Adds the new version of the doc as a quarto book

This commit is contained in:
2023-01-17 19:06:14 +01:00
parent f873645e8e
commit 4592855095
36 changed files with 7238 additions and 795 deletions
+304 -439
View File
@@ -1,461 +1,326 @@
<!DOCTYPE html>
<html lang="" xml:lang="">
<head>
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
<meta charset="utf-8" />
<meta http-equiv="X-UA-Compatible" content="IE=edge" />
<title>The GO OBITools</title>
<meta name="description" content="Description of the principles used into the GO implementation of OBITools." />
<meta name="generator" content="bookdown 0.29 and GitBook 2.6.7" />
<meta charset="utf-8">
<meta name="generator" content="quarto-1.2.256">
<meta property="og:title" content="The GO OBITools" />
<meta property="og:type" content="book" />
<meta property="og:description" content="Description of the principles used into the GO implementation of OBITools." />
<meta name="github-repo" content="seankross/bookdown-start" />
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
<meta name="twitter:card" content="summary" />
<meta name="twitter:title" content="The GO OBITools" />
<meta name="twitter:description" content="Description of the principles used into the GO implementation of OBITools." />
<meta name="author" content="Eric Coissac">
<meta name="dcterms.date" content="2023-01-17">
<meta name="author" content="SEric Coissac" />
<meta name="date" content="2022-08-25" />
<meta name="viewport" content="width=device-width, initial-scale=1" />
<meta name="apple-mobile-web-app-capable" content="yes" />
<meta name="apple-mobile-web-app-status-bar-style" content="black" />
<link rel="next" href="the-obitools-commands.html"/>
<script src="book_assets/jquery-3.6.0/jquery-3.6.0.min.js"></script>
<script src="https://cdn.jsdelivr.net/npm/fuse.js@6.4.6/dist/fuse.min.js"></script>
<link href="book_assets/gitbook-2.6.7/css/style.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-table.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-bookdown.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-highlight.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-search.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-fontsettings.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-clipboard.css" rel="stylesheet" />
<link href="book_assets/anchor-sections-1.1.0/anchor-sections.css" rel="stylesheet" />
<link href="book_assets/anchor-sections-1.1.0/anchor-sections-hash.css" rel="stylesheet" />
<script src="book_assets/anchor-sections-1.1.0/anchor-sections.js"></script>
<style type="text/css">
pre > code.sourceCode { white-space: pre; position: relative; }
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
pre > code.sourceCode > span:empty { height: 1.2em; }
.sourceCode { overflow: visible; }
code.sourceCode > span { color: inherit; text-decoration: inherit; }
pre.sourceCode { margin: 0; }
@media screen {
div.sourceCode { overflow: auto; }
<title>OBITools V4</title>
<style>
code{white-space: pre-wrap;}
span.smallcaps{font-variant: small-caps;}
div.columns{display: flex; gap: min(4vw, 1.5em);}
div.column{flex: auto; overflow-x: auto;}
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
ul.task-list{list-style: none;}
ul.task-list li input[type="checkbox"] {
width: 0.8em;
margin: 0 0.8em 0.2em -1.6em;
vertical-align: middle;
}
@media print {
pre > code.sourceCode { white-space: pre-wrap; }
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
}
pre.numberSource code
{ counter-reset: source-line 0; }
pre.numberSource code > span
{ position: relative; left: -4em; counter-increment: source-line; }
pre.numberSource code > span > a:first-child::before
{ content: counter(source-line);
position: relative; left: -1em; text-align: right; vertical-align: baseline;
border: none; display: inline-block;
-webkit-touch-callout: none; -webkit-user-select: none;
-khtml-user-select: none; -moz-user-select: none;
-ms-user-select: none; user-select: none;
padding: 0 4px; width: 4em;
color: #aaaaaa;
}
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
div.sourceCode
{ }
@media screen {
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
}
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
code span.at { color: #7d9029; } /* Attribute */
code span.bn { color: #40a070; } /* BaseN */
code span.bu { } /* BuiltIn */
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
code span.ch { color: #4070a0; } /* Char */
code span.cn { color: #880000; } /* Constant */
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
code span.dt { color: #902000; } /* DataType */
code span.dv { color: #40a070; } /* DecVal */
code span.er { color: #ff0000; font-weight: bold; } /* Error */
code span.ex { } /* Extension */
code span.fl { color: #40a070; } /* Float */
code span.fu { color: #06287e; } /* Function */
code span.im { } /* Import */
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
code span.op { color: #666666; } /* Operator */
code span.ot { color: #007020; } /* Other */
code span.pp { color: #bc7a00; } /* Preprocessor */
code span.sc { color: #4070a0; } /* SpecialChar */
code span.ss { color: #bb6688; } /* SpecialString */
code span.st { color: #4070a0; } /* String */
code span.va { color: #19177c; } /* Variable */
code span.vs { color: #4070a0; } /* VerbatimString */
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
</style>
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
<script src="site_libs/quarto-nav/headroom.min.js"></script>
<script src="site_libs/clipboard/clipboard.min.js"></script>
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
<script src="site_libs/quarto-search/fuse.min.js"></script>
<script src="site_libs/quarto-search/quarto-search.js"></script>
<meta name="quarto:offset" content="./">
<link href="./intro.html" rel="next">
<script src="site_libs/quarto-html/quarto.js"></script>
<script src="site_libs/quarto-html/popper.min.js"></script>
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
<script src="site_libs/quarto-html/anchor.min.js"></script>
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
<script id="quarto-search-options" type="application/json">{
"location": "sidebar",
"copy-button": false,
"collapse-after": 3,
"panel-placement": "start",
"type": "textbox",
"limit": 20,
"language": {
"search-no-results-text": "No results",
"search-matching-documents-text": "matching documents",
"search-copy-link-title": "Copy link to search",
"search-hide-matches-text": "Hide additional matches",
"search-more-match-text": "more match in this document",
"search-more-matches-text": "more matches in this document",
"search-clear-button-title": "Clear",
"search-detached-cancel-button-title": "Cancel",
"search-submit-button-title": "Submit"
}
}</script>
</head>
<body>
<body class="nav-sidebar floating">
<div class="book without-animation with-summary font-size-2 font-family-1" data-basepath=".">
<div class="book-summary">
<nav role="navigation">
<ul class="summary">
<li class="chapter" data-level="1" data-path="index.html"><a href="index.html"><i class="fa fa-check"></i><b>1</b> The OBITools</a>
<ul>
<li class="chapter" data-level="1.1" data-path="index.html"><a href="index.html#aims-of-obitools"><i class="fa fa-check"></i><b>1.1</b> Aims of <em>OBITools</em></a></li>
<li class="chapter" data-level="1.2" data-path="index.html"><a href="index.html#file-formats-usable-with-obitools"><i class="fa fa-check"></i><b>1.2</b> File formats usable with <em>OBITools</em></a>
<ul>
<li class="chapter" data-level="1.2.1" data-path="index.html"><a href="index.html#the-sequence-files"><i class="fa fa-check"></i><b>1.2.1</b> The sequence files</a></li>
<li class="chapter" data-level="1.2.2" data-path="index.html"><a href="index.html#classical-fasta"><i class="fa fa-check"></i><b>1.2.2</b> The <em>fasta</em> format</a></li>
<li class="chapter" data-level="1.2.3" data-path="index.html"><a href="index.html#the-fastq-sequence-format"><i class="fa fa-check"></i><b>1.2.3</b> The <em>fastq</em> sequence format</a></li>
</ul></li>
<li class="chapter" data-level="1.3" data-path="index.html"><a href="index.html#file-extension"><i class="fa fa-check"></i><b>1.3</b> File extension</a></li>
<li class="chapter" data-level="1.4" data-path="index.html"><a href="index.html#see-also"><i class="fa fa-check"></i><b>1.4</b> See also</a></li>
<li class="chapter" data-level="1.5" data-path="index.html"><a href="index.html#references"><i class="fa fa-check"></i><b>1.5</b> References</a></li>
</ul></li>
<li class="chapter" data-level="2" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html"><i class="fa fa-check"></i><b>2</b> The OBITools commands</a>
<ul>
<li class="chapter" data-level="2.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#metabarcode-design-and-quality-assessment"><i class="fa fa-check"></i><b>2.1</b> Metabarcode design and quality assessment</a></li>
<li class="chapter" data-level="2.2" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#file-format-conversions"><i class="fa fa-check"></i><b>2.2</b> File format conversions</a></li>
<li class="chapter" data-level="2.3" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#sequence-annotations"><i class="fa fa-check"></i><b>2.3</b> Sequence annotations</a></li>
<li class="chapter" data-level="2.4" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#computations-on-sequences"><i class="fa fa-check"></i><b>2.4</b> Computations on sequences</a>
<ul>
<li class="chapter" data-level="2.4.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#obipairing"><i class="fa fa-check"></i><b>2.4.1</b> <code>obipairing</code></a></li>
</ul></li>
<li class="chapter" data-level="2.5" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#sequence-sampling-and-filtering"><i class="fa fa-check"></i><b>2.5</b> Sequence sampling and filtering</a>
<ul>
<li class="chapter" data-level="2.5.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#utilities"><i class="fa fa-check"></i><b>2.5.1</b> Utilities</a></li>
</ul></li>
</ul></li>
<li class="chapter" data-level="3" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html"><i class="fa fa-check"></i><b>3</b> Reference documentation for the GO <em>OBITools</em> library</a>
<ul>
<li class="chapter" data-level="3.1" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#biosequence"><i class="fa fa-check"></i><b>3.1</b> BioSequence</a>
<ul>
<li class="chapter" data-level="3.1.1" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#creating-new-instances"><i class="fa fa-check"></i><b>3.1.1</b> Creating new instances</a></li>
<li class="chapter" data-level="3.1.2" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#end-of-life-of-a-biosequence-instance"><i class="fa fa-check"></i><b>3.1.2</b> End of life of a <code>BioSequence</code> instance</a></li>
<li class="chapter" data-level="3.1.3" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#accessing-to-the-elements-of-a-sequence"><i class="fa fa-check"></i><b>3.1.3</b> Accessing to the elements of a sequence</a></li>
<li class="chapter" data-level="3.1.4" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#sequence-attributes"><i class="fa fa-check"></i><b>3.1.4</b> Sequence attributes</a></li>
</ul></li>
</ul></li>
</ul>
</nav>
<div id="quarto-search-results"></div>
<header id="quarto-header" class="headroom fixed-top">
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
<div class="container-fluid d-flex justify-content-between">
<h1 class="quarto-secondary-nav-title">OBITools V4</h1>
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
<i class="bi bi-chevron-right"></i>
</button>
</div>
<div class="book-body">
<div class="body-inner">
<div class="book-header" role="navigation">
<h1>
<i class="fa fa-circle-o-notch fa-spin"></i><a href="./">The GO <em>OBITools</em></a>
</h1>
</div>
<div class="page-wrapper" tabindex="-1" role="main">
<div class="page-inner">
<section class="normal" id="section-">
<div id="header">
<h1 class="title">The GO <em>OBITools</em></h1>
<p class="author"><em>SEric Coissac</em></p>
<p class="date"><em>2022-08-25</em></p>
</div>
<div id="the-obitools" class="section level1 hasAnchor" number="1">
<h1><span class="header-section-number">1</span> The OBITools<a href="index.html#the-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h1>
<div id="aims-of-obitools" class="section level2 hasAnchor" number="1.1">
<h2><span class="header-section-number">1.1</span> Aims of <em>OBITools</em><a href="index.html#aims-of-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h2>
</div>
<div id="file-formats-usable-with-obitools" class="section level2 hasAnchor" number="1.2">
<h2><span class="header-section-number">1.2</span> File formats usable with <em>OBITools</em><a href="index.html#file-formats-usable-with-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h2>
<div id="the-sequence-files" class="section level3 hasAnchor" number="1.2.1">
<h3><span class="header-section-number">1.2.1</span> The sequence files<a href="index.html#the-sequence-files" class="anchor-section" aria-label="Anchor link to header"></a></h3>
<p>Sequences can be stored following various format. OBITools knows some of
them. The central formats for sequence files manipulated by OBITools
scripts are the <code>fasta</code> and fastq format. OBITools extends the both
these formats by specifying a syntax to include in the definition line
data qualifying the sequence. All file formats use the <code>IUPAC</code> code for
encoding nucleotides.</p>
</div>
<div id="classical-fasta" class="section level3 hasAnchor" number="1.2.2">
<h3><span class="header-section-number">1.2.2</span> The <em>fasta</em> format<a href="index.html#classical-fasta" class="anchor-section" aria-label="Anchor link to header"></a></h3>
<p>The <strong>fasta format</strong> is certainly the most widely used sequence file
format. This is certainly due to its great simplicity. It was originally
created for the Lipman and Pearson <a href="http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation">FASTA
program</a>.
OBITools use in more of the classical :ref:<code>fasta</code> format an
:ref:<code>extended version</code> of this format where structured data are
included in the title line.</p>
<p>In <em>fasta</em> format a sequence is represented by a title line beginning
with a <strong>&gt;</strong> character and the sequences by itself following the
:doc:<code>iupac</code> code. The sequence is usually split other severals lines of
the same length (expect for the last one)</p>
<pre><code>&gt;my_sequence this is my pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT</code></pre>
<p>This is no special format for the title line excepting that this line
should be unique. Usually the first word following the <strong>&gt;</strong> character
is considered as the sequence identifier. The end of the title line
corresponding to a description of the sequence. Several sequences can be
concatenated in a same file. The description of the next sequence is
just pasted at the end of the record of the previous one</p>
<pre><code>&gt;sequence_A this is my first pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
&gt;sequence_B this is my second pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
&gt;sequence_C this is my third pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT</code></pre>
</div>
<div id="the-fastq-sequence-format" class="section level3 hasAnchor" number="1.2.3">
<h3><span class="header-section-number">1.2.3</span> The <em>fastq</em> sequence format<a href="index.html#the-fastq-sequence-format" class="anchor-section" aria-label="Anchor link to header"></a></h3>
<p>.. _classical-fastq:</p>
<p>.. note::</p>
<pre><code>This article uses material from the Wikipedia article
`FASTQ format `
which is released under the
`Creative Commons Attribution-Share-Alike License 3.0 `</code></pre>
<p><strong>fastq format</strong> is a text-based format for storing both a biological
sequence (usually nucleotide sequence) and its corresponding quality
scores. Both the sequence letter and quality score are encoded with a
single ASCII character for brevity. It was originally developed at the
<code>Wellcome Trust Sanger Institute</code> to bundle a <a href="#genuine-fasta">fasta</a>
sequence and its quality data, but has recently become the <em>de facto</em>
standard for storing the output of high throughput sequencing
instruments such as the Illumina Genome Analyzer Illumina. [1]_</p>
<div id="format" class="section level4 hasAnchor" number="1.2.3.1">
<h4><span class="header-section-number">1.2.3.1</span> Format<a href="index.html#format" class="anchor-section" aria-label="Anchor link to header"></a></h4>
<p>A fastq file normally uses four lines per sequence.</p>
<ul>
<li>Line 1 begins with a ‘@’ character and is followed by a sequence
identifier and an <em>optional</em> description (like a :ref:<code>fasta</code> title
line).</li>
<li>Line 2 is the raw sequence letters.</li>
<li>Line 3 begins with a ‘+’ character and is <em>optionally</em> followed by
the same sequence identifier (and any description) again.</li>
<li>Line 4 encodes the quality values for the sequence in Line 2, and
must contain the same number of symbols as letters in the sequence.</li>
</ul>
<p>A fastq file containing a single sequence might look like this:</p>
<pre><code>@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!&#39;&#39;*((((***+))%%%++)(%%%%).1***-+*&#39;&#39;))**55CCF&gt;&gt;&gt;&gt;&gt;&gt;CCCCCCC65</code></pre>
<p>The character ‘!’ represents the lowest quality while ‘~’ is the
highest. Here are the quality value characters in left-to-right
increasing order of quality (<code>ASCII</code>):</p>
<pre><code>!&quot;#$%&amp;&#39;()*+,-./0123456789:;&lt;=&gt;?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~</code></pre>
<p>The original Sanger FASTQ files also allowed the sequence and quality
strings to be wrapped (split over multiple lines), but this is generally
discouraged as it can make parsing complicated due to the unfortunate
choice of “@” and “+” as markers (these characters can also occur in
the quality string).</p>
</div>
<div id="variations" class="section level4 hasAnchor" number="1.2.3.2">
<h4><span class="header-section-number">1.2.3.2</span> Variations<a href="index.html#variations" class="anchor-section" aria-label="Anchor link to header"></a></h4>
<div id="quality" class="section level5 hasAnchor" number="1.2.3.2.1">
<h5><span class="header-section-number">1.2.3.2.1</span> Quality<a href="index.html#quality" class="anchor-section" aria-label="Anchor link to header"></a></h5>
<p>A quality value <em>Q</em> is an integer mapping of <em>p</em> (i.e., the probability
that the corresponding base call is incorrect). Two different equations
have been in use. The first is the standard Sanger variant to assess
reliability of a base call, otherwise known as Phred quality score:</p>
<p><span class="math display">\[
Q_\text{sanger} = -10 \, \log_{10} p
\]</span></p>
<p>The Solexa pipeline (i.e., the software delivered with the Illumina
Genome Analyzer) earlier used a different mapping, encoding the odds
<span class="math inline">\(\mathbf{p}/(1-\mathbf{p})\)</span> instead of the probability <span class="math inline">\(\mathbf{p}\)</span>:</p>
<p><span class="math display">\[
Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p}
\]</span></p>
<p>Although both mappings are asymptotically identical at higher quality
values, they differ at lower quality levels (i.e., approximately
<span class="math inline">\(\mathbf{p} &gt; 0.05\)</span>, or equivalently, <span class="math inline">\(\mathbf{Q} &lt; 13\)</span>).</p>
<p>|Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa
(black) equations (described above). The vertical dotted line indicates
<span class="math inline">\(\mathbf{p}= 0.05\)</span>, or equivalently, <span class="math inline">\(Q = 13\)</span>.|</p>
</div>
</div>
<div id="encoding" class="section level4 hasAnchor" number="1.2.3.3">
<h4><span class="header-section-number">1.2.3.3</span> Encoding<a href="index.html#encoding" class="anchor-section" aria-label="Anchor link to header"></a></h4>
<ul>
<li>Sanger format can encode a Phred quality score from 0 to 93 using
ASCII 33 to 126 (although in raw read data the Phred quality score
rarely exceeds 60, higher scores are possible in assemblies or read
maps).</li>
<li>Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality
score from -5 to 62 using ASCII 59 to 126 (although in raw read data
Solexa scores from -5 to 40 only are expected)</li>
<li>Starting with Illumina 1.3 and before Illumina 1.8, the format
encoded a Phred quality score from 0 to 62 using ASCII 64 to 126
(although in raw read data Phred scores from 0 to 40 only are
expected).</li>
<li>Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0
to 2 have a slightly different meaning. The values 0 and 1 are no
longer used and the value 2, encoded by ASCII 66 “B”.</li>
</ul>
<p>Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part
# 15009921 Rev. A, November
2009] [<a href="http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\" class="uri">http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\\</a>](<a href="http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf)%7B.uri%7D" class="uri">http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\</a>
(page 30) states the following: <em>If a read ends with a segment of mostly
low quality (Q15 or below), then all of the quality values in the
segment are replaced with a value of 2 (encoded as the letter B in
Illumina’s text-based encoding of quality scores)… This Q2 indicator
does not predict a specific error rate, but rather indicates that a
specific final portion of the read should not be used in further
analyses.</em> Also, the quality score encoded as “B” letter may occur
internally within reads at least as late as pipeline version 1.6, as
shown in the following example:</p>
<pre><code>@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB</code></pre>
<p>An alternative interpretation of this ASCII encoding has been proposed.
Also, in Illumina runs using PhiX controls, the character ‘B’ was
observed to represent an “unknown quality score”. The error rate of ‘B’
reads was roughly 3 phred scores lower the mean observed score of a
given run.</p>
<ul>
<li>Starting in Illumina 1.8, the quality scores have basically returned
to the use of the Sanger format (Phred+33).</li>
</ul>
</div>
</div>
</div>
<div id="file-extension" class="section level2 hasAnchor" number="1.3">
<h2><span class="header-section-number">1.3</span> File extension<a href="index.html#file-extension" class="anchor-section" aria-label="Anchor link to header"></a></h2>
<p>There is no standard file extension for a FASTQ file, but .fq and
.fastq, are commonly used.</p>
</div>
<div id="see-also" class="section level2 hasAnchor" number="1.4">
<h2><span class="header-section-number">1.4</span> See also<a href="index.html#see-also" class="anchor-section" aria-label="Anchor link to header"></a></h2>
<ul>
<li>:ref:<code>fasta</code></li>
</ul>
</div>
<div id="references" class="section level2 hasAnchor" number="1.5">
<h2><span class="header-section-number">1.5</span> References<a href="index.html#references" class="anchor-section" aria-label="Anchor link to header"></a></h2>
<p>.. [1] Cock et al (2009) The Sanger FASTQ file format for sequences with
quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids
Research,</p>
<p>.. [2] Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego,
Illumina <code>1</code>__</p>
<p>.. |Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa
(black) equations (described above). The vertical dotted line indicates
<em>p</em> = 0.05, or equivalently, <em>Q</em> Å 13.| image:: Probability metrics.png</p>
<p>See <a href="http://en.wikipedia.org/wiki/FASTQ_format" class="uri">http://en.wikipedia.org/wiki/FASTQ_format</a></p>
</div>
</div>
</section>
</div>
</nav>
</header>
<!-- content -->
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
<!-- sidebar -->
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
<div class="pt-lg-2 mt-2 text-left sidebar-header">
<div class="sidebar-title mb-0 py-0">
<a href="./">OBITools V4</a>
</div>
</div>
<div class="mt-2 flex-shrink-0 align-items-center">
<div class="sidebar-search">
<div id="quarto-search" class="" title="Search"></div>
</div>
</div>
<div class="sidebar-menu-container">
<ul class="list-unstyled mt-1">
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./index.html" class="sidebar-item-text sidebar-link active">Preface</a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./intro.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span>&nbsp; <span class="chapter-title">The OBITools</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">The <em>OBITools</em> commands</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
</div>
</li>
</ul>
</div>
</nav>
<!-- margin-sidebar -->
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
<nav id="TOC" role="doc-toc" class="toc-active">
<h2 id="toc-title">Table of contents</h2>
<ul>
<li><a href="#preface" id="toc-preface" class="nav-link active" data-scroll-target="#preface">Preface</a></li>
</ul>
</nav>
</div>
<!-- main -->
<main class="content" id="quarto-document-content">
<a href="the-obitools-commands.html" class="navigation navigation-next navigation-unique" aria-label="Next page"><i class="fa fa-angle-right"></i></a>
<header id="title-block-header" class="quarto-title-block default">
<div class="quarto-title">
<h1 class="title d-none d-lg-block">OBITools V4</h1>
</div>
<div class="quarto-title-meta">
<div>
<div class="quarto-title-meta-heading">Author</div>
<div class="quarto-title-meta-contents">
<p>Eric Coissac </p>
</div>
</div>
<div>
<div class="quarto-title-meta-heading">Published</div>
<div class="quarto-title-meta-contents">
<p class="date">January 17, 2023</p>
</div>
</div>
<script src="book_assets/gitbook-2.6.7/js/app.min.js"></script>
<script src="book_assets/gitbook-2.6.7/js/clipboard.min.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-search.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-sharing.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-fontsettings.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-bookdown.js"></script>
<script src="book_assets/gitbook-2.6.7/js/jquery.highlight.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-clipboard.js"></script>
<script>
gitbook.require(["gitbook"], function(gitbook) {
gitbook.start({
"sharing": {
"github": false,
"facebook": true,
"twitter": true,
"linkedin": false,
"weibo": false,
"instapaper": false,
"vk": false,
"whatsapp": false,
"all": ["facebook", "twitter", "linkedin", "weibo", "instapaper"]
},
"fontsettings": {
"theme": "white",
"family": "sans",
"size": 2
},
"edit": {
"link": null,
"text": null
},
"history": {
"link": null,
"text": null
},
"view": {
"link": null,
"text": null
},
"download": ["_main.pdf"],
"search": {
"engine": "fuse",
"options": null
},
"toc": {
"collapse": "subsection"
}
});
</div>
</header>
<section id="preface" class="level1 unnumbered">
<h1 class="unnumbered">Preface</h1>
<p>The first version of <em>OBITools</em> started to be developed in 2005. This was at the beginning of the DNA metabarcoding story at the Laboratoire d’Ecologie Alpine (LECA) in Grenoble. At that time, with Pierre Taberlet and François Pompanon, we were thinking about the potential of this new methodology under development. PIerre and François developed more the laboratory methods, while I was thinking more about the tools for analysing the sequences produced. Two ideas were behind this development. I wanted something modular, and something easy to extend. To achieve the first goal, I decided to implement obitools as a suite of unix commands mimicking the classic unix commands but dedicated to sequence files. The basic unix commands are very useful for automatically manipulating, parsing and editing text files. They work in flow, line by line on the input text. The result is a new text file that can be used as input for the next command. Such a design makes it possible to quickly develop a text processing pipeline by chaining simple elementary operations. The <em>OBITools</em> are the exact counterpart of these basic Unix commands, but the basic information they process is a sequence (potentially spanning several lines of text), not a single line of text. Most <em>OBITools</em> consume sequence files and produce sequence files. Thus, the principles of chaining and modularity are respected. In order to be able to easily extend the <em>OBITools</em> to keep up with our evolving ideas about processing DNA metabarcoding data, it was decided to develop them using an interpreted language: Python. Python 2, the version available at the time, allowed us to develop the <em>OBITools</em> efficiently. When parts of the algorithms were computationally demanding, they were implemented in C and linked to the Python code. Even though Python is not the most efficient language available, even though computers were not as powerful as they are today, the size of the data we could produce using 454 sequencers or early solexa machines was small enough to be processed in a reasonable time.</p>
</section>
</main> <!-- /main -->
<script id="quarto-html-after-body" type="application/javascript">
window.document.addEventListener("DOMContentLoaded", function (event) {
const toggleBodyColorMode = (bsSheetEl) => {
const mode = bsSheetEl.getAttribute("data-mode");
const bodyEl = window.document.querySelector("body");
if (mode === "dark") {
bodyEl.classList.add("quarto-dark");
bodyEl.classList.remove("quarto-light");
} else {
bodyEl.classList.add("quarto-light");
bodyEl.classList.remove("quarto-dark");
}
}
const toggleBodyColorPrimary = () => {
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
if (bsSheetEl) {
toggleBodyColorMode(bsSheetEl);
}
}
toggleBodyColorPrimary();
const icon = "";
const anchorJS = new window.AnchorJS();
anchorJS.options = {
placement: 'right',
icon: icon
};
anchorJS.add('.anchored');
const clipboard = new window.ClipboardJS('.code-copy-button', {
target: function(trigger) {
return trigger.previousElementSibling;
}
});
clipboard.on('success', function(e) {
// button target
const button = e.trigger;
// don't keep focus
button.blur();
// flash "checked"
button.classList.add('code-copy-button-checked');
var currentTitle = button.getAttribute("title");
button.setAttribute("title", "Copied!");
let tooltip;
if (window.bootstrap) {
button.setAttribute("data-bs-toggle", "tooltip");
button.setAttribute("data-bs-placement", "left");
button.setAttribute("data-bs-title", "Copied!");
tooltip = new bootstrap.Tooltip(button,
{ trigger: "manual",
customClass: "code-copy-button-tooltip",
offset: [0, -8]});
tooltip.show();
}
setTimeout(function() {
if (tooltip) {
tooltip.hide();
button.removeAttribute("data-bs-title");
button.removeAttribute("data-bs-toggle");
button.removeAttribute("data-bs-placement");
}
button.setAttribute("title", currentTitle);
button.classList.remove('code-copy-button-checked');
}, 1000);
// clear code selection
e.clearSelection();
});
function tippyHover(el, contentFn) {
const config = {
allowHTML: true,
content: contentFn,
maxWidth: 500,
delay: 100,
arrow: false,
appendTo: function(el) {
return el.parentElement;
},
interactive: true,
interactiveBorder: 10,
theme: 'quarto',
placement: 'bottom-start'
};
window.tippy(el, config);
}
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
for (var i=0; i<noterefs.length; i++) {
const ref = noterefs[i];
tippyHover(ref, function() {
// use id or data attribute instead here
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
try { href = new URL(href).hash; } catch {}
const id = href.replace(/^#\/?/, "");
const note = window.document.getElementById(id);
return note.innerHTML;
});
}
const findCites = (el) => {
const parentEl = el.parentElement;
if (parentEl) {
const cites = parentEl.dataset.cites;
if (cites) {
return {
el,
cites: cites.split(' ')
};
} else {
return findCites(el.parentElement)
}
} else {
return undefined;
}
};
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
for (var i=0; i<bibliorefs.length; i++) {
const ref = bibliorefs[i];
const citeInfo = findCites(ref);
if (citeInfo) {
tippyHover(citeInfo.el, function() {
var popup = window.document.createElement('div');
citeInfo.cites.forEach(function(cite) {
var citeDiv = window.document.createElement('div');
citeDiv.classList.add('hanging-indent');
citeDiv.classList.add('csl-entry');
var biblioDiv = window.document.getElementById('ref-' + cite);
if (biblioDiv) {
citeDiv.innerHTML = biblioDiv.innerHTML;
}
popup.appendChild(citeDiv);
});
return popup.innerHTML;
});
}
}
});
</script>
<nav class="page-navigation">
<div class="nav-page nav-page-previous">
</div>
<div class="nav-page nav-page-next">
<a href="./intro.html" class="pagination-link">
<span class="nav-page-text"><span class="chapter-number">1</span>&nbsp; <span class="chapter-title">The OBITools</span></span> <i class="bi bi-arrow-right-short"></i>
</a>
</div>
</nav>
</div> <!-- /content -->
<!-- dynamically load mathjax for compatibility with self-contained -->
<script>
(function () {
var script = document.createElement("script");
script.type = "text/javascript";
var src = "true";
if (src === "" || src === "true") src = "https://cdnjs.cloudflare.com/ajax/libs/mathjax/2.7.9/latest.js?config=TeX-MML-AM_CHTML";
if (location.protocol !== "file:")
if (/^https?:/.test(src))
src = src.replace(/^https?:/, '');
script.src = src;
document.getElementsByTagName("head")[0].appendChild(script);
})();
</script>
</body>
</html>
</body></html>