⬆️ version bump to v4.5

- Update obioptions.Version from "Release 4.4.29" to "/v/ Release v5" - Update version.txt from 4.29 → .30 (automated by Makefile)
2026-04-30 03:50:39 +00:00 · 2026-04-07 08:36:50 +02:00
parent 670edc1958
commit 8c7017a99d
392 changed files with 18875 additions and 141 deletions
@@ -0,0 +1,23 @@
+[
+  {
+    "annotations": {
+      "definition": "Test DNA sequence for FASTA conversion"
+    },
+    "id": "seq001",
+    "sequence": "atcgatcgatcgatcgatcgatcgatcgatcgatcgatcg"
+  },
+  {
+    "annotations": {
+      "definition": "Another test sequence with different nucleotide content"
+    },
+    "id": "seq002",
+    "sequence": "gctagctagctagctagctagctagctagctagctagct"
+  },
+  {
+    "annotations": {
+      "definition": "Third sequence for testing output format"
+    },
+    "id": "seq003",
+    "sequence": "ttaaccggttaaccggttaaccggttaaccggttaaccg"
+  }
+]