⬆️ version bump to v4.5

- Update obioptions.Version from "Release 4.4.29" to "/v/ Release v5"
- Update version.txt from 4.29 → .30
(automated by Makefile)
This commit is contained in:
Eric Coissac
2026-04-13 13:34:53 +02:00
parent 670edc1958
commit 8c7017a99d
392 changed files with 18875 additions and 141 deletions
+23
View File
@@ -0,0 +1,23 @@
[
{
"annotations": {
"definition": "Test DNA sequence for FASTA conversion"
},
"id": "seq001",
"sequence": "atcgatcgatcgatcgatcgatcgatcgatcgatcgatcg"
},
{
"annotations": {
"definition": "Another test sequence with different nucleotide content"
},
"id": "seq002",
"sequence": "gctagctagctagctagctagctagctagctagctagct"
},
{
"annotations": {
"definition": "Third sequence for testing output format"
},
"id": "seq003",
"sequence": "ttaaccggttaaccggttaaccggttaaccggttaaccg"
}
]