mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-05-09 23:50:38 +00:00
First version of obisplit and patch a bug in the new workers API
Former-commit-id: f28af9f104c08d68e29fd866739d8dd58241da63
This commit is contained in:
@@ -0,0 +1,57 @@
|
|||||||
|
package main
|
||||||
|
|
||||||
|
import (
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obisplit"
|
||||||
|
)
|
||||||
|
|
||||||
|
func main() {
|
||||||
|
|
||||||
|
defer obiseq.LogBioSeqStatus()
|
||||||
|
|
||||||
|
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
|
||||||
|
// f, err := os.Create("cpu.pprof")
|
||||||
|
// if err != nil {
|
||||||
|
// log.Fatal(err)
|
||||||
|
// }
|
||||||
|
// pprof.StartCPUProfile(f)
|
||||||
|
// defer pprof.StopCPUProfile()
|
||||||
|
|
||||||
|
// go tool trace cpu.trace
|
||||||
|
// ftrace, err := os.Create("cpu.trace")
|
||||||
|
// if err != nil {
|
||||||
|
// log.Fatal(err)
|
||||||
|
// }
|
||||||
|
// trace.Start(ftrace)
|
||||||
|
// defer trace.Stop()
|
||||||
|
|
||||||
|
optionParser := obioptions.GenerateOptionParser(obisplit.OptionSet)
|
||||||
|
|
||||||
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
if obisplit.CLIAskConfigTemplate() {
|
||||||
|
fmt.Print(obisplit.CLIConfigTemplate())
|
||||||
|
os.Exit(0)
|
||||||
|
}
|
||||||
|
|
||||||
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
|
annotator := obisplit.CLISlitPipeline()
|
||||||
|
obiconvert.CLIWriteBioSequences(sequences.Pipe(annotator), true)
|
||||||
|
|
||||||
|
obiiter.WaitForLastPipe()
|
||||||
|
|
||||||
|
}
|
||||||
+35
-1
@@ -214,7 +214,7 @@ func MakeApatSequence(sequence *obiseq.BioSequence, circular bool, recycle ...Ap
|
|||||||
var errmsg *C.char
|
var errmsg *C.char
|
||||||
|
|
||||||
if apat_p != nil && apat_p.pointer != nil {
|
if apat_p != nil && apat_p.pointer != nil {
|
||||||
log.Debugf("Finaliser called on %p\n", apat_p.pointer)
|
// log.Debugf("Finaliser called on %p\n", apat_p.pointer)
|
||||||
C.delete_apatseq(apat_p.pointer, &errno, &errmsg)
|
C.delete_apatseq(apat_p.pointer, &errno, &errmsg)
|
||||||
}
|
}
|
||||||
})
|
})
|
||||||
@@ -376,3 +376,37 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
|
|||||||
// func AllocatedApaSequences() int {
|
// func AllocatedApaSequences() int {
|
||||||
// return int(_AllocatedApaSequences)
|
// return int(_AllocatedApaSequences)
|
||||||
// }
|
// }
|
||||||
|
|
||||||
|
func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int) (loc [][3]int) {
|
||||||
|
res := pattern.FindAllIndex(sequence, begin, length)
|
||||||
|
|
||||||
|
sbuffer := [(int(C.MAX_PAT_LEN) + int(C.MAX_PAT_ERR) + 1) * (int(C.MAX_PAT_LEN) + 1)]uint64{}
|
||||||
|
buffer := sbuffer[:]
|
||||||
|
|
||||||
|
for _, m := range res {
|
||||||
|
if m[2] > 0 && pattern.pointer.pointer.hasIndel {
|
||||||
|
start := m[0] - m[2]
|
||||||
|
end := m[0] + int(pattern.pointer.pointer.patlen) + m[2]
|
||||||
|
start = obiutils.MaxInt(start, 0)
|
||||||
|
end = obiutils.MinInt(end, sequence.Len())
|
||||||
|
|
||||||
|
cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat))
|
||||||
|
frg := sequence.pointer.reference.Sequence()[start:end]
|
||||||
|
|
||||||
|
score, lali := obialign.FastLCSEGFScoreByte(
|
||||||
|
frg,
|
||||||
|
(*cpattern)[0:int(pattern.pointer.pointer.patlen)],
|
||||||
|
m[2], true, &buffer)
|
||||||
|
|
||||||
|
// log.Debugf("seq[%d] : %s %d, %d", i, sequence.pointer.reference.Id(), score, lali)
|
||||||
|
|
||||||
|
m[2] = lali - score
|
||||||
|
m[0] = m[0] + int(pattern.pointer.pointer.patlen) - lali
|
||||||
|
m[1] = m[0] + lali
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Debugf("All matches : %v", res)
|
||||||
|
|
||||||
|
return res
|
||||||
|
}
|
||||||
|
|||||||
@@ -34,7 +34,7 @@ func (iterator IBioSequence) MakeIWorker(worker obiseq.SeqWorker,
|
|||||||
|
|
||||||
}()
|
}()
|
||||||
|
|
||||||
sw := obiseq.SeqToSliceWorker(worker, true, breakOnError)
|
sw := obiseq.SeqToSliceWorker(worker, breakOnError)
|
||||||
|
|
||||||
f := func(iterator IBioSequence) {
|
f := func(iterator IBioSequence) {
|
||||||
var err error
|
var err error
|
||||||
@@ -90,7 +90,7 @@ func (iterator IBioSequence) MakeIConditionalWorker(predicate obiseq.SequencePre
|
|||||||
|
|
||||||
}()
|
}()
|
||||||
|
|
||||||
sw := obiseq.SeqToSliceConditionalWorker(predicate, worker, true, breakOnError)
|
sw := obiseq.SeqToSliceConditionalWorker(predicate, worker, breakOnError)
|
||||||
|
|
||||||
f := func(iterator IBioSequence) {
|
f := func(iterator IBioSequence) {
|
||||||
var err error
|
var err error
|
||||||
|
|||||||
+20
-33
@@ -25,37 +25,27 @@ func AnnotatorToSeqWorker(function SeqAnnotator) SeqWorker {
|
|||||||
}
|
}
|
||||||
|
|
||||||
func SeqToSliceWorker(worker SeqWorker,
|
func SeqToSliceWorker(worker SeqWorker,
|
||||||
inplace, breakOnError bool) SeqSliceWorker {
|
breakOnError bool) SeqSliceWorker {
|
||||||
var f SeqSliceWorker
|
var f SeqSliceWorker
|
||||||
|
|
||||||
if worker == nil {
|
if worker == nil {
|
||||||
if inplace {
|
f = func(input BioSequenceSlice) (BioSequenceSlice, error) {
|
||||||
f = func(input BioSequenceSlice) (BioSequenceSlice, error) {
|
return input, nil
|
||||||
return input, nil
|
|
||||||
}
|
|
||||||
} else {
|
|
||||||
f = func(input BioSequenceSlice) (BioSequenceSlice, error) {
|
|
||||||
output := MakeBioSequenceSlice(len(input))
|
|
||||||
copy(output, input)
|
|
||||||
return output, nil
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
} else {
|
} else {
|
||||||
f = func(input BioSequenceSlice) (BioSequenceSlice, error) {
|
f = func(input BioSequenceSlice) (BioSequenceSlice, error) {
|
||||||
output := input
|
output := MakeBioSequenceSlice(len(input))
|
||||||
if !inplace {
|
|
||||||
output = MakeBioSequenceSlice(len(input))
|
|
||||||
}
|
|
||||||
i := 0
|
i := 0
|
||||||
for _, s := range input {
|
for _, s := range input {
|
||||||
r, err := worker(s)
|
r, err := worker(s)
|
||||||
if err == nil {
|
if err == nil {
|
||||||
for _, rs := range r {
|
for _, rs := range r {
|
||||||
|
if i == len(output) {
|
||||||
|
output = slices.Grow(output, cap(output))
|
||||||
|
output = output[:cap(output)]
|
||||||
|
}
|
||||||
output[i] = rs
|
output[i] = rs
|
||||||
i++
|
i++
|
||||||
if i == cap(output) {
|
|
||||||
slices.Grow(output, cap(output))
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
} else {
|
} else {
|
||||||
@@ -64,8 +54,8 @@ func SeqToSliceWorker(worker SeqWorker,
|
|||||||
s.Id(), err)
|
s.Id(), err)
|
||||||
return BioSequenceSlice{}, err
|
return BioSequenceSlice{}, err
|
||||||
} else {
|
} else {
|
||||||
log.Warnf("got an error on sequence %s processing",
|
log.Warnf("got an error on sequence %s processing : %v",
|
||||||
s.Id())
|
s.Id(), err)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -80,18 +70,14 @@ func SeqToSliceWorker(worker SeqWorker,
|
|||||||
|
|
||||||
func SeqToSliceConditionalWorker(
|
func SeqToSliceConditionalWorker(
|
||||||
condition SequencePredicate,
|
condition SequencePredicate,
|
||||||
worker SeqWorker,
|
worker SeqWorker, breakOnError bool) SeqSliceWorker {
|
||||||
inplace, breakOnError bool) SeqSliceWorker {
|
|
||||||
|
|
||||||
if condition == nil {
|
if condition == nil {
|
||||||
return SeqToSliceWorker(worker, inplace, breakOnError)
|
return SeqToSliceWorker(worker, breakOnError)
|
||||||
}
|
}
|
||||||
|
|
||||||
f := func(input BioSequenceSlice) (BioSequenceSlice, error) {
|
f := func(input BioSequenceSlice) (BioSequenceSlice, error) {
|
||||||
output := input
|
output := MakeBioSequenceSlice(len(input))
|
||||||
if !inplace {
|
|
||||||
output = MakeBioSequenceSlice(len(input))
|
|
||||||
}
|
|
||||||
|
|
||||||
i := 0
|
i := 0
|
||||||
|
|
||||||
@@ -100,11 +86,12 @@ func SeqToSliceConditionalWorker(
|
|||||||
r, err := worker(s)
|
r, err := worker(s)
|
||||||
if err == nil {
|
if err == nil {
|
||||||
for _, rs := range r {
|
for _, rs := range r {
|
||||||
|
if i == len(output) {
|
||||||
|
output = slices.Grow(output, cap(output))
|
||||||
|
output = output[:cap(output)]
|
||||||
|
}
|
||||||
output[i] = rs
|
output[i] = rs
|
||||||
i++
|
i++
|
||||||
if i == cap(output) {
|
|
||||||
slices.Grow(output, cap(output))
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
} else {
|
} else {
|
||||||
if breakOnError {
|
if breakOnError {
|
||||||
@@ -112,8 +99,8 @@ func SeqToSliceConditionalWorker(
|
|||||||
s.Id(), err)
|
s.Id(), err)
|
||||||
return BioSequenceSlice{}, err
|
return BioSequenceSlice{}, err
|
||||||
} else {
|
} else {
|
||||||
log.Warnf("got an error on sequence %s processing",
|
log.Warnf("got an error on sequence %s processing : %v",
|
||||||
s.Id())
|
s.Id(), err)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -134,7 +121,7 @@ func (worker SeqWorker) ChainWorkers(next SeqWorker) SeqWorker {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
sw := SeqToSliceWorker(next, true, false)
|
sw := SeqToSliceWorker(next, false)
|
||||||
|
|
||||||
f := func(seq *BioSequence) (BioSequenceSlice, error) {
|
f := func(seq *BioSequence) (BioSequenceSlice, error) {
|
||||||
if seq == nil {
|
if seq == nil {
|
||||||
|
|||||||
@@ -313,7 +313,7 @@ func CLIAnnotationPipeline() obiiter.Pipeable {
|
|||||||
predicate := obigrep.CLISequenceSelectionPredicate()
|
predicate := obigrep.CLISequenceSelectionPredicate()
|
||||||
worker := CLIAnnotationWorker()
|
worker := CLIAnnotationWorker()
|
||||||
|
|
||||||
annotator := obiseq.SeqToSliceConditionalWorker(predicate, worker, true, false)
|
annotator := obiseq.SeqToSliceConditionalWorker(predicate, worker, false)
|
||||||
f := obiiter.SliceWorkerPipe(annotator, false, obioptions.CLIParallelWorkers())
|
f := obiiter.SliceWorkerPipe(annotator, false, obioptions.CLIParallelWorkers())
|
||||||
|
|
||||||
return f
|
return f
|
||||||
|
|||||||
@@ -0,0 +1,257 @@
|
|||||||
|
package obisplit
|
||||||
|
|
||||||
|
import (
|
||||||
|
"fmt"
|
||||||
|
"sort"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiapat"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
)
|
||||||
|
|
||||||
|
type SplitSequence struct {
|
||||||
|
pattern string
|
||||||
|
name string
|
||||||
|
forward_pattern obiapat.ApatPattern
|
||||||
|
reverse_pattern obiapat.ApatPattern
|
||||||
|
}
|
||||||
|
|
||||||
|
type Pattern_match struct {
|
||||||
|
name string
|
||||||
|
pattern string
|
||||||
|
match string
|
||||||
|
begin int
|
||||||
|
end int
|
||||||
|
nerrors int
|
||||||
|
forward bool
|
||||||
|
}
|
||||||
|
|
||||||
|
func LocatePatterns(sequence *obiseq.BioSequence,
|
||||||
|
patterns []SplitSequence) []Pattern_match {
|
||||||
|
|
||||||
|
aseq, err := obiapat.MakeApatSequence(sequence, false)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Cannot index sequence %s for patern matching", sequence.Id())
|
||||||
|
}
|
||||||
|
|
||||||
|
res := make([]Pattern_match, 0, 10)
|
||||||
|
|
||||||
|
for _, split := range patterns {
|
||||||
|
ms := split.forward_pattern.AllMatches(aseq, 0, aseq.Len())
|
||||||
|
for _, m := range ms {
|
||||||
|
m[0] = max(0, m[0])
|
||||||
|
m[1] = min(sequence.Len(), m[1])
|
||||||
|
match, err := sequence.Subsequence(m[0], m[1], false)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Cannot extract pattern %s from sequence %s", split.pattern, sequence.Id())
|
||||||
|
}
|
||||||
|
|
||||||
|
res = append(res, Pattern_match{
|
||||||
|
name: split.name,
|
||||||
|
pattern: split.pattern,
|
||||||
|
match: match.String(),
|
||||||
|
begin: m[0],
|
||||||
|
end: m[1],
|
||||||
|
nerrors: m[2],
|
||||||
|
forward: true,
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
ms = split.reverse_pattern.AllMatches(aseq, 0, aseq.Len())
|
||||||
|
for _, m := range ms {
|
||||||
|
m[0] = max(0, m[0])
|
||||||
|
m[1] = min(sequence.Len(), m[1])
|
||||||
|
match, err := sequence.Subsequence(m[0], m[1], false)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Cannot extract reverse pattern %s from sequence %s", split.pattern, sequence.Id())
|
||||||
|
}
|
||||||
|
|
||||||
|
match = match.ReverseComplement(true)
|
||||||
|
|
||||||
|
res = append(res, Pattern_match{
|
||||||
|
name: split.name,
|
||||||
|
pattern: split.pattern,
|
||||||
|
match: match.String(),
|
||||||
|
begin: m[0],
|
||||||
|
end: m[1],
|
||||||
|
nerrors: m[2],
|
||||||
|
forward: false,
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
sort.Slice(res, func(i, j int) bool {
|
||||||
|
a := res[i].begin
|
||||||
|
b := res[j].begin
|
||||||
|
return a < b
|
||||||
|
})
|
||||||
|
|
||||||
|
log.Debugf("Sequence %s Raw match : %v", sequence.Id(), res)
|
||||||
|
if len(res) > 1 {
|
||||||
|
j := 0
|
||||||
|
m1 := res[0]
|
||||||
|
for _, m2 := range res[1:] {
|
||||||
|
if m2.begin < m1.end {
|
||||||
|
if m2.nerrors < m1.nerrors {
|
||||||
|
m1 = m2
|
||||||
|
}
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
res[j] = m1
|
||||||
|
m1 = m2
|
||||||
|
j++
|
||||||
|
}
|
||||||
|
|
||||||
|
res[j] = m1
|
||||||
|
res = res[:j+1]
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Debugf("Sequence %s No overlap match : %v", sequence.Id(), res)
|
||||||
|
|
||||||
|
return res
|
||||||
|
}
|
||||||
|
|
||||||
|
func SplitPattern(sequence *obiseq.BioSequence,
|
||||||
|
patterns []SplitSequence) (obiseq.BioSequenceSlice, error) {
|
||||||
|
|
||||||
|
matches := LocatePatterns(sequence, patterns)
|
||||||
|
|
||||||
|
from := Pattern_match{
|
||||||
|
name: "5extremity",
|
||||||
|
pattern: "",
|
||||||
|
match: "",
|
||||||
|
begin: 0,
|
||||||
|
end: 0,
|
||||||
|
nerrors: 0,
|
||||||
|
forward: true,
|
||||||
|
}
|
||||||
|
|
||||||
|
res := obiseq.MakeBioSequenceSlice(10)
|
||||||
|
nfrag := 0
|
||||||
|
res = res[:nfrag]
|
||||||
|
|
||||||
|
for i, to := range matches {
|
||||||
|
log.Debugf("from : %v to : %v", from, to)
|
||||||
|
start := from.end
|
||||||
|
end := to.begin
|
||||||
|
|
||||||
|
if i == 0 && end <= 0 {
|
||||||
|
from = to
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if end > start {
|
||||||
|
log.Debugf("Extracting fragment %d from sequence %s [%d:%d]",
|
||||||
|
nfrag+1, sequence.Id(),
|
||||||
|
start, end,
|
||||||
|
)
|
||||||
|
|
||||||
|
sub, err := sequence.Subsequence(start, end, false)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
return res[:nfrag],
|
||||||
|
fmt.Errorf("cannot extract fragment %d from sequence %s [%d:%d]",
|
||||||
|
nfrag+1, sequence.Id(),
|
||||||
|
start, end,
|
||||||
|
)
|
||||||
|
}
|
||||||
|
|
||||||
|
nfrag++
|
||||||
|
sub.SetAttribute("obisplit_frg", nfrag)
|
||||||
|
|
||||||
|
if from.name == to.name {
|
||||||
|
sub.SetAttribute("obisplit_group", from.name)
|
||||||
|
} else {
|
||||||
|
sub.SetAttribute("obisplit_group", fmt.Sprintf("%s-%s", from.name, to.name))
|
||||||
|
}
|
||||||
|
|
||||||
|
sub.SetAttribute("obisplit_location", fmt.Sprintf("%d..%d", start, end))
|
||||||
|
|
||||||
|
sub.SetAttribute("obisplit_right_error", to.nerrors)
|
||||||
|
sub.SetAttribute("obisplit_left_error", from.nerrors)
|
||||||
|
|
||||||
|
sub.SetAttribute("obisplit_right_pattern", to.pattern)
|
||||||
|
sub.SetAttribute("obisplit_left_pattern", from.pattern)
|
||||||
|
|
||||||
|
sub.SetAttribute("obisplit_left_match", from.match)
|
||||||
|
sub.SetAttribute("obisplit_right_match", to.match)
|
||||||
|
|
||||||
|
res = append(res, sub)
|
||||||
|
|
||||||
|
}
|
||||||
|
from = to
|
||||||
|
}
|
||||||
|
|
||||||
|
if from.end < sequence.Len() {
|
||||||
|
to := Pattern_match{
|
||||||
|
name: "3extremity",
|
||||||
|
pattern: "",
|
||||||
|
match: "",
|
||||||
|
begin: sequence.Len(),
|
||||||
|
end: sequence.Len(),
|
||||||
|
nerrors: 0,
|
||||||
|
forward: true,
|
||||||
|
}
|
||||||
|
|
||||||
|
start := from.end
|
||||||
|
end := to.begin
|
||||||
|
|
||||||
|
sub, err := sequence.Subsequence(start, end, false)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
return res[:nfrag],
|
||||||
|
fmt.Errorf("cannot extract last fragment %d from sequence %s [%d:%d]",
|
||||||
|
nfrag+1, sequence.Id(),
|
||||||
|
start, end,
|
||||||
|
)
|
||||||
|
}
|
||||||
|
|
||||||
|
nfrag++
|
||||||
|
sub.SetAttribute("obisplit_frg", nfrag)
|
||||||
|
if from.name == to.name {
|
||||||
|
sub.SetAttribute("obisplit_group", from.name)
|
||||||
|
} else {
|
||||||
|
sub.SetAttribute("obisplit_group", fmt.Sprintf("%s-%s", from.name, to.name))
|
||||||
|
}
|
||||||
|
sub.SetAttribute("obisplit_location", fmt.Sprintf("%d..%d", start, end))
|
||||||
|
|
||||||
|
sub.SetAttribute("obisplit_right_error", to.nerrors)
|
||||||
|
sub.SetAttribute("obisplit_left_error", from.nerrors)
|
||||||
|
|
||||||
|
sub.SetAttribute("obisplit_right_pattern", to.pattern)
|
||||||
|
sub.SetAttribute("obisplit_left_pattern", from.pattern)
|
||||||
|
|
||||||
|
sub.SetAttribute("obisplit_left_match", from.match)
|
||||||
|
sub.SetAttribute("obisplit_right_match", to.match)
|
||||||
|
|
||||||
|
res = append(res, sub)
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
return res[:nfrag], nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func SplitPatternWorker(patterns []SplitSequence) obiseq.SeqWorker {
|
||||||
|
f := func(sequence *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
|
||||||
|
return SplitPattern(sequence, patterns)
|
||||||
|
}
|
||||||
|
|
||||||
|
return f
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLISlitPipeline() obiiter.Pipeable {
|
||||||
|
|
||||||
|
worker := SplitPatternWorker(CLIConfig())
|
||||||
|
|
||||||
|
annotator := obiseq.SeqToSliceWorker(worker, false)
|
||||||
|
f := obiiter.SliceWorkerPipe(annotator, false, obioptions.CLIParallelWorkers())
|
||||||
|
|
||||||
|
return f
|
||||||
|
}
|
||||||
@@ -0,0 +1,135 @@
|
|||||||
|
package obisplit
|
||||||
|
|
||||||
|
import (
|
||||||
|
"encoding/csv"
|
||||||
|
"fmt"
|
||||||
|
"log"
|
||||||
|
"os"
|
||||||
|
"slices"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiapat"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
var _askTemplate = false
|
||||||
|
var _config = ""
|
||||||
|
var _pattern_error = 4
|
||||||
|
var _pattern_indel = false
|
||||||
|
|
||||||
|
func SplitOptionSet(options *getoptions.GetOpt) {
|
||||||
|
|
||||||
|
options.StringVar(&_config, "config", _config,
|
||||||
|
options.Description("The configuration file."),
|
||||||
|
options.Alias("C"))
|
||||||
|
|
||||||
|
options.BoolVar(&_askTemplate, "template", _askTemplate,
|
||||||
|
options.Description("Print on the standard output a script template."),
|
||||||
|
)
|
||||||
|
|
||||||
|
options.IntVar(&_pattern_error, "pattern-error", _pattern_error,
|
||||||
|
options.Description("Maximum number of allowed error during pattern matching"),
|
||||||
|
)
|
||||||
|
|
||||||
|
options.BoolVar(&_pattern_indel, "allows-indels", _pattern_indel,
|
||||||
|
options.Description("Allows for indel during pattern matching"),
|
||||||
|
)
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
func OptionSet(options *getoptions.GetOpt) {
|
||||||
|
SplitOptionSet(options)
|
||||||
|
obiconvert.OptionSet(options)
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIHasConfig() bool {
|
||||||
|
return CLIConfigFile() != ""
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIConfigFile() string {
|
||||||
|
return _config
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIConfig() []SplitSequence {
|
||||||
|
// os.Open() opens specific file in
|
||||||
|
// read-only mode and this return
|
||||||
|
// a pointer of type os.File
|
||||||
|
file, err := os.Open(CLIConfigFile())
|
||||||
|
|
||||||
|
// Checks for the error
|
||||||
|
if err != nil {
|
||||||
|
log.Fatal("Error while reading the file", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Closes the file
|
||||||
|
defer file.Close()
|
||||||
|
|
||||||
|
reader := csv.NewReader(file)
|
||||||
|
records, err := reader.ReadAll()
|
||||||
|
|
||||||
|
// Checks for the error
|
||||||
|
if err != nil {
|
||||||
|
fmt.Println("Error reading records")
|
||||||
|
}
|
||||||
|
|
||||||
|
config := make([]SplitSequence, 0, max(0, len(records)-1))
|
||||||
|
|
||||||
|
header := records[0]
|
||||||
|
|
||||||
|
pattern_idx := slices.Index(header, "T-tag")
|
||||||
|
pool_idx := slices.Index(header, "pcr_pool")
|
||||||
|
|
||||||
|
if pattern_idx == -1 {
|
||||||
|
log.Fatalf("Config file %s doesn't contain `T-tag`column", CLIConfigFile())
|
||||||
|
}
|
||||||
|
|
||||||
|
if pool_idx == -1 {
|
||||||
|
pool_idx = pattern_idx
|
||||||
|
}
|
||||||
|
|
||||||
|
// Loop to iterate through
|
||||||
|
// and print each of the string slice
|
||||||
|
for _, eachrecord := range records[1:] {
|
||||||
|
|
||||||
|
fp, err := obiapat.MakeApatPattern(eachrecord[pattern_idx],
|
||||||
|
CLIPatternError(), CLIPatternInDels())
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Error cannot compile pattern %s : %v",
|
||||||
|
eachrecord[pattern_idx], err)
|
||||||
|
}
|
||||||
|
|
||||||
|
rv, err := fp.ReverseComplement()
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Error cannot reverse complement pattern %s: %v",
|
||||||
|
eachrecord[pattern_idx], err)
|
||||||
|
}
|
||||||
|
|
||||||
|
config = append(config, SplitSequence{
|
||||||
|
pattern: eachrecord[pattern_idx],
|
||||||
|
name: eachrecord[pool_idx],
|
||||||
|
forward_pattern: fp,
|
||||||
|
reverse_pattern: rv,
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
return config
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIPatternError() int {
|
||||||
|
return _pattern_error
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIPatternInDels() bool {
|
||||||
|
return _pattern_indel
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIAskConfigTemplate() bool {
|
||||||
|
return _askTemplate
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIConfigTemplate() string {
|
||||||
|
return `T-tag,pcr_pool
|
||||||
|
CGGCACCTGTTACGCAGCCACTATCGGCT,pool_1
|
||||||
|
CGGCAAGACCCTATTGCATTGGCGCGGCT,pool_2
|
||||||
|
`
|
||||||
|
}
|
||||||
Reference in New Issue
Block a user