mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-08-08 14:30:36 +00:00
⬆️ version bump to v4.5
- Update obioptions.Version from "Release 4.4.29" to "/v/ Release v5" - Update version.txt from 4.29 → .30 (automated by Makefile)
This commit is contained in:
@@ -0,0 +1,23 @@
|
||||
[
|
||||
{
|
||||
"annotations": {
|
||||
"definition": "Test DNA sequence for FASTA conversion"
|
||||
},
|
||||
"id": "seq001",
|
||||
"sequence": "atcgatcgatcgatcgatcgatcgatcgatcgatcgatcg"
|
||||
},
|
||||
{
|
||||
"annotations": {
|
||||
"definition": "Another test sequence with different nucleotide content"
|
||||
},
|
||||
"id": "seq002",
|
||||
"sequence": "gctagctagctagctagctagctagctagctagctagct"
|
||||
},
|
||||
{
|
||||
"annotations": {
|
||||
"definition": "Third sequence for testing output format"
|
||||
},
|
||||
"id": "seq003",
|
||||
"sequence": "ttaaccggttaaccggttaaccggttaaccggttaaccg"
|
||||
}
|
||||
]
|
||||
Reference in New Issue
Block a user