mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-06-25 02:00:59 +00:00
more doc
This commit is contained in:
File diff suppressed because one or more lines are too long
+93
-40
@@ -231,6 +231,7 @@ div.csl-indent {
|
|||||||
<li><a href="#taxonomic-assignment-of-sequences" id="toc-taxonomic-assignment-of-sequences" class="nav-link" data-scroll-target="#taxonomic-assignment-of-sequences"><span class="toc-section-number">2.2.6</span> Taxonomic assignment of sequences</a></li>
|
<li><a href="#taxonomic-assignment-of-sequences" id="toc-taxonomic-assignment-of-sequences" class="nav-link" data-scroll-target="#taxonomic-assignment-of-sequences"><span class="toc-section-number">2.2.6</span> Taxonomic assignment of sequences</a></li>
|
||||||
<li><a href="#assign-each-sequence-to-a-taxon" id="toc-assign-each-sequence-to-a-taxon" class="nav-link" data-scroll-target="#assign-each-sequence-to-a-taxon"><span class="toc-section-number">2.2.7</span> Assign each sequence to a taxon</a></li>
|
<li><a href="#assign-each-sequence-to-a-taxon" id="toc-assign-each-sequence-to-a-taxon" class="nav-link" data-scroll-target="#assign-each-sequence-to-a-taxon"><span class="toc-section-number">2.2.7</span> Assign each sequence to a taxon</a></li>
|
||||||
<li><a href="#generate-the-final-result-table" id="toc-generate-the-final-result-table" class="nav-link" data-scroll-target="#generate-the-final-result-table"><span class="toc-section-number">2.2.8</span> Generate the final result table</a></li>
|
<li><a href="#generate-the-final-result-table" id="toc-generate-the-final-result-table" class="nav-link" data-scroll-target="#generate-the-final-result-table"><span class="toc-section-number">2.2.8</span> Generate the final result table</a></li>
|
||||||
|
<li><a href="#looking-at-the-data-in-r" id="toc-looking-at-the-data-in-r" class="nav-link" data-scroll-target="#looking-at-the-data-in-r"><span class="toc-section-number">2.2.9</span> Looking at the data in R</a></li>
|
||||||
</ul></li>
|
</ul></li>
|
||||||
</ul>
|
</ul>
|
||||||
</nav>
|
</nav>
|
||||||
@@ -430,7 +431,7 @@ agcccaaaactcaaaggacttggcggtgcttcacaccctt</code></pre>
|
|||||||
<div class="cell">
|
<div class="cell">
|
||||||
<div class="sourceCode cell-code" id="cb15"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb15-1"><a href="#cb15-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> results/wolf.ali.assigned.simple.clean.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
<div class="sourceCode cell-code" id="cb15"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb15-1"><a href="#cb15-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> results/wolf.ali.assigned.simple.clean.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
<div class="cell-output cell-output-stdout">
|
<div class="cell-output cell-output-stdout">
|
||||||
<pre><code>time="2023-01-31T22:44:30+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
|
<pre><code>time="2023-02-02T23:07:30+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
|
||||||
2749 36409 273387</code></pre>
|
2749 36409 273387</code></pre>
|
||||||
</div>
|
</div>
|
||||||
</div>
|
</div>
|
||||||
@@ -439,10 +440,10 @@ agcccaaaactcaaaggacttggcggtgcttcacaccctt</code></pre>
|
|||||||
<div class="sourceCode cell-code" id="cb17"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb17-1"><a href="#cb17-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-p</span> <span class="st">'sequence.Count() == 1'</span> results/wolf.ali.assigned.simple.clean.fasta <span class="dt">\</span></span>
|
<div class="sourceCode cell-code" id="cb17"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb17-1"><a href="#cb17-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-p</span> <span class="st">'sequence.Count() == 1'</span> results/wolf.ali.assigned.simple.clean.fasta <span class="dt">\</span></span>
|
||||||
<span id="cb17-2"><a href="#cb17-2" aria-hidden="true" tabindex="-1"></a> <span class="kw">|</span> <span class="ex">obicount</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
<span id="cb17-2"><a href="#cb17-2" aria-hidden="true" tabindex="-1"></a> <span class="kw">|</span> <span class="ex">obicount</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
<div class="cell-output cell-output-stdout">
|
<div class="cell-output cell-output-stdout">
|
||||||
<pre><code>time="2023-01-31T22:44:30+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
|
<pre><code>time="2023-02-02T23:07:30+01:00" level=info msg="Reading sequences from stdin in guessed\n"
|
||||||
time="2023-01-31T22:44:30+01:00" level=info msg="Reading sequences from stdin in guessed\n"
|
time="2023-02-02T23:07:30+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
|
||||||
time="2023-01-31T22:44:30+01:00" level=info msg="On output use JSON headers"
|
time="2023-02-02T23:07:30+01:00" level=info msg="On output use JSON headers"
|
||||||
2309 2309 229920</code></pre>
|
2309 2309 229912</code></pre>
|
||||||
</div>
|
</div>
|
||||||
</div>
|
</div>
|
||||||
<p>In that dataset sigletons corresponds to <span class="math inline">\(3511\)</span> variants.</p>
|
<p>In that dataset sigletons corresponds to <span class="math inline">\(3511\)</span> variants.</p>
|
||||||
@@ -490,7 +491,7 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
|
|||||||
<div class="cell">
|
<div class="cell">
|
||||||
<div class="sourceCode cell-code" id="cb23"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb23-1"><a href="#cb23-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> results/wolf.ali.assigned.simple.clean.c10.l80.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
<div class="sourceCode cell-code" id="cb23"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb23-1"><a href="#cb23-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> results/wolf.ali.assigned.simple.clean.c10.l80.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
<div class="cell-output cell-output-stdout">
|
<div class="cell-output cell-output-stdout">
|
||||||
<pre><code>time="2023-01-31T22:44:32+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.c10.l80.fasta file\n"
|
<pre><code>time="2023-02-02T23:07:31+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.c10.l80.fasta file\n"
|
||||||
26 31337 2585</code></pre>
|
26 31337 2585</code></pre>
|
||||||
</div>
|
</div>
|
||||||
</div>
|
</div>
|
||||||
@@ -502,6 +503,7 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
|
|||||||
<p>Taxonomic assignment of sequences requires a reference database compiling all possible species to be identified in the sample. Assignment is then done based on sequence comparison between sample sequences and reference sequences.</p>
|
<p>Taxonomic assignment of sequences requires a reference database compiling all possible species to be identified in the sample. Assignment is then done based on sequence comparison between sample sequences and reference sequences.</p>
|
||||||
<section id="download-the-taxonomy" class="level4 unnumbered">
|
<section id="download-the-taxonomy" class="level4 unnumbered">
|
||||||
<h4 class="unnumbered anchored" data-anchor-id="download-the-taxonomy">Download the taxonomy</h4>
|
<h4 class="unnumbered anchored" data-anchor-id="download-the-taxonomy">Download the taxonomy</h4>
|
||||||
|
<p>It is always possible to download the complete taxonomy from NCBI using the following commands.</p>
|
||||||
<div class="cell">
|
<div class="cell">
|
||||||
<div class="sourceCode cell-code" id="cb25"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb25-1"><a href="#cb25-1" aria-hidden="true" tabindex="-1"></a><span class="fu">mkdir</span> TAXO</span>
|
<div class="sourceCode cell-code" id="cb25"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb25-1"><a href="#cb25-1" aria-hidden="true" tabindex="-1"></a><span class="fu">mkdir</span> TAXO</span>
|
||||||
<span id="cb25-2"><a href="#cb25-2" aria-hidden="true" tabindex="-1"></a><span class="bu">cd</span> TAXO</span>
|
<span id="cb25-2"><a href="#cb25-2" aria-hidden="true" tabindex="-1"></a><span class="bu">cd</span> TAXO</span>
|
||||||
@@ -509,39 +511,45 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
|
|||||||
<span id="cb25-4"><a href="#cb25-4" aria-hidden="true" tabindex="-1"></a> <span class="kw">|</span> <span class="fu">tar</span> <span class="at">-zxvf</span> <span class="at">-</span></span>
|
<span id="cb25-4"><a href="#cb25-4" aria-hidden="true" tabindex="-1"></a> <span class="kw">|</span> <span class="fu">tar</span> <span class="at">-zxvf</span> <span class="at">-</span></span>
|
||||||
<span id="cb25-5"><a href="#cb25-5" aria-hidden="true" tabindex="-1"></a><span class="bu">cd</span> ..</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
<span id="cb25-5"><a href="#cb25-5" aria-hidden="true" tabindex="-1"></a><span class="bu">cd</span> ..</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
</div>
|
</div>
|
||||||
|
<p>For people have a low speed internet connection, a copy of the <code>taxdump.tar.gz</code> file is provided in the wolf_data directory. The NCBI taxonomy is dayly updated, but the one provided here is ok for running this tutorial.</p>
|
||||||
|
<p>To build the TAXO directory from the provided <code>taxdump.tar.gz</code>, you need to execute the following commands</p>
|
||||||
|
<div class="cell">
|
||||||
|
<div class="sourceCode cell-code" id="cb26"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb26-1"><a href="#cb26-1" aria-hidden="true" tabindex="-1"></a><span class="fu">mkdir</span> TAXO</span>
|
||||||
|
<span id="cb26-2"><a href="#cb26-2" aria-hidden="true" tabindex="-1"></a><span class="bu">cd</span> TAXO</span>
|
||||||
|
<span id="cb26-3"><a href="#cb26-3" aria-hidden="true" tabindex="-1"></a><span class="fu">tar</span> zxvf wolf_data/taxdump.tar.gz </span>
|
||||||
|
<span id="cb26-4"><a href="#cb26-4" aria-hidden="true" tabindex="-1"></a><span class="bu">cd</span> ..</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
|
</div>
|
||||||
</section>
|
</section>
|
||||||
<section id="build-a-reference-database" class="level4 unnumbered">
|
<section id="build-a-reference-database" class="level4 unnumbered">
|
||||||
<h4 class="unnumbered anchored" data-anchor-id="build-a-reference-database">Build a reference database</h4>
|
<h4 class="unnumbered anchored" data-anchor-id="build-a-reference-database">Build a reference database</h4>
|
||||||
<p>One way to build the reference database is to use the <code class="interpreted-text" role="doc">ecoPCR <scripts/ecoPCR></code> program to simulate a PCR and to extract all sequences from the EMBL that may be amplified <span class="title-ref">in silico</span> by the two primers (<span class="title-ref">TTAGATACCCCACTATGC</span> and <span class="title-ref">TAGAACAGGCTCCTCTAG</span>) used for PCR amplification.</p>
|
<p>One way to build the reference database is to use the <code>obipcr</code> program to simulate a PCR and extract all sequences from a general purpose DNA database such as genbank or EMBL that can be amplified <em>in silico</em> by the two primers (here <strong>TTAGATACCCCACTATGC</strong> and <strong>TAGAACAGGCTCCTCTAG</strong>) used for PCR amplification.</p>
|
||||||
<p>The full list of steps for building this reference database would then be:</p>
|
<p>The two steps to build this reference database would then be</p>
|
||||||
<ol type="1">
|
<ol type="1">
|
||||||
<li>Download the whole set of EMBL sequences (available from: <a href="ftp://ftp.ebi.ac.uk/pub/databases/embl/release/" class="uri">ftp://ftp.ebi.ac.uk/pub/databases/embl/release/</a>)</li>
|
<li><p>Today, the easiest database to download is <em>Genbank</em>. But this will take you more than a day and occupy more than half a terabyte on your hard drive. In the <code>wolf_data</code> directory, a shell script called <code>download_gb.sh</code> is provided to perform this task. It requires that the programs <code>wget2</code> and <code>curl</code> are available on your computer.</p></li>
|
||||||
<li>Download the NCBI taxonomy (available from: <a href="ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz" class="uri">ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz</a>)</li>
|
<li><p>Use <code>obipcr</code> to simulate amplification and build a reference database based on the putatively amplified barcodes and their recorded taxonomic information.</p></li>
|
||||||
<li>Format them into the ecoPCR format (see <code class="interpreted-text" role="doc">obiconvert <scripts/obiconvert></code> for how you can produce ecoPCR compatible files)</li>
|
|
||||||
<li>Use ecoPCR to simulate amplification and build a reference database based on putatively amplified barcodes together with their recorded taxonomic information</li>
|
|
||||||
</ol>
|
</ol>
|
||||||
<p>As step 1 and step 3 can be really time-consuming (about one day), we alredy provide the reference database produced by the following commands so that you can skip its construction. Note that as the EMBL database and taxonomic data can evolve daily, if you run the following commands you may end up with quite different results.</p>
|
<p>As these steps can take a long time (about a day for the download and an hour for the PCR), we already provide the reference database produced by the following commands so you can skip its construction. Note that as the Genbank and taxonomic database evolve frequently, if you run the following commands you may get different results.</p>
|
||||||
<p>Any utility allowing file downloading from a ftp site can be used. In the following commands, we use the commonly used <code>wget</code> <em>Unix</em> command.</p>
|
|
||||||
<section id="download-the-sequences" class="level5 unnumbered">
|
<section id="download-the-sequences" class="level5 unnumbered">
|
||||||
<h5 class="unnumbered anchored" data-anchor-id="download-the-sequences">Download the sequences</h5>
|
<h5 class="unnumbered anchored" data-anchor-id="download-the-sequences">Download the sequences</h5>
|
||||||
<div class="sourceCode" id="cb26"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb26-1"><a href="#cb26-1" aria-hidden="true" tabindex="-1"></a><span class="op">></span> mkdir <span class="ex">EMBL</span></span>
|
<div class="cell">
|
||||||
<span id="cb26-2"><a href="#cb26-2" aria-hidden="true" tabindex="-1"></a><span class="op">></span> cd <span class="ex">EMBL</span></span>
|
<div class="sourceCode cell-code" id="cb27"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb27-1"><a href="#cb27-1" aria-hidden="true" tabindex="-1"></a><span class="fu">mkdir</span> genbank</span>
|
||||||
<span id="cb26-3"><a href="#cb26-3" aria-hidden="true" tabindex="-1"></a><span class="op">></span> wget <span class="ex">-nH</span> <span class="at">--cut-dirs</span><span class="op">=</span>4 <span class="at">-Arel_std_\*.dat.gz</span> <span class="at">-m</span> ftp://ftp.ebi.ac.uk/pub/databases/embl/release/</span>
|
<span id="cb27-2"><a href="#cb27-2" aria-hidden="true" tabindex="-1"></a><span class="bu">cd</span> genbank</span>
|
||||||
<span id="cb26-4"><a href="#cb26-4" aria-hidden="true" tabindex="-1"></a><span class="op">></span> cd <span class="ex">..</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
<span id="cb27-3"><a href="#cb27-3" aria-hidden="true" tabindex="-1"></a><span class="ex">../wolf_data/install_gb.sh</span></span>
|
||||||
</section>
|
<span id="cb27-4"><a href="#cb27-4" aria-hidden="true" tabindex="-1"></a><span class="bu">cd</span> ..</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
<section id="download-the-taxonomy-1" class="level5 unnumbered">
|
</div>
|
||||||
<h5 class="unnumbered anchored" data-anchor-id="download-the-taxonomy-1">Download the taxonomy</h5>
|
<p>DO NOT RUN THIS COMMAND EXCEPT IF YOU ARE REALLY CONSIENT OF THE TIME AND DISK SPACE REQUIRED.</p>
|
||||||
<div class="sourceCode" id="cb27"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb27-1"><a href="#cb27-1" aria-hidden="true" tabindex="-1"></a><span class="op">></span> mkdir <span class="ex">TAXO</span></span>
|
|
||||||
<span id="cb27-2"><a href="#cb27-2" aria-hidden="true" tabindex="-1"></a><span class="op">></span> cd <span class="ex">TAXO</span></span>
|
|
||||||
<span id="cb27-3"><a href="#cb27-3" aria-hidden="true" tabindex="-1"></a><span class="op">></span> wget <span class="ex">ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz</span></span>
|
|
||||||
<span id="cb27-4"><a href="#cb27-4" aria-hidden="true" tabindex="-1"></a><span class="op">></span> tar <span class="ex">-zxvf</span> taxdump.tar.gz</span>
|
|
||||||
<span id="cb27-5"><a href="#cb27-5" aria-hidden="true" tabindex="-1"></a><span class="op">></span> cd <span class="ex">..</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
|
||||||
</section>
|
</section>
|
||||||
<section id="use-obipcr-to-simulate-an-in-silico-pcr" class="level5 unnumbered">
|
<section id="use-obipcr-to-simulate-an-in-silico-pcr" class="level5 unnumbered">
|
||||||
<h5 class="unnumbered anchored" data-anchor-id="use-obipcr-to-simulate-an-in-silico-pcr">Use obipcr to simulate an in silico` PCR</h5>
|
<h5 class="unnumbered anchored" data-anchor-id="use-obipcr-to-simulate-an-in-silico-pcr">Use obipcr to simulate an in silico` PCR</h5>
|
||||||
<div class="sourceCode" id="cb28"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb28-1"><a href="#cb28-1" aria-hidden="true" tabindex="-1"></a><span class="op">></span> obipcr <span class="ex">-d</span> ./ECODB/embl_last <span class="at">-e</span> 3 <span class="at">-l</span> 50 <span class="at">-L</span> 150 <span class="dt">\ </span></span>
|
<div class="cell">
|
||||||
<span id="cb28-2"><a href="#cb28-2" aria-hidden="true" tabindex="-1"></a> <span class="ex">TTAGATACCCCACTATGC</span> TAGAACAGGCTCCTCTAG <span class="op">></span> v05.ecopcr</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
<div class="sourceCode cell-code" id="cb28"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb28-1"><a href="#cb28-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obipcr</span> <span class="at">-t</span> TAXO <span class="at">-e</span> 3 <span class="at">-l</span> 50 <span class="at">-L</span> 150 <span class="dt">\ </span></span>
|
||||||
<p>Note that the primers must be in the same order both in <code>wolf_diet_ngsfilter.txt</code> and in the <code>obipcr</code> command.</p>
|
<span id="cb28-2"><a href="#cb28-2" aria-hidden="true" tabindex="-1"></a> <span class="ex">--forward</span> TTAGATACCCCACTATGC <span class="dt">\</span></span>
|
||||||
|
<span id="cb28-3"><a href="#cb28-3" aria-hidden="true" tabindex="-1"></a> <span class="at">--reverse</span> TAGAACAGGCTCCTCTAG <span class="dt">\</span></span>
|
||||||
|
<span id="cb28-4"><a href="#cb28-4" aria-hidden="true" tabindex="-1"></a> <span class="at">--no-order</span> <span class="dt">\</span></span>
|
||||||
|
<span id="cb28-5"><a href="#cb28-5" aria-hidden="true" tabindex="-1"></a> genbank/Release-251/gb<span class="pp">*</span>.seq.gz</span>
|
||||||
|
<span id="cb28-6"><a href="#cb28-6" aria-hidden="true" tabindex="-1"></a> <span class="op">></span> results/v05.pcr.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
|
</div>
|
||||||
|
<p>Note that the primers must be in the same order both in <code>wolf_diet_ngsfilter.txt</code> and in the <code>obipcr</code> command. The part of the path indicating the <em>Genbank</em> release can change. Please check in your genbank directory the exact name of your release.</p>
|
||||||
</section>
|
</section>
|
||||||
<section id="clean-the-database" class="level5 unnumbered">
|
<section id="clean-the-database" class="level5 unnumbered">
|
||||||
<h5 class="unnumbered anchored" data-anchor-id="clean-the-database">Clean the database</h5>
|
<h5 class="unnumbered anchored" data-anchor-id="clean-the-database">Clean the database</h5>
|
||||||
@@ -551,22 +559,25 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
|
|||||||
<li>ensure that the dereplicated sequences have a taxid at the family level (<code>obigrep</code> command below).</li>
|
<li>ensure that the dereplicated sequences have a taxid at the family level (<code>obigrep</code> command below).</li>
|
||||||
<li>ensure that sequences each have a unique identification (<code>obiannotate</code> command below)</li>
|
<li>ensure that sequences each have a unique identification (<code>obiannotate</code> command below)</li>
|
||||||
</ol>
|
</ol>
|
||||||
<div class="sourceCode" id="cb29"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb29-1"><a href="#cb29-1" aria-hidden="true" tabindex="-1"></a><span class="op">></span> obigrep <span class="ex">-d</span> embl_last <span class="at">--require-rank</span><span class="op">=</span>species <span class="dt">\</span></span>
|
<div class="cell">
|
||||||
<span id="cb29-2"><a href="#cb29-2" aria-hidden="true" tabindex="-1"></a> <span class="at">--require-rank</span><span class="op">=</span>genus <span class="at">--require-rank</span><span class="op">=</span>family v05.ecopcr <span class="op">></span> v05_clean.fasta</span>
|
<div class="sourceCode cell-code" id="cb29"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb29-1"><a href="#cb29-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-t</span> TAXO <span class="dt">\</span></span>
|
||||||
<span id="cb29-3"><a href="#cb29-3" aria-hidden="true" tabindex="-1"></a></span>
|
<span id="cb29-2"><a href="#cb29-2" aria-hidden="true" tabindex="-1"></a> <span class="at">--require-rank</span> species <span class="dt">\</span></span>
|
||||||
<span id="cb29-4"><a href="#cb29-4" aria-hidden="true" tabindex="-1"></a><span class="op">></span> obiuniq <span class="ex">-d</span> embl_last <span class="dt">\ </span></span>
|
<span id="cb29-3"><a href="#cb29-3" aria-hidden="true" tabindex="-1"></a> <span class="at">--require-rank</span> genus <span class="dt">\</span></span>
|
||||||
<span id="cb29-5"><a href="#cb29-5" aria-hidden="true" tabindex="-1"></a> <span class="ex">v05_clean.fasta</span> <span class="op">></span> v05_clean_uniq.fasta</span>
|
<span id="cb29-4"><a href="#cb29-4" aria-hidden="true" tabindex="-1"></a> <span class="at">--require-rank</span> family <span class="dt">\</span></span>
|
||||||
|
<span id="cb29-5"><a href="#cb29-5" aria-hidden="true" tabindex="-1"></a> results/v05.ecopcr <span class="op">></span> results/v05_clean.fasta</span>
|
||||||
<span id="cb29-6"><a href="#cb29-6" aria-hidden="true" tabindex="-1"></a></span>
|
<span id="cb29-6"><a href="#cb29-6" aria-hidden="true" tabindex="-1"></a></span>
|
||||||
<span id="cb29-7"><a href="#cb29-7" aria-hidden="true" tabindex="-1"></a><span class="op">></span> obigrep <span class="ex">-d</span> embl_last <span class="at">--require-rank</span><span class="op">=</span>family <span class="dt">\ </span></span>
|
<span id="cb29-7"><a href="#cb29-7" aria-hidden="true" tabindex="-1"></a><span class="ex">obiuniq</span> <span class="at">-c</span> taxid <span class="dt">\</span></span>
|
||||||
<span id="cb29-8"><a href="#cb29-8" aria-hidden="true" tabindex="-1"></a> <span class="ex">v05_clean_uniq.fasta</span> <span class="op">></span> v05_clean_uniq_clean.fasta</span>
|
<span id="cb29-8"><a href="#cb29-8" aria-hidden="true" tabindex="-1"></a> results/v05_clean.fasta <span class="dt">\</span></span>
|
||||||
<span id="cb29-9"><a href="#cb29-9" aria-hidden="true" tabindex="-1"></a></span>
|
<span id="cb29-9"><a href="#cb29-9" aria-hidden="true" tabindex="-1"></a> <span class="op">></span> results/v05_clean_uniq.fasta</span>
|
||||||
<span id="cb29-10"><a href="#cb29-10" aria-hidden="true" tabindex="-1"></a><span class="op">></span> obiannotate <span class="ex">--uniq-id</span> v05_clean_uniq_clean.fasta <span class="op">></span> db_v05.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
<span id="cb29-10"><a href="#cb29-10" aria-hidden="true" tabindex="-1"></a></span>
|
||||||
<p>obirefidx -t TAXO wolf_data/db_v05_r117.fasta > results/db_v05_r117.indexed.fasta</p>
|
<span id="cb29-11"><a href="#cb29-11" aria-hidden="true" tabindex="-1"></a><span class="ex">obirefidx</span> <span class="at">-t</span> TAXO results/v05_clean_uniq.fasta <span class="dt">\</span></span>
|
||||||
|
<span id="cb29-12"><a href="#cb29-12" aria-hidden="true" tabindex="-1"></a> <span class="op">></span> results/v05_clean_uniq.indexed.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
|
</div>
|
||||||
<div class="warning">
|
<div class="warning">
|
||||||
<div class="title">
|
<div class="title">
|
||||||
<p>Warning</p>
|
<p>Warning</p>
|
||||||
</div>
|
</div>
|
||||||
<p>From now on, for the sake of clarity, the following commands will use the filenames of the files provided with the tutorial. If you decided to run the last steps and use the files you have produced, you'll have to use <code>db_v05.fasta</code> instead of <code>db_v05_r117.fasta</code> and <code>embl_last</code> instead of <code>embl_r117</code></p>
|
<p>From now on, for the sake of clarity, the following commands will use the filenames of the files provided with the tutorial. If you decided to run the last steps and use the files you have produced, you'll have to use <code>results/v05_clean_uniq.indexed.fasta</code> instead of <code>wolf_data/db_v05_r117.indexed.fasta</code>.</p>
|
||||||
</div>
|
</div>
|
||||||
</section>
|
</section>
|
||||||
</section>
|
</section>
|
||||||
@@ -614,6 +625,48 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
|
|||||||
<pre><code>>HELIUM_000100422_612GNAAXX:7:84:16335:5083#0/1_sub[28..126] {"count":96,"merged_sample":{"26a_F040644":11,"29a_F260619":85},"obiclean_status":{"26a_F040644":"s","29a_F260619":"h"},"obiclean_weight":{"26a_F040644":14,"29a_F260619":110},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_difference":4,"obitag_match_count":1,"obitag_rank":"subspecies","scientific_name":"Canis lupus familiaris","taxid":9615}
|
<pre><code>>HELIUM_000100422_612GNAAXX:7:84:16335:5083#0/1_sub[28..126] {"count":96,"merged_sample":{"26a_F040644":11,"29a_F260619":85},"obiclean_status":{"26a_F040644":"s","29a_F260619":"h"},"obiclean_weight":{"26a_F040644":14,"29a_F260619":110},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_difference":4,"obitag_match_count":1,"obitag_rank":"subspecies","scientific_name":"Canis lupus familiaris","taxid":9615}
|
||||||
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
||||||
gattaaacctcaaaggacttggcagtgctttatacccct</code></pre>
|
gattaaacctcaaaggacttggcagtgctttatacccct</code></pre>
|
||||||
|
</section>
|
||||||
|
<section id="looking-at-the-data-in-r" class="level3" data-number="2.2.9">
|
||||||
|
<h3 data-number="2.2.9" class="anchored" data-anchor-id="looking-at-the-data-in-r"><span class="header-section-number">2.2.9</span> Looking at the data in R</h3>
|
||||||
|
<div class="cell">
|
||||||
|
<div class="sourceCode cell-code" id="cb34"><pre class="sourceCode r code-with-copy"><code class="sourceCode r"><span id="cb34-1"><a href="#cb34-1" aria-hidden="true" tabindex="-1"></a><span class="fu">library</span>(ROBIFastread)</span>
|
||||||
|
<span id="cb34-2"><a href="#cb34-2" aria-hidden="true" tabindex="-1"></a><span class="fu">library</span>(vegan)</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
|
<div class="cell-output cell-output-stderr">
|
||||||
|
<pre><code>Le chargement a nécessité le package : permute</code></pre>
|
||||||
|
</div>
|
||||||
|
<div class="cell-output cell-output-stderr">
|
||||||
|
<pre><code>Le chargement a nécessité le package : lattice</code></pre>
|
||||||
|
</div>
|
||||||
|
<div class="cell-output cell-output-stderr">
|
||||||
|
<pre><code>This is vegan 2.6-4</code></pre>
|
||||||
|
</div>
|
||||||
|
<div class="sourceCode cell-code" id="cb38"><pre class="sourceCode r code-with-copy"><code class="sourceCode r"><span id="cb38-1"><a href="#cb38-1" aria-hidden="true" tabindex="-1"></a><span class="fu">library</span>(magrittr)</span>
|
||||||
|
<span id="cb38-2"><a href="#cb38-2" aria-hidden="true" tabindex="-1"></a> </span>
|
||||||
|
<span id="cb38-3"><a href="#cb38-3" aria-hidden="true" tabindex="-1"></a></span>
|
||||||
|
<span id="cb38-4"><a href="#cb38-4" aria-hidden="true" tabindex="-1"></a>diet_data <span class="ot"><-</span> <span class="fu">read_obifasta</span>(<span class="st">"results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta"</span>) </span>
|
||||||
|
<span id="cb38-5"><a href="#cb38-5" aria-hidden="true" tabindex="-1"></a>diet_data <span class="sc">%<>%</span> <span class="fu">extract_features</span>(<span class="st">"obitag_bestmatch"</span>,<span class="st">"obitag_rank"</span>,<span class="st">"scientific_name"</span>,<span class="st">'taxid'</span>)</span>
|
||||||
|
<span id="cb38-6"><a href="#cb38-6" aria-hidden="true" tabindex="-1"></a></span>
|
||||||
|
<span id="cb38-7"><a href="#cb38-7" aria-hidden="true" tabindex="-1"></a>diet_tab <span class="ot"><-</span> <span class="fu">extract_readcount</span>(diet_data,<span class="at">key=</span><span class="st">"obiclean_weight"</span>)</span>
|
||||||
|
<span id="cb38-8"><a href="#cb38-8" aria-hidden="true" tabindex="-1"></a>diet_tab</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
|
||||||
|
<div class="cell-output cell-output-stdout">
|
||||||
|
<pre><code>4 x 26 sparse Matrix of class "dgCMatrix"</code></pre>
|
||||||
|
</div>
|
||||||
|
<div class="cell-output cell-output-stderr">
|
||||||
|
<pre><code> [[ suppressing 26 column names 'HELIUM_000100422_612GNAAXX:7:30:17945:19531#0/1_sub[28..126]', 'HELIUM_000100422_612GNAAXX:7:94:16908:11285#0/1_sub[28..127]', 'HELIUM_000100422_612GNAAXX:7:100:4828:3492#0/1_sub[28..127]' ... ]]</code></pre>
|
||||||
|
</div>
|
||||||
|
<div class="cell-output cell-output-stdout">
|
||||||
|
<pre><code>
|
||||||
|
26a_F040644 43 . . . . 88 . 52 208 15 31 . . 14 481 72 17 . .
|
||||||
|
13a_F730603 . 8409 22 1 . . . . . . . 20 . . 19 . . 15 .
|
||||||
|
29a_F260619 . . . 13 353 . 391 . . . . . 6275 . 1 . . . 44
|
||||||
|
15a_F730814 . . . . . . . . . . . . 9165 . 5 . . . .
|
||||||
|
|
||||||
|
26a_F040644 12830 14 . . 18 . .
|
||||||
|
13a_F730603 . . . 9 . . 25
|
||||||
|
29a_F260619 . 110 16 . . 25 .
|
||||||
|
15a_F730814 . . . 4 . . .</code></pre>
|
||||||
|
</div>
|
||||||
|
</div>
|
||||||
<dl>
|
<dl>
|
||||||
<dt>This file contains 26 sequences. You can deduce the diet of each sample:</dt>
|
<dt>This file contains 26 sequences. You can deduce the diet of each sample:</dt>
|
||||||
<dd>
|
<dd>
|
||||||
|
|||||||
+67
-52
@@ -379,6 +379,8 @@ sequences and reference sequences.
|
|||||||
|
|
||||||
#### Download the taxonomy {.unnumbered}
|
#### Download the taxonomy {.unnumbered}
|
||||||
|
|
||||||
|
It is always possible to download the complete taxonomy from NCBI using the following commands.
|
||||||
|
|
||||||
```{bash}
|
```{bash}
|
||||||
#| output: false
|
#| output: false
|
||||||
mkdir TAXO
|
mkdir TAXO
|
||||||
@@ -388,67 +390,62 @@ curl http://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz \
|
|||||||
cd ..
|
cd ..
|
||||||
```
|
```
|
||||||
|
|
||||||
|
For people have a low speed internet connection, a copy of the `taxdump.tar.gz` file is provided in the wolf_data directory.
|
||||||
|
The NCBI taxonomy is dayly updated, but the one provided here is ok for running this tutorial.
|
||||||
|
|
||||||
|
To build the TAXO directory from the provided `taxdump.tar.gz`, you need to execute the following commands
|
||||||
|
|
||||||
|
```{bash}
|
||||||
|
#| output: false
|
||||||
|
mkdir TAXO
|
||||||
|
cd TAXO
|
||||||
|
tar zxvf wolf_data/taxdump.tar.gz
|
||||||
|
cd ..
|
||||||
|
```
|
||||||
|
|
||||||
#### Build a reference database {.unnumbered}
|
#### Build a reference database {.unnumbered}
|
||||||
|
|
||||||
One way to build the reference database is to use the
|
One way to build the reference database is to use the `obipcr` program to simulate a PCR and extract all sequences from a general purpose DNA database such as genbank or EMBL that can be
|
||||||
`ecoPCR <scripts/ecoPCR>`{.interpreted-text role="doc"} program to
|
amplified *in silico* by the two primers (here **TTAGATACCCCACTATGC** and **TAGAACAGGCTCCTCTAG**)
|
||||||
simulate a PCR and to extract all sequences from the EMBL that may be
|
|
||||||
amplified [in silico]{.title-ref} by the two primers
|
|
||||||
([TTAGATACCCCACTATGC]{.title-ref} and [TAGAACAGGCTCCTCTAG]{.title-ref})
|
|
||||||
used for PCR amplification.
|
used for PCR amplification.
|
||||||
|
|
||||||
The full list of steps for building this reference database would then
|
The two steps to build this reference database would then be
|
||||||
be:
|
|
||||||
|
|
||||||
1. Download the whole set of EMBL sequences (available from:
|
1. Today, the easiest database to download is *Genbank*. But this will take you more than a day and occupy more than half a terabyte on your hard drive. In the `wolf_data` directory, a shell script called `download_gb.sh` is provided to perform this task. It requires that the programs `wget2` and `curl` are available on your computer.
|
||||||
<ftp://ftp.ebi.ac.uk/pub/databases/embl/release/>)
|
|
||||||
2. Download the NCBI taxonomy (available from:
|
|
||||||
<ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz>)
|
|
||||||
3. Format them into the ecoPCR format (see
|
|
||||||
`obiconvert <scripts/obiconvert>`{.interpreted-text role="doc"} for
|
|
||||||
how you can produce ecoPCR compatible files)
|
|
||||||
4. Use ecoPCR to simulate amplification and build a reference database
|
|
||||||
based on putatively amplified barcodes together with their recorded
|
|
||||||
taxonomic information
|
|
||||||
|
|
||||||
As step 1 and step 3 can be really time-consuming (about one day), we
|
1. Use `obipcr` to simulate amplification and build a reference database based on the putatively amplified barcodes and their recorded taxonomic information.
|
||||||
alredy provide the reference database produced by the following commands
|
|
||||||
so that you can skip its construction. Note that as the EMBL database
|
|
||||||
and taxonomic data can evolve daily, if you run the following commands
|
|
||||||
you may end up with quite different results.
|
|
||||||
|
|
||||||
Any utility allowing file downloading from a ftp site can be used. In
|
As these steps can take a long time (about a day for the download and an hour for the PCR), we already provide the reference database produced by the following commands so you can skip its construction. Note that as the Genbank and taxonomic database evolve frequently, if you run the following commands you may get different results.
|
||||||
the following commands, we use the commonly used `wget` *Unix* command.
|
|
||||||
|
|
||||||
##### Download the sequences {.unnumbered}
|
##### Download the sequences {.unnumbered}
|
||||||
|
|
||||||
``` bash
|
```{bash}
|
||||||
> mkdir EMBL
|
#| eval: false
|
||||||
> cd EMBL
|
mkdir genbank
|
||||||
> wget -nH --cut-dirs=4 -Arel_std_\*.dat.gz -m ftp://ftp.ebi.ac.uk/pub/databases/embl/release/
|
cd genbank
|
||||||
> cd ..
|
../wolf_data/install_gb.sh
|
||||||
|
cd ..
|
||||||
```
|
```
|
||||||
|
|
||||||
##### Download the taxonomy {.unnumbered}
|
DO NOT RUN THIS COMMAND EXCEPT IF YOU ARE REALLY CONSIENT OF THE TIME AND DISK SPACE REQUIRED.
|
||||||
|
|
||||||
``` bash
|
|
||||||
> mkdir TAXO
|
|
||||||
> cd TAXO
|
|
||||||
> wget ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz
|
|
||||||
> tar -zxvf taxdump.tar.gz
|
|
||||||
> cd ..
|
|
||||||
```
|
|
||||||
|
|
||||||
|
|
||||||
##### Use obipcr to simulate an in silico\` PCR {.unnumbered}
|
##### Use obipcr to simulate an in silico\` PCR {.unnumbered}
|
||||||
|
|
||||||
``` bash
|
```{bash}
|
||||||
> obipcr -d ./ECODB/embl_last -e 3 -l 50 -L 150 \
|
#| eval: false
|
||||||
TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG > v05.ecopcr
|
obipcr -t TAXO -e 3 -l 50 -L 150 \
|
||||||
|
--forward TTAGATACCCCACTATGC \
|
||||||
|
--reverse TAGAACAGGCTCCTCTAG \
|
||||||
|
--no-order \
|
||||||
|
genbank/Release-251/gb*.seq.gz
|
||||||
|
> results/v05.pcr.fasta
|
||||||
```
|
```
|
||||||
|
|
||||||
Note that the primers must be in the same order both in
|
Note that the primers must be in the same order both in
|
||||||
`wolf_diet_ngsfilter.txt` and in the `obipcr` command.
|
`wolf_diet_ngsfilter.txt` and in the `obipcr` command.
|
||||||
|
The part of the path indicating the *Genbank* release can change.
|
||||||
|
Please check in your genbank directory the exact name of your release.
|
||||||
|
|
||||||
##### Clean the database {.unnumbered}
|
##### Clean the database {.unnumbered}
|
||||||
|
|
||||||
@@ -461,20 +458,23 @@ Note that the primers must be in the same order both in
|
|||||||
4. ensure that sequences each have a unique identification
|
4. ensure that sequences each have a unique identification
|
||||||
(`obiannotate` command below)
|
(`obiannotate` command below)
|
||||||
|
|
||||||
``` bash
|
```{bash}
|
||||||
> obigrep -d embl_last --require-rank=species \
|
#| eval: false
|
||||||
--require-rank=genus --require-rank=family v05.ecopcr > v05_clean.fasta
|
|
||||||
|
|
||||||
> obiuniq -d embl_last \
|
obigrep -t TAXO \
|
||||||
v05_clean.fasta > v05_clean_uniq.fasta
|
--require-rank species \
|
||||||
|
--require-rank genus \
|
||||||
|
--require-rank family \
|
||||||
|
results/v05.ecopcr > results/v05_clean.fasta
|
||||||
|
|
||||||
> obigrep -d embl_last --require-rank=family \
|
obiuniq -c taxid \
|
||||||
v05_clean_uniq.fasta > v05_clean_uniq_clean.fasta
|
results/v05_clean.fasta \
|
||||||
|
> results/v05_clean_uniq.fasta
|
||||||
|
|
||||||
> obiannotate --uniq-id v05_clean_uniq_clean.fasta > db_v05.fasta
|
obirefidx -t TAXO results/v05_clean_uniq.fasta \
|
||||||
|
> results/v05_clean_uniq.indexed.fasta
|
||||||
```
|
```
|
||||||
|
|
||||||
obirefidx -t TAXO wolf_data/db_v05_r117.fasta > results/db_v05_r117.indexed.fasta
|
|
||||||
|
|
||||||
|
|
||||||
::: warning
|
::: warning
|
||||||
@@ -485,8 +485,7 @@ Warning
|
|||||||
From now on, for the sake of clarity, the following commands will use
|
From now on, for the sake of clarity, the following commands will use
|
||||||
the filenames of the files provided with the tutorial. If you decided to
|
the filenames of the files provided with the tutorial. If you decided to
|
||||||
run the last steps and use the files you have produced, you\'ll have to
|
run the last steps and use the files you have produced, you\'ll have to
|
||||||
use `db_v05.fasta` instead of `db_v05_r117.fasta` and `embl_last`
|
use `results/v05_clean_uniq.indexed.fasta` instead of `wolf_data/db_v05_r117.indexed.fasta`.
|
||||||
instead of `embl_r117`
|
|
||||||
:::
|
:::
|
||||||
|
|
||||||
### Assign each sequence to a taxon
|
### Assign each sequence to a taxon
|
||||||
@@ -551,6 +550,22 @@ ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
|||||||
gattaaacctcaaaggacttggcagtgctttatacccct
|
gattaaacctcaaaggacttggcagtgctttatacccct
|
||||||
```
|
```
|
||||||
|
|
||||||
|
### Looking at the data in R
|
||||||
|
|
||||||
|
|
||||||
|
```{r}
|
||||||
|
library(ROBIFastread)
|
||||||
|
library(vegan)
|
||||||
|
library(magrittr)
|
||||||
|
|
||||||
|
|
||||||
|
diet_data <- read_obifasta("results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta")
|
||||||
|
diet_data %<>% extract_features("obitag_bestmatch","obitag_rank","scientific_name",'taxid')
|
||||||
|
|
||||||
|
diet_tab <- extract_readcount(diet_data,key="obiclean_weight")
|
||||||
|
diet_tab
|
||||||
|
```
|
||||||
|
|
||||||
This file contains 26 sequences. You can deduce the diet of each sample:
|
This file contains 26 sequences. You can deduce the diet of each sample:
|
||||||
|
|
||||||
: - 13a_F730603: Cervus elaphus
|
: - 13a_F730603: Cervus elaphus
|
||||||
|
|||||||
@@ -17,9 +17,9 @@ var _setSeqLength = false
|
|||||||
var _uniqueID = false
|
var _uniqueID = false
|
||||||
|
|
||||||
func SequenceAnnotationOptionSet(options *getoptions.GetOpt) {
|
func SequenceAnnotationOptionSet(options *getoptions.GetOpt) {
|
||||||
options.BoolVar(&_addRank, "seq-rank", _addRank,
|
// options.BoolVar(&_addRank, "seq-rank", _addRank,
|
||||||
options.Description("Adds a new attribute named seq_rank to the sequence record indicating its entry number in the sequence file."),
|
// options.Description("Adds a new attribute named seq_rank to the sequence record indicating its entry number in the sequence file."),
|
||||||
)
|
// )
|
||||||
|
|
||||||
options.BoolVar(&_clearAll, "clear", _clearAll,
|
options.BoolVar(&_clearAll, "clear", _clearAll,
|
||||||
options.Description("Clears all attributes associated to the sequence records."),
|
options.Description("Clears all attributes associated to the sequence records."),
|
||||||
@@ -29,9 +29,10 @@ func SequenceAnnotationOptionSet(options *getoptions.GetOpt) {
|
|||||||
options.Description("Adds attribute with seq_length as a key and sequence length as a value."),
|
options.Description("Adds attribute with seq_length as a key and sequence length as a value."),
|
||||||
)
|
)
|
||||||
|
|
||||||
options.BoolVar(&_uniqueID, "uniq-id", _uniqueID,
|
// options.BoolVar(&_uniqueID, "uniq-id", _uniqueID,
|
||||||
options.Description("Forces sequence record ids to be unique."),
|
// options.Description("Forces sequence record ids to be unique."),
|
||||||
)
|
// )
|
||||||
|
|
||||||
options.StringMapVar(&_toBeRenamed, "rename-tag", 1, 1,
|
options.StringMapVar(&_toBeRenamed, "rename-tag", 1, 1,
|
||||||
options.Alias("R"),
|
options.Alias("R"),
|
||||||
options.ArgName("NEW_NAME=OLD_NAME"),
|
options.ArgName("NEW_NAME=OLD_NAME"),
|
||||||
@@ -47,10 +48,10 @@ func SequenceAnnotationOptionSet(options *getoptions.GetOpt) {
|
|||||||
options.ArgName("RANK_NAME"),
|
options.ArgName("RANK_NAME"),
|
||||||
options.Description("Adds taxonomic annotation at taxonomic rank <RANK_NAME>."))
|
options.Description("Adds taxonomic annotation at taxonomic rank <RANK_NAME>."))
|
||||||
|
|
||||||
options.StringVar(&_tagList, "tag-list", _tagList,
|
// options.StringVar(&_tagList, "tag-list", _tagList,
|
||||||
options.ArgName("FILENAME"),
|
// options.ArgName("FILENAME"),
|
||||||
options.Description("<FILENAME> points to a file containing attribute names"+
|
// options.Description("<FILENAME> points to a file containing attribute names"+
|
||||||
" and values to modify for specified sequence records."))
|
// " and values to modify for specified sequence records."))
|
||||||
|
|
||||||
options.StringSliceVar(&_keepOnly, "keep", 1, 1,
|
options.StringSliceVar(&_keepOnly, "keep", 1, 1,
|
||||||
options.Alias("k"),
|
options.Alias("k"),
|
||||||
@@ -111,14 +112,8 @@ func CLIHasToBeKeptAttributes() bool {
|
|||||||
return len(_keepOnly) > 0
|
return len(_keepOnly) > 0
|
||||||
}
|
}
|
||||||
|
|
||||||
func CLIToBeKeptAttributes() map[string]bool {
|
func CLIToBeKeptAttributes() []string {
|
||||||
d := make(map[string]bool, len(_keepOnly))
|
return _keepOnly
|
||||||
|
|
||||||
for _, v := range _keepOnly {
|
|
||||||
d[v] = true
|
|
||||||
}
|
|
||||||
|
|
||||||
return d
|
|
||||||
}
|
}
|
||||||
|
|
||||||
func CLIHasTaxonAtRank() bool {
|
func CLIHasTaxonAtRank() bool {
|
||||||
@@ -132,3 +127,7 @@ func CLITaxonAtRank() []string {
|
|||||||
func CLIHasSetLengthFlag() bool {
|
func CLIHasSetLengthFlag() bool {
|
||||||
return _setSeqLength
|
return _setSeqLength
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func CLIHasClearAllFlag() bool {
|
||||||
|
return _clearAll
|
||||||
|
}
|
||||||
Reference in New Issue
Block a user