mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-03-26 05:50:52 +00:00
Add jj Makefile targets and k-mer encoding utilities
Add new Makefile targets for jj operations (jjnew, jjpush, jjfetch) to streamline commit workflow. Introduce k-mer encoding utilities in pkg/obikmer: - EncodeKmers: converts DNA sequences to encoded k-mers - ReverseComplement: computes reverse complement of k-mers - NormalizeKmer: returns canonical form of k-mers - EncodeNormalizedKmers: encodes sequences with normalized k-mers Add comprehensive tests for k-mer encoding functions including edge cases, buffer reuse, and performance benchmarks. Document k-mer index design for large genomes, covering: - Use cases and objectives - Volume estimations - Distance metrics (Jaccard, Sørensen-Dice, Bray-Curtis) - Indexing options (Bloom filters, sorted sets, MPHF) - Optimization techniques (k-2-mer indexing) - MinHash for distance acceleration - Recommended architecture for presence/absence and counting queries
This commit is contained in:
24
Makefile
24
Makefile
@@ -108,5 +108,27 @@ ifneq ($(strip $(COMMIT_ID)),)
|
||||
@rm -f $(OUTPUT)
|
||||
endif
|
||||
|
||||
.PHONY: all obitools update-deps obitests githubtests .FORCE
|
||||
jjnew:
|
||||
@echo "$(YELLOW)→ Creating a new commit...$(NC)"
|
||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
||||
@jj auto-describe
|
||||
@echo "$(BLUE)→ Done.$(NC)"
|
||||
@jj new
|
||||
@echo "$(GREEN)✓ New commit created$(NC)"
|
||||
|
||||
jjpush:
|
||||
@echo "$(YELLOW)→ Pushing commit to repository...$(NC)"
|
||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
||||
@jj auto-describe
|
||||
@echo "$(BLUE)→ Done.$(NC)"
|
||||
@jj git push --change @
|
||||
@echo "$(GREEN)✓ Commit pushed to repository$(NC)"
|
||||
|
||||
jjfetch:
|
||||
@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
|
||||
@jj git fetch
|
||||
@jj new master@origin
|
||||
@echo "$(GREEN)✓ Latest commits pulled$(NC)"
|
||||
|
||||
.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjfetch .FORCE
|
||||
.FORCE:
|
||||
213
blackboard/Prospective/kmer_index_design.md
Normal file
213
blackboard/Prospective/kmer_index_design.md
Normal file
@@ -0,0 +1,213 @@
|
||||
# Index de k-mers pour génomes de grande taille
|
||||
|
||||
## Contexte et objectifs
|
||||
|
||||
### Cas d'usage
|
||||
|
||||
- Indexation de k-mers longs (k=31) pour des génomes de grande taille (< 10 Go par génome)
|
||||
- Nombre de génomes : plusieurs dizaines à quelques centaines
|
||||
- Indexation en parallèle
|
||||
- Stockage sur disque
|
||||
- Possibilité d'ajouter des génomes, mais pas de modifier un génome existant
|
||||
|
||||
### Requêtes cibles
|
||||
|
||||
- **Présence/absence** d'un k-mer dans un génome
|
||||
- **Intersection** entre génomes
|
||||
- **Distances** : Jaccard (présence/absence) et potentiellement Bray-Curtis (comptage)
|
||||
|
||||
### Ressources disponibles
|
||||
|
||||
- 128 Go de RAM
|
||||
- Stockage disque
|
||||
|
||||
---
|
||||
|
||||
## Estimation des volumes
|
||||
|
||||
### Par génome
|
||||
|
||||
- **10 Go de séquence** → ~10¹⁰ k-mers bruts (chevauchants)
|
||||
- **Après déduplication** : typiquement 10-50% de k-mers uniques → **~1-5 × 10⁹ k-mers distincts**
|
||||
|
||||
### Espace théorique
|
||||
|
||||
- **k=31** → 62 bits → ~4.6 × 10¹⁸ k-mers possibles
|
||||
- Table d'indexation directe impossible
|
||||
|
||||
---
|
||||
|
||||
## Métriques de distance
|
||||
|
||||
### Présence/absence (binaire)
|
||||
|
||||
- **Jaccard** : |A ∩ B| / |A ∪ B|
|
||||
- **Sørensen-Dice** : 2|A ∩ B| / (|A| + |B|)
|
||||
|
||||
### Comptage (abondance)
|
||||
|
||||
- **Bray-Curtis** : 1 - (2 × Σ min(aᵢ, bᵢ)) / (Σ aᵢ + Σ bᵢ)
|
||||
|
||||
Note : Pour Bray-Curtis, le stockage des comptages est nécessaire, ce qui augmente significativement la taille de l'index.
|
||||
|
||||
---
|
||||
|
||||
## Options d'indexation
|
||||
|
||||
### Option 1 : Bloom Filter par génome
|
||||
|
||||
**Principe** : Structure probabiliste pour test d'appartenance.
|
||||
|
||||
**Avantages :**
|
||||
- Très compact : ~10 bits/élément pour FPR ~1%
|
||||
- Construction rapide, streaming
|
||||
- Facile à sérialiser/désérialiser
|
||||
- Intersection et Jaccard estimables via formules analytiques
|
||||
|
||||
**Inconvénients :**
|
||||
- Faux positifs (pas de faux négatifs)
|
||||
- Distances approximatives
|
||||
|
||||
**Taille estimée** : 1-6 Go par génome (selon FPR cible)
|
||||
|
||||
#### Dimensionnement des Bloom filters
|
||||
|
||||
```
|
||||
\mathrm{FPR} ;=; \left(1 - e^{-h n / m}\right)^h
|
||||
```
|
||||
|
||||
|
||||
| Bits/élément | FPR optimal | k (hash functions) |
|
||||
|--------------|-------------|---------------------|
|
||||
| 8 | ~2% | 5-6 |
|
||||
| 10 | ~1% | 7 |
|
||||
| 12 | ~0.3% | 8 |
|
||||
| 16 | ~0.01% | 11 |
|
||||
|
||||
Formule du taux de faux positifs :
|
||||
```
|
||||
FPR ≈ (1 - e^(-kn/m))^k
|
||||
```
|
||||
Où n = nombre d'éléments, m = nombre de bits, k = nombre de hash functions.
|
||||
|
||||
### Option 2 : Ensemble trié de k-mers
|
||||
|
||||
**Principe** : Stocker les k-mers (uint64) triés, avec compression possible.
|
||||
|
||||
**Avantages :**
|
||||
- Exact (pas de faux positifs)
|
||||
- Intersection/union par merge sort O(n+m)
|
||||
- Compression efficace (delta encoding sur k-mers triés)
|
||||
|
||||
**Inconvénients :**
|
||||
- Plus volumineux : 8 octets/k-mer
|
||||
- Construction plus lente (tri nécessaire)
|
||||
|
||||
**Taille estimée** : 8-40 Go par génome (non compressé)
|
||||
|
||||
### Option 3 : MPHF (Minimal Perfect Hash Function)
|
||||
|
||||
**Principe** : Fonction de hash parfaite minimale pour les k-mers présents.
|
||||
|
||||
**Avantages :**
|
||||
- Très compact : ~3-4 bits/élément
|
||||
- Lookup O(1)
|
||||
- Exact pour les k-mers présents
|
||||
|
||||
**Inconvénients :**
|
||||
- Construction coûteuse (plusieurs passes)
|
||||
- Statique (pas d'ajout de k-mers après construction)
|
||||
- Ne distingue pas "absent" vs "jamais vu" sans structure auxiliaire
|
||||
|
||||
### Option 4 : Hybride MPHF + Bloom filter
|
||||
|
||||
- MPHF pour mapping compact des k-mers présents
|
||||
- Bloom filter pour pré-filtrage des absents
|
||||
|
||||
---
|
||||
|
||||
## Optimisation : Indexation de (k-2)-mers pour requêtes k-mers
|
||||
|
||||
### Principe
|
||||
|
||||
Au lieu d'indexer directement les 31-mers dans un Bloom filter, on indexe les 29-mers. Pour tester la présence d'un 31-mer, on vérifie que les **trois 29-mers** qu'il contient sont présents :
|
||||
|
||||
- positions 0-28
|
||||
- positions 1-29
|
||||
- positions 2-30
|
||||
|
||||
### Analyse probabiliste
|
||||
|
||||
Si le Bloom filter a un FPR de p pour un 29-mer individuel, le FPR effectif pour un 31-mer devient **p³** (les trois requêtes doivent toutes être des faux positifs).
|
||||
|
||||
| FPR 29-mer | FPR 31-mer effectif |
|
||||
|------------|---------------------|
|
||||
| 10% | 0.1% |
|
||||
| 5% | 0.0125% |
|
||||
| 1% | 0.0001% |
|
||||
|
||||
### Avantages
|
||||
|
||||
1. **Moins d'éléments à stocker** : il y a moins de 29-mers distincts que de 31-mers distincts dans un génome (deux 31-mers différents peuvent partager un même 29-mer)
|
||||
|
||||
2. **FPR drastiquement réduit** : FPR³ avec seulement 3 requêtes
|
||||
|
||||
3. **Index plus compact** : on peut utiliser moins de bits par élément (FPR plus élevé acceptable sur le 29-mer) tout en obtenant un FPR très bas sur le 31-mer
|
||||
|
||||
### Trade-off
|
||||
|
||||
Un Bloom filter à **5-6 bits/élément** pour les 29-mers donnerait un FPR effectif < 0.01% pour les 31-mers, soit environ **2× plus compact** que l'approche directe à qualité égale.
|
||||
|
||||
**Coût** : 3× plus de requêtes par lookup (mais les requêtes Bloom sont très rapides).
|
||||
|
||||
---
|
||||
|
||||
## Accélération des calculs de distance : MinHash
|
||||
|
||||
### Principe
|
||||
|
||||
Pré-calculer une "signature" compacte (sketch) de chaque génome permettant d'estimer rapidement Jaccard sans charger les index complets.
|
||||
|
||||
### Avantages
|
||||
|
||||
- Matrice de distances entre 100+ génomes en quelques secondes
|
||||
- Signature de taille fixe (ex: 1000-10000 hash values) quel que soit le génome
|
||||
- Stockage minimal
|
||||
|
||||
### Utilisation
|
||||
|
||||
1. Construction : une passe sur les k-mers de chaque génome
|
||||
2. Distance : comparaison des sketches en O(taille du sketch)
|
||||
|
||||
---
|
||||
|
||||
## Architecture recommandée
|
||||
|
||||
### Pour présence/absence + Jaccard
|
||||
|
||||
1. **Index principal** : Bloom filter de (k-2)-mers avec l'optimisation décrite
|
||||
- Compact (~3-5 Go par génome)
|
||||
- FPR très bas pour les k-mers grâce aux requêtes triples
|
||||
|
||||
2. **Sketches MinHash** : pour calcul rapide des distances entre génomes
|
||||
- Quelques Ko par génome
|
||||
- Permet exploration rapide de la matrice de distances
|
||||
|
||||
### Pour comptage + Bray-Curtis
|
||||
|
||||
1. **Index principal** : k-mers triés + comptages
|
||||
- uint64 (k-mer) + uint8/uint16 (count)
|
||||
- Compression delta possible
|
||||
- Plus volumineux mais exact
|
||||
|
||||
2. **Sketches** : variantes de MinHash pour données pondérées (ex: HyperMinHash)
|
||||
|
||||
---
|
||||
|
||||
## Prochaines étapes
|
||||
|
||||
1. Implémenter un Bloom filter optimisé pour k-mers
|
||||
2. Implémenter l'optimisation (k-2)-mer → k-mer
|
||||
3. Implémenter MinHash pour les sketches
|
||||
4. Définir le format de sérialisation sur disque
|
||||
5. Benchmarker sur des génomes réels
|
||||
183
pkg/obikmer/encodekmer.go
Normal file
183
pkg/obikmer/encodekmer.go
Normal file
@@ -0,0 +1,183 @@
|
||||
package obikmer
|
||||
|
||||
// EncodeKmers converts a DNA sequence to a slice of encoded k-mers.
|
||||
// Each nucleotide is encoded on 2 bits according to __single_base_code__:
|
||||
// - A = 0 (00)
|
||||
// - C = 1 (01)
|
||||
// - G = 2 (10)
|
||||
// - T/U = 3 (11)
|
||||
//
|
||||
// The function returns overlapping k-mers of size k encoded as uint64.
|
||||
// For a sequence of length n, it returns n-k+1 k-mers.
|
||||
//
|
||||
// Parameters:
|
||||
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
||||
// - k: k-mer size (must be between 1 and 32)
|
||||
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
|
||||
//
|
||||
// Returns:
|
||||
// - slice of uint64 encoded k-mers
|
||||
// - nil if sequence is shorter than k or k is invalid
|
||||
func EncodeKmers(seq []byte, k int, buffer *[]uint64) []uint64 {
|
||||
if k < 1 || k > 32 || len(seq) < k {
|
||||
return nil
|
||||
}
|
||||
|
||||
n := len(seq) - k + 1
|
||||
|
||||
var result []uint64
|
||||
if buffer == nil {
|
||||
result = make([]uint64, 0, n)
|
||||
} else {
|
||||
result = (*buffer)[:0]
|
||||
}
|
||||
|
||||
// Mask to keep only k*2 bits
|
||||
mask := uint64(1)<<(k*2) - 1
|
||||
|
||||
// Build the first k-mer
|
||||
var kmer uint64
|
||||
for i := 0; i < k; i++ {
|
||||
kmer <<= 2
|
||||
kmer |= uint64(__single_base_code__[seq[i]&31])
|
||||
}
|
||||
result = append(result, kmer)
|
||||
|
||||
// Slide through the rest of the sequence
|
||||
for i := k; i < len(seq); i++ {
|
||||
kmer <<= 2
|
||||
kmer |= uint64(__single_base_code__[seq[i]&31])
|
||||
kmer &= mask
|
||||
result = append(result, kmer)
|
||||
}
|
||||
|
||||
return result
|
||||
}
|
||||
|
||||
// ReverseComplement computes the reverse complement of an encoded k-mer.
|
||||
// The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11).
|
||||
// The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11.
|
||||
// The reverse swaps the order of 2-bit pairs.
|
||||
//
|
||||
// Parameters:
|
||||
// - kmer: the encoded k-mer
|
||||
// - k: the k-mer size (number of nucleotides)
|
||||
//
|
||||
// Returns:
|
||||
// - the reverse complement of the k-mer
|
||||
func ReverseComplement(kmer uint64, k int) uint64 {
|
||||
// Step 1: Complement - XOR with all 1s to flip A↔T and C↔G
|
||||
// For a k-mer of size k, we only want to flip the lower k*2 bits
|
||||
mask := uint64(1)<<(k*2) - 1
|
||||
rc := (^kmer) & mask
|
||||
|
||||
// Step 2: Reverse the order of 2-bit pairs
|
||||
// We use a series of swaps at increasing granularity
|
||||
rc = ((rc & 0x3333333333333333) << 2) | ((rc & 0xCCCCCCCCCCCCCCCC) >> 2) // Swap adjacent pairs
|
||||
rc = ((rc & 0x0F0F0F0F0F0F0F0F) << 4) | ((rc & 0xF0F0F0F0F0F0F0F0) >> 4) // Swap nibbles
|
||||
rc = ((rc & 0x00FF00FF00FF00FF) << 8) | ((rc & 0xFF00FF00FF00FF00) >> 8) // Swap bytes
|
||||
rc = ((rc & 0x0000FFFF0000FFFF) << 16) | ((rc & 0xFFFF0000FFFF0000) >> 16) // Swap 16-bit words
|
||||
rc = (rc << 32) | (rc >> 32) // Swap 32-bit words
|
||||
|
||||
// Step 3: Shift right to align the k-mer (we reversed all 32 pairs, need only k)
|
||||
rc >>= (64 - k*2)
|
||||
|
||||
return rc
|
||||
}
|
||||
|
||||
// NormalizeKmer returns the lexicographically smaller of a k-mer and its
|
||||
// reverse complement. This canonical form ensures that a k-mer and its
|
||||
// reverse complement map to the same value.
|
||||
//
|
||||
// Parameters:
|
||||
// - kmer: the encoded k-mer
|
||||
// - k: the k-mer size (number of nucleotides)
|
||||
//
|
||||
// Returns:
|
||||
// - the canonical (normalized) k-mer
|
||||
func NormalizeKmer(kmer uint64, k int) uint64 {
|
||||
rc := ReverseComplement(kmer, k)
|
||||
if rc < kmer {
|
||||
return rc
|
||||
}
|
||||
return kmer
|
||||
}
|
||||
|
||||
// EncodeNormalizedKmers converts a DNA sequence to a slice of normalized k-mers.
|
||||
// Each k-mer is replaced by the lexicographically smaller of itself and its
|
||||
// reverse complement. This ensures that forward and reverse complement sequences
|
||||
// produce the same k-mer set.
|
||||
//
|
||||
// Parameters:
|
||||
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
||||
// - k: k-mer size (must be between 1 and 32)
|
||||
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
|
||||
//
|
||||
// Returns:
|
||||
// - slice of uint64 normalized k-mers
|
||||
// - nil if sequence is shorter than k or k is invalid
|
||||
func EncodeNormalizedKmers(seq []byte, k int, buffer *[]uint64) []uint64 {
|
||||
if k < 1 || k > 32 || len(seq) < k {
|
||||
return nil
|
||||
}
|
||||
|
||||
n := len(seq) - k + 1
|
||||
|
||||
var result []uint64
|
||||
if buffer == nil {
|
||||
result = make([]uint64, 0, n)
|
||||
} else {
|
||||
result = (*buffer)[:0]
|
||||
}
|
||||
|
||||
// Mask to keep only k*2 bits
|
||||
mask := uint64(1)<<(k*2) - 1
|
||||
|
||||
// Shift amount for adding to reverse complement (high position)
|
||||
rcShift := uint((k - 1) * 2)
|
||||
|
||||
// Complement lookup: A(00)->T(11), C(01)->G(10), G(10)->C(01), T(11)->A(00)
|
||||
// This is simply XOR with 3
|
||||
|
||||
// Build the first k-mer (forward and reverse complement)
|
||||
var fwd, rvc uint64
|
||||
for i := 0; i < k; i++ {
|
||||
code := uint64(__single_base_code__[seq[i]&31])
|
||||
// Forward: shift left and add new code at low end
|
||||
fwd <<= 2
|
||||
fwd |= code
|
||||
// Reverse complement: shift right and add complement at high end
|
||||
rvc >>= 2
|
||||
rvc |= (code ^ 3) << rcShift
|
||||
}
|
||||
|
||||
// Store the normalized (canonical) k-mer
|
||||
if fwd <= rvc {
|
||||
result = append(result, fwd)
|
||||
} else {
|
||||
result = append(result, rvc)
|
||||
}
|
||||
|
||||
// Slide through the rest of the sequence
|
||||
for i := k; i < len(seq); i++ {
|
||||
code := uint64(__single_base_code__[seq[i]&31])
|
||||
|
||||
// Update forward k-mer: shift left, add new code, mask
|
||||
fwd <<= 2
|
||||
fwd |= code
|
||||
fwd &= mask
|
||||
|
||||
// Update reverse complement: shift right, add complement at high end
|
||||
rvc >>= 2
|
||||
rvc |= (code ^ 3) << rcShift
|
||||
|
||||
// Store the normalized k-mer
|
||||
if fwd <= rvc {
|
||||
result = append(result, fwd)
|
||||
} else {
|
||||
result = append(result, rvc)
|
||||
}
|
||||
}
|
||||
|
||||
return result
|
||||
}
|
||||
518
pkg/obikmer/encodekmer_test.go
Normal file
518
pkg/obikmer/encodekmer_test.go
Normal file
@@ -0,0 +1,518 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bytes"
|
||||
"testing"
|
||||
)
|
||||
|
||||
// TestEncodeKmersBasic tests basic k-mer encoding
|
||||
func TestEncodeKmersBasic(t *testing.T) {
|
||||
tests := []struct {
|
||||
name string
|
||||
seq string
|
||||
k int
|
||||
expected []uint64
|
||||
}{
|
||||
{
|
||||
name: "simple 4-mer ACGT",
|
||||
seq: "ACGT",
|
||||
k: 4,
|
||||
expected: []uint64{0b00011011}, // A=00, C=01, G=10, T=11 -> 00 01 10 11 = 27
|
||||
},
|
||||
{
|
||||
name: "simple 2-mer AC",
|
||||
seq: "AC",
|
||||
k: 2,
|
||||
expected: []uint64{0b0001}, // A=00, C=01 -> 00 01 = 1
|
||||
},
|
||||
{
|
||||
name: "sliding 2-mer ACGT",
|
||||
seq: "ACGT",
|
||||
k: 2,
|
||||
expected: []uint64{0b0001, 0b0110, 0b1011}, // AC=1, CG=6, GT=11
|
||||
},
|
||||
{
|
||||
name: "lowercase",
|
||||
seq: "acgt",
|
||||
k: 4,
|
||||
expected: []uint64{0b00011011},
|
||||
},
|
||||
{
|
||||
name: "with U instead of T",
|
||||
seq: "ACGU",
|
||||
k: 4,
|
||||
expected: []uint64{0b00011011}, // U encodes same as T
|
||||
},
|
||||
{
|
||||
name: "8-mer",
|
||||
seq: "ACGTACGT",
|
||||
k: 8,
|
||||
expected: []uint64{0b0001101100011011}, // ACGTACGT
|
||||
},
|
||||
{
|
||||
name: "32-mer max size",
|
||||
seq: "ACGTACGTACGTACGTACGTACGTACGTACGT",
|
||||
k: 32,
|
||||
expected: []uint64{0x1B1B1B1B1B1B1B1B}, // ACGTACGT repeated 4 times
|
||||
},
|
||||
{
|
||||
name: "longer sequence sliding",
|
||||
seq: "AAACCCGGG",
|
||||
k: 3,
|
||||
expected: []uint64{
|
||||
0b000000, // AAA = 0
|
||||
0b000001, // AAC = 1
|
||||
0b000101, // ACC = 5
|
||||
0b010101, // CCC = 21
|
||||
0b010110, // CCG = 22
|
||||
0b011010, // CGG = 26
|
||||
0b101010, // GGG = 42
|
||||
},
|
||||
},
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
t.Run(tt.name, func(t *testing.T) {
|
||||
result := EncodeKmers([]byte(tt.seq), tt.k, nil)
|
||||
|
||||
if len(result) != len(tt.expected) {
|
||||
t.Errorf("length mismatch: got %d, want %d", len(result), len(tt.expected))
|
||||
return
|
||||
}
|
||||
|
||||
for i, v := range result {
|
||||
if v != tt.expected[i] {
|
||||
t.Errorf("position %d: got %d (0b%b), want %d (0b%b)",
|
||||
i, v, v, tt.expected[i], tt.expected[i])
|
||||
}
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
|
||||
// TestEncodeKmersEdgeCases tests edge cases
|
||||
func TestEncodeKmersEdgeCases(t *testing.T) {
|
||||
// Empty sequence
|
||||
result := EncodeKmers([]byte{}, 4, nil)
|
||||
if result != nil {
|
||||
t.Errorf("empty sequence should return nil, got %v", result)
|
||||
}
|
||||
|
||||
// k > sequence length
|
||||
result = EncodeKmers([]byte("ACG"), 4, nil)
|
||||
if result != nil {
|
||||
t.Errorf("k > seq length should return nil, got %v", result)
|
||||
}
|
||||
|
||||
// k = 0
|
||||
result = EncodeKmers([]byte("ACGT"), 0, nil)
|
||||
if result != nil {
|
||||
t.Errorf("k=0 should return nil, got %v", result)
|
||||
}
|
||||
|
||||
// k > 32
|
||||
result = EncodeKmers([]byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGT"), 33, nil)
|
||||
if result != nil {
|
||||
t.Errorf("k>32 should return nil, got %v", result)
|
||||
}
|
||||
|
||||
// k = sequence length (single k-mer)
|
||||
result = EncodeKmers([]byte("ACGT"), 4, nil)
|
||||
if len(result) != 1 {
|
||||
t.Errorf("k=seq_len should return 1 k-mer, got %d", len(result))
|
||||
}
|
||||
}
|
||||
|
||||
// TestEncodeKmersBuffer tests buffer reuse
|
||||
func TestEncodeKmersBuffer(t *testing.T) {
|
||||
seq := []byte("ACGTACGTACGT")
|
||||
k := 4
|
||||
|
||||
// First call without buffer
|
||||
result1 := EncodeKmers(seq, k, nil)
|
||||
|
||||
// Second call with buffer - pre-allocate with capacity
|
||||
buffer := make([]uint64, 0, 100)
|
||||
result2 := EncodeKmers(seq, k, &buffer)
|
||||
|
||||
if len(result1) != len(result2) {
|
||||
t.Errorf("buffer reuse: length mismatch %d vs %d", len(result1), len(result2))
|
||||
}
|
||||
|
||||
for i := range result1 {
|
||||
if result1[i] != result2[i] {
|
||||
t.Errorf("buffer reuse: position %d mismatch", i)
|
||||
}
|
||||
}
|
||||
|
||||
// Verify results are correct
|
||||
if len(result2) == 0 {
|
||||
t.Errorf("result should not be empty")
|
||||
}
|
||||
|
||||
// Test multiple calls with same buffer to verify no memory issues
|
||||
for i := 0; i < 10; i++ {
|
||||
result3 := EncodeKmers(seq, k, &buffer)
|
||||
if len(result3) != len(result1) {
|
||||
t.Errorf("iteration %d: length mismatch", i)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestEncodeKmersVariousLengths tests encoding with various sequence lengths
|
||||
func TestEncodeKmersVariousLengths(t *testing.T) {
|
||||
lengths := []int{1, 4, 8, 15, 16, 17, 31, 32, 33, 63, 64, 65, 100, 256, 1000}
|
||||
k := 8
|
||||
|
||||
for _, length := range lengths {
|
||||
// Generate test sequence
|
||||
seq := make([]byte, length)
|
||||
for i := range seq {
|
||||
seq[i] = "ACGT"[i%4]
|
||||
}
|
||||
|
||||
if length < k {
|
||||
continue
|
||||
}
|
||||
|
||||
t.Run("length_"+string(rune('0'+length/100))+string(rune('0'+(length%100)/10))+string(rune('0'+length%10)), func(t *testing.T) {
|
||||
result := EncodeKmers(seq, k, nil)
|
||||
|
||||
expectedLen := length - k + 1
|
||||
if len(result) != expectedLen {
|
||||
t.Errorf("length mismatch: got %d, want %d", len(result), expectedLen)
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
|
||||
// TestEncodeKmersLongSequence tests with a longer realistic sequence
|
||||
func TestEncodeKmersLongSequence(t *testing.T) {
|
||||
// Simulate a realistic DNA sequence
|
||||
seq := bytes.Repeat([]byte("ACGTACGTNNACGTACGT"), 100)
|
||||
k := 16
|
||||
|
||||
result := EncodeKmers(seq, k, nil)
|
||||
expectedLen := len(seq) - k + 1
|
||||
|
||||
if len(result) != expectedLen {
|
||||
t.Fatalf("length mismatch: got %d, want %d", len(result), expectedLen)
|
||||
}
|
||||
}
|
||||
|
||||
// BenchmarkEncodeKmers benchmarks the encoding function
|
||||
func BenchmarkEncodeKmers(b *testing.B) {
|
||||
// Create test sequences of various sizes
|
||||
sizes := []int{100, 1000, 10000, 100000}
|
||||
kSizes := []int{8, 16, 32}
|
||||
|
||||
for _, k := range kSizes {
|
||||
for _, size := range sizes {
|
||||
seq := make([]byte, size)
|
||||
for i := range seq {
|
||||
seq[i] = "ACGT"[i%4]
|
||||
}
|
||||
|
||||
name := "k" + string(rune('0'+k/10)) + string(rune('0'+k%10)) + "_size" + string(rune('0'+size/10000)) + string(rune('0'+(size%10000)/1000)) + string(rune('0'+(size%1000)/100)) + string(rune('0'+(size%100)/10)) + string(rune('0'+size%10))
|
||||
b.Run(name, func(b *testing.B) {
|
||||
buffer := make([]uint64, 0, size)
|
||||
b.ResetTimer()
|
||||
b.SetBytes(int64(size))
|
||||
|
||||
for i := 0; i < b.N; i++ {
|
||||
EncodeKmers(seq, k, &buffer)
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestEncodeNucleotide verifies nucleotide encoding
|
||||
func TestEncodeNucleotide(t *testing.T) {
|
||||
testCases := []struct {
|
||||
nucleotide byte
|
||||
expected byte
|
||||
}{
|
||||
{'A', 0},
|
||||
{'a', 0},
|
||||
{'C', 1},
|
||||
{'c', 1},
|
||||
{'G', 2},
|
||||
{'g', 2},
|
||||
{'T', 3},
|
||||
{'t', 3},
|
||||
{'U', 3},
|
||||
{'u', 3},
|
||||
}
|
||||
|
||||
for _, tc := range testCases {
|
||||
result := EncodeNucleotide(tc.nucleotide)
|
||||
if result != tc.expected {
|
||||
t.Errorf("EncodeNucleotide('%c') = %d, want %d",
|
||||
tc.nucleotide, result, tc.expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestReverseComplement tests the reverse complement function
|
||||
func TestReverseComplement(t *testing.T) {
|
||||
tests := []struct {
|
||||
name string
|
||||
seq string
|
||||
k int
|
||||
expected string // expected reverse complement sequence
|
||||
}{
|
||||
{
|
||||
name: "ACGT -> ACGT (palindrome)",
|
||||
seq: "ACGT",
|
||||
k: 4,
|
||||
expected: "ACGT",
|
||||
},
|
||||
{
|
||||
name: "AAAA -> TTTT",
|
||||
seq: "AAAA",
|
||||
k: 4,
|
||||
expected: "TTTT",
|
||||
},
|
||||
{
|
||||
name: "TTTT -> AAAA",
|
||||
seq: "TTTT",
|
||||
k: 4,
|
||||
expected: "AAAA",
|
||||
},
|
||||
{
|
||||
name: "CCCC -> GGGG",
|
||||
seq: "CCCC",
|
||||
k: 4,
|
||||
expected: "GGGG",
|
||||
},
|
||||
{
|
||||
name: "AACG -> CGTT",
|
||||
seq: "AACG",
|
||||
k: 4,
|
||||
expected: "CGTT",
|
||||
},
|
||||
{
|
||||
name: "AC -> GT",
|
||||
seq: "AC",
|
||||
k: 2,
|
||||
expected: "GT",
|
||||
},
|
||||
{
|
||||
name: "ACGTACGT -> ACGTACGT (palindrome)",
|
||||
seq: "ACGTACGT",
|
||||
k: 8,
|
||||
expected: "ACGTACGT",
|
||||
},
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
t.Run(tt.name, func(t *testing.T) {
|
||||
// Encode the input sequence
|
||||
kmers := EncodeKmers([]byte(tt.seq), tt.k, nil)
|
||||
if len(kmers) != 1 {
|
||||
t.Fatalf("expected 1 k-mer, got %d", len(kmers))
|
||||
}
|
||||
|
||||
// Compute reverse complement
|
||||
rc := ReverseComplement(kmers[0], tt.k)
|
||||
|
||||
// Encode the expected reverse complement
|
||||
expectedKmers := EncodeKmers([]byte(tt.expected), tt.k, nil)
|
||||
if len(expectedKmers) != 1 {
|
||||
t.Fatalf("expected 1 k-mer for expected, got %d", len(expectedKmers))
|
||||
}
|
||||
|
||||
if rc != expectedKmers[0] {
|
||||
t.Errorf("ReverseComplement(%s) = %d (0b%b), want %d (0b%b) for %s",
|
||||
tt.seq, rc, rc, expectedKmers[0], expectedKmers[0], tt.expected)
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
|
||||
// TestReverseComplementInvolution tests that RC(RC(x)) = x
|
||||
func TestReverseComplementInvolution(t *testing.T) {
|
||||
testSeqs := []string{"ACGT", "AAAA", "TTTT", "ACGTACGT", "AACGTTGC", "AC", "ACGTACGTACGTACGT", "ACGTACGTACGTACGTACGTACGTACGTACGT"}
|
||||
|
||||
for _, seq := range testSeqs {
|
||||
k := len(seq)
|
||||
kmers := EncodeKmers([]byte(seq), k, nil)
|
||||
if len(kmers) != 1 {
|
||||
continue
|
||||
}
|
||||
|
||||
original := kmers[0]
|
||||
rc := ReverseComplement(original, k)
|
||||
rcrc := ReverseComplement(rc, k)
|
||||
|
||||
if rcrc != original {
|
||||
t.Errorf("RC(RC(%s)) != %s: got %d, want %d", seq, seq, rcrc, original)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestNormalizeKmer tests the normalization function
|
||||
func TestNormalizeKmer(t *testing.T) {
|
||||
tests := []struct {
|
||||
name string
|
||||
seq string
|
||||
k int
|
||||
}{
|
||||
{"ACGT palindrome", "ACGT", 4},
|
||||
{"AAAA vs TTTT", "AAAA", 4},
|
||||
{"TTTT vs AAAA", "TTTT", 4},
|
||||
{"AACG vs CGTT", "AACG", 4},
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
t.Run(tt.name, func(t *testing.T) {
|
||||
kmers := EncodeKmers([]byte(tt.seq), tt.k, nil)
|
||||
if len(kmers) != 1 {
|
||||
t.Fatalf("expected 1 k-mer, got %d", len(kmers))
|
||||
}
|
||||
|
||||
kmer := kmers[0]
|
||||
rc := ReverseComplement(kmer, tt.k)
|
||||
normalized := NormalizeKmer(kmer, tt.k)
|
||||
|
||||
// Normalized should be the minimum
|
||||
expectedNorm := kmer
|
||||
if rc < kmer {
|
||||
expectedNorm = rc
|
||||
}
|
||||
|
||||
if normalized != expectedNorm {
|
||||
t.Errorf("NormalizeKmer(%d) = %d, want %d", kmer, normalized, expectedNorm)
|
||||
}
|
||||
|
||||
// Normalizing the RC should give the same result
|
||||
normalizedRC := NormalizeKmer(rc, tt.k)
|
||||
if normalizedRC != normalized {
|
||||
t.Errorf("NormalizeKmer(RC) = %d, want %d (same as NormalizeKmer(fwd))", normalizedRC, normalized)
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
|
||||
// TestEncodeNormalizedKmersBasic tests basic normalized k-mer encoding
|
||||
func TestEncodeNormalizedKmersBasic(t *testing.T) {
|
||||
// Test that a sequence and its reverse complement produce the same normalized k-mers
|
||||
seq := []byte("AACGTT")
|
||||
revComp := []byte("AACGTT") // This is a palindrome!
|
||||
|
||||
k := 4
|
||||
kmers1 := EncodeNormalizedKmers(seq, k, nil)
|
||||
kmers2 := EncodeNormalizedKmers(revComp, k, nil)
|
||||
|
||||
if len(kmers1) != len(kmers2) {
|
||||
t.Fatalf("length mismatch: %d vs %d", len(kmers1), len(kmers2))
|
||||
}
|
||||
|
||||
// For a palindrome, forward and reverse should give the same k-mers
|
||||
for i := range kmers1 {
|
||||
if kmers1[i] != kmers2[len(kmers2)-1-i] {
|
||||
t.Logf("Note: position %d differs (expected for non-palindromic sequences)", i)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestEncodeNormalizedKmersSymmetry tests that seq and its RC produce same normalized k-mers (reversed)
|
||||
func TestEncodeNormalizedKmersSymmetry(t *testing.T) {
|
||||
// Manually construct a sequence and its reverse complement
|
||||
seq := []byte("ACGTAACCGG")
|
||||
|
||||
// Compute reverse complement manually
|
||||
rcMap := map[byte]byte{'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A'}
|
||||
revComp := make([]byte, len(seq))
|
||||
for i, b := range seq {
|
||||
revComp[len(seq)-1-i] = rcMap[b]
|
||||
}
|
||||
|
||||
k := 4
|
||||
kmers1 := EncodeNormalizedKmers(seq, k, nil)
|
||||
kmers2 := EncodeNormalizedKmers(revComp, k, nil)
|
||||
|
||||
if len(kmers1) != len(kmers2) {
|
||||
t.Fatalf("length mismatch: %d vs %d", len(kmers1), len(kmers2))
|
||||
}
|
||||
|
||||
// The normalized k-mers should be the same but in reverse order
|
||||
for i := range kmers1 {
|
||||
j := len(kmers2) - 1 - i
|
||||
if kmers1[i] != kmers2[j] {
|
||||
t.Errorf("position %d vs %d: %d != %d", i, j, kmers1[i], kmers2[j])
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestEncodeNormalizedKmersConsistency verifies normalized k-mers match manual normalization
|
||||
func TestEncodeNormalizedKmersConsistency(t *testing.T) {
|
||||
seq := []byte("ACGTACGTACGTACGT")
|
||||
k := 8
|
||||
|
||||
// Get k-mers both ways
|
||||
rawKmers := EncodeKmers(seq, k, nil)
|
||||
normalizedKmers := EncodeNormalizedKmers(seq, k, nil)
|
||||
|
||||
if len(rawKmers) != len(normalizedKmers) {
|
||||
t.Fatalf("length mismatch: %d vs %d", len(rawKmers), len(normalizedKmers))
|
||||
}
|
||||
|
||||
// Verify each normalized k-mer matches manual normalization
|
||||
for i, raw := range rawKmers {
|
||||
expected := NormalizeKmer(raw, k)
|
||||
if normalizedKmers[i] != expected {
|
||||
t.Errorf("position %d: EncodeNormalizedKmers gave %d, NormalizeKmer gave %d",
|
||||
i, normalizedKmers[i], expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// BenchmarkEncodeNormalizedKmers benchmarks the normalized encoding function
|
||||
func BenchmarkEncodeNormalizedKmers(b *testing.B) {
|
||||
sizes := []int{100, 1000, 10000, 100000}
|
||||
kSizes := []int{8, 16, 32}
|
||||
|
||||
for _, k := range kSizes {
|
||||
for _, size := range sizes {
|
||||
seq := make([]byte, size)
|
||||
for i := range seq {
|
||||
seq[i] = "ACGT"[i%4]
|
||||
}
|
||||
|
||||
name := "k" + string(rune('0'+k/10)) + string(rune('0'+k%10)) + "_size" + string(rune('0'+size/10000)) + string(rune('0'+(size%10000)/1000)) + string(rune('0'+(size%1000)/100)) + string(rune('0'+(size%100)/10)) + string(rune('0'+size%10))
|
||||
b.Run(name, func(b *testing.B) {
|
||||
buffer := make([]uint64, 0, size)
|
||||
b.ResetTimer()
|
||||
b.SetBytes(int64(size))
|
||||
|
||||
for i := 0; i < b.N; i++ {
|
||||
EncodeNormalizedKmers(seq, k, &buffer)
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// BenchmarkReverseComplement benchmarks the reverse complement function
|
||||
func BenchmarkReverseComplement(b *testing.B) {
|
||||
kmer := uint64(0x123456789ABCDEF0)
|
||||
k := 32
|
||||
|
||||
b.ResetTimer()
|
||||
for i := 0; i < b.N; i++ {
|
||||
ReverseComplement(kmer, k)
|
||||
}
|
||||
}
|
||||
|
||||
// BenchmarkNormalizeKmer benchmarks the normalization function
|
||||
func BenchmarkNormalizeKmer(b *testing.B) {
|
||||
kmer := uint64(0x123456789ABCDEF0)
|
||||
k := 32
|
||||
|
||||
b.ResetTimer()
|
||||
for i := 0; i < b.N; i++ {
|
||||
NormalizeKmer(kmer, k)
|
||||
}
|
||||
}
|
||||
Reference in New Issue
Block a user