mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-04-30 03:50:39 +00:00
⬆️ version bump to v4.5
- Update obioptions.Version from "Release 4.4.29" to "/v/ Release v5" - Update version.txt from 4.29 → .30 (automated by Makefile)
This commit is contained in:
@@ -0,0 +1,296 @@
|
||||
# NAME
|
||||
|
||||
obidistribute — divided an input set of sequences into subsets
|
||||
|
||||
---
|
||||
|
||||
# SYNOPSIS
|
||||
|
||||
```
|
||||
obidistribute --pattern|-p <string> [--append|-A] [--batch-mem <string>]
|
||||
[--batch-size <int>] [--batch-size-max <int>]
|
||||
[--batches|-n <int>] [--classifier|-c <string>] [--compress|-Z]
|
||||
[--csv] [--debug] [--directory|-d <string>] [--ecopcr] [--embl]
|
||||
[--fasta] [--fasta-output] [--fastq] [--fastq-output]
|
||||
[--genbank] [--hash|-H <int>] [--help|-h|-?]
|
||||
[--input-OBI-header] [--input-json-header] [--json-output]
|
||||
[--max-cpu <int>] [--na-value <string>] [--no-order]
|
||||
[--no-progressbar] [--out|-o <FILENAME>]
|
||||
[--output-OBI-header|-O] [--output-json-header] [--pprof]
|
||||
[--pprof-goroutine <int>] [--pprof-mutex <int>]
|
||||
[--silent-warning] [--skip-empty] [--solexa] [--u-to-t]
|
||||
[--version] [<args>]
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
# DESCRIPTION
|
||||
|
||||
`obidistribute` splits a set of biological sequences into multiple output files according to one of three distribution strategies: annotation-based classification, round-robin batch assignment, or hash-based sharding.
|
||||
|
||||
The most common use case in metabarcoding is demultiplexing: sequences carry a tag annotation (e.g., `sample_id`) and `obidistribute` writes each sample's sequences into its own file. The output filename for each group is built from a user-supplied pattern containing `%s`, which is replaced by the classifier value or batch index.
|
||||
|
||||
When no classifier is specified, sequences can be split into a fixed number of batches (`--batches`) for parallel downstream processing, or sharded deterministically by hash (`--hash`) to ensure reproducible partitioning regardless of input order.
|
||||
|
||||
Output files can be organised into subdirectories (one per classifier value) using `--directory`, and existing files can be extended rather than overwritten with `--append`. Sequences lacking the classifier annotation are assigned to a file whose name uses the NA value (default: `"NA"`).
|
||||
|
||||
---
|
||||
|
||||
# INPUT
|
||||
|
||||
`obidistribute` reads biological sequences from one or more files supplied as positional arguments, or from standard input when no files are given. All major NGS and flat-file formats are supported and auto-detected:
|
||||
|
||||
- FASTA / FASTQ (plain or gzip-compressed)
|
||||
- GenBank and EMBL flat files
|
||||
- ecoPCR output
|
||||
- CSV
|
||||
|
||||
Format can be forced with `--fasta`, `--fastq`, `--embl`, `--genbank`, `--ecopcr`, or `--csv`. Header annotation style can be specified with `--input-OBI-header` or `--input-json-header`.
|
||||
|
||||
---
|
||||
|
||||
# OUTPUT
|
||||
|
||||
Each distribution group produces a separate output file named according to the `--pattern` template. The `%s` placeholder in the pattern is replaced by the classifier value, batch index, or hash shard index, depending on the chosen distribution mode.
|
||||
|
||||
Output format follows the same rules as other OBITools commands: FASTQ is used when quality scores are present, FASTA otherwise. The format can be forced with `--fasta-output`, `--fastq-output`, or `--json-output`. All annotations present in the input sequences are preserved in the output files.
|
||||
|
||||
When `--directory` is used together with `--classifier`, output files are placed in subdirectories named after the classifier values, allowing hierarchical organisation of results.
|
||||
|
||||
## Observed output example
|
||||
|
||||
```
|
||||
@seq001 {"sample_id":"sampleA"}
|
||||
atcgatcgatcgatcgatcg
|
||||
+
|
||||
IIIIIIIIIIIIIIIIIIII
|
||||
@seq002 {"sample_id":"sampleA"}
|
||||
gctagctagctagctagcta
|
||||
+
|
||||
IIIIIIIIIIIIIIIIIIII
|
||||
@seq003 {"sample_id":"sampleA"}
|
||||
ttagctaatcggtaatcggt
|
||||
+
|
||||
IIIIIIIIIIIIIIIIIIII
|
||||
@seq009 {"sample_id":"sampleA"}
|
||||
atgatgatgatgatgatgat
|
||||
+
|
||||
IIIIIIIIIIIIIIIIIIII
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
# OPTIONS
|
||||
|
||||
## Distribution mode
|
||||
|
||||
- **`--pattern|-p <string>`** — _(required)_
|
||||
Default: none.
|
||||
The template used to build output filenames. The variable part is represented by `%s`. Example: `toto_%s.fastq`.
|
||||
|
||||
- **`--classifier|-c <string>`**
|
||||
Default: `""`.
|
||||
The name of an annotation tag on the sequences. Sequences are dispatched into separate files based on the value of this tag. The tag value must be a string, integer, or boolean.
|
||||
|
||||
- **`--batches|-n <int>`**
|
||||
Default: `0`.
|
||||
Splits the input into exactly *N* batches by round-robin assignment, regardless of sequence metadata.
|
||||
|
||||
- **`--hash|-H <int>`**
|
||||
Default: `0`.
|
||||
Splits the input into at most *N* batches using a hash of the sequence. Produces deterministic, reproducible sharding.
|
||||
|
||||
- **`--directory|-d <string>`**
|
||||
Default: `""`.
|
||||
Used together with `--classifier`: organises output files into subdirectories named after classifier values.
|
||||
|
||||
## Output file handling
|
||||
|
||||
- **`--append|-A`**
|
||||
Default: `false`.
|
||||
Appends sequences to output files if they already exist, instead of overwriting them.
|
||||
|
||||
- **`--na-value <string>`**
|
||||
Default: `"NA"`.
|
||||
Value used as the filename component when a sequence does not have the classifier tag defined.
|
||||
|
||||
- **`--compress|-Z`**
|
||||
Default: `false`.
|
||||
Compresses all output files using gzip.
|
||||
|
||||
## Input format
|
||||
|
||||
- **`--fasta`**
|
||||
Default: `false`.
|
||||
Read data following the FASTA format.
|
||||
|
||||
- **`--fastq`**
|
||||
Default: `false`.
|
||||
Read data following the FASTQ format.
|
||||
|
||||
- **`--embl`**
|
||||
Default: `false`.
|
||||
Read data following the EMBL flatfile format.
|
||||
|
||||
- **`--genbank`**
|
||||
Default: `false`.
|
||||
Read data following the GenBank flatfile format.
|
||||
|
||||
- **`--ecopcr`**
|
||||
Default: `false`.
|
||||
Read data following the ecoPCR output format.
|
||||
|
||||
- **`--csv`**
|
||||
Default: `false`.
|
||||
Read data following the CSV format.
|
||||
|
||||
- **`--input-OBI-header`**
|
||||
Default: `false`.
|
||||
FASTA/FASTQ title line annotations follow OBI format.
|
||||
|
||||
- **`--input-json-header`**
|
||||
Default: `false`.
|
||||
FASTA/FASTQ title line annotations follow JSON format.
|
||||
|
||||
- **`--solexa`**
|
||||
Default: `false`.
|
||||
Decodes quality string according to the Solexa specification.
|
||||
|
||||
- **`--u-to-t`**
|
||||
Default: `false`.
|
||||
Convert Uracil to Thymine.
|
||||
|
||||
- **`--skip-empty`**
|
||||
Default: `false`.
|
||||
Sequences of length equal to zero are suppressed from the output.
|
||||
|
||||
- **`--no-order`**
|
||||
Default: `false`.
|
||||
When several input files are provided, indicates that there is no order among them.
|
||||
|
||||
## Output format
|
||||
|
||||
- **`--fasta-output`**
|
||||
Default: `false`.
|
||||
Write sequences in FASTA format (default if no quality data available).
|
||||
|
||||
- **`--fastq-output`**
|
||||
Default: `false`.
|
||||
Write sequences in FASTQ format (default if quality data available).
|
||||
|
||||
- **`--json-output`**
|
||||
Default: `false`.
|
||||
Write sequences in JSON format.
|
||||
|
||||
- **`--output-OBI-header|-O`**
|
||||
Default: `false`.
|
||||
Output FASTA/FASTQ title line annotations follow OBI format.
|
||||
|
||||
- **`--output-json-header`**
|
||||
Default: `false`.
|
||||
Output FASTA/FASTQ title line annotations follow JSON format.
|
||||
|
||||
- **`--out|-o <FILENAME>`**
|
||||
Default: `"-"`.
|
||||
Filename used for saving the output.
|
||||
|
||||
## Performance
|
||||
|
||||
- **`--max-cpu <int>`**
|
||||
Default: `16`.
|
||||
Number of parallel threads computing the result.
|
||||
|
||||
- **`--batch-size <int>`**
|
||||
Default: `1`.
|
||||
Minimum number of sequences per batch.
|
||||
|
||||
- **`--batch-size-max <int>`**
|
||||
Default: `2000`.
|
||||
Maximum number of sequences per batch.
|
||||
|
||||
- **`--batch-mem <string>`**
|
||||
Default: `""` (128M).
|
||||
Maximum memory per batch (e.g. `128K`, `64M`, `1G`). Set to `0` to disable.
|
||||
|
||||
## Diagnostic & debug
|
||||
|
||||
- **`--debug`**
|
||||
Default: `false`.
|
||||
Enable debug mode, by setting log level to debug.
|
||||
|
||||
- **`--no-progressbar`**
|
||||
Default: `false`.
|
||||
Disable the progress bar printing.
|
||||
|
||||
- **`--silent-warning`**
|
||||
Default: `false`.
|
||||
Stop printing of warning messages.
|
||||
|
||||
- **`--pprof`**
|
||||
Default: `false`.
|
||||
Enable pprof server. Look at the log for details.
|
||||
|
||||
- **`--pprof-goroutine <int>`**
|
||||
Default: `6060`.
|
||||
Enable profiling of goroutine blocking profile.
|
||||
|
||||
- **`--pprof-mutex <int>`**
|
||||
Default: `10`.
|
||||
Enable profiling of mutex lock.
|
||||
|
||||
---
|
||||
|
||||
# EXAMPLES
|
||||
|
||||
```bash
|
||||
# Demultiplex sequences by sample_id annotation into per-sample FASTQ files
|
||||
obidistribute --classifier sample_id --pattern out_ex1_%s.fastq --no-progressbar --input-json-header reads.fastq
|
||||
```
|
||||
|
||||
**Expected output:** 10 sequences written to 4 files: `out_ex1_sampleA.fastq` (4 sequences), `out_ex1_sampleB.fastq` (3 sequences), `out_ex1_sampleC.fastq` (2 sequences), `out_ex1_NA.fastq` (1 sequence).
|
||||
|
||||
```bash
|
||||
# Demultiplex into subdirectories, one directory per sample
|
||||
obidistribute --classifier sample_id --directory --pattern %s/reads.fastq reads.fastq
|
||||
```
|
||||
|
||||
```bash
|
||||
# Split a large dataset into 3 equal batches for parallel processing
|
||||
obidistribute --batches 3 --pattern chunk_%s.fasta --fasta-output --no-progressbar sequences.fasta
|
||||
```
|
||||
|
||||
**Expected output:** 10 sequences written to 3 files: `chunk_1.fasta` (4 sequences), `chunk_2.fasta` (3 sequences), `chunk_3.fasta` (3 sequences). Batch indices are 1-based.
|
||||
|
||||
```bash
|
||||
# Hash-based sharding into 4 reproducible shards
|
||||
obidistribute --hash 4 --pattern shard_%s.fastq --no-progressbar reads.fastq
|
||||
```
|
||||
|
||||
**Expected output:** 10 sequences written to 4 files: `shard_0.fastq` through `shard_3.fastq`. Shard indices are 0-based.
|
||||
|
||||
```bash
|
||||
# Append new sequences to existing per-sample files (incremental demultiplexing)
|
||||
obidistribute --classifier sample_id --pattern samples_%s.fastq --append new_reads.fastq
|
||||
```
|
||||
|
||||
```bash
|
||||
# Demultiplex sequences, replacing the NA label for unclassified sequences
|
||||
obidistribute --classifier sample_id --na-value unclassified --pattern out_ex6_%s.fastq --no-progressbar --input-json-header reads.fastq
|
||||
```
|
||||
|
||||
**Expected output:** 10 sequences written to 4 files including `out_ex6_unclassified.fastq` (1 sequence without `sample_id` annotation).
|
||||
|
||||
---
|
||||
|
||||
# SEE ALSO
|
||||
|
||||
`obiconvert`, `obisplit`, `obigrep`
|
||||
|
||||
---
|
||||
|
||||
# NOTES
|
||||
|
||||
- Sequences that lack the annotation specified by `--classifier` are written to the file whose name is built using the `--na-value` (default: `"NA"`).
|
||||
- The three distribution modes (`--classifier`, `--batches`, `--hash`) are mutually exclusive.
|
||||
- When using `--directory` together with `--classifier`, subdirectories are created automatically if they do not exist.
|
||||
- Batch indices produced by `--batches` are 1-based; hash shard indices produced by `--hash` are 0-based.
|
||||
Reference in New Issue
Block a user