||||
#
|
||||
# Below is an example for the minimal description of the PCRs multiplexed in the
|
||||
# sequencing library.
|
||||
#
|
||||
# The first line is the column names and must exist.
|
||||
# Five columns are expected :
|
||||
# - experiment: the experiment name, that allows for grouping samples
|
||||
# - sample: the sample (pcr) name
|
||||
# - sample_tag: the tag identifying the sample
|
||||
# The sample tag must be unique in the library for a given pair of primers
|
||||
# + They can be a simple DNA word as here. This means that the same tag is used
|
||||
# for both primers.
|
||||
# + It can be two DNA words separated by a colon. For example, `aagtag:gaagtag`.
|
||||
# This means that the first tag is used for the forward primer and the second for the
|
||||
# reverse primers. "aagtag" is the same as "aagtag:aagtag".
|
||||
# + In the two word syntax, if a primer forward or reverse is not tagged, its tag
|
||||
# is replaced by a hyphen `-`, for example `aagtag:-` or `-:aagtag`.
|
||||
# For a given primer all the tags must have the same length.
|
||||
# - forward_primer: the forward primer sequence
|
||||
# - reverse_primer: the reverse primer sequence
|
||||
#
|
||||
experiment,sample,sample_tag,forward_primer,reverse_primer
|
||||
wolf_diet,13a_F730603,aattaac,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
|
||||
wolf_diet,15a_F730814,gaagtag,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
|
||||
wolf_diet,26a_F040644,gaatatc,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
|
||||
wolf_diet,29a_F260619,gcctcct,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
|
||||
|
Can't render this file because it contains an unexpected character in line 96 and column 24.
|
Reference in New Issue
Block a user